The Silk roads: phylogeography of Central Asian dice snakes (Serpentes: Natricidae) shaped by rivers in deserts and mountain valleys

Abstract

Influenced by rapid changes in climate and landscape features since the Miocene, widely distributed species provide suitable models to study the environmental impact on their evolution and current genetic diversity. The dice snake Natrix tessellata, widely distributed in the Western Palearctic is one such species. We aimed to resolve a detailed phylogeography of N. tessellata with a focus on the Central Asian clade with 4 and the Anatolia clade with 3 mitochondrial lineages, trace their origin, and correlate the environmental changes that affected their distribution through time. The expected time of divergence of both clades began at 3.7 Mya in the Pliocene, reaching lineage differentiation approximately 1 million years later. The genetic diversity in both clades is rich, suggesting different ancestral areas, glacial refugia, demographic changes, and colonization routes. The Caspian lineage is the most widespread lineage in Central Asia, distributed around the Caspian Sea and reaching the foothills of the Hindu Kush Mountains in Afghanistan, and Eastern European lowlands in the west. Its distribution is limited by deserts, mountains, and cold steppe environments. Similarly, Kazakhstan and Uzbekistan lineages followed the Amu Darya and the Syr Darya water systems in Central Asia, with ranges delimited by the large Kyzylkum and Karakum deserts. On the western side, there are several lineages within the Anatolia clade that converged in the central part of the peninsula with 2 being endemic to Western Asia. The distribution of both main clades was affected by expansion from their Pleistocene glacial refugia around the Caspian Sea and in the valleys of Central Asia as well as by environmental changes, mostly through aridification.

Full text

Current Zoology, 2024, 70, 150–162
https://doi.org/10.1093/cz/zoad008
Advance access publication 14 March 2023
Original Article
© The Author(s) 2023. Published by Oxford University Press on behalf of Editorial Ofce, Current Zoology.
This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial License (https://creativecommons.org/
licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For
commercial re-use, please contact journals.permissions@oup.com
Received 2 October 2022; accepted 2 March 2023
The Silk roads: phylogeography of Central Asian dice
snakes (Serpentes: Natricidae) shaped by rivers in deserts
and mountain valleys
DanielJablonskia,*,, KonradMebertb,, RafaqatMasroorc, EvgeniySimonovd, OlegKukushkine,f,
TimurAbduraupovg, and SylviaHofmannh,i,*,
aDepartment of Zoology, Comenius University in Bratislava, Bratislava, Slovakia,
bGlobal Biology, Birr, Switzerland,
cPakistan Museum of Natural History, Shakarparian, Islamabad, Pakistan,
dSevertsov Institute of Ecology and Evolution, Russian Academy of Sciences, Moscow, Russia,
eT. I. Vyazemski Karadag Scientific Station—Nature Reserve—Branch of A.O. Kovalevsky Institute of Biology of the Southern Seas, Theodosia,
Crimea,
fZoological Institute of the RAS, Saint Petersbourg, Russia,
gInstitute of Zoology, Academy of Sciences of the Republic of Uzbekistan, Yunusabad, Tashkent, Uzbekistan,
hMuseum Koenig Bonn, LIB—Leibniz Institute for the Analysis of Biodiversity Change, Bonn, Germany, and
iUFZ – Helmholtz Centre for Environmental Research, Department of Conservation Biology, Permoserstrasse 15, 04318 Leipzig, Germany
*Address correspondence to Daniel Jablonski. E-mail: daniel.jablonski@uniba.sk; Sylvia Hofmann. E-mail: s.hofmann@leibniz-lib.de.
Handling editor: JingChe
Abstract
Influenced by rapid changes in climate and landscape features since the Miocene, widely distributed species provide suitable models to study
the environmental impact on their evolution and current genetic diversity. The dice snake Natrix tessellata, widely distributed in the Western
Palearctic is one such species. We aimed to resolve a detailed phylogeography of N. tessellata with a focus on the Central Asian clade with 4
and the Anatolia clade with 3 mitochondrial lineages, trace their origin, and correlate the environmental changes that affected their distribution
through time. The expected time of divergence of both clades began at 3.7 Mya in the Pliocene, reaching lineage differentiation approximately
1 million years later. The genetic diversity in both clades is rich, suggesting different ancestral areas, glacial refugia, demographic changes, and
colonization routes. The Caspian lineage is the most widespread lineage in Central Asia, distributed around the Caspian Sea and reaching the
foothills of the Hindu Kush Mountains in Afghanistan, and Eastern European lowlands in the west. Its distribution is limited by deserts, moun-
tains, and cold steppe environments. Similarly, Kazakhstan and Uzbekistan lineages followed the Amu Darya and the Syr Darya water systems
in Central Asia, with ranges delimited by the large Kyzylkum and Karakum deserts. On the western side, there are several lineages within the
Anatolia clade that converged in the central part of the peninsula with 2 being endemic to Western Asia. The distribution of both main clades was
affected by expansion from their Pleistocene glacial refugia around the Caspian Sea and in the valleys of Central Asia as well as by environmental
changes, mostly through aridification.
Key words: biogeography, colonization, Eurasia, genetic diversity, mitochondrial DNA, Paratethys, refugia, water snakes.
The region from Anatolia to Central Asia played an important
role in the evolution of the current diversity of reptiles in the
Western Palearctic (Sindaco and Jeremcenko 2008; Sindaco
et al. 2013). Whereas the Anatolian area is well-studied and
provides several biogeographic hypotheses on the evolution
of regional biota (e.g., Bilgin 2011), Central Asia (countries
east of the Caspian Sea from Kazakhstan to Pakistan in the
south and north-western China and Mongolia in the east)
remains comparatively less explored. Several scenarios have
been presented for the diversication of herpetofauna in
Central Asia (e.g., Solovyeva et al. 2018; Asadi et al. 2019;
Dufresnes et al. 2019; Zhou et al. 2019), suggesting that
the diversity and expansion of various species in the region
were linked with the Mid-Miocene climatic transition char-
acterized by the rapid cooling and progressing aridication.
Such diversication has been driven also by uctuations of
the Paratethys Sea which responded to the Messinian Salinity
Crisis (Van Baak et al. 2017), one of the major events shaping
the evolution, diversity, and distribution of the current her-
petofauna in the Western Palearctic (Poulakakis et al. 2015).
Further population divergence was formed by the Pliocene
and Pleistocene climatic oscillations.
As the Eastern Paratethys (Euxinic-Caspian basin, semi-
closed or closed) was present in the area from the current
Black Sea to the mountains of Central Asia (Popov et al.
2006; Krijgsman et al. 2019), it raises the question of whether
it affected the evolution of reptiles requiring aquatic habitats.
The widely distributed dice snake, Natrix tessellata (Laurenti,
1768), is a suitable model to answer such a question. This
species is currently distributed from Central Europe, through

Jablonski et al. · The Silk roads 151
Egypt and the Middle East, Central Asia, to western China.
Previous research on the phylogeny and phylogeography of
the species detected 9 mitochondrial lineages with the basal
radiation occurring in Western Asia (Guicking et al. 2002;
2009; Guicking and Joger 2011; Kyriazi et al. 2013). It was
assumed that the diversication within the species is linked
to the major aridication and cooling that occurred during
the Tortonian period of the Miocene (Kyriazi et al. 2013)
and progressed with the late Miocene aridication events,
primarily the Messinian Salinity Crisis. This is paralleled by
the evolution of other animals in that region (Poulakakis et
al. 2015), and further supported by similar results from the
closely related grass snake Natrix natrix sensu lato (Fritz et al.
2012; Kindler et al. 2013, 2017). In contrast, the major clades
of N. tessellata originated in the Central Palearctic (Western
and Central Asia), whereas those for the N. natrix sensu lato
have their roots in the Western Palearctic realm (northern
Africa and Western and Central Europe).
In contrast to the large effort in the last decade for under-
standing the evolution and biogeography of the snake fauna
in the Western Palearctic, the genetic diversity in Asian dice
snake populations was only partially understood. Rastegar-
Pouyani et al. (2017) focused on the genetic diversity and
distribution of lineages found in Iran, however, without dis-
cussing biogeographic consequences. Asztalos et al. (2021)
presented an updated view on the phylogeography of N. tes-
sellata based on previous and new samples from Anatolia and
compared the phylogeographic structure and local hybridiza-
tions with N. natrix. These authors also found several cases
of hybridization between both studied species. Nevertheless, a
detailed phylogeographic study on populations from Central
Asia and related populations is missing. Thus, we aimed to
ll these gaps to provide insights into 1) the phylogeographic
structure of the species in Central Asia and adjacent regions;
2) the geographic origin of detected lineages, and their pos-
sible refugia; and 3) conditions that affected the colonization
and distribution in the arid and mountainous areas of Central
Asia.
Material and Methods
Data collection
We obtained DNA data from 33 new samples of N. tessel-
lata from Western and Central Asia. Tissues were transferred
into absolute ethanol and stored at −20°C. DNA was isolated
using the DNAeasy Tissue Kit (QIAGEN), following the man-
ufacturer’s protocols, and stored at −20°C. The material was
obtained through eldwork in areas that were not covered
in previous studies (e.g., Afghanistan, Kyrgyzstan, Pakistan,
and Tajikistan). Additional data were from museum collec-
tions and compiled with published sequences related to the
studied region (Guicking et al. 2006, 2009; Kyriazi et al.
2013; Rastegar-Pouyani et al. 2017; Asztalos et al. 2021;
Supplementary Table S1).
Amplification and sequencing
The complete mitochondrial DNA cytochrome b gene
(1,200 bp; cytb) was amplied with primers L14724NAT
(Guicking et al. 2002) and H16064 (Burbrink et al. 2000;
modied by De Queiroz et al. 2002) using the following
PCR program: 7 min denaturing step at 94°C followed by
40 cycles of denaturing for 40s at 94°C, primer annealing
for 30s at 46–50°C, and elongation for 1min at 72°C, with
a nal 7min elongation step at 72°C. The same primers were
applied for sequencing. Cytochrome b is the most common
marker used in molecular phylogenetic analyses of reptiles,
including studies on Eurasian snakes (Guicking et al. 2009;
Jablonski et al. 2019). In case of lower quality DNA of old
tissue samples (e.g., sample from specimen ZFMK 95022
from Kunduz, Afghanistan) we used universal cytb prim-
ers CB1—CCATCCAACATCTCAGCATGA and CB2—
CCCTCAGAATGATATTTGTCC (modied after Kocher
et al. 1989) to amplify a fragment of approximately 350bp
length. PCR products were puried using the ExoSAP-IT
enzymatic clean-up (USB Europe GmbH, Staufen, Germany;
manufacturer’s protocol). The sequencing was performed
by Macrogen Europe Inc. (Amsterdam, The Netherlands;
http://www.macrogen-europe.com), and new sequences were
deposited in GenBank under accession numbers OQ122168–
OQ122200 (Supplementary Table S1).
Phylogenetic analyses
DNA sequences were manually checked, aligned, and
inspected using Sequencher 5.4 and BioEdit 7.0.9.0 (Hall
1999). No stop codons were detected when the sequences
were translated using the vertebrate mitochondrial genetic
code in the program DnaSP 6.00 (Rozas et al. 2017). The
same program was used to calculate uncorrected p-dis-
tances among the main clades, and to estimate the number
of haplotypes (h) and nucleotide diversity (π). The best-t
codon-partitioning schemes and the best-t substitution mod-
els were selected using PartitionFinder 2 (Search algorithm:
all, linked branch lengths; Lanfear et al. 2017), according to
the Bayesian information criterion. Phylogenetic trees for the
dataset were inferred using the Bayesian approach (BA) and
maximum likelihood (ML) by MrBayes 3.2.6 (Ronquist et al.
2012) and RAxML 8.0. (Stamatakis 2014), respectively. The
best-t substitution model with each codon position treated
separately for the BA analysis was as follows: HKY + I + G
(rst and second positions), GTR + G (third position), while it
was GTR + I + G in each codon position in the ML analysis.
The rst 20% of trees were discarded as the burn-in after
inspection for stationarity of log-likelihood scores of sampled
trees in Tracer 1.7.1 (Rambaut et al. 2018; all parameters
had an effective sample size [ESS] of > 200). A majority-rule
consensus tree was drawn from the post-burn-in samples
and posterior probabilities were calculated as the frequency
of samples recovering any clade. The ML clade support was
assessed by 1,000 bootstraps. Nodes with posterior probabil-
ity/bootstraps values ≥0.95/≥70 were considered as moderate
or well-supported.
For the dating approach, we complemented our new
cytb sequences with data available in GenBank, including
all sequences of N. tessellata used in Guicking et al. (2006,
2009), and selected sequences from Kyriazi et al. (2013),
Rastegar-Pouyani et al. (2017), and Asztalos et al. (2021)
(Supplementary Table S1 and Figure S1). The resulting data
set consisted of 251 sequences (1,117bp). The time-calibrated
BA was performed based on the codon-partitioned data in
BEAST 2 v.2.7.0 (Bouckaert et al. 2019) using the bModel-
Test (Bouckaert and Drummond 2017) package in BEAST 2
to infer the nucleotide substitution models during the Markov
chain Monte Carlo (MCMC) analysis. To ensure that the tree
prior does not have a negative impact on molecular dating
(Ritchie et al., 2017), we conducted analyses using 2 different
diversication processes, Yule (pure birth) and a birth–death.

152 Current Zoology 2024, Vol. 70, No. 2
Both models were compared using the Bayes factor (BF). The
marginal likelihoods for the BF calculations were estimated
based on the steppingstone (ss; Xie et al. 2011) and path
sampling (ps; Lartillot and Philippe, 2006) methods using
in BEAST 2 with 100 million generations, a chain length of
1 million, and 100 path steps. Statistical support was then
evaluated via 2lnBF using the ps/ss results sensu Kass and
Raftery (1995). The dating approach followed Kyriazi et al.
(2013) using “external” calibration age constraints and set-
ting the prior on the calibration nodes so that the youngest
age of the distribution corresponded to the youngest possible
age at which that lineage existed using a log-normal distribu-
tion. Briey, 6 fossil records were implemented: C1 (earliest
Coluber and Masticophis fossils; mean = 0.0, SD = 0.843,
offset = 11.0), C2 (earliest Salvadora fossil; mean = 0.0, SD =
0.843, offset = 20.0), C3 (earliest Lampropeltis fossil; mean
= 0.0, SD = 0.843, offset = 15.0), C4 (earliest Pantherophis
fossil; mean = 0.0, SD = 0.843, offset = 16.0), C5 (earliest
Thamnophis fossil; mean = 14.0, SD = 4.70, offset = 13.4),
and C6 (the rst fossil appearance of the tribe Thamnophinii;
mean = 19.0, SD = 4.75, offset = 18.8). Eight runs were per-
formed each with 100 million generations, and a thinning
range of 10,000. Replicate runs were then combined with
BEAST 2 LogCombiner v.2.7.0 by resampling logs and trees
from the posterior distributions at a lower frequency and
using a burn-in of 10% for each dataset, resulting in a nal
set of approximately 18,000 trees. Convergence and station-
ary levels were veried with Tracer v.1.7.1 (Rambaut et al.
2018). We annotated the tree information with TreeAnnotator
v.2.6.7 and visualized it with FigTree v.1.4.2.
We also constructed TCS haplotype networks for each
mtDNA phylogenetic lineage detected in the studied region.
For this, we included only long-length sequences (>900bp).
We analyzed all lineages except Anatolia III which was rep-
resented by one sequence only. To build networks we used
the software PopArt 1.7 (http://popart.otago.ac.nz; Leigh and
Bryant 2015) with the incorporated 95% connection limit.
This approach allows us to present intraspecic evolution
and thus, better recognizes relationships between populations
(Posada and Crandall 2001).
Demography
The past population dynamics were estimated using the
Bayesian skyline plot (BSP; Drummond et al. 2005), as
implemented in BEAST 2 v.2.7.0. This method computes the
effective population size through time directly from sampled
sequences. The BSPs were applied to the Caspian, Kazakhstan,
and Uzbekistan lineages of the Central Asiatic clade and the
Anatolia IV lineage of the Anatolia clade, that is, lineages that
had enough sequences. We used a uniform prior for the mean
substitution rate for the cytb with the initial value of 0.00736
mutations per site/Mya taken from the nal molecular clock
analysis (see above). Preliminary analyses were run using
both a strict molecular clock and the uncorrelated lognor-
mal relaxed molecular clock provided similar data that were
in accordance with the published estimations. Given that the
parameter of the standard deviation of the uncorrelated log-
normal relaxed clock was close to zero, the nal analyses were
run enforcing the strict molecular clock model. The best-t-
ting partitioning scheme was estimated using PartitionFinder
2 (all codon positions being treated together as one partition),
and the HKY substitution model was selected as the best-t-
ting model. The nal BSP analysis was run in duplicates to
check for consistency between runs, each run for 10–50
million generations and sampled every 1,000 generations.
Convergence, ESS > 200, stationarity, and the appropriate
number of generations to be discarded as burn-in (10%) were
assessed using Tracer v.1.7.1. with the maximum time as the
mean of the root height parameter.
Ancestral area estimation in continuous space
The ancestral areas of the main detected N. tessellata line-
ages and the spatial-temporal patterns of diffusion through-
out their distribution range were estimated using the Bayesian
phylogeographic analysis in continuous space implemented
in BEAST v.1.10.4 (Lemey et al. 2010). We performed sep-
arate analyses with the same settings for each main clade
identied by the previous phylogenetic analysis, to avoid any
potential bias caused by population structure (Heller et al.
2013; Chiocchio et al. 2021). We applied a Yule tree prior,
the “Cauchy” model for spatial diffusion, and a strict molec-
ular clock model with 1.35% sequence divergence per mil-
lion years (Guicking et al. 2006). Geographical coordinates
were provided for each sequence, applying a jitter of ±0.001
to duplicated coordinates. Analyses were run for 200 million
generations, sampling every 20,000 generations. The conver-
gence of the MCMC chains was inspected using Tracer v.1.7.1
to ensure adequate mixing and convergence. Finally, the sam-
pled trees were annotated using TreeAnnotator v.2.6.2 and
the nal tree was analyzed in SpreaD3 v.1.0.7 (Bielejec et al.
2016) to visualize the ancestral area for each lineage.
Occurrence data species distribution modeling
We performed species distribution modeling (SDM) to illus-
trate the past and recent geographical distribution of N.
tessellata. Grids of 19 standard bioclimatic variables were
downloaded from the WorldClim (http://www.worldclim.
org) and CHELSA (https://chelsa-climate.org/) databases for
the Last Glacial Maximum (LGM) (~22 Kya; Karger et al.
2023), Mid-Holocene (~6 Kya; Fordham et al. 2017; Brown
et al. 2018), and current climate. All layers were clipped to
the extension of the known N. tessellata range and projected
to WGS84 using ArcGIS 10.8 (ESRI, Redlands, CA, USA).
To reduce the autocorrelation of climate data we removed
highly correlated variables based on the current climate data
sets and Pearson’s correlation coefcients (r > 0.7) using the
python script SDMtoolbox v.2.5 (Brown 2014) available for
ArcGIS. The nal bioclimatic data sets comprised 8 variables:
BIO1 = annual mean temperature, BIO2 = mean diurnal tem-
perature range, BIO4 = temperature seasonality, BIO8 = mean
temperature of wettest quarter, BIO12 = annual precipitation,
altitude (CHELSA data), BIO14 (WorldClim data) = precipi-
tation of driest month, BIO15 = precipitation seasonality, and
BIO19 = precipitation of coldest quarter.
Based on the recent climate data set, for these variables,
we carried out a principal components analysis (Figure 5D)
with SDMtoolbox and used the Eigenvalues of the resulting
3 components (88.79, 7.42, and 3.80) to assess the weighted
climatic heterogeneity (Figure 5E) across the area of interest.
To eliminate spatial clusters of localities we spatially ltered
our presence data by Euclidian distances (min 2 km, max
25 km; 5 distance classes) according to climate heterogene-
ity using the rarefying module in SDMtoolbox; as a result, 3
points were excluded. Prior to the SDMs, background points
were selected by a buffered minimum-convex polygon based
on known occurrences using a buffer distance of 200 km. The

Jablonski et al. · The Silk roads 153
nal 2 models were generated with MaxEnt v.3.4.3 (Phillips et
al. 2004, 2006) which is adequate for analyzing presence-only
data and based on the principle of maximum entropy. Model
performance and the importance of the environmental varia-
bles to the model were assessed using the mean area under the
curve (AUC) of the receiver operating characteristics (Hanley
and McNeil 1982; Robin et al. 2011), and jack-knife testing;
models with AUC values above 0.75 are considered poten-
tially informative (Elith et al. 2006), good between 0.8 and
0.9, and excellent for AUC between 0.9 and 1 (Préau et al.
2018). For projecting the MaxEnt models based on past cli-
mates, we used again the SDMtoolbox in ArcGIS.
Results
Molecular phylogeny, time divergence, and
phylogeography
The ML and BA gene trees based on a data matrix of 194
DNA sequences (190 without outgroup taxa) yielded almost
identical tree topologies with 7 major, well-supported clades
of N. tessellata (except the Greece clade in ML and Jordan
clade in BA tree) (Figure 1; for BA trees see Supplementary
Figures S1 and S2). These clades are named as follows: Iran,
Jordan, Greece, Crete, Europe, Anatolia (=Turkey lineage),
and Central Asia (modied from Guicking et al. 2009). The
last two, sister clades comprise 4 lineages (I–IV) in the Anatolia
clade (Anatolia III is represented by a single sequence from
Armenia) and 3 lineages in Central Asia clade (Caspian [=
Caucasus modied from Guicking et al. 2009], Kazakhstan,
and Uzbekistan; Figure 1). In the Anatolia clade, lineages
Anatolia I and Anatolia II (both endemic to Anatolia), consti-
tute the sister position, whereas the widely distributed lineage
Anatolia IV shows a sister relationship with the Armenian lin-
eage (Anatolia III). In the Central Asia clade, the Kazakhstan
lineage is sister to both Caspian and Uzbekistan lineages
that diverged later than the rst one (see Figure 1A, B and
Supplementary Figures S1 and S2).
We performed molecular dating under Yule and a birth–
death model. Both approaches provided different but com-
parable results (Supplementary Table S2). For the nal
phylogenetic inference, we applied a birth–death process
because this prior has been shown to be more suitable for
shallow and balanced phylogenies (Brown and Yang 2010),
while the Yule tree prior is more suitable for between species
branching (Drummond et al. 2007). Moreover, mean dating
results under birth–death model are more comparable with
other published data (Kyriazi et al. 2013). Overall, the age
estimations under the birth–death process are younger than
those inferred under the Yule model. The birth–death model
also strongly outperformed the Yule model (2lnBF > 20);
Table S3). Hence, we preferred the results under the birth–
death process to the Yule model. Molecular dating estima-
tions in N. tessellata suggest divergence from ancestral N.
tessellata begun in the late Miocene with the expected split
of the Iran clade at 9.6 Mya (11.6–7.1 Mya of 95% highest
posterior density—HPD), followed by the Greece clade at 7.8
Mya (9.6–5.9), Jordan clade at 7.1 Mya (8.3–5.4), and nally
Crete plus Europe clades at 6.0 Mya (7.5–4.5). The latter 2
clades diverged from each other probably between the end of
the Pliocene and the middle of the Pleistocene approximately
2.3 Mya (3.1–1.3 Mya), whereas Anatolia and Central Asia
clades diverged earlier around 3.7 Mya (4.5–2.6 Mya). In
Anatolia and Central Asia, 4 and 3 lineages were detected,
respectively, that is, Anatolia I–IV and Caspian, Kazakhstan,
and Uzbekistan. These lineages started their divergence dur-
ing the early Pleistocene with the initial split of Anatolia lin-
eages around 2.4 Mya (3.0–1.6 Mya) and around 2.5 Mya
(3.1–1.6 Mya) among Central Asia lineages (Figure 1A, B
and Supplementary Figure S2). The phylogenetic positions of
clades have been well resolved and supported, except for the
weaker support and uncertain placement of the Jordan clade
(Figure 1A).
The genetic diversity of Anatolia and Central Asia
clades shows a clear geographical pattern (Figure 2A)
with well-recognizable internal structures (Figure 1B and
Supplementary Figure S2). In the western part of the range
(Anatolia, Transcaucasia, and Black Sea region) 5 lineages
are present (Anatolia I–IV, Caspian), and 4 lineages are in
the region south and east of the Caspian Sea (Anatolia IV,
Caspian, Kazakhstan, and Uzbekistan). Lineages Anatolia
I and II are geographically restricted with a distribution
in central-south (Cilicia) and western Türkiye where they
approach the Europe clade of N. tessellata. The distinct lin-
eage from Armenia (sequence ID 2986) originates from an
area where geographically widespread lineages Anatolia IV
and Caspian meet. These 2 lineages also meet in northern
Iran, that is, along the Talysh and Alborz Mountains where
they possibly form a contact zone with the deeply diverged
Iran clade (Figure 2A). The geographically most widespread
Caspian lineage is also present as a distant single record in
the southern Zagros Mountains (see Discussion). Similarly,
the Anatolian IV lineage that continuously represents
records from Cyprus to Central and Eastern Anatolia, and
across Transcaucasia, has also been detected as an isolated
record in north-central Iran (Figure 2A). The Caspian line-
age occupies the area around the Caspian Sea and north of
it, approximately 3,000 km from central Kazakhstan and
Afghanistan to Eastern Europe (Crimean Peninsula and
Southern Bug River, Ukraine). Southeast of the Caspian Sea,
this lineage continues east along the Kopet Dag Mountains
limited north by the inhospitable Karakum Desert in
Turkmenistan, and equally south by the arid areas of Dasht-
e-Kavir in Iran and Sistan Basin in southern Afghanistan
(Figure 2A). The Caspian lineage reaches its easternmost
site in central Afghanistan, probably following the Hari
River. Finally, the Caspian lineage possibly meets the
Kazakhstan and Uzbekistan lineages north to the Aral Lake.
The Kazakhstan lineage is restricted to the Syr Darya basin
(northern Uzbekistan, southern Kazakhstan, and northern
and central Kyrgyzstan), and geographically limited due to
the Kyzylkum Desert and mountains of Tajikistan. Adjacent
to the south, the Uzbekistan lineage is linked to the Amu
Darya basin (western and southern Uzbekistan, Tajikistan,
and northern Afghanistan) and geographically constrained
by the Kyzylkum Desert in the north and the Karakum
Desert in the south. In Afghanistan, the Uzbekistan line-
age possibly meets the Caspian lineage somewhere around
Paropamisus and foothills of the Hindu Kush Mountains.
The Uzbekistan lineage also expanded east along Amu
Darya and Panj river systems into the Pakistani Hindu
Kush close to Karakoram (Figure 2A) and the Indus River
(Gilgit area; northern Pakistan), which constitutes the bor-
der between the Palearctic and the Oriental zoogeographical
realms. Noteworthy, the Uzbekistan lineage is characterized
by a high number of missing/extinct haplotypes and the
highest nucleotide variability (π = 1.2%) compared to the

154 Current Zoology 2024, Vol. 70, No. 2
other lineages, which are less structured with a nucleotide
variability equal to or lower than 0.5% (Supplementary
Figure S2).
The average of genetic distances among studied line-
ages of the N. tessellata varied from 2.1% (Kazakhstan vs.
Uzbekistan lineages) to 5.0% (Anatolia II vs. Caspian lin-
eages). Intralineage divergence reached the highest value
of 0.9% in the Anatolia I lineage (Table 1). The average of
genetic distances between Anatolia and Central Asia clades
was 3.9%.
Demographic history
The BSP analysis (Figure 1C) showed different population
demography of the investigated lineages. The mean value of
the population growth (Ne) was detected in all lineages except
Figure 1 The maximum likelihood tree reconstruction of Natrix tessellata (1,117bp; Supplementary Table S1) with time divergences based on the
molecular clock analysis (A), and the inset to relationships between Anatolia and Central Asia clades (B). Numbers at nodes represent the expected
time of the divergence. Terminal branch labels consist of the sample ID (new material) or GenBank accession number, and the name of the country
or region of origin (see also Figure 1 and Supplementary Table S1). (C) Bayesian skyline plots showing the historical demography for the investigated
lineages representing enough number of sequence data: the central line shows the mean value of the population size (Ne × τ × μ; where Ne is the
effective population size, τ is the generation length in units of time [substitutions/site], and μ is the mutation rate) on the logarithmic scale. LGM line
indicates the time of the Last Glacial Maximum. Inset photographs: Daniel Jablonski and M. M. Beskaravaynyi.

Jablonski et al. · The Silk roads 155
Figure 2 Upper panel (A): Geographic origin of sequences of the Anatolia and Central Asia clades of Natrix tessellata used in our study. Colors
correspond to the main phylogenetic lineages recovered in our analysis (Figure 1; for locality details see Supplementar y Table S1). Neighboring clades
(Iran, Jordan, Europe, sensu Guicking et al. 2009) are indicated by different symbols. The distribution range of the species is highlighted in light orange.
The question mark denotes uncertain origin of sequence KY887502. The pictured individual originates from Kazarman, Kyrgyzstan (Kazakhstan lineage).
Lower panel (B): Ancestral areas of the genetic lineages of N. tessellata from Anatolia and Central Asia. Polygons represent regions with 10–70%
highest posterior density (HPD) of the ancestral areas. The hypothetical colonization routes Caspian, Kazakhstan, and Uzbekistan lineage indicating by
color arrows. Question marks indicate unknown genetic affiliation in unstudied areas and white arrows hypothetical origins. The map was drawn using
QGIS 3.20. (https://qgis.org). Inset photograph: Daniel Jablonski.

156 Current Zoology 2024, Vol. 70, No. 2
Uzbekistan where certain stability was observed before and
after the LGM. The sign of the population growth started
before the LGM is visible in the Anatolia IV lineage (mean 40
Kya) and the Caspian lineage (35 Kya), and after the LGM in
the Kazakhstan lineage (19 Kya).
Ancestral areas, refugia, and SDM
The ancestral areas of the lineages (all except Anatolia III)
were restricted to distant regions across and east of Anatolia,
the Black and Caspian Seas (Figure 2B), and river val-
leys or lower elevated areas of Central Asia. For the wide-
spread Caspian lineage, the ancestral areas were detected
in the Kopet Dagh area of north-eastern Iran and southern
Turkmenistan (time to the most recent common ancestor—
TMRCA—95% HPD: 1.2–0.2 Mya), in the Transcaucasian
region (TMRCA: 0.9–0.4 Mya), and in the area north of
Black Sea and Caucasus (Crimea; TMRCA: 0.69–0.3 Mya).
Further to the east, putative ancestral areas of the Uzbekistan
lineage were mainly located along the Amu Darya, Pamirs,
and the Hindu Kush (TMRCA: 1.7–0.82 Mya), while the
Kazakhstan lineage had its ancestral areas probably in
river valleys of the Tian Shan in southern Kazakhstan and
northern Kyrgyzstan (TMRCA: 1.3–0.4 Mya; Figure 2B and
Supplementary Figure S2).
The ancestral area estimations were partially consistent with
the environmental niche model projection (SDM) on climatic
conditions during the LGM, representing putative glacial ref-
ugia (Figure 3A). Accordingly, the main refugia during the
LGM were apparently located in the Aral-Caspian depression
(Caspian lineage), especially in the Kura-Aras lowland that
delimitated the Greater and Lesser Caucasus and the lowland
north of the Caspian Sea, that is, Peri-Caspian lowland and in
the lowlands of Syr Darya and Chu rivers (Kazakhstan line-
age) in southern Kazakhstan, northern Kyrgyzstan, and in the
Fergana Valley (Uzbekistan lineage). One of the refugia of the
Caspian lineage was probably located in the northwestern part
of the Black Sea area. The projection during the Mid-Holocene
(6 Kya; Figure 3B) shows the increased areal size to the north
and west along climatically suitable areas, and the present
model corresponds well to the current species range (Figures
2A and 3C).
The current climate across the modeled area is spatially
heterogeneous, particularly in Anatolia, the Caucasus, south
of the Caspian Sea, and further east in the mountain valleys
of Central Asia (Figure 3D). All these areas share similar cli-
matic conditions (indicated by similar color, Figure 3E), and
are known distributions of N. tessellata.
Discussion
The evolution and phylogeography of the dice snake N. tessel-
lata have been previously addressed with studies by Guicking
et al. (2006, 2009), Guicking and Joger (2011), Kyriazi et
al. (2013), Rastegar-Pouyani et al. (2017), and Asztalos et
al. (2021). We complemented them with additional samples
from the species’ eastern distribution, the most poorly stud-
ied regions of Central Asia. Our study also comprised the
rst genetic data from the barely accessible river valleys of
the Paropamisus and Hindu Kush Mountains in Afghanistan
and Pakistan. The results conrmed the published molecular
phylogeny of N. tessellata (Guicking et al. 2009; Kyriazi et al.
2013) and identied at least 7 lineages within the Central Asia
and Anatolia clades. Our results further support the proposed
scenario of the species’ origin in southwestern Asia (Guicking
et al. 2009; Guicking and Joger 2011), followed by the diver-
sication of ancestral lineages from Iran (9.6 Mya), westward
to Egypt and Levant, Greece, and the rest of Europe during the
Miocene, and Anatolia and Central Asia during the Pliocene.
We also support the results of Kyriazi et al. (2013) that dated
the basal divergence of N. tessellata (split of the Iranian clade)
to an older age than previously reported by Guicking et al.
(2009) and parallels the basal diversication within the sister
species complex, N. natrix, around the same period (Fritz et
al. 2012). This age is also consistent with early divergence
times of other reptile groups with a similar distribution range
in Western and Central Asia (e.g., Phrynocephalus; Solovyeva
et al. 2018), and suggests a parallelism in the evolution of
regional biota, driven by environmental changes (Central
Asian aridication) since the Miocene (Guo et al. 2004).
However, for a better resolution of N. tessellata divergence
and phylogeography in space and time, it will be necessary to
study multilocus dataset or genomic data.
We have evaluated and rened several contact zones
between clades. The current distribution ranges of the large
Anatolia and Central Asia clades meet in the Transcaucasian
region, particularly in the Armenian Highlands, Lesser
Caucasus Mts., and Alborz Mts. in Iran. This conrms the
relevance of that area for phylogeographic studies (Tuniyev
1995; Ahmadzadeh et al. 2013; Zinenko et al. 2015; Jablonski
et al. 2019, 2021; Stratakis et al. 2022). Possible contact
zones between other clades of N. tessellata were detected
in western Türkiye (Anatolia with the Europe clade), the
Levant (Anatolia and Jordan clades), Iran (Anatolia, Central
Asia, and Iran clades), and in the easternmost Balkans and
Bessarabia in Moldova (Central Asia and Europe clades;
Figure 2). These multiple contact zones in Western Asia are
Table 1 Average uncorrected p-distances (%) calculated among the cytochrome b sequences of the main lineages of Anatolia and Central Asian clades
of Natrix tessellata. In diagonal (italics) are the average intraclade p-distances. The highest value of p-distance between Anatolia 2 and Caspian lineage is
highlighted in bold
P-distance
(%)
Anatolia
I (n = 6)
Anatolia
II (n = 4)
Anatolia
III (n = 1)
Anatolia
IV (n = 29)
Kazakhstan
(n = 20)
Caspian
(n = 27)
Uzbekistan
(n = 14)
Anatolia I 0.9
Anatolia II 2.3 0.4
Anatolia III 2.7 2.8 0
Anatolia IV 2.6 2.9 2.6 0.4
Kazakhstan 3.9 3.9 2.8 4.3 0.4
Caspian 3.9 5.0 4.1 4.0 3.2 0.7
Uzbekistan 3.7 3.6 2.6 4.1 2.1 4.0 0.7

Jablonski et al. · The Silk roads 157
reected by the highest genetic variation within N. tessellata,
because of clades having evolved separately over a long time
(Figure 1A) and thus, offer a particularly suitable window for
studies on gene ow, potential hybridization, and the evolu-
tionary dynamics between clades and lineages (see Asztalos
et al. 2021).
The separation of the Anatolia and Central Asia clades
began approximately 3.7 Mya (Figure 1) and continued dur-
ing the end of the Pliocene and beginning of the Pleistocene
probably within separated refugia in Anatolia, Caucasus, and
Black Sea regions, as well as lowlands and mountain valleys of
Central Asia; a phylogeographic evolution similar to the par-
tially sympatric N. natrix (Asztalos et al. 2021). We detected
at least 4 lineages within the Anatolia clade, 2 of them (I and
II) endemic to Western Asia, that is, the Anatolian region
(cf. Guicking et al. 2009; Asztalos et al. 2021; and Figure
2 this study). The ancestral diversication of these lineages
occurred at the beginning of the Pleistocene (2.4 Mya; Figures
Figure 3 The environmental niche model projection and the climate heterogeneity raster based on WorldClim data. (A) Climatic conditions at the Last
Glacial Maximum (LGM). The white arrows suggest examples of potential glacial refugia of the species during the LGM. (B) The model for the Mid-
Holocene. (C) Present model with the layer of data distribution points (white circles) downloaded from GBIF (2022). Yellow circles represent data used
for the SDM projection. (D) Warm colors depict high areas of climatic heterogeneity in the present time. (E) Principal components analysis (PCA) of
filtered WorldClim variables, showing climate space: the more similar the colors the more similar values. The maps were designed in QGIS 3.20 using
Min–Max as the stretching histogram.

158 Current Zoology 2024, Vol. 70, No. 2
1B and 2B), separately in south/western Anatolia (I and II)
and Armenian highlands (III and IV; Figure 2B). This separa-
tion appears to be related to the heterogeneous topography
in large parts of Anatolia, such as the biogeographic break
termed Anatolian Diagonal or its derivatives (see related
examples of snake biogeography; Jablonski et al. 2019; Šmíd
et al. 2021), that creates a multitude of ecosystems from
cold streams in tall mountains down to large humid-warm
wetlands adjacent to the Mediterranean and Black Seas.
Currently, dice snakes reach maximum elevations between
2,500 and 3,000 m above sea level (e.g., Yakovleva 1964;
Tuniyev et al. 2011). Anatolian lineages could survive glacial
periods along rocky shores of the southern Black Sea coast,
where the temperature prole was more suitable compared
to the adjacent highlands as demonstrated by mean annual
sea surface temperatures that uctuated between 6 and 9°C
during glaciation (Wegwerth et al. 2015). These conditions
resemble those that dice snakes experience today in northern
relict populations (e.g., Kotenko et al. 2011, Litvinov et al.
2011), or colder regions of the Pontic Mountains, Armenian
Highlands, and along the Kura-Aras river system (Figure
3A). Anatolian lineages I and IV probably survived in refu-
gia west and east of the Euphrates River, with the lineage IV
expanding during post-glacial warming westward across the
Euphrates and forming a mixed distribution pattern with the
southern Anatolian lineage I. This is, however, preliminary as
we miss the genetic data from Iraq and Syria. Similarly, the
endemic lineage Anatolia III consists of a single record from
Armenia, which might represent a local population diver-
gence restricted to Lake Sevan in Armenia, and where they
now occur in sympatry with the Caspian and Anatolia IV lin-
eages. Again, more genetic data are needed from that region,
especially from Armenia, Azerbaijan, Georgia, and northern
Iran, to better understand the phylogeographic patterns of N.
tessellata. We assume that dice snakes of central to eastern
Anatolia may have persisted during the coldest glacial period
in open microrefugia of xerophytic steppes, semi-deserts, and
south-exposed mountain slopes with plenty of solar radiation
reaching the ground level, which is relevant for proper ther-
moregulation (Adams and Faure 1997; Mebert et al. 2013;
Pickarski et al. 2015), thus experiencing further population
growth and expansion (see Anatolia IV lineage, Figure 1C). A
similar evolutionary diversity has been suggested in other rep-
tile species of the Anatolian-Transcaucasian region, including
snakes (Fritz et al. 2009; Sindaco et al. 2013; Hofmann et al.
2018; Jablonski et al. 2019, 2021; Asztalos et al. 2021; Šmíd et
al. 2021), thus, reecting the effects of natural barriers across
those complex landscapes (Bilgin 2011). The occurrence of
the Anatolia IV lineage in Cyprus suggests transmarine dis-
persal, for example, through oating objects, swimming (N.
tessellata is tolerant to saline water, see Gruschwitz et al.
1999), or human-induced colonization by shipping activities
in the past (Göçmen and Mebert 2011; Kyriazi et al. 2013;
Burton 2021).
In Central Asia, clade diversication of N. tessellata
began between the late Pliocene and the early Pleistocene
around 2.5 Mya (Figures 1 and 2), with subsequent splits
at 1.9 Mya (Caspian from Uzbekistan). The intralineage
variation is comparable across lineages, suggesting similar
environmental conditions that drove their mutual evolution
and rapid dispersion across large corridors. This is consist-
ent with the phylogeography of some amphibians and rep-
tiles in Central Asia, such as the green toads (Bufotes spp.;
Dufresnes et al. 2019), racerunners (Eremias spp., Guo et
al. 2011) or toad-headed agamas (Phrynocephalus spp.,
Melville et al. 2009; Solovyeva et al. 2018) that adjusted to
aridication, alterations in the Parathetys Basin, formation
of large rivers (particularly the Amu Darya and Syr Darya),
and tectonic uplifts during the Pliocene and the Pleistocene.
Even though the dates listed above are in good agreement
with results on time divergence within the Central Asian
lineages of N. tessellata, the historical reconstruction of this
species is complicated by the high dynamics of paleo-en-
vironments with cycles of ooding events and drainages,
leading to large geophysical changes of lowland rivers, trib-
utaries, lakes, and basins during this epoch that lasted up
to 1.8 Mya. However, we can expect that the evolution of
3 major lineages in Central Asia is connected to a variety
of water habitats (Caspian lineage) and the development
of river systems (Kazakhstan and Uzbekistan linages),
particularly the formation of deeply incised valleys in the
Parathetys Basin (e.g., palaeo-Amu Darya) during the Plio-
Pleistocene (Popov et al. 2006). Furthermore, vegetational
changes impacted the regionally available habitats, such as
the depletion of the oristic composition of vegetation, and
the replacement of savannahs, forests, and forest-steppes
by open steppes and deserts (Naidina and Richards 2020;
Lazarev et al. 2021).
The intralineage diversity of the Caspian, Kazakhstan, and
Uzbekistan lineages suggests surviving in different Pleistocene
microrefugia (Figure 2B), particularly in river valleys (Fergana,
Chu, Amu Darya, and Syr Darya), and along the southern
slopes of Alai and Tian Shan Mountains (Kazakhstan lineage),
as well as western Alai, Pamir, and Hindu Kush Mountains
(Uzbekistan lineage; see Figure 3A). Whereas the Kazakhstan
lineage is divided into 2 sublineages of geographically mixed
populations today (Figure 1B and Supplementary Figure
S3), the pattern in the Caspian lineage shows a clear struc-
ture of 3 areas that likely represent Pleistocene refugia as
more land masses and their wetlands along the coasts were
exposed due to sea level decrease by 20–120 m globally (e.g.,
Ganopolski et al. 2010). These refugia could be allocated in
1) north-eastern Iran and central Afghanistan, 2) western Iran
and Transcaucasia, and 3) steppe areas north of the Black Sea
(e.g., shallow brackish wetlands of the Odesa Bay and the Sea
of Azov), east to lowlands north of the Caucasus and the Peri-
Caspian region (Figures 2B and 3A). The Uzbekistan lineage
lacks readable phylogeographic structure, even though our
data indicate microrefugia in the Amu Darya Basin or even in
river systems of the southern Hindu Kush that were sources
of further colonization events. Comparable refugia also apply
to other biotas, for example, the Central Asian green toads of
the Bufo viridis complex (Zhang et al. 2008; Dufresnes et al.
2019), and even walnut trees (Aradhya et al. 2017).
We assume that the primary expansion of the ancestors’
population of Central Asian N. tessellata correlated with the
increased pluvial conditions in the Late Pliocene and Early
Pleistocene, caused by the great Akchagylian transgression,
respectively, extension, of the Caspian Basin with a reduced
salinity from 5‰ to 9‰ at the beginning and 18–25‰ at the
end of that epoch, and lasting from 3.6 to 1.8 Mya or 2.95–
2.13 Mya, depending on the source (see Gerasimov 1976;
Esin et al. 2019; Lazarev et al. 2021). In addition, the colo-
nization of the area between the Black and the Caspian Seas
was enabled through the Manych-Kerch Strait, a spillway
connecting these seas in the Late Pleistocene (Svitoch 2013).

Jablonski et al. · The Silk roads 159
The Pleistocene and the Holocene colonization routes of
N. tessellata in Central Asia correspond with rivers (and their
drainage systems) and lakes suitable for this semi-aquatic
snake (see Mebert 2011; Mebert and Masroor 2013; Mebert
et al. 2013). The best example is Central Asian populations
where particular lineages correspond to a specic river
basin. Similar linkage has been shown in the semiaquatic
colubrid snake Thermophis baileyi, inhabiting hot springs
in the high-elevated Tibetan Plateau, where the phylogeo-
graphic pattern corresponded clearly to the drainage system
(Hofmann et al. 2014).
The Caspian lineage (= Caucasus sensu Guicking et al.
2009) inhabits huge areas (ca. 3,300 km from west to east)
around the Caspian Sea and north of the Black Sea, that is,
the area of the former Paratethys. This shows the unprece-
dented colonization properties of N. tessellata, as they have
been observed to quickly nd and populate preferred habi-
tats and build large (articles in Mebert 2011; Pauwels et al.
2020). The Caspian region with its wide shallow water areas,
a large number of ground-dwelling gobiid sh (Gruschwitz et
al. 1999; Tuniyev et al. 2011), and massive shoreline habitat
have probably become a center of dispersion for N. tessellatа.
From there dice snakes expanded into different directions,
particularly from the southeast (today eastern Iran, cen-
tral or western Afghanistan) to the northwest and possibly
back to Central Asia from areas north of the Caspian Sea
(Figures 1A and 2B). Around the Aral Sea, it approached the
Kazakhstan and Uzbekistan lineages where the exact position
of their potential contact zones is currently unknown. The
expansion was probably rapid as suggested by the structure
of the haplotype network, exhibiting a high number of closely
related haplotypes, and the BSP analysis (Figures 1 and 2 and
Supplementary Figure S3). The Caspian lineage was able to
reach the European continent in central-southern Ukraine
and was detected even in one isolated and distant sample in
southern Iran (SUHC 1842: Rastegar-Pouyani et al. 2017).
However, this single record from southern Iran should be
taken with caution as the material was provided by an ille-
gal snake catcher with an unprecise, perhaps incorrect, origin
from somewhere in the Fars Province (Rastegar-Pouyani pers.
comm.). Hence, further investigations are required, for exam-
ple, based on material from Fars Province that was studied
only morphologically (Rajabizadeh et al. 2011).
The Uzbekistan and Kazakhstan lineages apparently
expanded westward along the Amu Darya and the Syr Darya
between Kyzylkum and Karakum deserts. The Uzbekistan lin-
eage also crossed the Hindu Kush Mountains following rivers
in north-eastern Afghanistan and reaching the Karakoram
Mountains in Pakistan (Mebert and Masroor 2013; Mebert et
al. 2013; and Figure 2B). The lack of signals indicating popula-
tion expansion after LGM in the Uzbekistan and Kazakhstan
lineages may suggest their long-term refugia (and possible bot-
tleneck) in Central Asian Mountain ranges during Pleistocene
glaciations. Given the strictly semiaquatic biology of N. tes-
sellata (Mebert 2011) we suggest that the species expanded
its range repeatedly during warm periods northeast along the
base of the Tien Shan Mountains, around the lakes Issyuk Kul,
Balkhash, and Alakol and their drainage systems. Proceeding
from these regions, they could colonize the Chinese Junggar
Basin, Turfan Depression, and the Tarim Basin, as records of
dice snakes in north-western China indicate (Liu et al. 2011).
However, these populations have not been genetically studied
so far and the exact colonization route to the easternmost
places of the species range is still hypothetical (Figure 2B). A
relatively large number of genetic differences between haplo-
types inside the Uzbekistan lineage might be triggered by the
rugged and highly elevated topography of the Hindu Kush
and Karakoram Mountains. It likely promoted frequent tem-
porary isolations of populations during climatic uctuation
in the Pleistocene, which is corroborated by the lack of pop-
ulation growth after the LGM (Figure 1C). Especially at the
edge of the species distribution in Pakistan, the haplotypes
from the south-eastern-most population at Ghakuch are very
distant from other populations (Supplementary Figure S3),
suggesting prolonged isolation. While the exact limit of N.
tessellata has not been established, the Indus River approxi-
mately 70 km downstream from Ghakuch, beginning east of
Gilgit-Jalal Abad turns into a fast-owing sediment-rich river,
which likely is an inferior shing ground. Another 100 km
farther downstream Indus River, the presence of the ecologi-
cally very similar Asiatic water snake Fowlea piscator possi-
bly prohibited the further expansion of N. tessellata (Mebert
and Masroor 2013; Mebert et al. 2013). An assessment of the
status and biogeographic history of these lineages requires a
wider sampling in the area.
There is also evidence of a signicantly wider distribution of
the dice snake during the Early and Middle Holocene, respec-
tively, the Holocene Climatic Optimum (HCO or Atlantic
epoch). During the HCO, the northern hemisphere has been
characterized by regionally higher temperatures and wetter
climate (9.3–5.7 Kya; Yakovleva and Bakiev 2010; Marosi
et al. 2012; Mebert et al. 2013). In such warmer periods, N.
tessellata expanded to the north of western Eurasia (Figure
3B) outside of its contemporary distribution (Ratnikov 2009;
Ratnikov and Mebert 2011). Simultaneously, the same inter-
glacial event probably reduced the species range in Central
Asia where signicant desertication has developed. On the
other hand, the huge Caspian Sea likely acted as a large repos-
itory for dice snakes in Central Asia, promoting expansion
into adjacent tributaries, whenever conditions became suita-
ble. The rapid colonization within a few years of various new
articial islands in the Caspian Sea, located at distances of
8–50 km from the mainland (Pauwels et al. 2020), is a perfect
example of the high expansion potential of N. tessellata, a fact
that is evident from its wide distribution range today. It high-
lights the high versatility of N. tessellata, a species that will
provide us with many more fascinating attributes to study.
Acknowledgments
We thank many of our colleagues, friends, and local people
for their support, material, information, or help in the eld
or in the laboratory. Special thanks are given to anonymous
reviewers for their benecial comments and suggestions for
revised versions of the manuscript. DJ was supported by the
Slovak Research and Development Agency under the con-
tract APVV-19-0076 and by the grant VEGA 1/0242/21 of
the Scientic Grant Agency of the Slovak Republic. SH was
supported by the German Research Foundation (DFG, grant
no. HO 3792/8-1). The work of OK was carried out within
the framework of research topics of the state assignments
nos. 121032300023-7 and 122031100282-2. The research
of DJ in Afghanistan has been approved by the National
Environmental Protection Agency of the Islamic Emirate
of Afghanistan (permits for access to genetic resources nos.
12429 and 12455).

160 Current Zoology 2024, Vol. 70, No. 2
Supplementary Material
Supplementary material can be found at https://academic.
oup.com/cz.
References
Adams JM, Faure H, 1997. Preliminary vegetation maps of the world
since the Last Glacial Maximum: An aid to archaeological under-
standing. J Archaeol Sci 24(7): 623–647.
Ahmadzadeh F, Flecks M, Rödder D, Böhme W, Ilgaz C et al., 2013.
Multiple dispersal out of Anatolia: Biogeography and evolution of
oriental green lizards. Biol J Linn Soc 110: 398–408.
Aradhya M, Velasco D, Ibrahimov Z, Toktoraliev B, Maghradze D et
al., 2017. Genetic and ecological insights into glacial refugia of
walnut (Juglans regia L.). PLoS One 12: e0185974.
Asadi A, Montgerald C, Nazarizadeh M, Moghaddasi A, Fatemizadeh
F et al., 2019. Evolutionary history and postglacial colonization
of an Asian pit viper Gloydius halys caucasicus into Transcaucasia
revealed by phylogenetic and phylogeographic analyses. Sci
Reports 9: 1224.
Asztalos M, Ayaz D, Bayrakci Y, Afsar M, Tok CV et al., 2021. It takes
two to tango: Phylogeography, taxonomy and hybridization in
grass snakes and dice snakes (Serpentes: Natricidae: Natrix natrix,
N. tessellata). Vertebr Zool 71: 813–834.
Bielejec F, Baele G, Vrancken B, Suchard MA, Rambaut A et al., 2016.
SpreaD3: Interactive visualisation of spatiotemporal history and
trait evolutionary processes. Mol Biol Evol 33: 2167–2169.
Bilgin R, 2011. Back to the suture: The distribution of intraspecic
genetic diversity in and around Anatolia. International J Mol Sci
12: 4080–4103.
Bouckaert RR, Drummond AJ, 2017. bModelTest: Bayesian phyloge-
netic site model averaging and model comparison. BMC Evol Biol
17: 1–11.
Bouckaert R, Vaughan TG, Barido-Sottani J, Duchêne S, Fourment
M et al., 2019. BEAST 2.5: An advanced software platform for
Bayesian evolutionary analysis. PLoS Comp Biol 15: e1006650.
Brown JL, 2014. SDMtoolbox: A python-based GIS toolkit for land-
scape genetic, biogeographic and species distribution model analy-
ses. Methods Ecol Evol 5: 694–700.
Brown JL, Hill DJ, Dolan AM, Carnaval AC, Haywood AM, 2018.
PaleoClim, high spatial resolution paleoclimate surfaces for global
land areas. Sci Data 5: 180254.
Brown RP, Yang Z, 2010. Bayesian dating of shallow phylogenies with
a relaxed clock. Syst Biol 59: 119–131.
Burbrink FT, Lawson R, Slowinski JB, 2000. Molecular phylogeogra-
phy of the North American rat snake Elaphe obsoleta: A critique of
the subspecies concept. Evolution 54: 2107–2118.
Burton A, 2021. Bithynian snake bombs. Front Ecol Environ 19: 196.
Chiocchio A, Arntzen JW, Martínez-Solano I, de Vries W, Bisconti R et
al., 2021. Reconstructing hotspots of genetic diversity from glacial
refugia and subsequent dispersal in Italian common toads Bufo
bufo. Sci Rep 11:260.
De Queiroz A, Lawson R, Lemos-Espinal JA, 2002. Phylogenetic rela-
tionships of North American garter snakes (Thamnophis) based on
four mitochondrial genes: How much DNA sequence is enough?
Mol Phylogenet Evol 22:315–329.
Drummond AJ, Ho SYW, Rawlence N, Rambaut A, 2007. A Rough
Guide to BEAST 1.4. Available from: https://www.ccg.unam.
mx/~vinuesa/tlem/docs/BEAST14_Manual_6July2007.pdf
Drummond AJ, Rambaut A, Shapiro B, Pybus OG, 2005. Bayesian
coalescent inference of past population dynamics from molecular
sequences. Mol Biol Evol 22: 1185–1192.
Dufresnes C, Mazepa G, Jablonski D, Oliveira RC, Wenseleers T et al.,
2019. Fifteen shades of green: the evolution of Bufotes toads revis-
ited. Mol Phylogenet Evol 141: 106615.
Elith J, Graham CH, Anderson RP, Dudík M, Ferrier S et al., 2006.
Novel methods improve prediction of species’ distributions from
occurrence data. Ecography 29: 129151.
Esin NV, Esin NI, Podymov IS, Lifanchuk AV, Melnikova IV, 2019.
Formation mechanisms of the Caspian transgressive seas in the
Pleistocene. Hydrosphere Еcol 1:13–23.
Fordham DA, Saltré F, Haythorne S, Wigley TM, Otto-Bliesner BL et
al., 2017. PaleoView: A tool for generating continuous climate pro-
jections spanning the last 21000 years at regional and global scales.
Ecography 40:1348–1358.
Fritz U, Ayaz D, Hundsdörfer AK, Kotenko T, Guicking D et al., 2009.
Mitochondrial diversity of European pond turtles Emys orbicularis
in Anatolia and the Ponto-Caspian region: Multiple old refuges,
hotspot of extant diversication and critically endangered endem-
ics. Org Divers Evol 9:100–114.
Fritz U, Corti C, Päckert M, 2012. Mitochondrial DNA sequences
suggest unexpected phylogenetic position of Corso-Sardinian
grass snakes Natrix cetti and do not support their species status,
with notes on phylogeography and subspecies delineation of grass
snakes. Org Divers Evol 12:71–80.
Ganopolski A, Calov R, Claussen M, 2010. Simulation of the last gla-
cial cycle with a coupled climate ice-sheet model of intermediate
complexity. Climate Past 6:229–244.
GBIF, 2022. GBIF Occurrence Download. https://doi.org/10.15468/
dl.rd3awv, accessed on 09 March 2022.
Gerasimov IP, 1976. The main stages in the development of the relief of
the Turan plains in recent geological time. In: Gerasimov IP, editor.
New Pathways in Geomorphology and Paleogeography. Moscow:
Nauka. 20–41 (in Russian).
Göçmen B, Mebert K, 2011. The rediscovery of Natrix tessellata on
Cyprus. Mertensiella 18:383–387.
Gruschwitz M, Lenz S, Mebert K, Lanka V, 1999. Natrix tessellata
(Laurenti, 1768)—Würfelnatter. In: Böhme W, editor. Handbuch
der Reptilien und Amphibien Europas, Band 3/IIA., Schlangen
(Serpentes) II. Wiesbaden: Aula-Verlag, 581–644.
Guicking D, Joger U, 2011. A range-wide molecular phylogeography of
Natrix tessellata. Mertensiella 18:1–10.
Guicking D, Joger U, Wink M, 2002. Molecular phylogeography of the
viperine snake Natrix maura and the dice snake Natrix tessellata:
First results. Biota 3:49–59.
Guicking D, Joger U, Wink M, 2009. Cryptic diversity in a Eurasian
water snake (Natrix tessellata, Serpentes: Colubridae): Evidence
from mitochondrial sequence data and nuclear ISSR-PCR nger-
printing. Org Divers Evol 9:201–214.
Guicking D, Lawson R, Joger U, Wink M, 2006. Evolution and phylog-
eny of the genus Natrix (Serpentes: Colubridae). Biol J Linn Soc
87:127–143.
Guo X, Dai X, Dali C, Papenfuss TJ, Ananjeva NB et al., 2011.
Phylogeny and divergence times of some racerunner lizards
(Lacertidae: Eremias) inferred from mitochondrial 16S rRNA gene
segments. Mol Phylogenet Evol 61:400–412.
Guo Z, Peng S, Hao Q, Biscaye PE, An Z et al., 2004. Late Miocene-
Pliocene development of Asian aridication as recorded in the Red-
Earth formation in northern China. Glob Planet Change 41:135–145.
Hall TA, 1999. BioEdit: A user-friendly biological sequence alignment
editor and analysis program for Windows 95/98/NT. Nucleic Acids
Symp Ser 41:95–98.
Hanley JA, McNeil BJ, 1982. The meaning and use of the area under
a receiver operating characteristic (ROC) curve. Radiology
143:29–36.
Heller R, Chikhi L, Siegismund HR, 2013. The confounding effect of
population structure on Bayesian skyline plot inferences of demo-
graphic history. PLoS One 8:e62992.
Hofmann S, Kraus S, Dorge T, Nothnagel M, Fritzsche P et al., 2014.
Effects of Pleistocene climatic uctuations on the phylogeography,
demography and population structure of a high-elevation snake
species Thermophis baileyi on the Tibetan Plateau. J Biogeogr
41:2162–2172.
Hofmann S, Mebert K, Schulz K-D, Helfenberger N, Göçmen B et al.,
2018. A new subspecies of Zamenis hohenackeri (Strauch, 1873)
(Serpentes: Colubridae) based on morphological and molecular
data. Zootaxa 137:4471–4153.

Jablonski et al. · The Silk roads 161
Jablonski D, Nagy ZT, Avcı A, Olgun K, Kukushkin OV et al., 2019.
Cryptic diversity in the smooth snake Coronella austriaca. Amphib-
Reptilia 40:179–192.
Jablonski D, Ribeiro-Júnior MA, Meiri S, Maza E, Kukushkin OV et
al., 2021. Morphological and genetic differentiation in the anguid
lizard Pseudopus apodus supports the existence of an endemic sub-
species in the Levant. Vertebr Zool 71:175–200.
Karger DN, Nobis MP, Normand S, Graham CH, Zimmermann NE,
2023. CHELSA-TraCE21k-high-resolution (1 km) downscaled
transient temperature and precipitation data since the Last Glacial
Maximum. Clim Past 19:439–456.
Kass RE, Raftery AE, 1995. Bayes factors. J Am Stat Assoc 90:773–795.
Kindler C, Böhme W, Corti C, Gvoždík V, Jablonski D et al., 2013.
Mitochondrial phylogeography, contact zones and taxonomy
of grass snakes (Natrix natrix, N. megalocephala). Zool Scripta
42:458–472.
Kindler C, Chèvre M, Ursenbacher S, Böhme W, Hille A et al., 2017.
Hybridization patterns in two contact zones of grass snakes reveal
a new Central European snake species. Sci Reports 7:7378.
Kocher TD, Thomas WK, Meyer A, Edwards SV, Pääbo S et al.,
1989. Dynamics of mitochondrial DNA evolution in animals:
Amplication and sequencing with conserved primers. Proc Nat
Acad Sci U S A 86:6196–6200.
Kotenko TI, Shaitan SV, Starkov VG, Zinenko OI, 2011. The northern
range limit of the dice snake Natrix tessellata in Ukraine and the
Don River basin in Russia. Mertensiella 18:311–324.
Krijgsman W, Tesakov A, Yanina T, Lazarev S, Danukalova G et al.,
2019. Quaternary time scales for the Pontocaspian domain:
Interbasinal connectivity and faunal evolution. Earth-Sci Rev
188:1–40.
Kyriazi P, Kornilios P, Nagy ZT, Poulakakis N, Kumlutaş Y et al., 2013.
Comparative phylogeography reveals distinct colonization patterns
of Cretan snakes. J Biogeogr 40:1143–1155.
Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B, 2017.
PartitionFinder 2: New methods for selecting partitioned models of
evolution for molecular and morphological phylogenetic analyses.
Mol Biol Evol 34:772–773.
Lartillot N, Philippe H, 2006. Computing Bayes factors using thermo-
dynamic integration. Syst Biol 55:195–207.
Lazarev S, Kuiper KF, Oms O, Bukhsianidze M, Vasilyan D et al., 2021.
Five-fold expansion of the Caspian Sea in the late Pliocene: New
and revised magnetostratigraphic and 40Ar/39Ar age constraints
on the Akchagylian stage. Glob Planet Change 206:103624.
Leigh JW, Bryant D, 2015. PopART: full-feature software for haplotype
network construction. Methods Ecol Evol 6:1110–1116.
Lemey P, Rambaut A, Welch JJ, Suchard MA, 2010. Phylogeography
takes a relaxed random walk in continuous space and time. Mol
Biol Evol 27:1877–1885.
Litvinov N, Bakiev A, Mebert K, 2011. Thermobiology and micro-
climate of the dice snake at its northern range limit in Russia.
Mertensiella 18:330–336.
Liu Y, Mebert K, Shi L, 2011. Notes on distribution and morphology of
the dice snake Natrix tessellata in China. Mertensiella 18:430–436.
Marosi B, Zinenko OI, Ghira IV, Crnobrnja-Isailović J, Lymberakis P
et al., 2012. Molecular data conrm recent uctuations of north-
ern border of dice snake Natrix tessellata range in Eastern Europe.
North-Western J Zool 8:374–377.
Mebert K, 2011. The Dice Snake Natrix tessellata: Biology, Distribution
and Conservation of a Palaearctic Species. Mertensiella, Vol. 18.
Rheinbach: DGHT.
Mebert K, Masroor R, 2013. Dice snakes in western Himalaya: Insights
into regional expansion routes of Natrix tessellata after its redis-
covery in Pakistan. Salamandra 49:229–233.
Mebert K, Masroor R, Chaudhry MJI, 2013. The dice snake Natrix
tessellata (Serpentes: Colubridae) in Pakistan: Analysis of its range
limited to few valleys in the western Karakoram. Pakistan J Zool
45:395–410.
Melville J, Hale J, Mantziou G, Ananjeva NB, Milto K et al.,
2009. Historical biogeography, phylogenetic relationships and
intraspecic diversity of agamid lizards in the Central Asian
deserts of Kazakhstan and Uzbekistan. Mol Phylogenet Evol
53:99–112.
Naidina OD, Richards K, 2020. The Akchagylian stage (late Pliocene-
early Pleistocene) in the North Caspian. Quater Internatonal
540:22–37.
Pauwels OSG, Kadeyeva M, Kovshar V, Sakharbayev A, Sarayev FA et
al., 2020. Colonization of articial islands in the Kazakh sector of
the Caspian Sea by the aquatic snake Natrix tessellata (Squamata:
Natricidae). Bull Chicago Herpetol Soc 55:133–140.
Phillips SJ, Anderson RP, Schapire RE, 2006. Maximum entropy mode-
ling of species geographic distributions. Ecol Model 190:231–259.
Phillips SJ, Dudık M, Schapire RE, 2004. A maximum entropy approach
to species distribution modelling. In: Proc of the 21st Intern Confer
on Machine Learning, New York, 4–8 July, 655–662.
Pickarski N, Kwiecien O, Langgut D, Litt T, 2015. Abrupt climate and
vegetation variability of eastern Anatolia during the last glacial.
Clim Past 11:1491–1505.
Popov SV, Shcherba IG, Ilyina LB, Nevesskaya LA, Paramonova NP
et al., 2006. Late Miocene to Pliocene palaeogeography of the
Paratethys and its relation to the Mediterranean. Palaeogeogr
Palaeoclim Palaeoecol 238:91–106.
Posada D, Crandall KA, 2001. Intraspecic gene genealogies: Trees
grafting into networks. Trends Ecol Evol 16:37–45.
Poulakakis N, Kapli P, Lymberakis P, Trichas A, Vardinoyiannis K et
al., 2015. A review of phylogeographic analyses of animal taxa
from the Aegean and surrounding regions. J Zool Syst Evol Res
53:18–32.
Préau C, Trochet A, Bertrand R, Isselin-Nondedeu F, 2018. Modeling
potential distributions of three European amphibian species com-
paring ENFA and MaxEnt. Herpetol Conserv Biol 13:91–104.
Rajabizadeh M, Javanmardi S, Rastegar-Pouyani N, Karamiani R,
Youse M et al., 2011. Geographic variation, distribution, and
habitat of Natrix tessellata in Iran. Mertensiella 18:414–429.
Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA, 2018.
Posterior summarization in Bayesian phylogenetics using Tracer
1.7. Syst Biol 67:901–904.
Rastegar-Pouyani E, Ebrahimipour F, Hosseinian S, 2017. Genetic
variability and differentiation among the populations of Dice snake
Natrix tessellata (Sepentes, Colubridae) in the Iranian Plateau.
Biochem Syst Ecol 72:23–28.
Ratnikov VY, 2009. Fossil remains of modern amphibian and reptile
species as the material for studying the history of their distribu-
tion. Proc Res Inst Geol Voronezh State Univ, Vol. 59. Voronezh:
Publishing House of Voronezh State University. 91 p. (in Russian).
Ratnikov VY, Mebert K, 2011. Fossil remains of Natrix tessellata from
the late cenozoic deposits of the East European Plain. Mertensiella
18:337–342.
Ritchie AM, Lo N, Ho SY, 2017. The impact of the tree prior on
molecular dating of data sets containing a mixture of inter-and
intraspecies sampling. Syst Biol 66:413–425.
Robin X, Turck N, Hainard A, Tiberti N, Lisacek F et al., 2011. pROC:
An open-source package for R and S+ to analyze and compare
ROC curves. BMC Bioinform 12:77.
Ronquist F, Teslenko M, Van der Mark P, Ayres DL, Darling A et al.,
2012. MrBayes 3.2: Efcient Bayesian phylogenetic inference and
model choice across a large model space. Syst Biol 61:539–542.
Rozas J, Ferrer-Mata A, Sánchez-DelBarrio JC, Guirao-Rico S, Librado
P et al., 2017. DnaSP 6: DNA sequence polymorphism analysis of
large datasets. Mol Biol Evol 34:3299–3302.
Sindaco, R, Jeremcenko VK, 2008. The Reptiles of the Western
Palearctic. 1. Annotated Checklist and Distributional Atlas of the
Turtles, Crocodiles, Amphisbaenians and Lizards of Europe, North
Africa, Middle East and Central Asia. Latina: Edizioni Belvedere.
Sindaco R, Venchi A, Grieco C, 2013. The Reptiles of the Western
Palearctic 2. Annotated checklist and distributional atlas of the
snakes of Europe, North Africa, the Middle East and Central
Asia, with an update to the vol. 1. Latina: Edizioni Belvedere, Soc
Herpetol Italica, Via Adige.

162 Current Zoology 2024, Vol. 70, No. 2
Šmíd J, Aghová T, Velenská D, Moravec J, Balej P et al., 2021.
Quaternary range dynamics and taxonomy of the Mediterranean
collared dwarf racer Platyceps collaris (Squamata: Colubridae).
Zool J Linn Soc 193:655–672.
Solovyeva EN, Lebedev VS, Dunayev EA, Nazarov RA, Bannikova
AA et al., 2018. Cenozoic aridization in Central Eurasia shaped
diversication of toad-headed agamas (Phrynocephalus; Agamidae,
Reptilia). PeerJ 6:e4543.
Stamatakis A, 2014. RAxML version 8: A tool for phylogenetic
analysis and post-analysis of large phylogenies. Bioinformatics
30:1312–1313.
Stratakis M, Koutmanis I, Ilgaz C, Jablonski D, Kukushkin OV et al., 2022.
Evolutionary divergence of the smooth snake (Serpentes, Colubridae):
The role of the Balkans and Anatolia. Zool Scripta 51:310–329.
Svitoch AA, 2013. The Pleistocene Manych straits: their structure, evo-
lution and role in the Ponto-Caspian basin development. Quater
International 302:101e109.
Tuniyev BS, 1995. On the Mediterranean inuence on the formation of
herpetofauna of the Caucasian Isthmus and its main xerophylous
refugia. Russ J Herpetol 2:95–119.
Tuniyev B, Tuniyev S, Kirschey T, Mebert K, 2011. Notes on the dice
snake Natrix tessellata from the Caucasian Isthmus. Mertensiella
18:343–356.
Van Baak CGC, Krijgsman W, Magyar I, Sztanó O, Golovina LA et al.,
2017. Paratethys response to the Messinian salinity crisis. Earth-Sci
Rev 172:193–223.
Wegwerth A, GanopolskiBard E, Lamy F, Arz HWA, Ménot G et al.,
2015. Black Sea temperature response to glacial millennial-scale
climate variability. Geophys Res Lett 42:8147–8154.
Xie W, Lewis PO, Fan Y, Kuo L, Chen M-H, 2011. Improving marginal
likelihood estimation for Bayesian phylogenetic model selection.
Syst Biol 60:150–160.
Yakovleva ID, 1964. Reptiles of Kirgizia. Frunze: Ilim (in Russian).
Yakovleva TI, Bakiev AG, 2010. Changes in the fauna and range
boundaries of snakes in the Volga basin in the Late Cenozoic.
In: Rozenberg GS, Saksonov SV, editors. Theoretical Problems
of Ecology and Evolution. Theory of Home Ranges: Species,
Communities, Ecosystems (5th Lyubishchev readings). Togliatti:
Cassandra, 221–231 (in Russian).
Zhang YJ, Stöck M, Zhang P, Wang XL, Zhou H et al., 2008.
Phylogeography of a widespread terrestrial vertebrate in a
barely studied Palearctic region: Green toads (Bufo viridis sub-
group) indicate glacial refugia in Eastern Central Asia. Genetica
134:353–365.
Zhou L, Liang T, Shi L, 2019. Amphibian and reptilian chorotypes in
the arid land of Central Asia and their determinants. Sci Reports
9:9453.
Zinenko O, Stümpel N, Mazanaeva L, Bakiev A, Shiryaev K et al.,
2015. Mitochondrial phylogeny shows multiple independent eco-
logical transition and northern dispersion despite of Pleistocene
glaciations in meadow and steppe vipers (Vipera ursinii and Vipera
renardi). Mol Phylogenet Evol 84:85–100.