ArticlePDF Available

Phylogeography of Helleria brevicornisEbner 1868 (Crustacea, Oniscidea): Old and recent differentiations of an ancient lineage

Authors:

Abstract and Figures

Helleria brevicornis has a disjunct, peri-Tyrrhenian distribution that mirrors that of several organisms, for which geographic vicariance is invoked, due to the geological events started with the Oligocene split of the Sardo-Corsican microplate from the Pyrenees, and successive separation between Sardinia and Corsica. Molecular phylogenetic analyses demonstrated that such a biogeographic model does not apply to Helleria. The original split of the Sardinian and Corsican lineages originated in the Early Pliocene. Further diversification occurred later. The colonization of the Tuscan archipelago, French, and Italian mainland occurred most recently, but a possible time dependency bias suggests that such colonization was driven by human-transport.
Content may be subject to copyright.
Short Communication
Phylogeography of Helleria brevicornis Ebner 1868 (Crustacea, Oniscidea): Old
and recent differentiations of an ancient lineage
Gabriele Gentile
a,§,*
, Alessandro Campanaro
b,c,§
, Monica Carosi
a
, Valerio Sbordoni
a
, Roberto Argano
b
a
Department of Biology, University ‘‘Tor Vergata, Via della Ricerca Scientifica, 1, 00133 Rome, Italy
b
Department of Animal and Human Biology, University ‘‘La Sapienza, Viale dell’Università, 32, 00185 Rome, Italy
c
Centro Nazionale per lo Studio e la Conservazione della Biodiversità Forestale ‘‘Bosco FontanaCorpo Forestale dello Stato, Via Carlo Ederle 16/a, I-37100 Verona, Italy
article info
Article history:
Received 30 March 2009
Revised 21 September 2009
Accepted 5 October 2009
Available online 21 October 2009
Keywords:
Isopoda
Paleogeography
Molecular phylogeny
Coalescence
Time dependency
abstract
Helleria brevicornis has a disjunct, peri-Tyrrhenian distribution that mirrors that of several organisms, for
which geographic vicariance is invoked, due to the geological events started with the Oligocene split of
the Sardo-Corsican microplate from the Pyrenees, and successive separation between Sardinia and Cor-
sica. Molecular phylogenetic analyses demonstrated that such a biogeographic model does not apply
to Helleria. The original split of the Sardinian and Corsican lineages originated in the Early Pliocene. Fur-
ther diversification occurred later. The colonization of the Tuscan archipelago, French, and Italian main-
land occurred most recently, but a possible time dependency bias suggests that such colonization was
driven by human-transport.
Ó2009 Elsevier Inc. All rights reserved.
1. Introduction
Oniscidea is certainly the largest group of Crustaceans that
mostlysucceededincolonizingterrestrialenvironmentsand,among
Oniscidea, Helleria brevicornis is one of the most intriguing species.
Its origin and phylogenetic relationship have been debated for long
time, as many morphological characters separate H. brevicornis from
the rest of Oniscidea. For such features, this species has been consid-
ered the remnant of a branch that diverged early from the lineage
that led to other Oniscidea (see literature in Vandel, 1960).
Current systematics reflects such a hypothesis. H. brevicornis is
the only recognized species of the genus. So far, Helleria and Tylos
(which comprises several species) are the only two genera included
in the family Tylidae, although in two separate subfamilies (Vandel,
1960). In the case of Helleria, mitochondrial DNA provided evidence
for an early divergence from the rest of Oniscidea and suggested a
distinctive pattern of molecular evolution, as indicated by an extre-
mely high adenine–thymine (AT) richness (Michel-Salzat and Bou-
chon, 2000). However, those data did not resolve the phylogenetic
relationships of this genus, which still remain to be investigated.
Helleria lives in the litter and humus horizons of soil, in forests
from the sea level up to 1200 m (Vandel, 1960). This taxon is ende-
mic to the North Tyrrhenian area. In fact, its geographic distribution
is limited to spotted locations in Sardinia, Corsica, continental France
(Esterel), a few islands of the Tuscan archipelago, and continental
Italy (Massoncello, Tuscany), as indicated in Fig. 1. Such a disjunct
peri-Tyrrhenian distribution, which mirrors that of several organ-
isms, as for example earthworms (Omodeo and Rota, 2008), insects
(Caccone and Sbordoni, 2001), salamanders (Caccone et al., 1997),
is generally explained in terms of geographic vicariance. Often,
vicariance is interpreted as due to the geological events started with
the Oligocene split of the Sardo-Corsican microplate from the
Pyrenees, followed by the separation between Sardina and Corsica
(Caccone et al., 1997; Caccone and Sbordoni, 2001; Grill et al.,
2007). Paleomagnetic and tectono-sedimentary data suggest that,
between 33 Million years ago (Ma) and 21–20.5 Ma, Sardinia–
Corsica microplate rotated 35–30°clockwise, with a successive
counterclockwise rotation, terminated about 17.5–18 Ma (Edel
et al., 2001). The microplate may have started breaking into Sardinia
and Corsica (Boccaletti et al., 1990), which separated completely
about 9 Ma (Alvarez, 1972; Bellon et al., 1977; Bonin et al., 1979).
Such a biogeographic model of evolution implies that the iso-
lated populations may undergo independent evolution which
may ultimately lead to speciation, generating closely related but
distinct species without sympatric occurrence. Phylogenetic rela-
tionships between these species should reflect the temporal conse-
cution of geological events.
Although the old origin of the Helleria lineage and its present
distribution could potentially fit the vicariance model, the phyloge-
ography of this species has never been studied and the predictions
of the model have not been tested, yet.
1055-7903/$ - see front matter Ó2009 Elsevier Inc. All rights reserved.
doi:10.1016/j.ympev.2009.10.005
§
These authors equally contributed to the work
*Corresponding author. Fax: +39 06 72595965.
E-mail address: gabriele.gentile@uniroma2.it (G. Gentile).
Molecular Phylogenetics and Evolution 54 (2010) 640–646
Contents lists available at ScienceDirect
Molecular Phylogenetics and Evolution
journal homepage: www.elsevier.com/locate/ympev
Here we use mtDNA sequence data to investigate the phyloge-
ographic relationships between multiple populations from the en-
tire area of distribution of H. brevicornis. We combined classical
phylogenetic and network analyses with a coalescence approach
to elucidate times and modes of evolution and to test the predic-
tions of the vicariance model.
2. Methods
2.1. Sampling
The 54 individuals of H. brevicornis used in this study were col-
lected from 21 localities, representing the entire area of distribu-
tion of the species. Sampling locations and the number of
individuals investigated are reported in Fig. 1. Two individuals
belonging to Tylos europaeus were also collected from the seashore
near Brindisi (Apulia).
2.2. DNA extraction, PCR amplification and sequencing
Whole DNA was extracted from 2–4 legs using C-Tab protocol
(Doyle and Doyle, 1987).
Fragments of the Cytochrome Oxydase I gene (COI), the large
ribosomal subunit (16S) and the small ribosomal subunit (12S) of
mtDNA were PCR amplified. PCR amplifications were performed
in a volume of 50
l
L containing 1X Reaction buffer, 5 mM MgCl
2
,
0,2 mM dNTP, 0.5
l
M each primer, 1, 5 units EuroTaq (Euroclone,
UK). The following specific primer pairs were designed and used
for both PCR amplifying and sequencing fragments of COI, 12S,
and 16S, respectively: (i) heCOIfor TCCTTTAGCTTCAAATATTGC,
heCOIrev CATAATGGAAATGAGCTACAAC; (ii) 12S aih1 GGATTAGAT
ACCCTACTATTTATAAAC, 12S bih1 GACGGGCGATGTGTACTTATTC;
(iii) 16S tyhefor ATATTGACTGTGCTAAGGTAGC, 16S tyherev CT
TAATCCAACATCGAGGTC. These primers were successfully used
for H. brevicornis and T. europaeus. PCR conditions were: 2 min at
94 °C followed by 35 cycles of 30 s at 94 °C, 45 s at 46 °C, 1 min
at 72 °C and a final elongation of 5 min at 72 °C. PCR products were
purified by using ExoSap-IT (USB). Sequences were run on ABI
PRISM 3100 sequencer and edited with SEQUENCHER 4.1.2 (Gene
Codes). The alignment obtained by using CLUSTAL X (Thompson
et al., 1997) was checked by eye. The final dataset consisted in
631 bp of COI, 365 bp of 12S, and 331 bp of 16S. GenBank accession
numbers for the sequences generated and used in this study are
GU097457–GU097510 for the 12S, GU097511–GU097564 for
16S, and GU097565–GU097618 for COI of H. brevicornis. Accession
numbers are GU097623–GU097626 for 12S, GU097627–GU097630
for 16S, and GU097619–GU097622 for COI of T. europaeus.
As it has been shown that the occurrence of Wolbachia may alter
the levels and patterns of mtDNA diversity, leading to biased infer-
ence of organisms’ evolutionary history (Hurst and Higgins, 2005),
we used the primer pair wsp81F and wsp691R (Zhou et al., 1998)
to test for the occurrence of Wolbachia in our samples.
2.3. Phylogenetic analyses
Phylogeny inference was performed using the three datasets
both separately and combined. We tested for phylogenetic incon-
gruence of different datasets by performing the incongruence
length difference test (ILD; Farris et al., 1994), after removing the
invariant characters (Cunningham, 1997). Analyses were con-
ducted using maximum parsimony (MP; Farris, 1970), maximum
likelihood (ML; Felsenstein, 1981), and Bayesian inference (Bayes,
1763), as implemented in PAUP* 4.0b10 (Swofford, 2002), TREE-
FINDER 2008 (Jobb, 2008) and MRBAYES 3.1.2 (Ronquist and Huel-
senbeck, 2003), respectively. PAUP* 4.0b10 was also used to
estimate uncorrected p-distances. MP heuristic parameters were
as follows: starting trees obtained by random-addition (10 repli-
cates) and TBR branch swapping. Gaps in the 12S were single-base
deletions and were coded as fifth character state.
ML trees were sought via a genetic algorithm, less prone to get
trapped in local optima (Jobb, 2004). Different models were used
for the COI, 12S, and the 16S data. MODELTEST 3.7 (Posada and
Crandall, 1998) and the corrected Akaike information criterion
(AICc; Hurvich and Tsai, 1989) was used to select the HKY85 + I
for the 12S (Ti/Tv rate = 19.6907; I= 0.8612) and 16S (Ti/Tv
rate =9.5184; I= 0.8791) genes. The GTR +
C
Imodel was chosen
by the ‘‘model proposer” in TREEFINDER and was used for the
COI, with all parameters estimated separately for first, second,
and third positions. The same models were used in the Bayesian
analysis. Gaps were recoded as binary data and considered as a
separate partition to which a binary (restriction) model of evolu-
tion was applied as implemented in MRBAYES. For each partition,
parameters’ values were estimated during the search. First, second
and third positions of the COI were treated as separate partitions.
For MP and ML, nodal support was tested by bootstrapping (Fel-
senstein, 1985), with 1000 pseudoreplicates. T. europaeus was used
as outgroup within the family Tylidae.
Average genetic distances were calculated between populations
within and between each group resulting from the phylogenetic
analysis. They were estimated starting from pairwise tip-to-tip dis-
tances along the ML tree.
Network analysis was performed using the TCS software (Clem-
ent et al., 2000), which implements the method of statistical parsi-
mony developed by Templeton (Templeton et al., 1992). This
method is not constrained by many of the assumptions of phyloge-
netic reconstruction techniques as it does not assume that the
ancestral sequence is missing and does not require bifurcating
relationships. Since this method performs poorly in case of phylog-
Fig. 1. Sampling localities. For Corsica, gray area is South Corsica and white area is
Upper Corsica. Numbers within square brackets indicate individuals used for COI,
12S, and 16S analyses, respectively. (1) Esterel: rue du Pic del’Ours [2, 4, 3]. (2)
Esterel: carfour de la Colle Douce [2, 4, 4]. (3) Capraia: port [4, 4, 4]. (4) Masson-
cello: Populonia [4, 4, 4]. (5) Elba: Portoferraio [3, 3, 3]. (6) Pianosa [1, 3, 3]. (7) Col
de Saint Nicolas [4, 4, 4]. (8) Marinca [3, 1, 2]. (9) Crosciano [3, 2, 1]. (10) Aregno
[2, 2, 2]. (11) Murato [2, 0,1]. (12) Castirla [4, 4, 4]. (13) Vizzavona: Plateau Monte
d’Oro [7, 5, 8]. (14) Bocognano [1, 1, 1]. (15) Tolla [2, 2, 2]. (16) Col de Bavella
[4, 4, 4]. (17) Casalabriva [7, 5, 5]. (18) Foret de l’Ospedale [4, 2, 4]. (19) Ierzu
[3, 3, 3]. (20) Fluminimaggiore [2, 4, 4]. (21) Burcei [4, 4, 4].
G. Gentile et al. / Molecular Phylogenetics and Evolution 54 (2010) 640–646 641
enies with long branches, it is particularly suitable only for popu-
lation level analysis.
Based on results of phylogenetic analyses, we investigated the
hypothesis of molecular clock for the COI gene by applying the
‘‘global molecular clock test — all roots”, as implemented in
HY-PHY (ver.0.99 beta, Pond et al., 2005). We used the same set-
tings as for the ML phylogenetic analysis. The test was run start-
ing from a ML unrooted tree with six terminal nodes obtained
by eliminating poorly diverging sequences (less than 1%). The
test performed the likelihood ratio test of the null hypothesis
of global molecular clock, versus the alternative hypothesis of
no molecular clock, on every possible rooted version of the tree
(i.e. 2N3, for a binary unrooted, where Nis the number of
sequences).
We applied coalescence to estimate divergence times for the
monophyletic clades found by the phylogenetic analyses. We used
the BEAST package v1.4.7 to run an analysis for 20 million steps of
the MCMC, using the GTR +
C
Imodel partitioned by codon posi-
tion, under the assumption of strict clock (Drummond et al.,
2006). Convergence was assessed with ESS (effective sample size)
values, after a burning of 5 million steps. As no obvious calibration
point is available for Helleria, we used, as a fix mean substitution
rate, the rate estimated by Ketmaier and collaborators (2003) for
the COI gene in Crustacea Isopoda Asellota. We used the ‘‘constant
size” option, as a parametric demographic function of population
size. This choice was suggested by the statistics D(Tajima, 1989)
and F
S
(Fu, 1997) which, under neutrality, can identify the effects
of demographic changes, with demographic expansions being re-
flected in large negative values. Dand F
S
were estimated for the
monophyletic clades, identified by the phylogenetic and network
analyses, for which it was reasonable to hypothesize a population
expansion. Dand F
S
statistics were calculated by using DNASP
v4.50.3 (Rozas et al., 2003).
3. Results
The PCR amplification of Wolbachia genes was unsuccessful in
all our samples.
Combined (P
ILD test
> 0.99) and separate phylogenetic analyses
of the 12S, 16S, and COI datasets as well as different methods
of inference all produced very similar results. However, indepen-
dent of the approach used, the disproportionate AT richness and
multiple substitutions, typical of Helleria, impeded the correct
rooting of the Helleria tree, when Tylos was used as outgroup. In
fact, the root of the Helleria tree, as suggested by Tylos appeared
inconsistent (Fig. 2). Despite we could not use an outgroup to root
our trees, all phylogenetic analyses indicated four homogeneous
clusters: A, B, C, and D. Clusters A and B included only popula-
tions from Sardinia, whereas clusters C and D comprised the
remaining populations. Average ML genetic distances within clus-
ters A, B, C, and D were: 0.0150 ± 0.0124 (standard deviation);
0.0285 ± 0.0004; 0.0045 ± 0.0081; and 0.0042 ± 0.0051, respec-
tively. Average ML genetic distances between clusters were all
very high, ranging between 0.0719 ± 0.0024 (B vs. C) and
0.0949 ± 0.0035 (A vs. D). A complete synopsis of ML and p-dis-
tances between groups, as resulting from the phylogenetic analy-
sis, is shown in Table 1.
As expected, the molecular clock hypothesis was rejected when
reduced trees were rooted at terminal nodes (Pranging from
0.0003 to 0.0273, with only one exception: P= 0.2389). However,
the hypothesis could not be rejected when rooting at internal
nodes (Pranging from 0.2750 to 0.4561). Thus, rooting the Helleria
tree at the midpoint seemed reasonable. When the root was placed
at the midpoint Sardinian and Corsican populations formed two
separate and monophyletic clades (Figs. 2 and 4a).
The network analysis indicated the genealogical relationships
between the 25 haplotypes found (Fig. 3). They were distributed
Fig. 2. Phylogenetic tree based on maximum likelihood. The tree was rooted at the midpoint, after testing for the hypothesis of global clock. The black arrow indicates the
position of the root. The white arrow indicates the position of the root when Tylos was used as outgroup. Such a rooting is a statistical artifact. Robustness of nodes is reported
for MP, ML, and Bayesian analyses, respectively.
642 G. Gentile et al. / Molecular Phylogenetics and Evolution 54 (2010) 640–646
in six haplogroups, when the statistical significance level was set at
0.95%. Eight haplotypes exclusive of Sardinia were distributed in
haplogroups 1, 2, (which together corresponded to cluster A of
phylogenetic analyses) and 3 (cluster B). Eight haplotypes from
Upper Corsica, continental France, Tuscan islands, and continental
Italy were distributed in haplogroups 4 and 5 (together corre-
sponding to cluster D), whereas haplogroup 6 (cluster C) com-
prised nine haplotypes occurring in an area mostly
corresponding to South Corsica (only haplotypes 5 and 6 were
found in Upper Corsica). Haplogroups 1 and 2 were linked by a
27-step long path, whereas 25 steps separated haplogroups 4 and
5. However, these connections were not statistically supported.
Despite the star-like shape of haplogroups 5 and 6 could suggest
a recent expansion, both D and F
S
estimates were not statistically
significant (P0.05).
Results of the BEAST analysis are summarized in Fig. 4. For each
monophyletic clade, the posterior probability distributions of
divergence time were bell-shaped, with minor, negligible skew-
ness occurring in a few cases (Fig. 4a). The means of such distribu-
tions indicate that three separate periods of diversification may be
identified, along the Helleria lineage. Such periods are better illus-
trated in Fig. 4b. Although with large interval of confidence, three
events appear to have occurred in the first period, between 4 and
5 Ma. The split of the basal lineages (Sardinia and Corsica) dates
back to about 4.8 Ma. Perhaps 700–800 thousand years later, two
major lineages in Sardinia and two in Corsica have originated
almost contemporarily, leading to the clades A, B and C, D, respec-
tively. A second period of differentiation occurred between 1 and
1.5 Ma, within clades A, C, and D. A third, more recent, period
would set the timing of the diversification within clades C and D
(haplogroups 6, and [4 + 5], respectively) between 200 and 450
thousand years ago (Ka).
4. Discussion
The PCR survey failed to detect the occurrence of Wolbachia in
our samples. However, this can not permit to completely exclude
the presence of Wolbachia in Helleria, as our sample is limited
and different populations of arthropods may show different levels
of infection (Hurst and Jiggins, 2005).
Our results confirm the distinctiveness of Helleria, which per-
haps could be assigned to a separate family. Clearly, these data
unambiguously falsify the hypothesis that current distribution of
Helleria may be explained by vicariance related to the Oligocene–
Miocene dynamics. Most likely, the basal split between Corsican
and Sardinia lineages occurred in the Early Pliocene. It was a con-
sequence of insularity conditions, restored after the Mediterranean
was re-flooded at the end of the Messinian crisis of salinity
(5.33 Ma; Popov et al., 2006). In fact, according to the double-phase
model of the Messinian crisis (Clauzon et al., 2001), the Mediterra-
nean sea level lowered initially by less than 100 m during a first
phase (5.8 Ma) that affected only the Mediterranean basin margins.
A flooding event followed. In a second phase (5.6 Ma) a drastic
Table 1
ML and uncorrected p-distances between groups, as resulting from the phylogenetic
analysis.
ML distance Uncorrected p-distance
Average SD Average SD
12S + 16S + COI
Cvs. D 0.0802 0.0019 0.0496 0.0020
(A + B) vs. (C + D) 0.0842 0.0094 0.0498 0.0038
Avs. B 0.0721 0.0030 0.0458 0.0009
Avs. D 0.0949 0.0035 0.0545 0.0012
Bvs. D 0.0782 0.0019 0.0486 0.0012
Avs. C 0.0885 0.0038 0.0508 0.0014
Bvs. C 0.0719 0.0024 0.0443 0.0006
COI
Cvs. D 0.0983 0.0060 0.0607 0.0037
(A + B) vs. (C + D) 0.1202 0.0151 0.0685 0.0067
Avs. B 0.1199 0.0021 0.0695 0.0012
Avs. D 0.1319 0.0025 0.0732 0.0047
Bvs. D 0.1029 0.0017 0.0685 0.0028
Avs. C 0.1343 0.0061 0.0719 0.0043
Bvs. C 0.1053 0.0058 0.0586 0.0015
12S
Cvs. D 0.0502 0.0040 0.0369 0.0025
(A + B) vs. (C + D) 0.0415 0.0080 0.0306 0.0046
Avs. B 0.0362 0.0050 0.0256 0.0031
Avs. D 0.0403 0.0049 0.0325 0.0028
Bvs. D 0.0298 0.0028 0.0254 0.0028
Avs. C 0.0467 0.0050 0.0291 0.0030
Bvs. C 0.0474 0.0030 0.0351 0.0035
16S
Cvs. D 0.0663 0.0026 0.0427 0.0024
(A + B) vs. (C + D) 0.0586 0.0114 0.0354 0.0060
Avs. B 0.0312 0.0009 0.0230 0.0015
Avs. D 0.0738 0.0021 0.0430 0.0023
Bvs. D 0.0593 0.0019 0.0360 0.0009
Avs. C 0.0567 0.0020 0.0343 0.0024
Bvs. C 0.0421 0.0018 0.0271 0.0019
Fig. 3. Statistical parsimony network. The genealogical relationships between the
25 mtDNA haplotypes (12S + 16S + COI) are shown. Six groups of haplotypes are
identified at the 95% significance level groups 1, 2, and 3 include haplotypes from
Sardinia. Haplogroups 4 and 6 comprise only haplotypes found in Corsica. Group 5
includes haplotypes occurring in Upper Corsica, continental France, some Tuscan
islands, and continental Italy.
G. Gentile et al. / Molecular Phylogenetics and Evolution 54 (2010) 640–646 643
drop in sea level occurred, that exceeded 1500 m and affected the
whole basin. After the crisis, Corsica and Sardinia joined again dur-
ing the Pliocene (Meulenkamp and Sissingh, 2003). Connections
occurred also in the Pleistocene and are reflected in the vertebrate
fauna, which suggests a flow, from Italian mainland to Sardina, via
Corsica, ended in the Middle-Pleistocene (Masini et al., 2002). Our
data, however, do not provide evidence that Helleria might have
dispersed along that route.
Events of differentiation occurred between 1 and 1.5 Ma could
be a reflection of the climatic changes that occurred in the Mediter-
ranean at the end of the Pliocene through the Early Pleistocene. In
fact, Mediterranean-type climate, with a marked seasonality, con-
solidated in the Mediterranean region about 3.2–3.6 Ma (Suc,
1984; Tzedakis, 2007), although it might have intermittingly ap-
peared in the Tertiary. Such a climate was characterized by a per-
iod of obliquity-dominated cycles of glaciations (2.8–1 Ma), which
determined marked environmental transformations and ecological
successions in the Mediterranean area (Tzedakis, 2007). Pliocene
and Pleistocene climatic events might have maintained the two
lineages, leading to the separated haplogroups [4 + 5] and 6. In fact,
during the Pleistocene, the main mountain range, crossing Corsica
from North-West to South-East, was repeatedly and extensively
covered by glaciers (Hughes et al., 2006) impeding Helleria dis-
persal. For its overall high altitude, culminating with Monte Cinto
(2710 m a.s.l.), such a barrier would be difficult to overcome even
during interglacial periods (haplotypes 5 and 6 indicate a recent
crossing).
The interpretation of the latest events requires caution. On one
hand, our data would indicate that climatic changes of the Pleisto-
cene, as documented by isotopic (Deuterium concentration) data
(EPICA, 2004) in the marine isotope stage (MIS) 12 and between
MIS 6–10 (formerly recognized as alpine Riss and Mindel glacia-
tions; Fig. 4b) could have driven the diversification within haplo-
groups 5 and 6. According to this model, marine regressions,
associated with glacial maxima (Kukla, 2005), should have pro-
vided facilitated conditions for dispersal to continental France (Est-
erel) and for the colonization of some of the islands of the Tuscan
archipelago, some of which were joint by land bridges and con-
nected with the Italian mainland. Both phylogenetic and network
analyses indicate that such colonization might have started from
Corsican Cape, in the North-East region of Upper Corsica. Some
support to this scenario, that implies recent colonization and dif-
ferentiation, would also be provided by a few haplotypes (10, 13,
14 and 15) with narrow distribution. However, we must remark
Fig. 4. (a) Coalescence tree, based on COI sequence data, scaled along the time axis. At each node, 95% High Posterior Density intervals and TMRCA (Time to Most Recent
Common Ancestor) posterior probability densities are also shown. Colors indicate the same clades as in Fig. 2. (b) Sea level variation (meters), stratigraphy (in terms of Marine
Isotopic Stages, MIS), and DeltaD/permil concentration (EPICA, 2004), over the last 0.5 Ma. Sea level variations and stratigraphy are redrawn after Kukla (2005).
644 G. Gentile et al. / Molecular Phylogenetics and Evolution 54 (2010) 640–646
that these haplotypes are only one-two steps different from the
most widely distributed haplotype 11. Additionally, their narrow
distribution might be an effect of limited sampling.
Although similar processes of dispersal have been invoked to
explain patterns of distribution and genetic variation in several
organisms during the Late Pleistocene (Dapporto et al., 2007;
Fattorini, 2009), the case of Helleria remains controversial. In fact,
the direct colonization of continental France via a hypothetical
Pleistocene land bridge is not supported by any palinspastic recon-
struction, or by vertebrate fossil records.
While we believe that our data certainly demonstrate that the
colonization of the Tuscan archipelago, Italian and French main-
land occurred recently, we suspect that our time estimate for such
event might suffer from a ‘‘time-dependency” bias, as recently de-
scribed by Ho et al. (2005). They provided evidence of a relation-
ship between the rate of molecular evolution and the age of
calibration that can be described by vertically translated exponen-
tial decay curves. Such curves identify measurable transitions be-
tween short- and long-term substitution rate, around 1–2 Ma.
Thus, as the substitution rate that we used was obtained by setting
two calibration points at 29 and 9 Ma (Ketmaier et al., 2003), our
estimates of the time for the most recent events of divergence
could be severely overestimated. Recently, experimental evidence
showed that the use of rates extrapolated from deep phylogenies
may lead to overestimation in molecularly-based timing of Pleisto-
cene events (Saarma et al., 2007; Gratton et al., 2008). Indirect evi-
dence of this bias is provided here by some discrepancies between
time estimates and the paleogeographic implications of the model.
As the Pleistocene bathymetry of the Mediterranean was similar to
that of today, variations in sea levels were produced by the glacio-
eustatic processes of the World Ocean (Emig and Geistdoerfer,
2004). In fact, during the entire Pleistocene, drops in the sea levels
were cyclically interspersed by rises. Pronounced increases (about
20 m a.s.l.) occurred three times, in the last 450,000 years (Kukla,
2005; see Fig. 4b), enough to submerge Pianosa island, where Hel-
leria occurs at present.
A further complication, not easy to reconcile with the hypothe-
sis of a glacial colonization, arises from the current distribution of
Helleria. In fact, if Helleria was able to expand its area during a gla-
cial marine regression, it is very difficult to explain why the occur-
rence of Helleria in continental France and Italy remained restrict
to point locations, although the Holocene reforestation (Tinner
and Kaltenrieder, 2005) formed suitable habitats along all Italian
peninsula and in large part of continental France.
Based on the previous considerations we suggest, as a possible
working hypothesis, an alternative scenario that implies historic
human-mediated transportation to explain the presence of Helleria
in the French and Italian mainland and in the Tuscan archipelago.
In fact, during the VI and V century B.C. a documented increase in
commercial trades occurred between Corsica, Tuscany (including
islands), and southern France (where the Greek colony Massalía,
the modern Marseille, was expanding). In this period, Etruscans ex-
panded and intensified their marine commercial trades to the
northern Tyrrhenian area of the Mediterranean Sea. This was a
consequence of (i) the substantial control of Corsica, gained after
winning, in alliance with Carthago, the battle at Alalíe (the modern
Aleria, Corsica) against the Greeks Phocei (540–535 B.C.); (ii) the
dramatic naval debacle at Cuma (near Naples, southern Italy; 474
B.C.) against the Greek colony Syracuse, which terminated the
expansion of the Etruscan political influence (and piracy) in the
southern Italy. In this period, Corsica island was for Etruscans a pri-
mary source of timber, very expensive at those times yet funda-
mental for urban and architectonic use, naval purposes and as
combustible to operate metal melting furnaces (Gras, 1985).
In conclusion, the current distribution of this species in not due
to Oligocene–Miocene paleogeographic events, but rather to more
recent processes of diversification datable, at the latest, to Early
Pliocene. Thus, the causes that determined the occurrence of Helle-
ria in Corsica and Sardinia remain obscure and, most likely, will
never be uncovered. The colonization of the French and Italian
mainland and of the Tuscan archipelago occurred very recently,
but it is still unclear if such colonization was driven primarily by
climatic changes of the Late Pleistocene or by human-transport
in historic times.
Acknowledgments
We are grateful to A. Caccone for her support in this research
and to T. Kotsakis for providing valuable and illuminating advice
in discussing Pleistocene scenarios. We also thank G. Cifani for dis-
cussing Etruscan commercial routes and I.M. Grimaldi for critically
reviewing Helleria literature. Thanks to M. Oliverio for reading an
early version of this paper. We wish to thank an anonymous re-
viewer for suggesting to investigate the occurrence of Wolbachia
and its possible effect on our phylogeographic analysis.
This work was supported by a post-doc fellowship from the
University ‘‘La Sapienza” (1997) to G. Gentile, the grant MIUR
2005 (Calibrating molecular clocks by means of vicariant specia-
tion events and paleogeographical dating) to V. Sbordoni, and the
Faculty grant 2005 (University ‘‘La Sapienza”) to R. Argano.
References
Alvarez, W., 1972. Rotation of the Corsica–Sardinia microplate. Nature 235, 103–
105.
Bayes, T., 1763. Studies in the history of probability and statistics: IX. Thomas
Bayes’s essay towards solving a problem in the doctrine of chances. Biometrika
45, 296–315.
Bellon, H., Coulon, C., Edel, J.B., 1977. Le deplacement de la Sardigne: synthese des
donnees geochronologiques, magmatiques et paleomagnetiques. Bull. Soc. Geol.
France 7, 825–831.
Boccaletti, M., Ciaranfi, N., Cosentino, D., et al., 1990. Palinspastic restoration and
paleogeographic reconstruction of the peri-Tyrrhenian area during the
Neogene. Palaeogeogr. Palaeocl. 77, 41–50.
Bonin, B., Chotin, P., Giret, A., Orsini, J.B., 1979. Etude du bloc corsosarde sur
documents satellites: le probleme des mouvements differentiels entre les deux
iles. Rev. Geogr. Phys. Geol. Dynam. 21, 147–154.
Caccone, A., Milinkovitch, M., Sbordoni, V., Powell, J.R., 1997. Phylogeny,
biogeography, and molecular rates in European newts (genera Euproctus and
Triturus), inferred from mitochondrial DNA sequences. Syst. Biol. 46, 126–144.
Caccone, A., Sbordoni, V., 2001. Molecular biogeography, evolutionary rates, and
morphological adaptation to cave life: a case study using Bathysciine beetles
and sequence data from the mitochondrial COI gene. Evolution 55, 122–130.
Clauzon, G., Rubino, J.L., Casero, P., 2001. Regional modalities of the Messinian
salinity crisis in the framework of a two phases model. Late Miocene to Early
Pliocene environments and ecosystems. In: 2nd EEDEN Workshop. Sabadell,
Spain, pp. 17–18.
Clement, M., Posada, D., Crandall, K.A., 2000. TCS: a computer program to estimate
gene genealogies. Mol. Ecol. 9, 1657–1660.
Cunningham, C.W., 1997. Can three incongruence tests predict when data should be
combined? Mol. Biol. Evol. 14, 733–740.
Dapporto, L., Wolf, H., Strumia, F., 2007. Recent geography determines the
distribution of some flying Hymenoptera in the Tuscan Archipelago. J. Zool.
272, 37–44.
Doyle, J.J., Doyle, J.L., 1987. A rapid DNA isolation procedure for small quantities of
fresh leaf tissue. Phytochem. Bull. 19, 11–15.
Drummond, A.J., Ho, S.Y.W., Phillips, M.J., Rambaut, A., 2006. Relaxed phylogenetics
and dating with confidence. PLoS Biol. 4, e88.
Ebner, V.v., 1868. Helleria, eine neue Isopodengattung aus der Familie der
Oniscoiden. Verhandlungen der zoologischbotanischen Gesellschaft Wien 18,
95–114.
Edel, J.B., Dubois, D., Marchant, R., Hernandez, J., Cosca, M., 2001. La rotation
miocene inferieur du bloc corso-sarde; nouvelles contraintes paleomagnetiques
sur la fin du mouvement. Bull. Soc. Geol. France 172, 275–283.
Emig, C.C., Geistdoerfer, P., 2004. The Mediterranean deep-sea fauna: historical
evolution, bathymetric variations and geographical changes. Carnets de
Géologie/Notebooks on Geology, Article 2004/01 (CG2004_A01_CCE-PG).
EPICA community members, 2004. Eight glacial cycles from an Antarctic ice core.
Nature 429, 623–628.
Farris, J.S., 1970. Methods for computing Wagner trees. Syst. Zool. 18, 374–385.
Farris, J.S., Kallersjo, M., Kluge, A.G., Bult, C., 1994. Testing significance of
incongruence. Cladistics 10, 315–319.
Fattorini, S., 2009. Both Recent and Pleistocene geography determine animal
distributional patterns in the Tuscan Archipelago. J. Zool., 1–11.
G. Gentile et al. / Molecular Phylogenetics and Evolution 54 (2010) 640–646 645
Felsenstein, J., 1981. Evolutionary trees from DNA sequences: a maximum
likelihood approach. J. Mol. Evol. 17, 368–376.
Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the
bootstrap. Evolution 39, 783–791.
Fu, Y.X., 1997. Statistical tests of neutrality of mutations against population growth,
hitchhiking and background selection. Genetics 147, 915–925.
Gras, M., 1985. Trafics tyrrhéniens archaïques, Bibliothèque des Écoles francaises
d’Athènes et Rome, Rome.
Gratton, P., Konopinski, M.K., Sbordoni, V., 2008. Pleistocene evolutionary history of
the Clouded Apollo (Parnassius mnemosyne): genetic signatures of climate
cycles and a ‘time-dependent’ mitochondrial substitution rate. Mol. Ecol. 17,
4248–4262.
Grill, A., Casula, P., Lecis, R., Menken, S., 2007. Endemism in Sardinia. In: Weiss, S.,
Ferrand, N. (Eds.), Phylogeography of Southern European Refugia. Springer,
Netherlands, pp. 273–296.
Ho, S.Y.W., Phillips, M.J., Cooper, A., Drummond, A.J., 2005. Time dependency of
molecular rate estimates and systematic overestimation of recent divergence
times. Mol. Biol. Evol. 22, 1561–1568.
Hughes, P.D., Woodward, J.C., Gibbard, P.L., 2006. Quaternary glacial history of the
Mediterranean mountains. Prog. Phys. Geogr. 30, 334–364.
Hurst, G.D.D., Jiggins, F.M., 2005. Problems with mitochondrial DNA as a marker in
population, phylogeographic and phylogenetic studies: the effects of inherited
symbionts. Proc. R. Soc. B 272, 1525–1534.
Hurvich, C.M., Tsai, C.L., 1989. Regression and time series model selection in small
samples. Biometrika 76, 297–307.
Jobb, G., 2004. TREEFINDER: a powerful graphical analysis environment for
molecular phylogenetics. BMC Evol. Biol. 4 (18).
Jobb, G., 2008. TREEFINDER version of April 2008. Munich, Germany. Distributed by
the author at: <www.treefinder.de>.
Ketmaier, V., Argano, R., Caccone, A., 2003. Phylogeography and molecular rates of
subterranean aquatic Stenasellid Isopods with a peri-Tyrrhenian distribution.
Mol. Ecol. 12, 547–555.
Kukla, G., 2005. Saalian supercycle, Mindel/Riss interglacial and Milankovitch’s
dating. Quatern. Sci. Rev. 24, 1573.
Masini, F., Bonfiglio, L., Abbazzi, L., Delfino, M., Fanfani, F., Ferretti, M., Kotsakis, T.,
Petruso, D., Marra, A.C., Torre, D., 2002. Vertebrate assemblages of the central-
western Mediterranean islands during the Pliocene and Quaternary: reflecting
on extinction events. In: Vth Deia International Conference of Prehistory —
World Island in Prehistory: 2001. British Archaeological Research Reports,
International Series No. 1095, pp. 437–444.
Meulenkamp, J.E., Sissingh, W., 2003. Tertiary palaeogeography and
tectonostratigraphy evolution of the Northern and Southern Peri-Tethys
platforms and the intermediate domains of the African-Eurasian convergent
plate boundary zone. Palaeogeogr. Palaeocl. 196, 209–228.
Michel-Salzat, A., Bouchon, D., 2000. Phylogenetic analysis of mitochondrial LSU
rRNA in oniscids. CR Acad. Sci. Ser. III Sci. 323, 827–837.
Omodeo, P., Rota, E., 2008. Earthworm diversity and land evolution in three
Mediterranean districts. Proc. Calif. Acad. Sci. 59 (Suppl. I), 65–83.
Pond, S.L.K., Frost, S.D.W., Muse, S.V., 2005. HyPhy: hypothesis testing using
phylogenies. Bioinformatics 21, 676–679.
Popov, S.V., Shcherba, I.G., Ilyina, L.B., et al., 2006. Late Miocene to Pliocene
palaeogeography of the Paratethys and its relation to the Mediterranean.
Palaeogeogr. Palaeocl. 238, 91–106.
Posada, D., Crandall, K.A., 1998. Modeltest: testing the model of DNA substitution.
Bioinformatics 14, 817–818.
Ronquist, F., Huelsenbeck, J.P., 2003. MRBAYES 3: Bayesian phylogenetic inference
under mixed models. Bioinformatics 19, 1752–1754.
Rozas, J., Sánchez-DelBarrio, J.C., Messeguer, X., Rozas, R., 2003. DnaSP, DNA
polymorphism analyses by the coalescent and other methods. Bioinformatics
19, 2496–2497.
Saarma, U., Ho, S.Y.W., Pybus, O.G., et al., 2007. Mitogenetic structure of brown
bears (Ursus arctos L.) in northeastern Europe and a new time frame for the
formation of European brown bear lineages. Mol. Ecol. 16, 401–413.
Suc, J.-P., 1984. Origin and evolution of the Mediterranean vegetation and climate in
Europe. Nature 307, 429–432.
Swofford, D.L., 2002. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other
Methods). Version 4. Sinauer Associates, Sunderland, MA.
Tajima, F., 1989. Statistical method for testing the neutral mutation hypothesis by
DNA polymorphism. Genetics 123, 585–595.
Templeton, A.R., Crandall, K.A., Sing, C.F., 1992. A cladistic analysis of phenotypic
associations with haplotypes inferred from restriction endonuclease mapping
and DNA sequence data. III. Cladogram estimation. Genetics 132, 619–633.
Thompson, J.D., Gibson, T.J., Plewniak, F., et al., 1997. The CLUSTAL_X windows
interface: flexible strategies for multiple sequence alignment aided by quality
analysis tools. Nucleic Acids Res. 25 (24), 4876–4882.
Tinner, W., Kaltenrieder, P., 2005. Rapid responses of high-mountain vegetation
to early Holocene environmental changes in the Swiss Alps. J. Ecol. 93, 936–
947.
Tzedakis, P.C., 2007. Seven ambiguities in the Mediterranean palaeoenvironmental
narrative. Quatern. Sci. Rev. 26, 2042–2066.
Vandel, A., 1960. Faune de France — Isopodes Terrestres. P. Lechevalier, Paris.
Zhou, W., Rousset, F., O’Neill, S., 1998. Phylogeny and PCR-based classification of
Wolbachia strains using wsp gene sequences. Proc. R. Soc. Lond. B 265, 509–
515.
646 G. Gentile et al. / Molecular Phylogenetics and Evolution 54 (2010) 640–646
... In the last decade, Corsican-Sardinian species have been the subject of intensive phylogeographic surveys, especially regarding amphibians and reptiles [12,13,[20][21][22][23][24][25][26][27][28][29][30][31][32][33][34], which have revealed how an essential component of the Tyrrhenian biodiversity hotspot is represented by the genetic variation held within and among populations of these endemic species. A significant realization of these studies is that the current patterns of genetic structure and diversity of these endemic species have been historically shaped by an unexpectedly diverse array of evolutionary and demographic processes acting across unrelated spatial and temporal scales [20]. ...
... Thus, these preliminary findings point to the interesting possibility that local adaptation leading to phylogeographic structure could influence both mitochondrial genes and nuclear genes functionally related to mitochondrial genes. This line of research appears particularly promising on Corsican Sardinian endemics for several reasons: (i) the well delimited and restricted spatial scale of this insular setting [19]; (ii) the availability of previous phylogeographic assessment and well known distribution of the species [12,13,[20][21][22][23][24][25][26][27][28][29][30][31][32][33][34]; (iii) the growing number of cases of deep within-islands mitochondrial divergence that has been observed in the absence of a current or historical barrier to gene flow [12,13,29]; this study]; and (iv) preliminary evidence of association of allozyme genetic variation with climatic variables [21,27]. Thus, Corsican-Sardinian endemic lizards appear a promising model for testing how and whether selection has been shaping patterns of within-species diversity in such a biodiversity hotspot. ...
Article
Full-text available
Background Mediterranean islands host a disproportionately high level of biodiversity and endemisms. Growing phylogeographic evidence on island endemics has unveiled unexpectedly complex patterns of intra-island diversification, which originated at diverse spatial and temporal scales. We investigated multilocus genetic variation of the Corsican-Sardinian endemic lizard Podarcis tiliguerta with the aim of shedding more light on the evolutionary processes underlying the origin of Mediterranean island biodiversity. Results We analysed DNA sequences of mitochondrial (12S and nd4) and nuclear (acm4 and mc1r) gene fragments in 174 individuals of P. tiliguerta from 81 localities across the full range of the species in a geographic and genealogical framework. We found surprisingly high genetic diversity both at mitochondrial and nuclear loci. Seventeen reciprocally monophyletic allopatric mitochondrial haplogroups were sharply divided into four main mitochondrial lineages (two in Corsica and two in Sardinia) of Miocene origin. In contrast, shallow divergence and shared diversity within and between islands was observed at the nuclear loci. We evaluated alternative biogeographic and evolutionary scenarios to explain such profound discordance in spatial and phylogenetic patterning between mitochondrial and nuclear genomes. While neutral models provided unparsimonious explanations for the observed pattern, the hypothesis of environmental selection driving mitochondrial divergence in the presence of nuclear gene flow is favoured. Conclusions Our study on the genetic variation of P. tiliguerta reveals surprising levels of diversity underlining a complex phylogeographic pattern with a striking example of mito-nuclear discordance. These findings have profound implications, not only for the taxonomy and conservation of P. tiliguerta. Growing evidence on deep mitochondrial breaks in absence of geographic barriers and of climatic factors associated to genetic variation of Corsican-Sardinian endemics warrants additional investigation on the potential role of environmental selection driving the evolution of diversity hotspots within Mediterranean islands.
... All these approaches, however, rely highly on comprehensive on-line reference libraries of correctly identified specimens (e.g., Brandon-Mong et al. 2015;Creer et al. 2016;Staats et al. 2016). Ideally, such libraries include sequence data of a species` complete distribution range that can provide additional information of phylogeographic substructures that are well-known for many species (e.g., Gentile et al. 2010;Raupach et al. 2014;Paill et al. 2021). ...
... (Bedek et al. 2019), the common sea slater Ligia oceanica (Linneaus, 1767), Ligidium spp.(Klossa-Kilia et al. 2005), the common woodlouse Oniscus asellus Linnaeus, 1758(Bilton et al. 1999), Orthometopon spp.(Poulakakis and Sfenthourakis 2008), Helleria brevicornis Ebner, 1868(Gentile et al. 2010), or two species of the genus Trachelipus Budde-Lund, 1908(Parmakelis et al. 2008). Similar results have been also demonstrated for freshwater isopods of the genus Asellus Geoffroy, 1762(Verovnik et al. 2004;Verovnik et al. 2005;Sworobowicz et al. 2015;Pérez-Moreno et al. 2017) and ...
Article
Full-text available
DNA barcoding has become the most popular approach for species identification in recent years. As part of the German Barcode of Life project, the first DNA barcode library for terrestrial and freshwater isopods from Germany is presented. The analyzed barcode library included 38 terrestrial (78% of the documented species of Germany) and five freshwater (63%) species. A total of 513 new barcodes was generated and 518 DNA barcodes were analyzed. This analysis revealed surprisingly high intraspecific genetic distances for numerous species, with a maximum of 29.4% for Platyarthrus hoffmannseggii Brandt, 1833. The number of BINs per species ranged from one (32 species, 68%) to a maximum of six for Trachelipus rathkii (Brandt, 1833). In spite of such high intraspecific variability, interspecific distances with values between 12.6% and 29.8% allowed a valid species assignment of all analyzed isopods. The observed high intraspecific distances presumably result from phylogeographic events, Wolbachia infections, atypical mitochondrial DNAs, heteroplasmy, or various combinations of these factors. Our study represents the first step in generating an extensive reference library of DNA barcodes for terrestrial and freshwater isopods for future molecular biodiversity assessment studies.
... Oniscidea are particularly suitable for biogeographical and ecological studies because of their low dispersal ability (Vandel, 1960) and high stenoecy (Argano & Manicastri, 1996), which may favour strong genetic differentiation (Gentile & Sbordoni, 1998;Gentile et al., 2010). Past studies of Oniscidea from Mediterranean islands have indeed indicated that the number of species is directly proportional to environmental heterogeneity, which may also influence community structure (Cazzolla Gatti et al., 2018;Sfenthourakis, 1996a). ...
Article
Full-text available
Area and environmental heterogeneity influence species richness in islands. Whether area or environmental heterogeneity is more relevant in determining species richness is a central issue in island biogeography. Several models have been proposed, addressing the issue, and they can be reconducted to three main hypotheses developed to explain the species-area relationship: (1) the area-per se hypothesis (known also as the extinction-colonisation equilibrium), (2) the random placement (passive sampling), and the (3) environmental heterogeneity (habitat diversity). In this paper, considering also the possible influence of geographic distance on island species richness, we explore the correlation between area, environmental heterogeneity, and species richness by using faunistic data of Oniscidea inhabiting the Pontine Islands, a group of five small volcanic islands and several islets in the Tyrrhenian Sea, located about 60 km from the Italian mainland. We found that the colonisation of large Pontine Islands may occur via processes independent of geographic distance which could instead be an important factor at a much smaller scale. Such processes may be driven by a combination of anthropogenic influences and natural events. Even in very small-size island systems, environmental heterogeneity mostly contributes to species richness. Environmental heterogeneity could influence the taxocenosis structure and, ultimately, the number of species of Oniscidea via direct and indirect effects, these last mediated by area which may or may not have a direct effect on species richness.
... It is found at elevations from sea level to 1200 m (Vandel, 1960). Its original geographic distribution is restricted to Sardinia and Corsica, while very recent colonization of spotted continental locations in France and Italy and of some islands of the Tuscan archipelago are possibly driven by human transport (Gentile et al., 2010). Molecular features and many morphological characteristics that separate H. brevicornis from all other terrestrial isopods suggest an ancient divergence from the lineage to other terrestrial isopods (Collinge, 1941;Michel-Salzat and Bouchon, 2000;Vandel, 1960). ...
Article
Full-text available
Among the terrestrial Crustacea, isopods have most successfully established themselves in a large variety of terrestrial habitats. As in most Crustacea, their cuticle consists of a hierarchically organised organic phase of chitin-protein fibrils, containing calcium carbonate and some calcium phosphate. In previous studies, we examined the tergite cuticle of Tylos europaeus, which lives on seashores and burrows into moist sand. In this study, we investigate the closely related species Helleria brevicornis, which is completely terrestrial and lives in leaf litter and humus and burrows into the soil. To get deeper insights in relation between the structure of the organic and mineral phase in species living in diverse habitats, we have investigated the structure, and the chemical and crystallographic properties of the tergite cuticle using various preparation techniques, and microscopic and analytical methods. The results reveal long and short epicuticular sensilla with brushed tips on the tergite surface that do not occur in T. europaeus. As in T. europaeus a distal exocuticle, which contains a low number of organic fibres, contains calcite while the subjacent layers of the exo- and endocuticle contain amorphous calcium carbonate. The distal exocuticle contains a polygonal pattern of mineral initiation sites that correspond to interprismatic septa described for decapod crabs. The shape and position of calcite units do not follow the polygonal pattern of the septa. The results indicate that the calcite units form by crystallisation from an amorphous phase that progresses from both margins of the septa to the centres of the polygons.
... Finally, in more recent times, the application of the phylogeographic toolbox to the study of evolutionary histories within islands (i.e., postsettlement) is shedding light on a plethora of previously unappreciated evolutionary processes contributing to the diversity of the island biota above and below the species level (Bisconti, Canestrelli, & Nascetti, 2011b;Bisconti, Canestrelli, Salvi, et al., 2013;Bisconti et al., 2011a;Falchi et al., 2009;Gentile, Campanaro, Carosi, Sbordoni, & Argano, 2010;Ketmaier, Manganelli, Tiedemann, & Giusti, 2010;Salvi, Capula, Bombi, & Bologna, 2009;Salvi, Harris, Bombi, Carretero, & Bologna, 2010). ...
Preprint
Full-text available
How the often highly endemic biodiversity of islands originated has been debated for decades and it remains a fervid research ground. Here, using mitochondrial and nuclear gene sequence analyses, we investigate the diversity, phylogenetic relationships, and evolutionary history of the mayfly Baetis gr. rhodani on the three largest north-western Mediterranean islands (Sardinia, Corsica, Elba). We identify three distinct, largely co-distributed, and deeply differentiated lineages, with divergences tentatively dated back to the Eocene-Oligocene transition. Bayesian population structure analyses reveal a lack of gene exchange between them, even at sites where they are syntopic, indicating that these lineages belong to three putative species. Their phylogenetic relationships with continental relatives, together with the dating estimates, support a role for three processes contributing to this diversity: (1) vicariance, primed by microplate disjunction and oceanic transgression; (2) dispersal from the continent; and (3) speciation within the island group. Thus, our results do not point toward a prevailing role for any of the previously invoked processes. Rather, they suggest that a variety of processes equally contributed to shape the diverse and endemic biota of this group of islands.
... (d) genetic diversity on islands. In many studies, complex patterns similar to those observed for other continental species, characterized by wider ranges, occur (Gentile et al., 2010;Salvi et al., 2010Salvi et al., , 2016Bisconti et al., 2013aBisconti et al., ,2013b. The evolutionary history of the Tyrrhenian wall lizard, Podarcis tiliguerta, is among these examples. ...
Article
Sea level oscillations occurred during the Pleistocene have strongly affected islands’ physiography by changing area, elevation, and even the number of islands rising above the sea level. Such changes had direct consequences on island genetic diversity by promoting genetic admixture during glacial marine regressions while fragmentation or even extinctions occurred because of marine transgressions. Here we investigated the effect of islands’ physiographic changes on the mitochondrial diversity of 84 individuals of the Tyrrhenian wall lizard (Podarcis tiliguerta) from different islands and island groups surrounding Corsica and Sardinia. The La Maddalena Archipelago that is the more complex of the studied island groups, showed the highest genetic diversity, while we detected decreasing genetic diversity in island groups with lower number of islands and elevation. The genetic imprint we found seems to have been shaped by eustatic changes occurred in the Mediterranean basin during Mid‐Pleistocene times. Indeed, a relevant component of ancient lineages was found on those island groups among which elevation of at least one island allowed populations to survive during the Mid‐Pleistocene marine transgressions. In contrast, we found evidence of recent gene flow between populations inhabiting islands or island groups characterized by low elevation. Our results suggest that many features such as number of islands and their elevation, may provide predictive information to identify those islands or “archipelagos” that deserve special attention in terms of conservation priority. We investigated the effect of islands’ physiographic changes on the mitochondrial diversity of the Tyrrhenian wall lizard (Podarcis tiliguerta) from different islands and island groups surrounding Corsica and Sardinia. Our results suggest the importance of some island related features such as number of islands and their elevation in generating pattern of genetic diversity. Thus, such information may also be implemented in identifying those islands or “archipelagos” that deserve special attention in terms of conservation priority.
... En el continente europeo, la respuesta frente a estas oscilaciones climáticas es en modo de contracciones hacia refugios glaciares, seguidos por expansiones postgaliares para recolonizar territorios (Hewitt 1996;Hewitt 1999;Gassert et al. 2013;Salvi et al. 2013). En las islas, en cambio, el territorio es restringido y parece que son las oscilaciones en el nivel del mar las que afectan, principalmente, la diversidad y estructura de las especies (Grill et al. 2007;Gentile et al. 2010;Bisconti et al. 2011a;Bisconti et al. 2011b), más que el cambio en el clima en sí (Salvi et al. 2014). ...
... Our results also highlight the intriguing evolution of H. brevicornis. As the only recognized species of the Helleriinae subfamily (grouped with the Tylos genus in the Tylidae family), this endemic species from the North Tyrrhenian area 53 has been considered as a branch that diverged early during terrestrial isopod evolution based on morphological characters 54 . Characterized by a high mitochondrial AT nucleotide content, the early divergence of H. brevicornis from the other Oniscidea was already suspected 29 , without being able to solve the phylogenetic relationships of this species. ...
Article
Full-text available
Sex determination systems are highly variable in many taxa, sometimes even between closely related species. Yet the number and direction of transitions between these systems have seldom been characterized, and the underlying mechanisms are still poorly understood. Here we generated transcriptomes for 19 species of terrestrial isopod crustaceans, many of which are infected by Wolbachia bacterial endosymbionts. Using 88 single-copy orthologous genes, we reconstructed a fully resolved and dated phylogeny of terrestrial isopods. An original approach involving crossings of sex-reversed individuals allowed us to characterize the heterogametic systems of five species (one XY/XX and four ZW/ZZ). Mapping of these and previously known heterogametic systems onto the terrestrial isopod phylogeny revealed between 3 and 13 transitions of sex determination systems during the evolution of these taxa, most frequently from female to male heterogamety. Our results support that WW individuals are viable in many species, suggesting sex chromosomes are at an incipient stage of their evolution. Together, these data are consistent with the hypothesis that nucleo-cytoplasmic conflicts generated by Wolbachia endosymbionts triggered recurrent turnovers of sex determination systems in terrestrial isopods. They further establish terrestrial isopods as a model to study evolutionary transitions in sex determination systems and pave the way to molecularly characterize these systems.
... Molecular phylogenies and dating methods provide the necessary information to discern the origins of island taxa and hence the ability to assess the relative roles of vicariance versus dispersal and in situ diversification events. Notably, the application of molecular tools to investigate the origins of endemic taxa on continental islands has revealed a more important role for dispersal than was originally anticipated (Trewick, 2000;Carranza & Amat, 2005;Yoder & Nowak, 2006;Gentile et al., 2010;Salvo et al., 2010;Trewick & Gibb, 2010;Cruaud et al., 2012). ...
Article
To unravel the origins and to infer the processes of diversification in the low-vagility nemesiid trap-door spiders of the Balearic Islands. The specific goals were: (1) to determine whether nemesiid spiders colonized the islands by oversea dispersal, or whether they are the result of the fragmentation of a once continuous distribution by continental drift, and (2) to test whether the Balearic lineages have undergone local diversification processes. Balearic Islands, Iberian Peninsula, Western Mediterranean. Multilocus molecular phylogenetic inference using parsimony and model-based methods, and divergence time estimation with relaxed clocks and informed substitution rate priors, and biogeographical ancestral reconstruction inferred in a Bayesian framework. Phylogenetic analyses revealed the monophyly of the genera Iberesia and Nemesia. Four independent clades were recovered for the Balearic fauna. One of the clades included a formerly unknown species from Minorca. The Balearic clades split from their continental relatives in the early Tortonian, except for Iberesia brauni, which dates to the Messinian-Zanclean. The biogeographical reconstruction indicated that the Balearic fauna probably originated in the Betic region of the Iberian Peninsula. The presence of Nemesia on the Balearic Islands was explained by fragmentation of an ancestral distribution range that included the Betic region and the islands in the Early Tortonian. The arrival of Iberesia to the islands, however, was the result of a secondary range expansion that was facilitated by the emergence of land bridges with the continent during the Messinian salinity crisis (MSC). Similarly, the drops in the sea level that occurred during the MSC and subsequently in the Quaternary glacial cycles established land passages between Majorca and Minorca.
Article
The large radiation of terrestrial isopods (suborder Oniscidea) includes several families that are represented primarily in marine-littoral or riparian habitats. Among these are members of Ligiidae and Tylidae as well as several basal families within the section Crinocheta. Structural and physiological evidence supports a marine-littoral ancestry of the Oniscidea. We examined aerial and aquatic respiration (measured as VCO2) in six species of marine-littoral Oniscidea representing five families, as well as one riparian and one endogean species. Complimentary data were collected for immersion tolerance and whole-animal permeability in air, and structural specialization of the respiratory pleopods was examined using SEM. Ligia occidentalis Dana, 1853 (marine, littoral) and Ligidium lapetum Mulaik & Mulaik, 1942 (riparian) showed similar VCO2 in air and water. VCO2 in air for the other species was significantly higher than in water. Compared across species, aerial VCO2 scaled with mass in accordance with Kleiber’s law (β = 0.774) while aquatic VCO2 increased in approximate proportion to mass (β = 0.957). At least some specimens of the six marine-littoral species survived over 24 h immersion. Ligidium lapetum and the endogean trichoniscid Brackenridgia heroldi (Arcangeli, 1932) also tolerated prolonged immersion in freshwater but did not survive beyond 5–6 h, probably due to limited capacity for hyper-regulation. The upper shore sand-burrowers, Tylos punctatus Holmes & Gay, 1909 and Alloniscus perconvexus Dana, 1856 had the lowest permeability among the study species and are the only representatives with elaborated pleopodal respiratory fields (Alloniscus) and lungs (Tylos). The ventral lung spiracles of T. punctatus are surrounded by an extensive cuticle meshwork and we propose that this functions as a plastron field to enhance aquatic gas exchange. Collectively, the results show that littoral species tolerate significant periods of immersion, allowing them to withstand habitat inundation during spring high tides, storm swells and, in riparian species, rainstorms and snowmelt.
Article
Full-text available
The paleomagnetic investigations carried out in the 70th on Oligo-Miocene volcanics of Sardinia have demonstrated that the island was turned by 35-30° clockwise from 33 Ma up to 21-20.5 Ma and rotated counterclockwise in a few million years (De Jong et al., 1969, 1973; Bobier et Coulon, 1970; Coulon et al., 1974; Manzoni, 1974, 1975; Bellon et al., 1977; Edel et Lörtscher, 1977; Edel, 1979, 1980). Since, the end of the rotation fixed at 19 Ma by Montigny et al. (1981) was the subject of discussions and several studies associating paleomagnetism and radiometric dating were undertaken (Assorgia et al., 1994; Vigliotti et Langenheim, 1995; Deino et al., 1997; Gattacceca et Deino, 1999). This is a contribution to this debate that is hampered by the important secular variation recorded in the volcanics. The only way to get out of this problem is to sample series of successive flows as complete as possible, and to reduce the effect of secular variation by the calculation of means. Sampling was performed north of Bonorva in 5 pyroclastic flows that belong to the upper ignimbritic series SI2 acording to Coulon et al. (1974) or LBLS according to Assorgia et al. (1997) (Fig. 1). 40Ar/39Ar dating of biotites from the debris flow (MDF) has yielded an age of 18.35±0.03 Ma (Dubois, 2000). Five of the investigated sites are located beneath the debris flow (TV, TVB, TVD, SPM85, SPM86), one site was cored in the matrix of the debris flow (MDF) and one in 4 metric blocks included in the flow (DFC). An other site was sampled in the upper ash flow (PDM) that marks the end of the pyroclastic activity, just before the marine transgression. According to micropaleontological and radiometric dating this transgression has occurred between 18.35 and 17.6 Ma (Dubois, 2000). After removal of a soft viscous component, the thermal demagnetization generally shows an univectorial behaviour of the remanent magnetization (Fig. 2a). The maximum unblocking temperatures of 580-620° (Tab. 1) and a rapid saturation below 100 mT (Fig. 3) indicate that the carrier of the characteristic magnetization is magnetite. The exception comes from the upper site PDM in which were found two characteristic components, one with a normal polarity and low unblocking temperatures up to 350°C and one with a reversed polarity and maximum unblocking temperatures at 580-600°C of magnetite. After calculation of a mean direction for each flow, the mean "A1" direction 4°/57° (α95=13°) computed with the mean directions for the 5 flows may be considered as weakly affected by secular variation. But the results require a more careful examination. The declinations are N to NNW beneath the debris flow, NNW in the debris flow, and NNE (or SSW) above the debris flow. The elongated distribution of the directions obtained at sites TVB and TVD, scattered from the mean direction of TV to the mean direction of MDF is interpreted as due to partial overprinting during the debris flow volcanic episode. The low temperature component PDMa is likely related to the alteration seen on thin sections and is also viewed as an overprint. As NNE/SSW directions occur as well below (mean direction "B": 5°/58°) as above the debris flow (PDMb: 200°/-58°), the NNW directions ("C": 337°/64°) associated with the debris flow volcanism may be interpreted as resulting from a magnetic field excursion. According to the polarity scale of Cande and Kent (1992, 1995) and the radiometric age of MDF, the directions with normal polarity (TV, TVB, TVD, SPM85, SPM86a, MDF, DFC) may represent the period 5En, while the directions with reversed polarity PDMb and SPM86b were likely acquired during the period 5Dr. Using the mean "A1" direction, the mean "B" or the PDM direction (Tab. 1), the deviation in declination with the direction of stable Europe 6.4°/58.7° (α95=8°) for a selection of 4 middle Tertiary poles by Besse et Courtillot (1991) or 7°/56° (α95=3°) for 19 poles listed by Edel (1980) can be considered as negligible. Using the results from the uppermost ignimbritic layer of Anglona also emplaced around 18.3 Ma (Odin et al., 1994), the mean direction "E" (3°/51.5°) leads to the same conclusion. On the contrary, when taking into account all dated results available for the period 5En (mean direction "D" 353°/56° for 45 sites) (Tab. 2), the deviation 13° is much more significant. As the rotation of Sardinia started around 21-20.5 Ma, the assumption of a constant velocity of rotation and the deviations of the Sardinia directions with respect to the stable Europe direction locate the end of the motion between 18.3 and 17.2 or 16.7 Ma (Fig. 4). During the interval 18.35-17.5 Ma, the marine transgression took place. At the same period a NE-SW shortening interpreted as resulting from the collision of Sardinia with Apulia affected different parts of the island (Letouzey et al., 1982). Consequently, the new paleomagnetic results and the tectono-sedimentary evolution are in favour of an end of the rotation at 17.5- 18 Ma.
Article
Full-text available
Estimating genealogical relationships among genes at the population level presents a number of difficulties to traditional methods of phylogeny reconstruction. These traditional methods such as parsimony, neighbour-joining, and maximum-likelihood make assumptions that are invalid at the population level. In this note, we announce the availability of a new software package, TCS, to estimate genealogical relationships among sequences using the method of Templeton et al. (1992) .
Article
The paleomagnetic investigations carried out in the 70's on Oligo-Miocene volcanics of Sardinia have demonstrated that the island was turned by 35-30 ° clockwise from 33 Ma up to 21-20.5 Ma and rotated counterclockwise in a few million years [De Jong et al., 1969, 1973 ; Bobier et Coulon. 1970 ; Coulon et al., 1974 ; Manzoni, 1974, 1975 ; Bellon et al., 1977 ; Edel et Lörtscher, 1977 ; Edel, 1979, 1980]. Since then, the end of the rotation fixed at 19 Ma by Montigny et al. [1981] was the subject of discussions and several studies associating palcomagnetism and radiometric dating were undertaken [Assorgia et al., 1994 ; Vigliotti et Langenheim, 1995 ; Deino et al., 1997 ; Gattacceca et Deino, 1999]. This is a contribution to this debate that is hampered by the important secular variation recorded in the volcanics. The only way to get out of this problem is to sample series of successive flows as completely as possible, and to reduce the effect of secular variation by the calculation of means. Sampling was performed north of Bonorva in 5 pyroclastic flows that belong to the upper ignimbritic series S12 according to Coulon et al. [1974] or LBLS according to Assorgia et al. [1997] (fig. 1). 40Ar/39Ar dating of biotites from the debris flow (MDF) has yielded an age of 18.35 ± 0.03 Ma [Dubois, 2000]. When taking into account all dated results available for the period 5En (mean direction « D » 353°/56° for 45 sites) (tab. II), the deviation 13 ° is much more significant. As the rotation of Sardinia started around 21-20.5 Ma, the assumption of a constant velocity of rotation and the deviations of the Sardinia directions with respect to the stable Europe direction locate the end of the motion between 18.3 and 17.2 or 16.7 Ma (fig. 4). During the interval 18.35-17.5 Ma, the marine transgression took place. At the same period a NE-SW shortening interpreted as resulting from the collision of Sardinia with Apulia affected different parts of the island [Letouzey et al., 1982]. Consequently, the new paleomagnetic results and the tectono-sedimentary evolution are in favour of an end of the rotation at 17.5-18 Ma.
Book
— We studied sequence variation in 16S rDNA in 204 individuals from 37 populations of the land snail Candidula unifasciata (Poiret 1801) across the core species range in France, Switzerland, and Germany. Phylogeographic, nested clade, and coalescence analyses were used to elucidate the species evolutionary history. The study revealed the presence of two major evolutionary lineages that evolved in separate refuges in southeast France as result of previous fragmentation during the Pleistocene. Applying a recent extension of the nested clade analysis (Templeton 2001), we inferred that range expansions along river valleys in independent corridors to the north led eventually to a secondary contact zone of the major clades around the Geneva Basin. There is evidence supporting the idea that the formation of the secondary contact zone and the colonization of Germany might be postglacial events. The phylogeographic history inferred for C. unifasciata differs from general biogeographic patterns of postglacial colonization previously identified for other taxa, and it might represent a common model for species with restricted dispersal.
Article
The paleomagnetic investigations carried out in the 70's on Oligo-Miocene volcanics of Sardinia have demonstrated that the island was turned by 35-30 degrees clockwise from 33 Ma up to 21-20.5 Ma and rotated counterclockwise in a few million years [De Jong et al., 1969, 1973; Bobier et Coulon, 1970; Coulon et al., 1974; Manzoni, 1974, 1975; Bellon et al., 1977; Edel et Lortscher, 1977; Edel, 1979, 1980]. Since then, the end of the rotation fixed at 19 Ma by Montigny et al. [1981] was the subject of discussions and several studies associating paleomagnetism and radiometric dating were undertaken [Assorgia et al., 1994; Vigliotti et Langenheim, 1995; Deino et al., 1997; Gattacceca et Deino, 1999]. This is a contribution to this debate that is hampered by the important secular variation recorded in the volcanics. The only way to get out of this problem is to sample series of successive flows as completely as possible, and to reduce the effect of secular variation by the calculation of means. Sampling was performed north of Bonorva in 5 pyroclastic flows that belong to the upper ignimbritic series S12 according to Coulon et al. [1974] or LBLS according to Assorgia et al. [1997] (fig. 1). 40 Ar/ 39 Ar dating of biotites from the debris flow (MDF) has yielded an age of 18.35+ or -0.03 Ma [Dubois, 2000]. Five of the investigated sites are located beneath the debris flow (TV, TVB, TVD, SPM85, SPM86), one site was cored in the matrix of the debris flow (MDF) and one in 4 metric blocks included in the flow (DFC). Another site was sampled in the upper ash flow (PDM) that marks the end of the pyroclastic activity, just before the marine transgression. According to micropaleontological and radiometric dating this transgression has occurred between 18.35 and 17.6 Ma [Dubois, 2000]. After removal of a soft viscous component, the thermal demagnetization generally shows a univectorial behaviour of the remanent magnetization (fig. 2a). The maximum unblocking temperatures of 580-620 degrees (tab. I) and a rapid saturation below 100 mT (fig. 3) indicate that the carrier of the characteristic magnetization is magnetite. The exception comes from the upper site PDM in which were found two characteristic components, one with a normal polarity and low unblocking temperatures up to 350 degrees C and one with a reversed polarity and maximum unblocking temperatures at 580-600 degrees C of magnetite. After calculation of a mean direction for each flow, the mean "A1" direction 4 degrees /57 degrees (alpha 95 = 13 degrees ) computed with the mean directions for the 5 flows may be considered as weakly affected by secular variation. But the results require a more careful examination. The declinations are N to NNW beneath the debris flow, NNW in the debris flow, and NNE (or SSW) above the debris flow. The elongated distribution of the directions obtained at sites TVB and TVD, scattered from the mean direction of TV to the mean direction of MDF is interpreted as due to partial overprinting during the debris flow volcanic episode. The low temperature component PDMa is likely related to the alteration seen on thin sections and is also viewed as an overprint. As NNE/SSW directions occur as well below (mean direction "B": 5 degrees /58 degrees ) as above the debris flow (PDMb: 200 degrees /-58 degrees ), the NNW directions ("C": 337 degrees /64 degrees ) associated with the debris flow volcanism may be interpreted as resulting from a magnetic field excursion. According to the polarity scale of Cande and Kent [1992, 1995] and the radiometric age of MDF, the directions with normal polarity (TV, TVB, TVD, SPM85, SPM86a, MDF, DFC) may represent the period 5En, while the directions with reversed polarity PDMb and SPM86b were likely acquired during the period 5Dr. Using the mean "A1" direction, the mean "B" or the PDM direction (tab. I), the deviation in declination with the direction of stable Europe 6.4 degrees /58.7 degrees (alpha 95 = 8 degrees ) for a selection of 4 middle Tertiary poles by Besse et Courtillot [1991] or 7 degrees /56 degrees (alpha 95 = 3 degrees ) for 19 poles listed by Edel [1980] can be considered as negligible. Using the results from the upper-most ignimbritic layer of Anglona also emplaced around 18.3 Ma [Odin et al., 1994], the mean direction "E" (3 degrees /51.5 degrees ) leads to the same conclusion. On the contrary, when taking into account all dated results available for the period 5En (mean direction "D" 353 degrees /56 degrees for 45 sites) (tab. II), the deviation 13 degrees is much more significant. As the rotation of Sardinia started around 21-20.5 Ma, the assumption of a constant velocity of rotation and the deviations of the Sardinia directions with respect to the stable Europe direction locate the end of the motion between 18.3 and 17.2 or 16.7 Ma (fig. 4). During the interval 18.35-17.5 Ma, the marine transgression took place. At the same period a NE-SW shortening interpreted as resulting from the collision of Sardinia with Apulia affected different parts of the island [Letouzey et al., 1982]. Consequently, the new paleomagnetic results and the tectono-sedimentary evolution are in favour of an end of the rotation at 17.5-18 Ma.