High production of ectoine from methane in genetically engineered Methylomicrobium alcaliphilum 20Z by preventing ectoine degradation

Abstract

Background
Methane is a greenhouse gas with a significant potential to contribute to global warming. The biological conversion of methane to ectoine using methanotrophs represents an environmentally and economically beneficial technology, combining the reduction of methane that would otherwise be combusted and released into the atmosphere with the production of value-added products.

Results
In this study, high ectoine production was achieved using genetically engineered Methylomicrobium alcaliphilum 20Z, a methanotrophic ectoine-producing bacterium, by knocking out doeA, which encodes a putative ectoine hydrolase, resulting in complete inhibition of ectoine degradation. Ectoine was confirmed to be degraded by doeA to N-α-acetyl-L-2,4-diaminobutyrate under nitrogen depletion conditions. Optimal copper and nitrogen concentrations enhanced biomass and ectoine production, respectively. Under optimal fed-batch fermentation conditions, ectoine production proportionate with biomass production was achieved, resulting in 1.0 g/L of ectoine with 16 g/L of biomass. Upon applying a hyperosmotic shock after high–cell–density culture, 1.5 g/L of ectoine was obtained without further cell growth from methane.

Conclusions
This study suggests the optimization of a method for the high production of ectoine from methane by preventing ectoine degradation. To our knowledge, the final titer of ectoine obtained by M. alcaliphilum 20ZDP3 was the highest in the ectoine production from methane to date. This is the first study to propose ectoine production from methane applying high cell density culture by preventing ectoine degradation.

Full text

RESEARCH Open Access
© The Author(s) 2024. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use,
sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and
the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this
article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included
in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will
need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The
Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available
in this article, unless otherwise stated in a credit line to the data.
Lim et al. Microbial Cell Factories (2024) 23:127
https://doi.org/10.1186/s12934-024-02404-2 Microbial Cell Factories
†Sang Eun Lim, Sukhyeong Cho contributed equally to this work.
*Correspondence:
Jinwon Lee
jinwonlee@sogang.ac.kr
1Department of Chemical and Biomolecular Engineering, Sogang
University, Seoul, Republic of Korea
2C1 Gas Renery R&D Center, Sogang University, Seoul, Republic of Korea
Abstract
Background Methane is a greenhouse gas with a signicant potential to contribute to global warming. The
biological conversion of methane to ectoine using methanotrophs represents an environmentally and economically
benecial technology, combining the reduction of methane that would otherwise be combusted and released into
the atmosphere with the production of value-added products.
Results In this study, high ectoine production was achieved using genetically engineered Methylomicrobium
alcaliphilum 20Z, a methanotrophic ectoine-producing bacterium, by knocking out doeA, which encodes a putative
ectoine hydrolase, resulting in complete inhibition of ectoine degradation. Ectoine was conrmed to be degraded
by doeA to N-α-acetyl-L-2,4-diaminobutyrate under nitrogen depletion conditions. Optimal copper and nitrogen
concentrations enhanced biomass and ectoine production, respectively. Under optimal fed-batch fermentation
conditions, ectoine production proportionate with biomass production was achieved, resulting in 1.0g/L of ectoine
with 16g/L of biomass. Upon applying a hyperosmotic shock after high–cell–density culture, 1.5g/L of ectoine was
obtained without further cell growth from methane.
Conclusions This study suggests the optimization of a method for the high production of ectoine from methane
by preventing ectoine degradation. To our knowledge, the nal titer of ectoine obtained by M. alcaliphilum 20ZDP3
was the highest in the ectoine production from methane to date. This is the rst study to propose ectoine production
from methane applying high cell density culture by preventing ectoine degradation.
Keywords Methane, Methanotroph, Ectoine, Methylomicrobium alcaliphilum 20Z, Nitrogen source
High production of ectoine from methane
in genetically engineered Methylomicrobium
alcaliphilum 20Z by preventing ectoine
degradation
Sang EunLim1†, SukhyeongCho2†, YejinChoi1, Jeong-GeolNa1 and JinwonLee1,2*
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 2 of 12
Lim et al. Microbial Cell Factories (2024) 23:127
Background
Methane is a major greenhouse gas with a global warm-
ing potential at least 20 times higher than that of carbon
dioxide [1]. Atmospheric methane concentrations have
been steadily increasing and exceeded 1,900 parts per
billion in 2022 [2]. Recently, as the industry’s interest
in methane emissions has grown, the “Global Methane
Pledge” was declared, marking the beginning of height-
ened attention towards methane reduction. Although
technologies exist for the chemical conversion of meth-
ane to liquid fuel, they are inecient owing to the cost
and complexity of the process and the extreme reaction
conditions such as high temperature and high pressure
[3, 4]. us, the biological conversion of methane, which
is relatively simple and operates at an ambient tempera-
ture and pressure, has been proposed as an alternative
[5]. Methane is also highly valued as a next-generation
carbon source because it is relatively cheaper than sugar
or its derivatives, and does not compete with food
resources [6].
Methanotrophs are promising biocatalysts for the pro-
duction of chemicals such as polyhydroxyalkanoates,
single-cell proteins, and methanol from methane [7–9].
However, the production of these methane-derived bulk
chemicals often cannot compete with petrochemical
products in terms of price, due to the low gas-to-liquid
mass transfer, low productivity of processes, leading to
high investment and operational costs [10–12]. In this
context, the production of ectoine, an osmotic protec-
tor with a retail market value around 1,000 $ kg− 1 and
an annual demand of 20,000 tons, has recently attracted
increasing attention of industries producing ne chemi-
cals from methane [13]. Ectoine, which protects cells,
enzymes, proteins, and other biomolecules, is primarily
used in cosmetics and biomedical applications [14, 15].
Recent studies have reported that high protability of the
process from methane to ectoine comparing the produc-
tion costs of ectoine and the current market price of this
chemical [12, 16].
Methylomicrobium alcaliphilum 20Z is a methano-
trophic ectoine-producing bacterium. Its full genome
sequence has been identied and relevant genetic tools
have been established [17]. M. alcaliphilum 20Z has a
pathway for ectoine synthesis by the sequential action
of Ask, EctB, EctA, and EctC as described in Fig.1 [18].
Ectoine is converted into hydroxyectoine by EctD in M.
alcaliphilum 20Z. But, also ectoine degradation pathway
exists in M. alcaliphilum 20Z mediated by DoeA, DoeB
[19].
e main process used for ectoine production is sugar
fermentation by Halomonas species [20, 21]. However,
this process is costly because it requires high-quality
carbon sources, such as glucose, sodium glutamate, and
yeast extract [15]. Although the reported production of
ectoine using methanotrophs is much lower than that
achieved with traditional sugar-fermenting microbes,
the combined process of ectoine production and the
treatment of atmospheric methane can reduce the costs
associated with ectoine production while also promoting
climate change mitigation through active methane reduc-
tion. us, methanotrophs provide an excellent environ-
mental benet of producing ectoine from dilute methane.
is study suggests the optimization of a method
for enhanced production of ectoine from methane by
knocking out doeA, a putative ectoine-degrading hydro-
lase gene, from M. alcaliphilum 20ZDP2, which was
constructed by disrupting ectD and ectR genes. Nota-
bly, it was conrmed that the nitrogen source is cru-
cial for ectoine synthesis, with production ceasing once
the nitrogen source in the medium was depleted. is
emphasizes the need for continuous replenishment
of nitrogen source in the medium to maintain ectoine
production concurrent with cell growth. To the best of
our knowledge, the nal titer of ectoine obtained from
M. alcaliphilum 20ZDP3 via this process is the high-
est reported ectoine production from methane to date.
is is the rst study to propose ectoine production from
methane applying high–cell–density culture by prevent-
ing ectoine degradation.
Materials and methods
Bacterial strains and culture media
Halophilic, methanotrophic Methylomicrobium alca-
liphilum 20Z was used for ectoine production. Speci-
cally, the ectD and ectR gene–decient 20ZDP2 strain
was constructed in our previous study [22] and 20ZDP3,
20ZDP4, and 20ZDP5 defective in doeA, doeD, ectB
genes, respectively, from 20ZDP2 were constructed
in this study (Table1). e bacteria were cultured in a
modied Methylomicrobium medium described in the
previous study comprising 30% (v/v) methane or 9.93g/L
methanol [22]. e strains were cryopreserved with 10%
(v/v) dimethylsulfoxide added in the early exponential
phase.
Deletion of ectoine-degradation genes from M.
Alcaliphilum 20ZDP2
Deletion of doeA, doeD, or ectB from M. alcaliphilum
20ZDP2 was performed with suicide vectors using the
conjugation method described previously [22, 23]. e
anking regions of the target gene were cloned into a
suicide vector, pK19mobsacB, after restriction digestion
using Hind III and EcoRI using an infusion system (In-
Fusion™ HD Cloning Kit, Takara Bio Inc., Japan). All sub-
sequent procedures, such as the conjugation of vectors
to M. alcaliphilum 20ZDP2 and sucrose counterselec-
tion for doeA or ectB deletion, were carried out as previ-
ously described [22]. e knock–out of target genes was
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 3 of 12
Lim et al. Microbial Cell Factories (2024) 23:127
conrmed by PCR. All the oligonucleotides used in this
study are listed in Table2.
Batch culture in a ask
For ask fermentation, seed culture was carried out for 2
days in Methylomicrobium medium containing 3% (w/v)
NaCl and 9.93g/L methanol with the cryo-preserved cell
stock at 30°C and 230rpm. For the main culture, culture
broth was inoculated at an initial OD600 nm of 0.2 to 50
mL medium containing 6% (w/v) NaCl and 0.05 µM tung-
sten in a 250-mL baed ask. e headspace of the ask
was lled with 30% (v/v) methane gas mixed with air and
refreshed every 12h using a mass ow controller (GMC
1200-MMOO-O-1, ATOVAC, Korea). Flask culture was
conducted at 30°C and 230rpm and samples taken every
24h to analyze cell growth and ectoine production. All
batch fermentations were performed in triplicate.
Fed-batch culture in a 5-L bioreactor
e pre-culture process was performed in the same man-
ner as that for ask culture. All trials for ectoine produc-
tion with continuous methane supply and pH control
were performed in a 5-L stirred bioreactor (Bio Control
& System, Korea) with a working volume of 3L. All cul-
tivations were conducted at 30°C, and the pH was main-
tained at 8.9 to 9.1 using 2.5 M H2SO4 and 5M NaOH.
Air with 30% methane was supplied at 0.1–0.52 vvm with
an agitation speed of 300–650 rpm for controlling the
dissolved oxygen (DO) levels. To increase biomass, the
DO level was maintained at 20% by controlling the agi-
tation speed and ow rate of the gas. e initial OD600
nm value was 0.2; further, 1X trace elements and 20 mM
KNO3 were added when the dry cell weight (DCW)
increased by 2g/L.
Accumulation of ectoine after high–cell–density culture
To accumulate ectoine by a hyperosmotic shock, 30g/L
of NaCl was added to the medium (the nal salinity
reached was 6% (w/v)) when the OD600 nm value reached
Fig. 1 Metabolic pathway for ectoine bio-synthesis and degradation in M. alcaliphilum 20Z. Ask: aspartate kinase; AsdB: aspartate-semialdehyde dehydro-
genase; EctB: L-2,4-diaminobutyrate transaminase; EctA: L-2,4-diaminobutyric acid acetyltransferase; EctC: L-ectoine synthase; EctD: ectoine hydroxylase;
DoeA: ectoine hydrolase; DoeB: N2-acetyl-L-2,4-diaminobutanoate deacetylase; DoeC: aspartate-semialdehyde dehydrogenase; DoeD: L-2,4-diaminobu-
tyrate transaminase
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 4 of 12
Lim et al. Microbial Cell Factories (2024) 23:127
110 (22g/L of DCW) in a bioreactor. Further, 5g/L of
KNO3 was supplied and the agitation speed and gas ow
rate were decreased to 300rpm and 0.1 vvm, respectively,
to minimize the shear stress aecting cells.
qRT- PCR
M. alcaliphilum 20ZDP2 was cultured for 72 h in a
medium containing 1 g/L or 5 g/L KNO3 with meth-
ane. Total RNA was prepared using the TRIzol™ Plus
RNA Purication Kit (ermo Fisher Scientic, United
States). Real-time PCR was performed after cDNA syn-
thesis using the ermal Cycler (Takara Bio Inc., Japan)
using the TB GreenR Premix Ex Taq™ II kit (Takara Bio
Inc., Japan). e transcriptional level of ectoine-degrad-
ing genes (doeA, doeB, doeD) was normalized using 16S
rRNA as a housekeeping gene. Data were analyzed using
the 2−ΔΔCT method with the doeA (1g/L KNO3) sample
as the standard.
Analytical procedure
Cell growth was estimated by optical density at 600nm
using a UV-VIS spectrophotometer (Biochrom WPA
Lightwave II, Biochrom Ltd., UK). e DCW (g/L) was
calculated as illustrated in a previous study [24].
For the quantitative analysis of intracellular ectoine,
2 mL of culture broth was harvested over time, and the
cells were freeze-dried for 2 days using a freeze dryer
(TFD8503, iLShinBioBase, Korea). Intracellular ectoine
was then extracted from freeze-dried cells as previ-
ously reported [25] and measured using HPLC (RID-
20A, SHIMADZU, Japan) with a UV detector using the
ZORBAX-NH2 column (NH2 Analytical HPLC Column
4.6 × 250, Agilent Technologies, United States) under fol-
lowing conditions: mobile phase, 70% (v/v) acetonitrile;
temperature of column oven, 35°C; ow rate, 0.8 mL/
min.
For quantitative and qualitative analysis of the pro-
duced ectoine in fed-batch fermentation, LC-MS analy-
sis was performed using LC (UltiMate 3000, ermo
Fisher Scientic, United states)-MS(EVOQ QUBE,
Bruker, United States) with an MS/MS detector using
Table 1 Strains and vectors used in this study
Characteristics Refer-
ences or
source
Strains
Escherichia coli DH10B F- mcrA ∆(mrr-hsdRMS-mcrBC)
ϕ80lacZ∆M15 ∆lacX74 recA1
endA1 ara
∆139 ∆(ara, leu)7697 galU galK λ-
rpsL (StrR) nupG
RBC
Biosci-
ence
Escherichia coli S17-1
λpir
Donor strain
Methylomicrobium
alcaliphilum 20Z
host strain DSMZ
M. alcaliphilum 20ZDP2 M. alcaliphilum 20ZDP ΔectDΔectR [22]
M. alcaliphilum 20ZDP3 M. alcaliphilum 20ZDP
ΔectDΔectRΔdoeA
This
study
M. alcaliphilum 20ZDP4 M. alcaliphilum 20ZDP
ΔectDΔectRΔdoeD
This
study
M. alcaliphilum 20ZDP5 M. alcaliphilum 20ZDP
ΔectDΔectRΔectB
This
study
Vectors
pK19mobsacB suicide vector for gene deletion
pK19mobsacBΔdoeA pK19mobsacB containing ank
regions of doeA
This
study
pK19mobsacBΔdoeD pK19mobsacB containing ank
regions of doeD
This
study
pK19mobsacBΔectB pK19mobsacB containing ank
regions of ectB
This
study
Table 2 Oligonucleotides used in this study
Oligonucleotides Sequence
Upstream of doeA
F/R
tgacatgattacgccaagcttatgaaagtctttgaacaatgggaa/
ccctccttgcaaggcctccaaagcatccg
Downstream of
doeA F/R
Tggaggccttgcaaggagggttactcaatggc/
aaaacgacggccagtgaattcttaacccagccaaacctgctgc
Integration to up-
stream of doeA F/R
atgcttccggctcgtatgtt / tccggatcgctgattacgac
Integration to
downstream of
doeA F/R
gcgtcgaaggcgataaaacc / taagcccactgcaagctacc
Conrmation of
doeA deletion F/R
gcttcgaacgcggactacta / cgctgttgaggccgtaagtt
Upstream of doeD
F/R
tgacatgattacgccaagcttatggccatacagtgggatcagc/
gttcaatcatgaatactctccttacggttgacagg
Downstream of
doeD F/R
gagagtattcatgattgaacgcgacgacatg/
aaaacgacggccagtgaattcctaagccccgtattcgggt
Integration to up-
stream of doeD F/R
cagtgagcgcaacgcaatta / cgcctgcgaagaagtcgata
Integration to
downstream of
doeD F/R
gccttggcgaaaaacatcgt / ggacaggtcggtcaatcgtt
Conrmation of
doeD deletion F/R
cgattgagagatgtcggggg / cggtatcgggataaggtcgc
Upstream of ectB
F/R
tgacatgattacgccaagctttcaggacgcgaggcatattgc/
gagaattagaagcccgctgagccaaccag
Downstream of
ectB F/R
tcagcgggcttctaattctctcctgagcaagatgg/
aaaacgacggccagtgaattcttaaaccggaaaatcaaacgc
Integration to up-
stream of ectB F/R
ttgccgtcaggtgaaacgat / catgggctctgtttgagggg
Integration to
downstream of
ectB F/R
ccgggtgattgtgaccgtaa / taagcccactgcaagctacc
Conrmation of
ectB deletion F/R
atgcatgcgaaaatcggcac / ggcagtgctgtgatgtttga
RT-PCR for 16s rRNA
gene F/R
tcccgggccttgtacacacc / gtggtaagcgccctcccgaa
RT-PCR for doeA
gene F/R
ggcgtcgaaggcgataaaac/ cccgtattcgggtttcacca
RT-PCR for doeB
gene F/R
RT-PCR for doeD
gene F/R
ctcacgaattcacacgcgac / tgcatcaatgtccggcgata
gccttggcgaaaaacatcgt / caaagcatccgctaagacgc
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 5 of 12
Lim et al. Microbial Cell Factories (2024) 23:127
C18 column (C18 50 × 2.1mm, 1.9μm, ACME) under the
following conditions: mobile phase, 80% (v/v) methanol
containing 0.1% (v/v) formic acid ; temperature of col-
umn oven, 30°C; ow rate, 0.2 mL/min. is analysis was
performed at e Core Facility Center for Chronic and
Metabolic Diseases at Sookmyung Women’s University.
For analyzing anionic and cationic ions in the medium
at various time intervals, the culture broth was centri-
fuged (Smart R17 Plus, HANIL SCIENCE CO., LTD,
Korea) and the supernatant was analyzed using Ion
Chromatography (Dionex™ Aquion™ IC System, ermo
Fisher Scientic, United States) [26].
Results and discussion
Development of M. Alcaliphilum 20Z mutants defective in
ectoine degradation
In a previous study, intracellular ectoine was conrmed
to be increased until the mid-exponential phase but
rapidly decreased in M. alcaliphilum 20Z despite cell
growth [18, 22, 27]. To prevent ectoine degradation after
the mid-exponential phase, the genes encoding ectoine
hydrolase (doeA) were selected for deletion. us,
we knocked out the doeA gene from M. alcaliphilum
20ZDP2 (ΔectDΔectR), which was constructed in our
previous study [22]. Deletion of the doeA gene in M. alca-
liphilum 20ZDP2 was conrmed via PCR (Fig S1a), and
the resulting strain was named M. alcaliphilum 20ZDP3
(ΔectDΔectRΔdoeA).
To investigate the eect of DoeA, ask culture was car-
ried out with M. alcaliphilum 20ZDP2 and the newly
constructed M. alcaliphilum 20ZDP3. Intracellular and
extracellular ectoine levels were measured; however,
extracellular ectoine was barely detectable under these
conditions. e time-course cultivation prole of each
strain is shown in Fig. 2. Until 48 h, cell growth and
ectoine production was similar in DP2 and DP3; how-
ever, after 72h, their production trends were very dier-
ent. e biomass (DCW) in DP3 was 1.7-fold lower than
that in DP2 at 72h. In contrast, DP3 produced ectoine up
to 102mg/L for 72h and maintained it without degrada-
tion, whereas DP2 produced ectoine up to 90mg/L for
48h, which then rapidly decreased. ese results dem-
onstrate that the ectoine can be degraded by DoeA and
re-used for synthesizing cell constituents. erefore, not
only was the maximum ectoine production improved
by up to 1.2-fold, but ectoine degradation that occurred
after the mid-exponential phase was also completely pre-
vented by disrupting the doeA gene.
In M. alcaliphilum 20Z, ectoine is synthesized by the
sequential action of EctB, EctA, and EctC (Fig. 1) [17,
18]. ese three genes are organized on the ectABC-
ask operon, and the transcriptional regulation of these
ectoine synthesis genes by EctR has been identied and
described [28]. Notably, two genes encoding L-2,4-di-
aminobutyrate transaminase are present on the chro-
mosome of M. alcaliphilum 20Z, as indicated in Fig.1.
One is located within the ectABC operon, and the other
is located upstream of the doeA gene. Reshetnikov et al.
reported that M. alcaliphilum 20Z possesses the puta-
tive doeA, doeB, doeC and doeD genes, which code for
the enzymes involved in ectoine degradation, and these
genes are aligned in the same direction, forming the
doeBDAC cluster [19]. And it was demonstrated that
DoeA and DoeB are directly involved in the hydrolysis of
ectoine in M. alcaliphilum 20Z through the deletion of
each gene. As there have been no studies on the eect of
ectB or doeD deletion on ectoine synthesis and degrada-
tion, M. alcaliphilum 20ZDP4 (DP2ΔdoeD) and M. alca-
liphilum 20ZDP5 (DP2ΔectB) were constructed (Table1).
Successful deletion of doeD and ectB was conrmed by
PCR for 20ZDP4 and 20ZDP5 strains, respectively (Fig
S1b, Fig S1c). Flask fermentation was carried out using
these newly constructed strains. As shown in Fig. 2b,
Fig. 2 Flask culture of the mutant defective in doeA (M. alcaliphilum
20ZDP3), defective in doeD (M. alcaliphilum 20ZDP4), defective in ectB (M.
alcaliphilum 20ZDP5), and M. alcaliphilum 20ZP2 as a control. The biomass
(a) and ectoine (b) production
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 6 of 12
Lim et al. Microbial Cell Factories (2024) 23:127
the ectoine titer reached 108 mg/L at 96 h and was
maintained in the DP4 strain. Interestingly, the trends
in ectoine production and cell growth in DP4 were very
similar to that in DP3. e observation of similar eects
following the removal of either doeA or doeD may be
attributed to these enzymes sequentially catalyzing the
conversion of ectoine to aspartate in the metabolic path-
way. In contrast, both ectoine production and cell growth
were severely inhibited by deletion of the ectB gene from
M. alcaliphilum 20DP2, suggesting that inhibition of
ectoine production suppressed cell growth under hyper-
osmotic conditions. ese results clearly indicated that
doeD exhibits high activity opposite to that of ectB, and
might be involved in ectoine degradation. Consequently,
ectB is essential for ectoine production, whereas doeD
contributes to ectoine degradation. More importantly,
disruption of doeA or doeD blocked ectoine degradation,
consequently increasing the ectoine titer. Although the
ectoine production and cell growth trends were similar
between DP3 and DP4, slight degradation of ectoine at
120h was found in DP4 (Fig.2b). erefore, M. alcaliphi-
lum DP3, which completely prevented ectoine degrada-
tion, was selected as the nal ectoine producer in this
study.
Eect of copper on cell growth in batch culture
During batch culture of the newly constructed strain
DP3, the ectoine titer was maintained with no degrada-
tion, regardless of cell growth, unlike in the DP2 strain,
which degraded ectoine after 48 h of culture when
approximately 1g/L of biomass (DCW) was produced.
However, after 72h of culture, the growth rate of the
DP3 strain started to slow down compared to that of
DP2, resulting in a 1.7-fold lower biomass production.
To improve ectoine production by stimulating DP3 cell
growth, the optimal concentration of copper, a micro-
mineral that aects cell growth, was determined. Type
I methanotrophs, including M. alcaliphilum 20Z, use
copper as a cofactor of particulate methane monooxy-
genase (pMMO), which mediates the rst step of meth-
ane oxidation and converts methane to methanol; many
studies have investigated the eects of copper addition
on cell growth [29, 30]. Hence, the optimal concentra-
tion of copper (0.01–0.5g/L) was investigated to increase
cell growth. Maximum cell growth was achieved with the
addition of 0.2, and 0.3g/L CuCl2; however, the growth
rate and biomass production were inhibited when more
than 0.4g/L of CuCl2 was added (Fig.3a). In contrast,
ectoine production was almost identical in all experimen-
tal groups regardless of copper concentration and gradu-
ally increased as the cells grew up to 48h, and maintained
the ectoine level without degradation (Fig. 3b). ese
results indicate that addition of copper to the medium
might benet cell growth by promoting methane oxida-
tion but does not aect ectoine production.
Eect of nitrogen source on biomass and ectoine synthesis
in a batch culture
Considering that ectoine was no longer produced by
DP3 strain after 72h (Figs.2 and 3), we presumed that
the specic nutrients necessary for ectoine biosynthesis
were depleted at that point. To investigate the nutrients
required for increase of ectoine production in the DP3
culture, ask culture was performed with M. alcaliphi-
lum 20ZDP3 in an optimized medium with methane for
120h. e main components of the medium, such as K+,
Mg2+, NO3−, and PO43−, were analyzed using ion chro-
matography (Fig S1). e concentrations of K+, Mg2+,
and PO43− were almost constant during culture; however,
NO3−, the only nitrogen source, was completely depleted
when the biomass (DCW) reached about 1 g/L (Fig.2
and Fig S1). Given that the point of complete NO3−
depletion coincides with the point at which ectoine is no
Fig. 3 Eect of copper (Cu) addition on cell growth and ectoine produc-
tion in M. alcaliphilum 20ZDP3. Time course of the biomass (g/L) (a) and
ectoine (mg/L) (b) production from methane by M. alcaliphilum 20ZDP3
cultured in Methylomicrobium medium containing 6% (w/v) NaCl with
0.01, 0.1, 0.2, 0.3, 0.4, and 0.5g/L of CuCl2, respectively
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 7 of 12
Lim et al. Microbial Cell Factories (2024) 23:127
longer produced in the DP3 strain, a sucient supply of
nitrogen sources may be necessary for increased ectoine
biosynthesis. In addition, the lower cell growth rate in
the DP3 strain compared to that in DP2 at the time of
complete depletion of KNO3 after 48h might be caused
by the failure of DP3 in degrading ectoine for reuse as a
nitrogen source (Fig.2 and Fig S1). Nevertheless, as DP3
could grow under nitrogen-starvation conditions, this
strain was considered capable of xing nitrogen in air
and supplying it for cell growth, but not at sucient lev-
els for ectoine synthesis. Methylomicrobium is reported
to demonstrate the potential to utilize atmospheric nitro-
gen gas based on identication of the nif gene cluster and
MoFe-containing nitrogenase activity [31–35].
To evaluate the eect of nitrogen sources on the ectoine
and biomass production by M. alcaliphilum 20ZDP3,
ask culture was conducted using an optimized medium
containing various concentrations of KNO3 (0.5, 1, 2, 5,
and 10g/L). As shown in Fig. 4, the nal ectoine titer
increased as the amount of KNO3 increased, reaching
176.7mg/L when 5g/L KNO3 was added, which was 2.3-
fold higher than that obtained with 1g/L of KNO3. is
indicates that KNO3 plays a key role in ectoine biosynthe-
sis. Meanwhile, the biomass production in all experimen-
tal groups, including that with 5g/L KNO3, was similar
except for that with 0.5g/L KNO3. us, the biomass
did not increase with the concentration of KNO3 in the
medium, and the cells could grow through nitrogen xa-
tion from air, even if the nitrogen source was exhausted.
When 0.5, 1, and 2g/L of KNO3 was supplied, the ectoine
titer did not show any increase although biomass was
produced up to 0.5, 1, and 2g/L, respectively. us, the
point at which the nitrogen source was exhausted and
the point at which ectoine was no longer increased coin-
cided exactly (Fig.4), consistent with the calculation of
the amount of KNO3 required to support cell growth and
ectoine production [36]. In other words, 1g/L of KNO3
per 1g of dry cells was required for ectoine production
proportional to cell growth, maintaining the yield (mg/g
DCW) of ectoine as the cells grow. When the nitrogen
source was abundant, biomass and ectoine were syn-
thesized together; however, when the nitrogen source
was depleted, biomass was produced by the xation of
atmospheric nitrogen gas; however, ectoine, a nitrogen
sink, was no longer produced. Further, various nitrogen
sources, such as NO2−, NH4+, and urea, have been used
to cultivate cells for identifying a nitrogen source use-
ful for cell growth and ectoine production. However, M.
alcaliphilum 20ZDP3 could only use nitrate (NO3−) as a
nitrogen source (data not shown).
We hypothesized that the expression level of ectoine-
degrading proteins in M. alcaliphilum 20ZDP2 might be
regulated by depletion of the KNO3. To conrm that the
increase in ectoine was caused by low expression levels
of ectoine-degrading proteins, such as doeA, doeB, and
doeD according to the supply of nitrogen source, the
transcriptional level of ectoine-degrading genes was esti-
mated by qRT-PCR in the M. alcaliphilum DP2 strain
cultivated in medium containing 1–5g/L of KNO3. To
determine the eect of nitrogen starvation on the tran-
scriptional level of related genes, the cells were harvested
at 72 h when ectoine would have been degraded. e
relative transcriptional levels of doeA, doeB, and doeD
with 5g/L KNO3 were lower than those in samples with
1 g/L KNO3 (0.76-, 0.77-, and 0.64-fold, respectively)
(Fig S3). ese results indicated that nitrogen starvation
induces the transcription of ectoine-degrading genes
and that ectoine may act as a nitrogen sink for M. alca-
liphilum 20Z under nitrogen-rich conditions. erefore,
high ectoine production in proportion to cell growth can
be achieved through a continuous supply of optimized
nitrogen source.
Fig. 4 Comparison of biomass and ectoine production according to the
addition of KNO3 in the medium. Biomass (a) and ectoine (b) production
by M. alcaliphilum 20ZDP3 cultivated in a medium with 0.5, 1, 2, 5, and
10g/L of KNO3, respectively
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 8 of 12
Lim et al. Microbial Cell Factories (2024) 23:127
In previous studies, it was considered meaningless to
grow cells to a high density for the mass production of
ectoine because of ectoine degradation and cessation of
production at a certain growth point [13, 22, 27]; there-
fore, the bio-milking process was performed at a certain
growth point before ectoine degradation. However, by
conrming the key components for ectoine biosynthesis
and optimizing the concentration of the medium com-
ponents, especially nitrogen source, ectoine degrada-
tion could be prevented and ectoine synthesis could be
achieved in proportion to the increase in cell density, as
shown in this study. erefore, the ndings of this study
allow cells to be grow to a high density and achieve high
ectoine production from methane.
Ectoine production in proportion to cell growth by
optimization of culture conditions in a Fed-batch culture
To achieve high production of the ectoine, fed-batch fer-
mentation in optimized Methylomicrobium medium con-
taining 2g/L of KNO3 and 0.3g/L CuCl2 was carried out
with pH control (pH 8.9–9.1) in a 5-L bioreactor using M.
alcaliphilum 20ZDP3. To prevent the depletion of nitro-
gen sources and cofactors, 2g/L of KNO3 and 1X trace
elements were additionally supplied every time the bio-
mass increased by 2 g/L. Biomass was produced up to
16.8g/L for 73h with a growth rate of 0.09 µaverage and
0.19 µmax (Fig.5). As expected, the ectoine titer steadily
increased with the concentration of cells, while maintain-
ing a constant ectoine yield (64–78mg/g DCW) over the
entire period; nally, 1.0g/L of ectoine was produced. To
investigate the feasibility of high ectoine production by
M. alcaliphilum 20ZDP3 without growth inhibition using
higher levels of KNO3, 5g/L KNO3 was added every time
the biomass increased by 2g/L. Here, up to 18g/L of bio-
mass was produced at a rate of 0.1 µaverage and 0.17 µmax;
however, only 0.98g/L ectoine was produced, maintain-
ing the ectoine yield per g DCW (data not shown). ere-
fore an intermittent supply of 2g/L KNO3 was conrmed
to be sucient for ectoine synthesis in proportion to the
increase in cell mass, which was an ecient and econom-
ical condition for fed-batch culture. In summary, ectoine
production with a steady yield as well as high–cell–den-
sity culture was successfully achieved through fed-batch
fermentation by applying the proposed optimal condi-
tions. In this fed-batch culture, we measured the organic
acids expelled from the cells, but organic acids such as
formate, acetate, and lactate were not detected at sig-
nicant levels. is indicates that the culture conditions
used in this study are highly eective at minimizing the
production of by-products.
To estimate the ectoine yield from methane, online gas
chromatography was used. e M. alcaliphilum 20ZDP3
consumed 87.9g of methane for 73h with a yield of 0.04g
ectoine/g methane (Fig.5). Additionally, a yield of 0.6g
biomass/g methane was obtained under the growth con-
ditions, with the remaining methane probably released
as carbon dioxide (data not shown). In this study, only
2.3% (g/g) of supplied methane was assimilated in a 5-L
Fig. 5 Fed-batch cultivation by M. alcaliphilum 20ZDP3 under optimized conditions. Fed-batch was performed with an optimized medium in a 5-L scale
fermenter. For high-cell-density cultivation with a constant yield of ectoine to biomass, 2g/L of KNO3 and 1X trace elements were additionally supplied
every time the biomass increased by 2g/L
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 9 of 12
Lim et al. Microbial Cell Factories (2024) 23:127
bioreactor, which may be due to limited gas-liquid trans-
fer and methanotrophic methane oxidation eciency.
Considering the signicant portion of the carbon ux
that is converted to non-targeted products, further stud-
ies will require bioprocess design, development of novel
bioreactor that overcome the limitations of gas-liquid
mass transfer, and strain engineering with enhanced car-
bon ux to ectoine synthesis.
High production of ectoine by hyperosmotic shock
Ectoine is an osmoprotectant that protects cells from
osmotic pressure. In previous bio-milking studies, it was
possible to accumulate intracellular ectoine in a short
time by subjecting cells to hyperosmotic shock [37].
erefore, a high-density culture was performed in a 5-L
bioreactor to verify this eect.
To conrm the accumulation of ectoine by hyperos-
motic shock after high–cell density fed-batch culture, 50
mL of culture broth was transferred to a 250-mL ask
and an appropriate concentration of NaCl and a nitrogen
source were added to the broth to evaluate the optimal
conditions for ectoine accumulation (6%, 9% (w/v) NaCl;
5, 10g/L KNO3). e cells were cultured with shaking at
30°C for 48h, and harvested every 24h to measure the
amount of intracellular ectoine. e initial ectoine con-
centration after fed-batch fermentation was 697 mg/L,
which showed a signicant (2.3-fold) increase upon add-
ing NaCl and KNO3 (Table 3). In particular, medium
containing 6% (w/v) NaCl showed accumulation of up
to 1.6g/L ectoine without biomass increase, and no dif-
ferences were observed with dierent concentrations of
KNO3. When 9% (w/v) NaCl was added to the medium,
ectoine accumulation and production rates were lower
than those in medium containing 6% (w/v) NaCl. As suf-
cient ectoine was accumulated with 5g/L KNO3 and 6%
(w/v) NaCl, these conditions were applied for fed-batch
fermentation.
To further improve ectoine production, two stages of
fermentation were conducted in a 5-L bioreactor. In the
rst stage, fed-batch fermentation in optimized Methy-
lomicrobium medium was carried out with pH control
(pH 8.9–9.1) using M. alcaliphilum 20ZDP3, and 2g/L
of KNO3 and 1X trace elements were additionally added
for every 2g/L increase in biomass to achieve maximum
possible cells density with a constant ectoine yield. In
the second stage, when cells were determined to have
reached stationary phase and no further cell growth was
considered possible, 5 g/L of KNO3 was supplied, and
NaCl was added to achieve a concentration of 6% (w/v)
to induce intracellular ectoine accumulation by hyper-
osmotic shock. e gas ow rate was lowered from 0.5
vvm to 0.1 vvm, while the ratio of methane to air was
kept constant at 3:7 to minimize the shear stress on the
cells. e cells grew with a growth rate of 0.09 µaverage and
0.19 µmax until the biomass reached 18.7g/L (Fig.6). e
specic growth rate (µ) was the highest in the initial 23h
and then decreased until 54h and remained below 0.03.
Ectoine was produced rapidly at 0.9g/L until 54h and
maintained during rst stage of fermentation as the spe-
cic growth rate decreased. e point at which ectoine
production slowed down owing to decrease of the spe-
cic growth rate coincided with the point at which dis-
solved oxygen in the culture medium rapidly decreased,
remained at 0%, and then began to gradually increased
(data not shown), which is an oxygen-limitation eect
during fermentation. Nevertheless, with additional sup-
plementation with KNO3 and NaCl in the second stage,
1.5g/L of ectoine was accumulated, which was 1.5-fold
higher than that in the rst stage. e ectoine yield per
biomass (mg/g DCW) was remained approximately
Table 3 Ectoine titer (mg/L) accumulated by hyperosmotic shock after stationary phase by addition of 6% (w/v), 9% (w/v) of salinity
and 5g/L, 10g/L of KNO3 in 250-mL ask
KNO3
concentration
(g/L)
NaCl 6% (w/v) NaCl 9% (w/v)
0h 24h 48h 0h 24h 48h
5 697 1593 ± 24 1473 ± 18 697 1161 ± 45 1352 ± 41
10 1546 ± 27 1572 ± 29 1103 ± 36 1326 ± 68
Fig. 6 Two-stage cultivation of M. alcaliphilum 20ZDP3 under optimized
conditions for high cell density (stage 1) and ectoine accumulation (stage
2). In stage 1, fed-batch culture was conducted using the optimized me-
dium and 2g/L of KNO3 and 1X trace elements were supplied additionally
every time the biomass increased by 2g/L until the cells reached a station-
ary phase. In stage 2, 5g/L of KNO3 was supplied and NaCl was added to
adjust the concentration to 6% (w/v) for ectoine accumulation by a hyper-
osmotic shock. Time course of biomass (g/L) and ectoine (g/L) production
by M. alcaliphilum 20ZDP3
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 10 of 12
Lim et al. Microbial Cell Factories (2024) 23:127
63 mg/ g DCW during initial 54 h but it was slightly
decreased afterward (58mg/ g DCW at 75.5 h). While
biomass decreased due to cell lysis caused by hyperos-
motic shock, the ectoine yield per biomass was enhanced
to 93mg/g DCW in Stage 2 of fermentation by hyperos-
motic shock at 24h.
e production of ectoine using methanotrophs is
much lower than that achieved through sugar fermenta-
tion by using Halomonas species, Escherichia coli, and
Corynebacterium glutamicum [20, 38, 39]. However,
this process is meaningful as it combines with the atmo-
spheric reduction of methane, a greenhouse gas that
contributes to global warming. Table 4 compares the
ectoine production from methane from previous reports
and this study. Until now, Cantera et al. [37] reported
the highest titer of ectoine (0.25g/L) by M. alcaliphilum
20Z using the bio-milking process. We had previously
demonstrated that genetically engineered M. alcaliphi-
lum 20Z could produce ectoine up to 0.14g/L with the
yield of 111mg/ g DCW from methane under batch fer-
mentation [22]. Additionally, recent studies have sug-
gested that mixed culture of Methylomicrobium species
were able to produce ectoine up to 105mg/ g DCW and
109mg/ DCW g, respectively [13, 40]. Ngoc Pham et al.
[41] reported ectoine production (38mg/ g DCW) from
methane and lignocellulose-derived sugars (glucose and
xylose) by genetical modication in M. alcaliphilum
20Z. Previous studies on the conversion of methane to
ectoine have focused on the bio-milking process with
wild-type stain, which has a limitation of ectoine deg-
radation with cell growth [13, 22, 27]. In this study, we
constructed M. alcaliphilum 20ZDP3 by removing the
doeA gene responsible for the rst step of ectoine degra-
dation after the cells reached a mid-exponential growth
phase. Ectoine production proportional to cell growth
was then achieved by supplementation with a sucient
nitrogen source, and enhanced ectoine was synthesized
using a hyperosmotic shock and supplying with high salt
and nitrogen after the cells reached a stationary phase.
erefore, the highest ectoine titer obtained using meth-
ane (1.5g/L) was achieved. is result was successfully
accomplished by preventing ectoine degradation in M.
alcaliphilum 20Z. More importantly, this study estab-
lished the critical role of nitrogen sources in the medium
for ectoine production. Additionally, it was found that
the expression of genes related to ectoine degradation
is regulated by the availability of nitrogen sources in the
medium. Considering that the ectoine is a high value-
added product, this strain exhibits an excellent indus-
trial and environmental benet better than other similar
methanotrophs.
Conclusions
In the present study, high ectoine production from meth-
ane was achieved using engineered M. alcaliphilum
20ZDP3 by preventing ectoine degradation. By com-
bining strategies:1) disruption of doeA gene, which is
responsible for the rst step of ectoine degradation, in
M. alcaliphilum 20ZDP2; 2) supplying nitrogen source
for ectoine synthesis in proportion to cell growth; 3) fed-
batch fermentation using M. alcaliphilum DP3 supple-
menting KNO3 and trace element for high cell density
culture (HCDC); 4) hyperosmotic shock after HCDC of
M. alcaliphilum 20ZDP3, ectoine was accumulated up to
1.5g/L with a yield of 93mg/g DCW. e ectoine pro-
duction achieved in this study is the highest among the
methane-based ectoine production using methanotrophs
reported to date. Further improvements in the high-cell-
density cultivation of M. alcaliphilum 20Z strains based
on this study can facilitate eco-friendly and economi-
cal processes for ectoine production by methanotrophs,
beyond the currently expensive sugar-based fermentation
using microorganisms.
Supplementary Information
The online version contains supplementary material available at https://doi.
org/10.1186/s12934-024-02404-2.
Supplementary Material 1
Author contributions
SEL, SC, and JL conceived the study. SEL and SC carried out the experimental
works and coordinated the manuscript draft. YC participated in the
experimental work and analysis. JN and JL reviewed and commented on the
Table 4 Comparison of ectoine production by methanotrophs
Host bacteria Carbon sources Culture mode Ectoine
titer (g/L)
Maximum
ectoine yield
(mg/ g DCW)
Refer-
ences
Methylomicrobium buryatense, Methylomicrobium japanense Methane Batch - 105 [40]
Methylomicrobium alcaliphilum 20Z Methane Bio-milking 0.25 - [37]
Methylomicrobium alcaliphilum 20Z Methane, Xylose,
Glucose
Batch - 38 [41]
Methylomicrobium alcaliphilum 20Z, mixed haloalkaiphilic
consortium
Biogas Continuous - 109 [13]
Methylomicrobium alcaliphilum 20ZDP2 Methane Batch 0.14 111 [22]
Methylomicrobium alcaliphilum 20ZDP3 Methane Fed-batch 1.50 93 This study
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 11 of 12
Lim et al. Microbial Cell Factories (2024) 23:127
manuscript. JL participated in its design and coordination of the manuscript
draft. All authors read and approved the nal manuscript.
Funding
This research was supported by C1 Gas Renery Program through the National
Research Foundation of Korea (NRF) funded by the Ministry of Science and ICT
(2015M3D3A1A01064929).
Data availability
No datasets were generated or analysed during the current study.
Declarations
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Received: 19 March 2024 / Accepted: 24 April 2024
References
1. Meraz JL, Abel AJ, Clark DS, Criddle CS. Biological conversion of methane to
bioplastics: kinetics, stoichiometry, and thermodynamic considerations for
process optimization. Chem Eng J. 2023;454:140166.
2. Tollefson J. Scientists raise alarm over’dangerously fast’growth in atmospheric
methane. Nature. 2022.
3. Cantera S, Muñoz R, Lebrero R, López JC, Rodríguez Y, García-Encina PA.
Technologies for the bioconversion of methane into more valuable products.
Curr Opin Biotechnol. 2018;50:128–35.
4. Hwang IY, Nguyen AD, Nguyen TT, Nguyen LT, Lee OK, Lee EY. Biological con-
version of methane to chemicals and fuels: technical challenges and issues.
Appl Microbiol Biotechnol. 2018;102(7):3071–80.
5. Cantera S, Bordel S, Lebrero R, Gancedo J, García-Encina PA, Muñoz R. Bio-
conversion of methane into high prot margin compounds: an innovative,
environmentally friendly and cost-eective platform for methane abatement.
World J Microbiol Biotechnol. 2019;35(16):1–10.
6. Nguyen DTN, Lee OK, Nguyen TT, Lee EY. Type II methanotrophs: a promising
microbial cell-factory platform for bioconversion of methane to chemicals.
Biotechnol Adv. 2021;47:107700.
7. Strong PJ, Xie S, Clarke WP. Methane as a resource: can the methanotrophs
add value? Environ Sci Technol. 2015;49(7):4001–18.
8. Pieja AJ, Morse MC, Cal AJ. Methane to bioproducts: the future of the bio-
economy? Curr Opin Chem Biol. 2017;41:123–31.
9. Cantera S, Sánchez-Andrea I, Lebrero R, García-Encina PA, Stams AJM, Muñoz
R. Multi-production of high added market value metabolites from diluted
methane emissions via methanotrophic extremophiles. Bioresour Technol.
2018;267:401–7.
10. Strong PJ, Kalyuzhnaya M, Silverman J, Clarke WP. A methanotroph-based bio-
renery: potential scenarios for generating multiple products from a single
fermentation. Bioresour Technol. 2016;215:314–23.
11. López JC, Rodríguez Y, Pérez V, Lebrero R, Muñoz R. CH4-Based polyhydroxy-
alkanoate production: a step further towards a sustainable bioeconomy.
In: Kalia VC, editor. Biotechnological applications of Polyhydroxyalkanoates.
Singapore: Springer Singapore; 2019. pp. 283–321.
12. Pérez V, Moltó JL, Lebrero R, Muñoz R. Ectoine production from biogas: a sen-
sitivity analysis. Eect of local commodity prices, economy of scale, market
trends and biotechnological limitations. J Clean Prod. 2022;369:133440.
13. Cantera S, Phandanouvong-Lozano V, Pascual C, García-Encina PA, Lebrero R,
Hay A, et al. A systematic comparison of ectoine production from upgraded
biogas using Methylomicrobium alcaliphilum and a mixed haloalkaliphilic
consortium. Waste Manage. 2020;102:773–81.
14. Ma Z, Wu C, Zhu L, Chang R, Ma W, Deng Y, et al. Bioactivity proling of the
extremolyte ectoine as a promising protectant and its heterologous produc-
tion. 3 Biotech. 2022;12(12):331.
15. Pastor JM, Salvador M, Argandoña M, Bernal V, Reina-Bueno M, Csonka LN, et
al. Ectoines in cell stress protection: uses and biotechnological production.
Biotechnol Adv. 2010;28(6):782–801.
16. Pérez V, Moltó JL, Lebrero R, Muñoz R. Ectoine production from biogas in
waste treatment facilities: a techno-economic and sensitivity analysis. ACS
Sustainable Chem Eng. 2021;9(51):17371–80.
17. Vuilleumier S, Khmelenina VN, Bringel F, Reshetnikov AS, Lajus A, Mangenot
S, et al. Genome sequence of the Haloalkaliphilic Methanotrophic Bacterium
Methylomicrobium alcaliphilum 20Z. J Bacteriol. 2012;194(2):551–2.
18. Reshetnikov AS, Khmelenina VN, Trotsenko YA. Characterization of the
ectoine biosynthesis genes of haloalkalotolerant obligate methanotroph
Methylomicrobium alcaliphilum 20Z. Arch Microbiol. 2006;184(5):286–97.
19. Reshetnikov AS, Rozova ON, Trotsenko YA, But SY, Khmelenina VN, Mustakhi-
mov II. Ectoine degradation pathway in halotolerant methylotrophs. PLoS
ONE. 2020;15(4):e0232244.
20. Zhao Q, Li S, Lv P, Sun S, Ma C, Xu P, et al. High ectoine production by an engi-
neered Halomonas hydrothermalis Y2 in a reduced salinity medium. Microb
Cell Fact. 2019;18:1–12.
21. Sauer T, Galinski EA. Bacterial milking: a novel bioprocess for production of
compatible solutes. Biotechnol Bioeng. 1998;59(1):128.
22. Cho S, Lee YS, Chai H, Lim SE, Na JG, Lee J. Enhanced production of ectoine
from methane using metabolically engineered Methylomicrobium alcaliphi-
lum 20Z. Biotechnol Biofuels Bioprod. 2022;15(1):1–13.
23. Puri AW, Owen S, Chu F, Chavkin T, Beck DA, Kalyuzhnaya MG, et al. Genetic
tools for the industrially promising methanotroph Methylomicrobium bury-
atense. Appl Environ Microbiol. 2015;81(5):1775–81.
24. Cho S, Ha S, Kim HS, Han JH, Kim H, Yeon YJ, et al. Stimulation of cell growth
by addition of tungsten in batch culture of a methanotrophic bacterium,
Methylomicrobium alcaliphilum 20Z on methane and methanol. J Biotechnol.
2020;309:81–4.
25. Jörg Kunte H, Galinski EA, Trüper HG. A modied FMOC-method for the
detection of amino acid-type osmolytes and tetrahydropyrimidines
(ectoines). J Microbiol Methods. 1993;17(2):129–36.
26. Varão Moura A, Aparecido Rosini Silva A, Domingos Santo da Silva J,
Aleixo Leal Pedroza L, Bornhorst J, Stiboller M, et al. Determination of
ions in Caenorhabditis elegans by ion chromatography. J Chromatogr B.
2022;1204:123312.
27. Cantera S, Lebrero R, Rodríguez E, García-Encina PA, Muñoz R. Continuous
abatement of methane coupled with ectoine production by Methylomi-
crobium alcaliphilum 20Z in stirred tank reactors: a step further towards
greenhouse gas bioreneries. J Clean Prod. 2017;152:134–41.
28. Mustakhimov II, Reshetnikov AS, Glukhov AS, Khmelenina VN, Kalyuzh-
naya MG, Trotsenko YA. Identication and characterization of EctR1, a
new transcriptional regulator of the ectoine biosynthesis genes in the
halotolerant methanotroph Methylomicrobium alcaliphilum 20Z. J Bacteriol.
2010;192(2):410–7.
29. Cantera S, Lebrero R, García-Encina PA, Muñoz R. Evaluation of the inuence
of methane and copper concentration and methane mass transport on
the community structure and biodegradation kinetics of methanotrophic
cultures. J Environ Manage. 2016;171:11–20.
30. Chistoserdova L. Modularity of methylotrophy, revisited. Environ Microbiol.
2011;13(10):2603–22.
31. Hu L, Yang Y, Yan X, Zhang T, Xiang J, Gao Z, et al. Molecular mechanism asso-
ciated with the impact of methane/oxygen gas supply ratios on cell growth
of Methylomicrobium buryatense 5GB1 through RNA-Seq. Front Bioeng
Biotechnol. 2020;8:263.
32. Jung G-Y, Rhee S-K, Han Y-S, Kim S-J. Genomic and physiological properties
of a facultative methane-oxidizing bacterial strain of Methylocystis sp. from a
wetland. Microorganisms. 2020;8(11):1719.
33. Dedysh SN, Liesack W, Khmelenina VN, Suzina NE, Trotsenko YA, Semrau
JD, et al. Methylocella palustris gen. nov., sp. nov., a new methane-oxidizing
acidophilic bacterium from peat bogs, representing a novel subtype of
serine-pathway methanotrophs. Int J Syst Evol Microbiol. 2000;50(3):955–69.
34. Auman AJ, Speake CC, Lidstrom ME. nifH sequences and Nitrogen
xation in type I and type II methanotrophs. Appl Environ Microbiol.
2001;67(9):4009–16.
35. Guo S, Zhang T, Chen Y, Yang S, Fei Q. Transcriptomic proling of nitrogen
xation and the role of NifA in Methylomicrobium buryatense 5GB1. Appl
Microbiol Biotechnol. 2022;106(8):3191–9.
36. Akberdin IR, Thompson M, Hamilton R, Desai N, Alexander D, Henard CA, et
al. Methane utilization in Methylomicrobium alcaliphilum 20ZR: a systems
approach. Sci Rep. 2018;8(1):2512.
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

Page 12 of 12
Lim et al. Microbial Cell Factories (2024) 23:127
37. Cantera S, Lebrero R, Rodríguez S, García-Encina PA, Muñoz R. Ectoine
bio-milking in methanotrophs: a step further towards methane-based bio-
reneries into high added-value products. Chem Eng J. 2017;328:44–8.
38. Zhang H, Liang Z, Zhao M, Ma Y, Luo Z, Li S, et al. Metabolic Engineering
of Escherichia coli for Ectoine Production with a fermentation strategy of
supplementing the amino donor. Front Bioeng Biotechnol. 2022;10:9.
39. Gießelmann G, Dietrich D, Jungmann L, Kohlstedt M, Jeon EJ, Yim SS, et
al. Metabolic Engineering of Corynebacterium glutamicum for High-Level
Ectoine production: design, Combinatorial Assembly, and implementation
of a transcriptionally balanced Heterologous Ectoine Pathway. Biotechnol J.
2019;14(9):e1800417.
40. Carmona-Martínez AA, Marcos-Rodrigo E, Bordel S, Marín D, Herrero-Lobo R,
García-Encina PA, et al. Elucidating the key environmental parameters during
the production of ectoines from biogas by mixed methanotrophic consortia.
J Environ Manage. 2021;298:113462.
41. Ngoc Pham D, Duc Nguyen A, Hoang Anh Mai D, Yeol Lee E. Development
of a novel methanotrophic platform to produce ectoine from methane and
lignocellulose-derived sugars. Chem Eng J. 2023;463:142361.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional aliations.
Content courtesy of Springer Nature, terms of use apply. Rights reserved.

1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com