Available via license: CC BY
Content may be subject to copyright.
Article Not peer-reviewed version
Alternative DNA Markers to Detect
Guam-Specific CRB-G (Clade I) Oryctes
rhinoceros (Coleoptera: Scarabaeidae)
Indicate That the Beetle Did Not
Disperse from Guam to the Solomon
Islands or Palau.
Wee Tek Tay * , Sean D.G. Marshall , Angel David Popa-Baez , Glenn F.J. Dulla , Andrea L Blas ,
Juniaty W Sambiran , Meldy Hosang , Justine B Millado , Michael Melzer , Rahul V Rane , Tim Hogarty ,
Demi Yi-Chun Cho , Jelfina C Alouw , Muhammad Faheem , Ben Hoffmann
Posted Date: 23 May 2024
doi: 10.20944/preprints202405.1484.v1
Keywords: DNA barcoding, comparative mitogenome analysis, Asiatic rhinoceros beetle, hitchhiker plant
pest
Preprints.org is a free multidiscipline platform providing preprint service that
is dedicated to making early versions of research outputs permanently
available and citable. Preprints posted at Preprints.org appear in Web of
Science, Crossref, Google Scholar, Scilit, Europe PMC.
Copyright: This is an open access article distributed under the Creative Commons
Attribution License which permits unrestricted use, distribution, and reproduction in any
medium, provided the original work is properly cited.
Article
Alternative DNA Markers to Detect Guam-Specific
CRB-G (Clade I) Oryctes rhinoceros (Coleoptera:
Scarabaeidae) Indicate that the Beetle Did Not
Disperse from Guam to the Solomon Islands or Palau
Wee Tek Tay 1 *, Sean D.G. Marshall 2, Angel David Popa-Baez 1, Glenn F.J. Dulla 3,
Andrea L Blas 3, Juniaty W Sambiran 4, Meldy Hosang 5, Justine B Millado 6, Michael Melzer 7,
Rahul V Rane 8, Tim Hogarty 9, Demi Yi-Chun Cho 1, Jelfina C Alouw 5,10, Muhammad Faheem 11
and Ben Hoffmann 12
1 CSIRO Black Mountain Laboratories, Clunies Ross Street, ACT 2601, Australia
2 AgResearch Limited, 19 Ellesmere Junction Road, Lincoln 7674, New Zealand
3 Research Corporation of the University of Guam, 303 University Dr, Mangilao, Guam 96923
4 Indonesia Agricultural Instrument Standardization Agency, Jalan Raya Mapanget Kotak Pos 1004 Manado
95001, Indonesia
5 National Research & Innovation Agency of Indonesia (BRIN), B.J Habibie Building M.H Thamrin No.8
Jakarta 10340X, Indonesia
6 Department of Pest Management, Visayas State University, Baybay City, Leyte, 6521 Philippines
7 Department of Plant and Environmental Protection Sciences, University of Hawaii, Honolulu, HI 96822
8 CSIRO, 343 Royal Parade, Parkville, VIC 3052, Australia
9 CSIRO Marine Labs, 3 Castray Esplanade, Hobart 7000
10 International Coconut Community (ICC), 8th Floor BAPPEBTI Building Jl. Kramat Raya No. 172 Kenari,
Senen, Jakarta, Indonesia, 10430
11 CAB International Southeast Asia, Serdang, Kuala Lumpur, Malaysia
12 CSIRO, Tropical Ecosystems Research Centre, PMB 44, Winnellie, NT, 0822, Australia
Abstract: A partial mitochondrial DNA Cytochrome Oxidase subunit I (mtCOI) gene haplotype variant of the
coconut rhinoceros beetle (CRB) Oryctes rhinoceros classed as ‘CRB-G (clade I)’ has been the focus of much
research since 2007 with reports of invasions into new Pacific Island locations (e.g., Guam, Hawaii, Solomons
Islands). For numerous invasive species, inference of invasion biology via whole genome is superior to
assessments via the partial mtCOI gene. Here, we explore CRB draft mitochondrial genomes (mitogenomes)
from historical and recent collections, with assessment focused on individuals associated within the CRB-G
(clade I) classification. We found that all Guam CRB individuals possessed the same mitogenome across all 13
protein coding genes and differed from individuals collected elsewhere, including ‘non-Guam’ individuals
designated as CRB-G (clade I) by partial mtCOI assessment. Two alternative ATP6 and COIII partial gene
primer sets were developed to enable distinction between CRB (clade I) that invaded Guam and CRB-G (Clade
I) individuals collected elsewhere. Phylogenetic analyses based on concatenated ATP6-COIII genes showed
that only Guam CRB-G (clade I) individuals clustered together, and therefore Guam was not the source of the
CRB that invaded the other locations in the Pacific assessed in this study. The use of the mtCOI and/or mtCOIII
genes for initial molecular diagnosis of CRB remained crucial, and assessment of more native CRB populations
will further advance our ability to identify the provenance of CRB invasions being reported within the Pacific
and elsewhere.
Keywords: DNA barcoding; comparative mitogenome analysis; Asiatic rhinoceros beetle;
hitchhiker plant pest
Disclaimer/Publisher’s Note: The statements, opinions, and data contained in all publications are solely those of the individual author(s) and
contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting
from any ideas, methods, instructions, or products referred to in the content.
Preprints.org (www.preprints.org) | NOT PEER-REVIEWED | Posted: 23 May 2024 doi:10.20944/preprints202405.1484.v1
© 2024 by the author(s). Distributed under a Creative Commons CC BY license.
2
1. Introduction
The mitochondrial DNA (mtDNA) genome (mitogenome) is largely maternally inherited and
generally consists of 13 protein coding genes (PCG’s), 22 tRNA genes, 2 rRNA genes, and an AT-rich
region that is low in nucleotide complexity (e.g., Crozier 1990). Due to the maternal inheritance
nature, the mitogenome in general does not undergo recombination (e.g., Saville et al. 1998; Leducq
et al. 2017). Hebert et al. (2003) demonstrated the use of the partial mtDNA cytochrome oxidase
subunit I (mtCOI) gene sequence to aid in species diagnostics, and this system helped transform
understanding of species diversity (Hebert et al. 2004; Rugman-Jones et al. 2013; Tay et al. 2016).
Multiple partial mtCOI databases (e.g., BOLD; GenBank) subsequently provided considerable
contribution to disentangling species status (e.g., De Barro et al. 2011; Behere et al. 2007; Tay et al.
2017a). However, the use of partial mtCOI is not without its limitations; association with
endosymbionts, effect of selective sweep, and impact of pseudogenes, amongst other factors, can all
lead to inaccurate interpretations (Hurst and Jiggins, 2005; Tay et al. 2017b). Analysis of population-
wide partial mtCOI gene diversity has also found that the 5’ gene region typically has low nucleotide
diversity (i.e., conserved nucleotide sequence) in some arthropod groups such as Hemiptera,
Lepidoptera, and Coleoptera (e.g., Tay et al. 2022a; Tay et al. 2022b; Behere et al. 2007). Subsequently,
an over reliance on partial mtCOI gene sequences has resulted in some misidentification of species
status (e.g., Tay et al. 2017b), and some misunderstandings of population dynamics (e.g., Goergen et
al. 2016 vs. Tay et al. 2022a; see also review by Tay et al. 2023). Examples of confounded
interpretations include the invasion history of Spodoptera frugiperda (Cock et al. 2017; Nagoshi et al.
2018, Nagoshi et al. 2019) and population expansion patterns of Helicoverpa species (Leite et al. 2014
vs. Arnemann et al. 2018).
As technology advances and costs decrease, it is now easier and cheaper than ever before to
obtain greater genetic data from specimens to provide richer information content for analysis and
interpretation. Combining sequence data from multiple mtDNA genes, full mitochondrial DNA
genomes (mitogenomes) and/or whole genomes is now regularly being shown to provide superior
analysis to partial mtCOI genes alone for all applications. Examples include: identifications of species
(e.g., Walsh et al. 2019), sub-species (e.g., Anderson et al. 2016; Elfekih et al. 2021; Zhang et al. 2022),
hybrids (e.g., Anderson et al. 2016; Elfekih et al. 2021; Valencia-Montoya et al. 2020), populations (Tay
et al. 2022a; Rane et al. 2023), patterns like demographic expansion (e.g., Pearce et al. 2017; Lannucci
et al. 2021), and pest incursion histories (e.g., Tay 2016; Otim et al. 2018; Benelli et al. 2023; Li et al.
2022).
Here, we examine draft full mitogenomes of the coconut rhinoceros beetle (CRB; Oryctes
rhinoceros), a pest that causes economic yield losses to coconut and oil palm (Bedford, 1980; Indriyanti
et al. 2019). These mitogenomes were generated through whole genome sequencing (WGS) from
multiple geographically distinct locations to develop additional molecular markers for tracking and
monitoring genetically distinct populations of this species. Particular attention is given to the CRB-G
(clade I) group determined using partial mtCOI gene assessment (Marshall et al. 2017), because of
the current biosecurity focus on this mitocnondrial haplotype variant due to its reported resistance
to known isolates of the Oryctes rhinoceros Nudivirus (OrNV) biological control agent (Marshall et al.
2017), and new incursions within the Pacific region (Paudel et al. 2023; Marshall et al. 2023).
Specifically, we test whether or not the Guam CRB-G (clade I) was the source population for the CRB-
G (clade I) in Solomon Islands and in Palau as suggested in some publications (e.g., Datt 2020, Caasi
2023). We do this by identifying two partial mitochondrial gene regions that more confidently
differentiated CRB (clade I) individuals that invaded Guam from other CRB individuals, including
other individuals classed as CRB-G (clade I) using the partial mtCOI gene, but which were collected
on other Pacific islands (e.g., Solomon Islands, Palau). We discuss the benefits of mitogenomes as
resources for developing alternative diagnostic markers, and assess efficacies of the partial mtCOI
gene as the current preferred standard diagnostic DNA marker to distinguish CRB populations.
2. Material and Methods
Preprints.org (www.preprints.org) | NOT PEER-REVIEWED | Posted: 23 May 2024 doi:10.20944/preprints202405.1484.v1
3
2.1. Samples
CRB samples collected between 2019 and 2022 were sourced from Guam, Palau, Indonesia,
Malaysia, Hawaii, and Philippines (Table 1). The gut of each specimen was dissected, preserved in
100% ethanol, and stored at -20˚ C until needed for DNA extraction. Additionally, a historic specimen
collected from Guam (04-Or5; circa 2014) was used as a reference to enable matching of more recently
collected CRB individuals from Guam that classed within the CRB-G (clade I) haplotype grouping
sensu Marshall et al. (2017).
Table 1. Details of Oryctes rhinoceros (CRB) samples used in this study, including GenBank accession
numbers of publicly available assembled and annotated mitogenomes and single nucleotide
polymorphisms (SNPs) differentiating CRB-G (clade I) that invaded Guam from other CRB using the
mitochondrial cytochrome oxidase subunit I (mtCOI), ATP synthase membrane subunit 6 (ATP6) and
cytochrome oxidase subunit III (COIII). A related Oryctes nasicornis mitogenome (GenBank OK484312;
Ayivi et al. 2021) was included to provide comparison of inter-specific nucleotide distance with CRB.
A historic CRB specimen collected from Guam (sample 04-Or5), classed as CRB-G (clade I) using the
partial mtCOI gene was included to generate a Guam-type reference mitogenome for sequence
comparison with the other CRB specimens analysed. Nucleotide positions followed annotation of
MT457815 (Filipović et al. 2021).
Sample
code
Country Specimen
collection
date
Haplotype
designatio
n based on
partial
mtCOI
(Marshall
et al. 2017)
mtCOI
_
G1779
A
Designatio
n based on
partial
ATP6 and
COIII (this
study)
ATP6_
T4430
C
COIII_
C5390
T
04-Or5 Guam 2014 CRB-G
(clade I)
G Guam T C
NZ-20-738 Guam 2020 CRB-G
(clade I)
G Guam T C
Guam-
01_GDoA
Guam 2022 CRB-G
(clade I)
G Guam T C
Guam-
02_GDoA
Guam 2022 CRB-G
(clade I)
G Guam T C
Guam-
09_GDoA
Guam 2022 CRB-G
(clade I)
G Guam T C
Preprints.org (www.preprints.org) | NOT PEER-REVIEWED | Posted: 23 May 2024 doi:10.20944/preprints202405.1484.v1
4
Guam-
13_GDoA
Guam 2022 CRB-G
(clade I)
G Guam T C
Guam-
17_GDoA
Guam 2022 CRB-G
(clade I)
G Guam T C
MT457815 Solomon
Is.
2019 CRB-G
(clade I)
G not Guam C T
MW63213
1
Taiwan 2002 CRB-G
(clade I)
G not Guam C T
MY-A-02 Malaysia 2022 CRB-S
(clade IV)
A not Guam C T
MY-A-04 Malaysia 2022 CRB-S
(clade IV)
A not Guam C T
MY-A-10 Malaysia 2022 CRB-S
(clade III)
A not Guam C T
ON764800 Malaysia 2021 CRB-S
(clade III)
A not Guam C T
OP694176 Malaysia 2021 CRB-S
(clade III)
A not Guam C T
OP694175 Malaysia 2021 CRB-S
(clade IV)
A not Guam C T
ON764799 Malaysia 2020 CRB-S
(clade II)
A not Guam C T
ON764801 Malaysia 2021 CRB-S
(clade II)
A not Guam C T
Preprints.org (www.preprints.org) | NOT PEER-REVIEWED | Posted: 23 May 2024 doi:10.20944/preprints202405.1484.v1
5
PALAU-
01
Palau 2022 CRB-S
(clade IV)
A not Guam C T
PALAU-
02
Palau 2022 CRB-S
(clade IV)
A not Guam C T
PALAU-
03
Palau 2022 CRB-G
(clade I)
G not Guam C T
PALAU-
04
Palau 2022 CRB-G
(clade I)
G not Guam C T
Phil-01 Philippine
s
2022 CRB-G
(clade I)
G not Guam C T
Phil-02 Philippine
s
2022 CRB-G
(clade I)
G not Guam C T
Phil-05 Philippine
s
2022 CRB-G
(clade I)
G not Guam C T
Phil-10 Philippine
s
2022 CRB-G
(clade I)
G not Guam C T
IND-H01 Indonesia 2021 CRB-S
(clade III)
A not Guam C T
IND-H02 Indonesia 2021 CRB-S
(clade IV)
A not Guam C T
IND-H10 Indonesia 2021 CRB-S
(clade III)
A not Guam C T
IND-J14 Indonesia 2022 CRB-S
(clade IV)
A not Guam C T
Preprints.org (www.preprints.org) | NOT PEER-REVIEWED | Posted: 23 May 2024 doi:10.20944/preprints202405.1484.v1
6
IND-J15 Indonesia 2022 CRB-S
(clade IV)
A not Guam C T
IND-J20 Indonesia 2022 CRB-S
(clade IV)
A not Guam C T
OK484312 unspecifie
d
unspecifie
d
Not
applicable
T Not
applicable
T T
Note: Annotation of the mtCOI, ATP6 and COIII genes in the samples used in this study was based on the
published mitochondrial genome (MT457815) from a Solomon Islands individual (Filipović et al. 2021)
associated within the CRB-G (clade I) haplotype grouping (based on the mtCOI partial gene characterisation).
Additional GenBank accessions included are: MW632131 (Cheng et al. 2021), ON764800, OP694176, OP694175,
ON764799, ON764801 (Anggraini et al. 2023), and OK484312 (Ayivi et al. 2021; O. nasicornis).
2.2. Whole Genome Sequencing (WGS)
We used the Qiagen Blood and Tissue DNA extraction kit (Duesseldorf, Germany) and the
manufacturer’s protocol to extract genomic DNA. All extracted DNA was eluted in 200 µL EB and
kept frozen until used for WGS. We assessed the quality of the extracted DNA using Qubit 2.0 prior
to sequencing. WGS was carried out by the Australian Genome Resource Facility (AGRF) in
Melbourne, Australia, or by AZENTA Life Sciences in China. The WGS data returned an average of
25x coverage, 150 bp paired-end reads/sample, assuming a genome size of approximately 350 Mbp.
2.3. Mitogenome Assembly and Annotation
We assembled all mitogenomes by importing the raw sequence reads into Geneious Prime
2022.2.2 (Build 2022-08-18 14:34) (Biomatters Ltd., Auckland), and used the published mitogenome
(MT457815, Filipovic et al. 2021) as the reference sequence. We used Geneious Mapper with ‘Low
Sensitivity / Fastest’ option and selecting no fine tuning (i.e., None (fast / read mapping)) during the
mitogenome assembling process. Although we received pair-ended reads for all samples,
mitogenomes were assembled using forward reads only due to the high genome coverage for each
sample. All assembled mitogenomes were initially annotated using the MITOS program and
selecting invertebrate mitochondrial genetic code (Bernt et al. 2013). As a final quality assessment,
the annotated CRB mitogenomes were visually inspected. The assembled and annotated mtCOI,
ATP6, and COIII genes used in this study are available from the CSIRO data repository (Tay et al.
2024).
2.4. Mitogenome Identity Assessment
The non-recombination nature of the mitogenome implies that CRB individuals classified as
CRB-G (clade I) based on the partial mtCOI gene assessment method of Marshall et al. (2017) (e.g.,
Solomon Islands MT457815, Taiwan MW632131) would share mitogenome identity with our
reference Guam specimen (i.e., 04-Or5; Table 1), if a single source of invasion entered into Guam and
subsequently spread from to other locations. To assess this, randomly selected CRB specimens from
Guam (i.e., NZ-20-738; Guam-01_GDoA, Guam-02_GDoA, Guam-09_GDoA, Guam-13_GDoA,
Guam-17_GDoA; Table 1) that were collected in more recent times (2020 and 2021) were compared
with the representative historical Guam individual (04-Or5) to visually assess and confirm
mitogenome identity. This was then followed by comparison with all other CRB individuals
including CRB-G type individuals collected from elsewhere (Table 1). Individuals were compared
Preprints.org (www.preprints.org) | NOT PEER-REVIEWED | Posted: 23 May 2024 doi:10.20944/preprints202405.1484.v1
7
based on the partial mtCOI sequence analysis (described in Marshall et al. 2017) as well as sequence
similarity of other mitochondrial genes assessed by this work.
2.5. Alternative CRB Marker Development to Identify the Original CRB Population that Invaded Guam
To identify candidate mitochondrial genes as alternative DNA markers specific to individuals
from Guam, all mitogenomes generated from this study, as well as publicly available CRB
mitogenomes from GenBank, were downloaded and aligned within GenBank using MAFFT V7.490
(Katoh and Standley 2013; Katoh et al. 2002) with default setting options (i.e., algorithm: FFT-NS-2;
Scoring matrix: 200PAM / k=2; Gap open penalty: 1.53; Offset value: 0.123). We visually identified
candidate polymorphic sites unique to individuals from Guam (i.e., 04-Or5, NZ-20-738, Guam-
01_GDoA, Guam-02_GDoA, Guam-09_GDoA, Guam-13_GDoA, Guam-17_GDoA), but absent in all
other CRB individuals (Table 1). SNPs identified were analysed for potential restriction
endonucleases to develop polymerase-chain reaction (PCR) restriction fragment length
polymorphism (RFLP) solutions (PCR-RFLP), for a simple and easy-to-use approach to confidently
differentiate CRB-G (clade I) that invaded Guam from all other genetically distinct CRB, including
CRB from elsewhere classed as CRB-G (clade I) by partial COI assessment. Design and analysis of
PCR-primers were through the Primer Analysis Software version 7.60 (Molecular Biology Insights,
Inc., Cascade, CO, USA). Primers were optimised for minimal false primer annealing sites, minimal
primer dimer and duplex formation, and minimal/no hairpin structure, with a Ta (theoretical
annealing temperature) of ≥60˚ C (calculated as Ta = 4(G+C)+2(A+T)), and an optimal amplicon length
of between 500-600 bp to facilitate ease of Sanger sequencing. The candidate restriction endonuclease
was initially selected for a single cut site with in silico analysis of all different mitochondrial DNA
haplotypes in Enzyme X version 3.3 <http://nucleobytes.com/enzymex/>. We reconfirmed primer
efficacies and RFLP conditions by randomly selecting and analysing DNA from specimens collected
from Guam and elsewhere, as well as by PCR-Sanger sequencing to confirm primer amplification
accuracy. We used the restriction digestion conditions as recommended by the manufacturer of the
BmpI restriction enzyme (New England BioLabs). Visualisation of the RFLP was on a 1.5% 1x TAE
agarose gel.
2.6. Mitogenome Analysis
The mitogenomes from the GenBank database and those generated from this study were aligned
to estimate pairwise nucleotide identity and distances (p-dist) between: (i) full mtCOI gene vs. full
ATP6 gene, and (ii) full mtCOI vs. full COIII genes. The related O. nasicornis mitogenome (0K484312)
was included to provide comparison of inter-specific nucleotide distance with CRB. We also inferred
phylogenies of the CRB individuals based on the widely used partial mtCOI gene region (676 bp)
versus our proposed alternative mitochondrial ATP6 and COIII partial gene regions (excluding
nucleotides at primer annealing sites, see Marshall et al. 2017). The APT6 and COIII partial gene
sequences were concatenated before phylogeny inference. We used IQ-Tree (Trifinopoulos et al. 2016)
and selected the ‘Auto’ option for estimating substitution models, and 1,000 bootstrap alignments to
estimate branch support using the ultrafast bootstrap approximation (UFBoot) (Hoang et al. 2018)
algorithm. We used Dendroscope 3 (Huson et al. 2007) for visualisation and post analysis editing for
both COI and ATP6+COIII phylogenies.
3. Results
3.1. Mitochondrial Genome Analysis
Mitochondrial genomes were assembled and annotated from an average of 1,472 fragments
(mean standard deviation 997 fragments) per sample. Across all the mitochondrial COI, ATP6, and
COIII gene sequences, nucleotide differences between CRB individuals were low (<2% difference)
suggesting that all were the same species (i.e., O. rhinoceros) (Table S1). The assembled and annotated
mitogenome from the Guam 04-Or5 specimen (collected in 2014) provided evidence that all Guam
individuals examined here shared the same mitogenome (Table 1). Nucleotide differences within the
Preprints.org (www.preprints.org) | NOT PEER-REVIEWED | Posted: 23 May 2024 doi:10.20944/preprints202405.1484.v1
8
mitochondrial ATP6 and COIII genes were identified in Guam individuals, but these nucleotide
polymorphisms were absent from specimens collected elsewhere, including those classed as CRB-G
(clade I) by partial COI assessment. For the ATP6_T4430C and COIII_C5390T SNPs identified from
the partial ATP6 for COIII genes (see Table 1), there were, on average, 1,876 and 1,740 reads at each
of these nucleotide sites to confirm differentiation of CRB-G (clade I) that invaded Guam from other
CRB (i.e., equivalent to the diagnostic SNP for ATP6 and COIII being independently confirmed an
average of 1,876 and 1,740 times, respectively).
Pairwise nucleotide analysis of the complete mtCOI gene sequence vs. complete ATP6 gene
sequence, and also the complete mtCOI gene sequence vs. the complete COIII gene sequence, showed
that the seven Guam CRB, one Solomon Islands CRB (MT457815), one Taiwan (MW632131), two
Palau CRBs (Palau-03, Palau-04), and four Philippines CRB (Phil-01. -02, -03, -04) specimens analysed
shared 100% identity across the complete mtCOI gene sequence. However, when the comparison
included the full ATP6 and full COIII gene sequences, only the Guam individuals remained 100%
identical to each other. CRB from Solomon Islands (MT457815), Taiwan (MW632131), Palau (Palau-
03, Palau-04), and Philippines (Phil-01. -02, -03, -04) all had polymorphisms in these two alternative
mitochondrial marker genes (Table 1).
3.2. Alternative Primers to Identify the Original Invasive CRB Population Present in Guam
Two alternative sets of primers were developed (Table 2) to distinguish CRB-G (clade I) that
invaded Guam from other CRB, including those collected elsewhere classed as CRB-G (clade 1) by
partial COI assessment. One primer amplifies a partial ATP6 gene region of 494 bp length, and the
other amplifies a partial COIII gene region of 469 bp length. Optimal PCR annealing temperature for
both ATP6 and COIII was 52˚ C with 1.0 µM primer concentration for both ATP6 and COIII primer
pairs, and 0.5 mM dNTPs concentration and 1 unit of DNA polymerase in a 50 µL PCR reaction
volume.
Table 2. PCR primer sets for ATP6 (for PCR-RFLP) and COIII were developed to differentiate CRB
that invaded Guam from other CRB (including CRB classed as CRB-G (clade I) using the partial
mtCOI gene in other locations; sensu Marshall et al. 2017). The restriction enzyme BpmI, which has a
restriction digest site of CTCCAG, cuts the partial ATP6 gene associated with the Guam CRB-G (clade
I) population once to produce two fragments of 271 and 223 bp due to the presence of a ‘T’ at
nucleotide position (nt) 4430, whereas for ‘non-Guam’ individuals this partial gene amplicon of 494
bp remains undigested (see Table 1). The PCR-Sanger sequencing primers for COIII targets a partial
469 bp gene region from nucleotide position (nt) 5017 to 5485. COIII identification of Guam CRB-G
(clade I) is through the detection of the ‘C’ base at nt5390, which is a ‘T’ nucleotide in all other CRB
(see Table 1). Primer locations followed the nucleotide position of MT457815 (Filipović et al. 2021).
Nucleotide
position
Primer name: primer sequence (5’-3’) Restriction
enzyme
CRB-G (clade I)
(Marshall et al.
2017)
Other
CRB
nt4192-
4216
CRB-ATP6-F:
ATGAATTCAAACTTTTAATTGGACC
BpmI
(CTCCAG)
T C
nt4685-
4663
CRB-ATP6-R:
GGAGTAAAGAGTTCTAAGGATAG
271+223 bp 494
bp
Preprints.org (www.preprints.org) | NOT PEER-REVIEWED | Posted: 23 May 2024 doi:10.20944/preprints202405.1484.v1
9
nt5017-
5039
CRB-COIII-F:
CTTAGCTCCTACAATCGAATTAG
Uncut C T
nt5485-
5462
CRB-COIII-R:
TCTACCTCATCAGTAAATGGAAAT
469 bp 469
bp
3.3. Phylogeny
Phylogenetic analysis was carried out using specimens (see Table 1) with available mitogenome
DNA sequence data to allow comparison using the mitochondrial gene regions from COI, COIII, and
ATP6. Based on the widely used mtCOI partial gene, Figure 1a three clades could be recognised. One
clade (red branches) included seven Guam CRB-G (clade I) specimens, four Philippines (green circles)
and two individuals from Palau (yellow circles). The other two clades (blue branches) included six
individuals from Indonesia, eight from Malaysia, and two from Palau B. Phylogenetic analysis based
on concatenation of both partial ATP6 and partial COIII genes returned a different population
clustering pattern (Figure 1b). Together, the use of the ATF6 and COIII gene regions showed that
Guam CRB-G (clade I) individuals (red branches) clustered by themselves, whereas the Philippines,
Malaysian, and Indonesian individuals clustered largely according to their geographical
distributions. CRB from Palau (yellow circles) appeared to have multiple origins, clustering with
specimens collected from both the Philippines and Indonesia. However, branch node confidence
values for Indonesia (54-78) and Philippines (46-48) were low, suggesting longer sequence lengths
from both mitochondrial and inclusion of nuclear genes, as well as more samples, are required for
confident assessment. Notably, CRB populations in Malaysia appeared to be consisted of two diverse
evolutionary lineages based on both COI and the concatenated ATP6-COIII partial genes, with the
unique ON764799 and ON764801 individuals originating from both coconut palm and oil palm hosts
from the state of Johor (Anggraini et al. 2023).
Figure 1. Phylogenetic analysis using (a) partial mtCOI gene sequence (676 bp), and (b) concatenated
partial APT6 (446 bp) and partial COIII (422 bp) gene sequences. (a) Three clades are evident based
on partial mtCOI genes. One clade (red) contains all individuals from Guam and Philippines (green
circles), two from Palau (yellow circles), one from Taiwan (aqua blue circle), and one from Solomon
Islands (purple circle). Two (major and minor) clades (blue) do not contain any individuals from
Guam but include all individuals from Malaysia (i.e., two Malaysian CRB (ON764799, ON764801) in
the minor but evolutionary divergent clade). The major blue clade also included all CRB individuals
from Indonesia as well as two Palauan CRB individuals (PALAU-01, PALAU-02). (b) The phylogeny
Preprints.org (www.preprints.org) | NOT PEER-REVIEWED | Posted: 23 May 2024 doi:10.20944/preprints202405.1484.v1
10
from partial ATP6 and COIII concatenated sequences showed different population demographic
patterns, with all Guam individuals clustering together (red), whereas Philippines (green), Malaysia
(khaki), and Indonesia (pink) largely clustered according to geography. CRB specimens from Palau
(yellow circles) appeared to have multiple origins involving at least Philippines and Indonesia,
whereas Taiwan (aqua blue circle) and Solomon Islands (purple circle) appeared to have closer
affinity with Philippines CRB individuals but with low (<50%) bootstrap node support values. The
Oryctes narsicornis sample (OK484312) was included as an outgroup.
4. Discussion
In this study, we characterised and reanalysed the draft mitogenomes of CRB individuals from
both the native (i.e., Indonesia, Malaysia, Philippines, Taiwan) and exotic (i.e., Guam, Palau, Solomon
Islands) ranges. This is also the first time the mitogenome of all recently collected Guam CRB
individuals analysed in this study were found to shared sequence identity with specimens
historically collected from Guam by possessing the same mitogenome sequence across all 13 protein
coding genes (results not presented), and specifically to the ATP6 and COIII genes that exhibited
nucleotide differences with CRB from other locations. This resulted in the ATP6 and COIII protein
coding genes being used as alternative DNA markers for differentiating Guam-specific CRB-G (clade
I) from the other tested CRB individuals. The remaining individuals from elsewhere, however,
including those designated as CRB-G (clade I) (based on the partial mtCOI assessment approach),
did not share the same maternal lineage as the Guam CRB-G (clade I) individuals. In other words,
the multi-gene assessment (albeit with a limited number of specimens), provided strong supporting
evidence that the CRB invasion into Guam was distinct from the CRB invasions detected in from
Solomon Islands and in Palau, and therefore Guam was not the source of the CRB that invaded these
other locations. Our finding based on full mitogenome and especially the ATP6 and COIII genes vs.
the widely used partial COI gene in the CRB studies reported to-date (e.g., Marshall et al. 2017; Reil
et al. 2018; Etebari et al. 2020) indicated that the reported mitogenome of CRB-G from Solomon
Islands identified from the partial COI gene signature (Filipović et al. 2021) represented a mistaken
identity. Increasing sampling of CRB from Guam, Palau, and Solomon Islands is needed to further
increase confidence of the specificity of the ATP6 and COIII alternative markers to differentiate CRB-
G (clade I) from other CRB populations.
For the PCR-RFLP primers focused on the partial ATP6 gene sequence, separation is based on a
BpmI restriction site. Individuals classed as Guam CRB-G (clade I) produced two fragments (i.e., 271
bp and 223 bp), whereas all other CRB remained uncut (i.e., 494 bp) (Table 2). A second primer set
was developed based on the COIII gene that can also differentiate between Guam CRB-G (clade I)
from other CRB; however, this diagnostic method requires sequence analysis (such as through Sanger
sequencing) to detect the presence of a ‘C’ or a ‘T’ base at nucleotide position 5,390 (see Table 1).
Although these new markers improve the differentiation between CRB that invaded Guam and other
CRB populations, assessment of more CRB individuals from native populations (e.g., Malaysia,
Singapore, Sri Lanka, India, Bangladesh, Myanmar, Cambodia, Laos, Vietnam, southern China,
Indonesia, Philippines, Taiwan, Thailand), will be needed to provide a more robust confirmation of
CRB invasion histories. Also, for all work using molecular diagnostics of CRB, use of either the mtCOI
or mtCOIII genes is recommended as an initial approach to first confirm that samples are O.
rhinoceros. For example, while the T4430C SNP site within ATP6 from Guam specimens was a T, it
was also a ‘T’ in O. narsicornis (see Table 1). Therefore, a direct PCR-RFLP without first confirming
species status could lead to misidentification of O. rhinoceros among other Oryctes spp.
The CRB is a hitchhiker pest (Hoffmann et al. in press) and is continuing to disperse to new
locations, being recently reported in the Marshall Islands (The Marshall Islands Journal 2023) and
multiple Hawaiian islands (HDOA 2024). Notably, our results found that Palau CRB appear to have
multiple origins (Figure 1b). The node confidence support estimates in Figure 1b displayed a range
of values, with some of the individuals (e.g., from Palau, Indonesia) appearing low (less than 60),
which limited the power of inference for better understanding the invasion history of this pest across
Preprints.org (www.preprints.org) | NOT PEER-REVIEWED | Posted: 23 May 2024 doi:10.20944/preprints202405.1484.v1
11
its distributional ranges. It is likely that future detailed genetic assessments of CRB will provide the resolving
power required to further elucidate CRB invasion histories.
Increasingly, WGS and multigene approaches have provided greater analytical power than
partial genome assessments, and are therefore rapidly becoming more widely adopted for the
interrogation of demographic history and evolutionary relationships of some of the world’s most
significant transboundary invasive plant pests (Anderson et al. 2016; Anderson et al. 2018; Zhang et
al. 2022; Elfekih et al. 2018; Elfekih et al. 2021; Tay et al. 2022a; Rane et al. 2023), including CRB (Reil
et al. 2018; Etebari et al. 2021; Filipović et al. 2021). Given that the WGS/multigene approaches can
provide more comprehensive evidence than single gene analyses (e.g., partial mtCOI), and we have
found exactly this result with this analysis, we suggest that a detailed study using these more detailed
genetic assessments is needed to further improve current understanding of CRB invasion biology.
Acknowledgements: This project was funded by the Australian Government Department of Foreign Affairs and
Trade (DFAT) Administered (aid) Simple Grant Agreement 77092). Indonesian CRB samples were provided
under Republic of Indonesia Ministry of Agriculture Agricultural Quarantine Agency Permit numbers
2021.1.2005.0.K13.E.00003 No. 4299301 and 2022.1.2005.0.K12.E.00002 No. 5896762. CRB samples from the
Philippines were gathered under the Gratuitous Permit DENR8-GP No. 2022-02 (2022.01.10) provided by the
Department of Environment and Natural Resources 8 of the Republic of the Philippines and conducted under
the VSU-IP 2021-10 (BIO-CAMP) and VSU-IP 2022-2 (CRB) projects. All other CRB individuals sourced for this
study did not require collection/export permits.
Conflict of Interest: The authors declare no conflict of interest.
References
1. Anderson, C.J., Tay, W.T., McGaughran, A., et al. (2016) Population structure and gene flow in the global
pest, Helicoverpa armigera. Molecular Ecology 25, 5296-5311.
2. Anderson, C.J., Oakeshott, J.G., Tay, W.T., et al. (2018) Hybridization and gene flow in the mega-pest
lineage of moth, Helicoverpa. Proceedings of the National Academy of Sciences U.S.A. 115, 5034-5039.
3. Anggraini, E., Vadamalai, G., Lih, L.K., et al. (2023) Variants in the mitochondrial genome sequence of
Oryctes rhinoceros (Coleoptera: Scarabaeidae) infected with Oryctes rhinoceros nudivirus in oil palm and
coconut plantations. Scientific Reports 13, 16850.
4. Arnemann, J.A., Roxburgh, S., Walsh, T., et al. (2018) Multiple incursion pathways for Helicoverpa armigera
in Brazil show its genetic diversity spreading in a connected world. Scientific Reports 9, 19380
5. Ayivi, S.P.G., Tong, Y., Storey, K.B., et al. (2021) The mitochondrial genomes of 18new Pleurosticti
(Coleoptera: Scarabaeidae) exhibit a novel trnQ-NCR-trnI-trnM gene rearrangement and clarify
phylogenetic relationships of subfamilies within Scarabaeidae. Insects 12, 1025.
6. Bedford, G.O. (1980) Biology, Ecology, and control of palm rhinoceros beetles. Annual Review of
Entomology, 25, 209-229.
7. Behere, B.T., Tay, W.T., Russell, D.A., et al. (2007) Mitochondrial DNA analysis of field populations of
Helicoverpa armigera (Lepidoptera: Noctuidae) and of its relationship to H. zea. BMC Evolutionary Biology
7, 117.
8. Bernt, M., Donath, A., Jühling, F., et al. (2013) MITOS: Improved de novo Metazoan Mitochondrial
Genome Annotation. Molecular Phylogenetics and Evolution 2013, 69, 313-319.
9. Benelli, G., Lucchi, A., Anfora, G., et al. (2023) European grapevine moth, Lobesia botrana. Part I: Biology
and ecology. Entomologia Generalis 43, 261-280.
10. Caasi, J.A.S., Guerrero, A.L., Yoon, K., et al. (2023) A mathematical model of invasion and control of
coconut rhinoceros beetle Oryctes rhinoceros (L.) in Guam. Journal of Theoretical Biology 570, 11525.
11. Cheng, C.-T., Jeng, M.-L., Tsai, J.-F., et al. (2021) Two mitochondrial genomes of Taiwanese rhinoceros
beetles, Oryctes rhinoceros and Eophileurus chinensis (Coleoptera: Scarabaeidae). Mitochondrial DNA B
Resources 6, 2260-2262.
12. Cock, M.J.W., Beseh, P.K., Buddie, A.G., et al. (2017) Molecular methods to detect Spodoptera frugiperda in
Ghana, and implications for monitoring the spread of invasive species in developing countries. Scientific
Reports 7, 4103.
13. Crozier, R.H. (1990) From population genetics to phylogeny: Uses and limits of mitochondrial DNA. Aust.
Syst. Biol. 3, 111-124.
14. Datt, N., Gosai, R.C., Ravuiwasa, K. & Timote, V. (2020) Key transboundary plant pests of Coconut [Cocos
nucifera] in the Pacific Island countries – a biosecurity perspective. Plant Pathology & Quarantine 10(1), 152-
171.
Preprints.org (www.preprints.org) | NOT PEER-REVIEWED | Posted: 23 May 2024 doi:10.20944/preprints202405.1484.v1
12
15. De Barro, P.J., Liu, S.-S., Boykin, L.M. & Dinsdale, A.B. (2011) Bemisia tabaci: a statement of species status.
Annual Review of Entomology 56, 1-19.
16. Etebari, K., Hereward, J., Sailo, A., et al. (2021) Examination of population genetics of the coconut
rhinoceros beetle (Oryctes rhinoceros) and the incidence of its biocontrol agent (Oryctes rhinoceros nudivirus)
in the South Pacific Islands. Current Research in Insect Science 1, 100015.
17. Elfekih, S., Tay, W.T., Gordon, K., et al. (2018) Standardized molecular diagnostic tool for the identification
of cryptic species within the Bemisia tabaci complex. Pest Management Science 74, 170-173.
18. Elfekih, S., Tay, W.T., Polaszek, A., et al. (2021) On species delimitation, hybridization and population
structure of cassava whitefly in Africa. Scientific Reports 11, 7923.
19. Filipović, I., Hereward, J., Rašić, G., et al. (2021) The complete mitochondrial genome sequence of Oryctes
rhinoceros (Coleoptera: Scarabaeidae) based on long-read on nanopore sequencing. PeerJ 9, e10552
20. Goergen, G., Lava-Kumar, P., Sankung, S.B., et al. (2016) First report of outbreaks of the fall armyworm
Spodoptera frugiperda (J E Smith) (Lepidoptera, Noctuidae), a new alien invasive pest in West and Central
Africa. PLoS ONE 11, e0165632.
21. HDOA (Hawaii Department of Agriculture) (2024) Coconut rhinoceros beetle information. Posted on 15-
Jan, 2014. https://hdoa.hawaii.gov/pi/main/crb/ (last accessed on 10-April, 2024).
22. Hebert, P.D.N., Cywinska, A., Ball, S.L., et al. (2003) Biological identifications through DNA barcodes.
Proceedings of the Royal Society of London, Series B. 270, 313-322.
23. Hebert, P.D.N., Penton, E.H., Burns, J.M., et al. (2004) Ten species in one: DNA barcoding reveals cryptic
species in the neotropical skipper butterfly Astraptes fulgerator. Proc. Natl. Acad. Sci. U.S.A. 101, 14812-
14817.
24. Hoang, D.T., Chernomor, Q., von Haeseler, A., Minh, B.Q. & Vinh, L.S. (2018) UFBoot2: improving the
ultrafast bootstrap approximation. Molecular Biology and Evolution 35, 518-522.
25. Hoffmann, B.D., Blas, A. & Tay, W.T. (in press) Biosecurity interceptions of Coconut Rhinoceros Beetle
Oryctes rhinoceros. Management of Biological Invasions.
26. Hurst, G.D.D. and Jiggins, F.M. (2005) Problems with mitochondrial DNA as a marker in population,
phylogeographic and phylogenetic studies: the effects of inherited symbionts. Proceedings of the Royal
Society, Series B 272,1525-1534.
27. Huson, D.H., Richter, D.C., Rausch, C., Dezulian, T., Franz, M. & Rupp, R. (2007) Dendroscope: an
interactive viewer for large phylogenetic trees. BMC Bioinformatics 8,460.
28. Indriyanti, D.R., Utami, Z.T., Setiati, N., Soesilowati, E. & Slamet, M. (2019) Identification of insect pests
that attack the coconut plants in Jepara regency. Journal of Physics: Conference Series 1321, 032030
29. Katoh, K., Misawa, K., Kuma, K.-I., et al. (2002) MAFFT: a novel method for rapid multiple sequence
alignment based on fast Fourier transform. Nucleic Acids Research 440, 3059-3066.
30. Katoh, K. and Standley, D.M. (2013) MAFFT Multiple sequence alignment software version 7:
Improvements in performance and usability. Molecular Biology and Evolution 30, 772-780.
31. Lannucci, A., Benazzo, A., Natali, C., et al. (2021) Population structure, genomic diversity and
demographic history of Komodo dragons inferred from whole-genome sequencing. Molecular Ecology 20,
6309-6324.
32. Leducq, J.-B., Henault, M., Charron, G., et al. (2017) Mitochondrial recombination and introgression
during speciation by hybridization. Molecular Biology and Evolution, 38, 1947-1959.
33. Leite, N.A., Alves-Pereira, A., Corrêa, A.S., et al. (2014) Demographics and genetic variability of the new
world bollworm (Helicoverpa zea) and the Old World bollworm (Helicoverpa armigera) in Brazil. PLoS ONE
9, e113286, https://doi.org/10.1371/journal.pone.0113286
34. Li, X.W., Fu, K.Y., Guo, W.C., Wang, T.Z. & Lu, Y.B. (2022) The complete mitochondrial genome of Tuta
absoluta (Lepidoptera: Gelechiidae) and genetic variation in two newly invaded populations in China.
Journal of Asia-Pacific Entomology 25, 101988.
35. Marshall, S.D.G., Moore, A., Vaqalo, M., et al. (2017) A new haplotype of the coconut rhinoceros beetle,
Oryctes rhinoceros, has escaped biological control by Oryctes rhinoceros nudivirus and is invading Pacific
Islands. Journal of Invertebrate Pathology 149, 127-134.
36. Marshall, S.D.G., Paudel, S., Mansfield, S., et al. (2023) Coconut rhinoceros beetle in Solomon Islands: a
tale of two invasions. Biological Invasions 25, 2659–2678. https://doi.org/10.1007/s10530-023-03063-x
37. Nagoshi, R.N., Goergen, G., Tounou, K.A., et al. (2018) Analysis of strain distribution, migratory potential,
and invasion history of fall armyworm populations in northern Sub-Saharan Africa. Scientific Reports 8,
3710.
38. Nagoshi, R.N., Dhanani, I., Asokan, R., et al. (2019) Genetic characterization of fall armyworm infesting
South Africa and India indicate recent introduction from a common source population. PLoS ONE 14,
e0217755.
39. Otim, M.H., Tay, W.T., Walsh, T.K., et al. (2018) Detection of sister-species in invasive populations of the
fall armyworm Spodoptera frugiperda (Lepidoptera: Noctuidae) from Uganda. PLoS ONE 13, e0194571
Preprints.org (www.preprints.org) | NOT PEER-REVIEWED | Posted: 23 May 2024 doi:10.20944/preprints202405.1484.v1
13
40. Paudel, S., Mansfield, S., Villamizar, L.F., et al. (2023) Can biological control overcome the threat from
newly invasive coconut rhinoceros beetle populations (Coleoptera: Scarabaeidae)? A review. Annals of the
Entomological Society of America 114, 247-256.
41. Pearce, S.L., Clarke, D.F., East, P.D., et al. (2017) Genomic innovation, transcriptional plasticity and gene
loss underlying the evolution and divergence of two highly polyphagous and invasive Helicoverpa pest
species. BMC Biology 15, 63
42. Rane, R., Walsh, T.K., Lenancker, P., et al. (2023) Complex multiple introductions drive fall armyworm
invasions into Asia and Australia. Scientific Reports 13, 660.
43. Reil, J.B., Doorenweerd, C., San Jose, M., et al. (2018) Transpacific coalescent pathways of coconut
rhinoceros beetle biotypes: Resistance to biological control catalyses resurgence of an old pest. Molecular
Ecology 27, 4459-4474.
44. Rugman-Jones, P.F., Hoddle, C.D., Hoddle, M.S. & Stouthamer, R. (2013) The Lesser of Two Weevils:
Molecular-Genetics of Pest Palm Weevil Populations Confirm Rhynchophorus vulneratus (Panzer 1798) as a
Valid Species Distinct from R. ferrugineus (Olivier 1790), and Reveal the Global Extent of Both. PLoS ONE
8, e78379.
45. Saville, B., Kohli, Y. & Anderson, J.B. (1998) mtDNA recombination in a natural population. Proceedings
of the National Academy of Sciences of the United States of America 95, 1331-1335.
46. Tay , W.T. (2016) Rapid molecular DNA identification method for the European invasive grapevine moth
Lobesia botrana. Australia: CSIRO; Available from: https://www.wineaustra- lia.com/getmedia/72f4848c-
82c7-45b2-ba10-a179add3d6df/ CSE-1301-Final-Report
47. Tay, W.T., Beckett, S.J. & De Barro, P.J. (2016). Phosphine resistance in Australian Cryptolestes species
(Coleoptera: Laemophloeidae): perspectives from mitochondrial DNA cytochrome oxidase I analysis. Pest
Management Science 72, 1250-1259.
48. Tay, W.T., Walsh, T.K., Downes, S., Anderson, C., et al. (2017a) Mitochondrial DNA and trade data
support multiple origins of Helicoverpa armigera (Lepidoptera, Noctuidae) in Brazil. Scientific Reports 7,
45302.
49. Tay, W.T., Elfekih, S., Court, L.N., et al. (2017b) The trouble with MEAM2: Implications of pseudogenes
on species delimitation in the globally invasive Bemisia tabaci (Hemiptera: Aleyrodidae) cryptic species
complex. Genome Biology and Evolution 9, 2732-2738.
50. Tay, W.T., Rane, R., Padovan, A., et al. (2022a) Global population genomic signature of Spodoptera frugiperda
(fall armyworm) supports complex introduction events across the Old World. Communications Biology 5,
297.
51. Tay, W.T., Court, L.N., Hoffmann, B.D., et al. (2022b) Draft mitogenomes of the invasive ant Lepisiota
frauenfeldi (Mayr 1855) (Hymenoptera: Formicidae). Mitochondrial DNA Part B 7, 1183-1185.
52. Tay, W.T., Meagher, R.L. Jr., Czepak, C. & Groot, A.T. (2023) Spodoptera frugiperda: Ecology, evolution and
management options of an invasive species. Annual Review of Entomology 68, 299-317.
53. Tay, W.T., Popa-Baez, A., Dulla, G., et al. (2024) Mitochondrial COI, ATP6, and COIII complete sequence
database for coconut rhinoceros beetles (Oryctes rhinoceros) from native and introduced ranges. CSIRO Data
Access Portal https://doi.org/10.25919/srkk-j595.
54. The Marshall Islands Journal (2023) Rhino beetle takes root. October 19 2023
https://marshallislandsjournal.com/rhino-beetle-takes-root/ (accessed 17 March 2024).
55. Trifinopoulos, J., Nguyen, L.T., von Haeseler, A. & Minh, B.Q. (2016) W-IQ-TREE: a fast online
phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res. 44(W1), W232–235
56. Valencia-Montoya, W.A., Elfekih, S., North, H.L., Meier, J.I., et al. (2020) Adaptive introgression across
semipermeable species boundaries between local Helicoverpa zea and invasive Helicoverpa armigera moths.
Molecular Biology and Evolution 37, 2568-2583.
57. Walsh, T.K., Perera, O., Anderson, A., et al. (2019) Mitochondrial DNA genomes of five major Helicoverpa
pest species from the Old and New Worlds (Lepidoptera: Noctuidae). Ecology and Evolution 9, 2933-2944.
58. Zhang, J., Zhang, F., Tay, W.T., et al. (2022) Population genomics provides insights into lineage divergence
and local adaptation within the cotton bollworm. Molecular Ecology Resources 22, 1875-1891.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those
of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s)
disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or
products referred to in the content.
Preprints.org (www.preprints.org) | NOT PEER-REVIEWED | Posted: 23 May 2024 doi:10.20944/preprints202405.1484.v1
