Frank DN.. BARCRAWL and BARTAB: software tools for the design and implementation of barcoded primers for highly multiplexed DNA sequencing. BMC Bioinformatics 10: 362

Department of Molecular, University of Colorado, Boulder, CO 80309, USA.
BMC Bioinformatics (Impact Factor: 2.58). 10/2009; 10(1):362. DOI: 10.1186/1471-2105-10-362
Source: PubMed

ABSTRACT

Advances in automated DNA sequencing technology have greatly increased the scale of genomic and metagenomic studies. An increasingly popular means of increasing project throughput is by multiplexing samples during the sequencing phase. This can be achieved by covalently linking short, unique "barcode" DNA segments to genomic DNA samples, for instance through incorporation of barcode sequences in PCR primers. Although several strategies have been described to insure that barcode sequences are unique and robust to sequencing errors, these have not been integrated into the overall primer design process, thus potentially introducing bias into PCR amplification and/or sequencing steps.
Barcrawl is a software program that facilitates the design of barcoded primers, for multiplexed high-throughput sequencing. The program bartab can be used to deconvolute DNA sequence datasets produced by the use of multiple barcoded primers. This paper describes the functions implemented by barcrawl and bartab and presents a proof-of-concept case study of both programs in which barcoded rRNA primers were designed and validated by high-throughput sequencing.
Barcrawl and bartab can benefit researchers who are engaged in metagenomic projects that employ multiplexed specimen processing. The source code is released under the GNU general public license and can be accessed at http://www.phyloware.com.

  • Source
    • "The hypervariable V3-V5 region of the 16S rRNA gene was amplified using the primer set 341F (5 CCTACGGGAGGCAGCAG 3 ) and 907R (5 CCGTCAATTCCTTTRAGTTT 3 ). A unique 8- nucleotide barcode was added to both primers for multiplexed pyrosequencing using barcrawl (Pourmand et al., 2002; Frank, 2009). Each 20-µL PCR reaction consisted of 4 µL of 5 × Phusion "
    [Show abstract] [Hide abstract]
    ABSTRACT: Glass sponge (Hexactinellida, Porifera) is a special lineage due to its unique tissue organization and skeleton material. Structure and physiology of glass sponge have been extensively studied. However, our knowledge of the glass sponge-associated microbial community and the interaction with the host is rather limited. Here, we performed genomic studies on the microbial community in the glass sponge Lophophysema eversa in seamount. The microbial community was dominated by an ammonia-oxidizing archaeum (AOA), a nitrite-oxidizing bacterium (NOB) and a sulfur-oxidizing bacterium (SOB), all of which were autotrophs. Genomic analysis on the AOA, NOB and SOB in the sponge revealed specific functional features of sponge-associated microorganisms in comparison to the closely related free-living relatives, including chemotaxis, phage defense, vitamin biosynthesis and nutrient uptake among others, which are related to ecological functions. The three autotrophs play essential roles in the cycles of carbon (C), nitrogen (N) and sulfur (S) in the microenvironment inside the sponge body, and they are considered to play symbiotic roles in the host as scavengers of toxic ammonia, nitrite and sulfide. Our study extends knowledge regarding the metabolism and evolution of chemolithotrophs inside the invertebrate body.
    Full-text · Article · Dec 2015 · Environmental Microbiology
  • Source
    • "cylindracea Aires et al. (2015) Yes Yes NA Caulerpa prolifera Abbreviation: NA, not available. Stable and sporadic symbionts ER Hester et al 3 The ISME Journal 454_338R: GCCTCCCTCGCGCCATCAGxxxxxxxxxx xxCATGCTGCCTCCCGTAGGAGT) (Frank 2009 "
    [Show abstract] [Hide abstract]
    ABSTRACT: Coral and algal holobionts are assemblages of macroorganisms and microorganisms, including viruses, Bacteria, Archaea, protists and fungi. Despite a decade of research, it remains unclear whether these associations are spatial-temporally stable or species-specific. We hypothesized that conflicting interpretations of the data arise from high noise associated with sporadic microbial symbionts overwhelming signatures of stable holobiont members. To test this hypothesis, the bacterial communities associated with three coral species (Acropora rosaria, Acropora hyacinthus and Porites lutea) and two algal guilds (crustose coralline algae and turf algae) from 131 samples were analyzed using a novel statistical approach termed the Abundance-Ubiquity (AU) test. The AU test determines whether a given bacterial species would be present given additional sampling effort (that is, stable) versus those species that are sporadically associated with a sample. Using the AU test, we show that coral and algal holobionts have a high-diversity group of stable symbionts. Stable symbionts are not exclusive to one species of coral or algae. No single bacterial species was ubiquitously associated with one host, showing that there is not strict heredity of the microbiome. In addition to the stable symbionts, there was a low-diversity community of sporadic symbionts whose abundance varied widely across individual holobionts of the same species. Identification of these two symbiont communities supports the holobiont model and calls into question the hologenome theory of evolution.The ISME Journal advance online publication, 10 November 2015; doi:10.1038/ismej.2015.190.
    Full-text · Article · Nov 2015 · The ISME Journal
  • Source
    • "The PCR reaction mixture contained unique primer pair combinations for each sample, each with a different barcode sequence at their 5 0 end (Parameswaran et al. 2007). Six base pair long barcode sequences for forward and reverse primers were created with the Barcrawl program (Frank 2009). PCR was performed with the Phusion Hot Start High Fidelity Polymerase (Thermo Fisher Scientific, Waltham , MA, USA) reaction mixture according to the manufacturer's instructions. "
    [Show abstract] [Hide abstract]
    ABSTRACT: This two-week anaerobic batch study evaluated 2,4,6-trinitrotoluene (TNT) removal efficiency from industrial pink water by (1) adsorption on low-cost adsorbent pine bark, and (2) adsorption coupled with TNT biotransformation by specialised microbial communities. Samples of the supernatant and acetonitrile extracts of pine bark were analysed by HPLC, while the composition of the bacterial community of the experimental batches, inocula and pine bark were profiled by high-throughput sequencing the V6 region of the bacterial 16S rRNA gene. Integrated adsorption and biotransformation proved to be the most efficient method for TNT removal from pink water. The type of applied inoculum had a profound effect on TNT removal efficiencies and microbial community structures, which were dominated by phylotypes belonging to the Enterobacteriaceae family. The analysis of acetonitrile extracts of pine bark supported the hypothesis that the microbial community indigenous to pine bark has the ability to degrade TNT.
    Full-text · Article · Jul 2015 · Biodegradation
Show more