Available via license: CC BY 4.0
Content may be subject to copyright.
Citation: González-Cabanelas, D.;
Perreca, E.; Rohwer, J.M.; Schmidt, A.;
Engl, T.; Raguschke, B.; Gershenzon,
J.; Wright, L.P. Deoxyxylulose
5-Phosphate Synthase Does Not Play
a Major Role in Regulating the
Methylerythritol 4-Phosphate
Pathway in Poplar. Int. J. Mol. Sci.
2024,25, 4181. https://doi.org/
10.3390/ijms25084181
Academic Editor: Abir U.
Igamberdiev
Received: 21 February 2024
Revised: 26 March 2024
Accepted: 29 March 2024
Published: 10 April 2024
Copyright: © 2024 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
International Journal of
Molecular Sciences
Article
Deoxyxylulose 5-Phosphate Synthase Does Not Play a Major
Role in Regulating the Methylerythritol 4-Phosphate Pathway
in Poplar
Diego González-Cabanelas 1, Erica Perreca 1, *,† , Johann M. Rohwer 2, Axel Schmidt 1, Tobias Engl 3,
Bettina Raguschke 1, Jonathan Gershenzon 1and Louwrance P. Wright 1,‡
1Department of Biochemistry, Max Plank Institute for Chemical Ecology, Hans-Knöll-Straße 8, 07745 Jena,
Germany; dgc87bueu@gmail.com (D.G.-C.); aschmidt@ice.mpg.de (A.S.); raguschke@ice.mpg.de (B.R.);
gershenzon@ice.mpg.de (J.G.); zeiselhof@tutanota.com (L.P.W.)
2Laboratory for Molecular Systems Biology, Department of Biochemistry, Stellenbosch University,
Private Bag X1, Matieland, Stellenbosch 7602, South Africa; jr@sun.ac.za
3Department of Insect Symbiosis, Max Plank Institute for Chemical Ecology, Hans-Knöll-Straße 8,
07745 Jena, Germany; tengl@ice.mpg.de
*Correspondence: erica.perreca@uni-jena.de
†Current address: Institute of Biodiversity, Friedrich Schiller University Jena, Dornburger Straße 159,
07743 Jena, Germany.
‡Current address: Zeiselhof Research Farm, P.O. Box 35984, Menlo Park, Pretoria 0102, South Africa.
Abstract: The plastidic 2-C-methylerythritol 4-phosphate (MEP) pathway supplies the precursors of
a large variety of essential plant isoprenoids, but its regulation is still not well understood. Using
metabolic control analysis (MCA), we examined the first enzyme of this pathway, 1-deoxyxylulose
5-phosphate synthase (DXS), in multiple grey poplar (Populus
×
canescens) lines modified in their DXS
activity. Single leaves were dynamically labeled with
13
CO
2
in an illuminated, climate-controlled
gas exchange cuvette coupled to a proton transfer reaction mass spectrometer, and the carbon flux
through the MEP pathway was calculated. Carbon was rapidly assimilated into MEP pathway
intermediates and labeled both the isoprene released and the IDP+DMADP pool by up to 90%. DXS
activity was increased by 25% in lines overexpressing the DXS gene and reduced by 50% in RNA
interference lines, while the carbon flux in the MEP pathway was 25–35% greater in overexpressing
lines and unchanged in RNA interference lines. Isoprene emission was also not altered in these
different genetic backgrounds. By correlating absolute flux to DXS activity under different conditions
of light and temperature, the flux control coefficient was found to be low. Among isoprenoid end
products, isoprene itself was unchanged in DXS transgenic lines, but the levels of the chlorophylls
and most carotenoids measured were 20–30% less in RNA interference lines than in overexpression
lines. Our data thus demonstrate that DXS in the isoprene-emitting grey poplar plays only a minor
part in controlling flux through the MEP pathway.
Keywords: isoprene; DXS enzyme; MEP pathway; DMADP; IDP; metabolic control analysis (MCA);
flux control coefficient (FCC); isoprenoid
1. Introduction
Isoprenoids are the largest and structurally most diverse group of low molecular
weight metabolites in living organisms, with a multitude of different functions [
1
,
2
]. De-
spite this structural and functional variety, all isoprenoids are derived from the same
five-carbon building blocks, isopentenyl diphosphate (IDP) and its isomer dimethylallyl
diphosphate (DMADP) [
3
–
8
]. These five-carbon precursors can be synthesized via two
different pathways in plants: the mevalonic acid (MVA) pathway and the 2-C-methyl-
methyleritritol-4-phosphate (MEP) pathway [
4
,
5
,
7
–
9
]. Unlike in other living organisms,
Int. J. Mol. Sci. 2024,25, 4181. https://doi.org/10.3390/ijms25084181 https://www.mdpi.com/journal/ijms
Int. J. Mol. Sci. 2024,25, 4181 2 of 23
these two independent pathways coexist within the same cell, but in different compart-
ments. While the cytosolic MVA pathway produces IDP and DMADP as precursors
for sesquiterpenes, sterols, brassinosteroids, protein farnesylation, and cytokinin biosyn-
thesis, among others, the plastidic MEP pathway is responsible for the biosynthesis of
photosynthesis-related isoprenoids (carotenoids and the side chains of chlorophylls, plas-
toquinones, and tocopherols), hormones (gibberellins and abscisic acid), and a wealth of
monoterpenes and diterpenes [
1
,
10
–
14
]. While previous studies showed a limited exchange
of common intermediates between both pathways, this exchange is not capable of rescuing
a pharmacological block in either pathway [
11
,
15
–
17
], suggesting an important role of the
MEP pathway as the source of precursors for essential plastid isoprenoids.
The seven steps of the MEP pathway begin with 1-deoxy-D-xylulose-5-phosphate
(DXP) synthase (DXS), which catalyzes the condensation of the precursors glyceraldehyde
3-phosphate (GAP) and pyruvate (PYR) into DXP [
18
,
19
]. DXP is then reduced by DXP
reductoisomerase (DXR) to 2-C-methyl-D-erythritol-2,4-phospate (MEP) and further con-
verted in three steps to 2-C-methyl-D-erythritol-2,4-cyclodiphosphate (MEcDP). MEcDP
is successively reduced to (E)-4-hydroxy-3-methylbut-2-enyl 4-diphosphate (HMBDP),
catalyzed by HMBDP synthase (HDS), and then to a mixture of IDP and DMADP, catalyzed
by HMBDP reductase (HDR) [
20
,
21
] (Figure 1). Some of these intermediates are involved
in complex signaling cascades from plastids to the nucleus [22–27].
Int. J. Mol. Sci. 2024, 25, x FOR PEER REVIEW 2 of 25
two independent pathways coexist within the same cell, but in different compartments.
While the cytosolic MVA pathway produces IDP and DMADP as precursors for sesquit-
erpenes, sterols, brassinosteroids, protein farnesylation, and cytokinin biosynthesis,
among others, the plastidic MEP pathway is responsible for the biosynthesis of photosyn-
thesis-related isoprenoids (carotenoids and the side chains of chlorophylls, plastoqui-
nones, and tocopherols), hormones (gibberellins and abscisic acid), and a wealth of mon-
oterpenes and diterpenes [1,10–14]. While previous studies showed a limited exchange of
common intermediates between both pathways, this exchange is not capable of rescuing
a pharmacological block in either pathway [11,15–17], suggesting an important role of the
MEP pathway as the source of precursors for essential plastid isoprenoids.
The seven steps of the MEP pathway begin with 1-deoxy-
D
-xylulose-5-phosphate
(DXP) synthase (DXS), which catalyzes the condensation of the precursors glyceraldehyde
3-phosphate (GAP) and pyruvate (PYR) into DXP [18,19]. DXP is then reduced by DXP
reductoisomerase (DXR) to 2-C-methyl-
D
-erythritol-2,4-phospate (MEP) and further con-
verted in three steps to 2-C-methyl-
D
-erythritol-2,4-cyclodiphosphate (MEcDP). MEcDP
is successively reduced to (E)-4-hydroxy-3-methylbut-2-enyl 4-diphosphate (HMBDP),
catalyzed by HMBDP synthase (HDS), and then to a mixture of IDP and DMADP, cata-
lyzed by HMBDP reductase (HDR) [20,21] (Figure 1). Some of these intermediates are in-
volved in complex signaling cascades from plastids to the nucleus [22–27].
Once the biosynthetic steps of the MEP pathway were elucidated, researchers began
to study the regulation of this pathway [28]. Regulatory control has been found to be ex-
erted at different steps and different levels [24,29–33] and to vary under different environ-
mental conditions such as drought and herbivore attack [34,35]. Major insights came from
studies on the model plant Arabidopsis thaliana, where diverse experimental evidence
demonstrates that the first step, DXS, is a critical regulation point [29,36]. Analysis of
transgenic lines with altered DXS levels show increased or decreased levels of various
isoprenoids end products including chlorophylls, carotenoids or tocopherols [37,38]. Sim-
ilar results have been obtained in other plants including tomato [39,40], potato [41], and
ginkgo [42].
Figure 1. Scheme of the two isoprenoid biosynthesis pathways in the plant cell (modified after Ro-
driguez-Concepcion (2006) [14]). The MEP pathway is depicted in the bright green box inside the
plastid. Dashed arrows indicate multiple steps. The question mark indicates that the extent of
Figure 1. Scheme of the two isoprenoid biosynthesis pathways in the plant cell (modified after
Rodriguez-Concepcion (2006) [
14
]). The MEP pathway is depicted in the bright green box inside
the plastid. Dashed arrows indicate multiple steps. The question mark indicates that the extent
of IDP+DMADP exchange between compartments is uncertain. MVA, mevalonic acid; AACT, ace-
toacetyl CoA thiolase; HMGS, hydroxymethylglutaryl (HMG) CoA synthase; HMGR, HMG-CoA
reductase; IDP, isopentenyl diphosphate; DMADP, dimethylallyl diphosphate; IDI, IDP isomerase;
GAP, glyceraldehyde phosphate; MEP, methylerythritol phosphate; DXP, deoxyxylulose phosphate;
DXS, DXP synthase; DXR, DXP reductoisomerase; MCT, MEP cytidylyltransferase; ME-CDP, cyti-
dine diphosphomethylerythritol; CMK, ME-CDP kinase; MEP-CDP, ME-CDP phosphate; MEcDP,
methylerythritol cyclodiphosphate; MDS, MEcDP synthase; HMBDP, hydroxymethylbutenyl diphos-
phate; HDS, HMBDP synthase; HDR, HMBDP reductase; ISPS, isoprene synthase; GGDP, geranylger-
anyl diphosphate; GGDPS, GGDP synthase; FDP, farnesyl diphosphate; ABA, abscisic acid.
Int. J. Mol. Sci. 2024,25, 4181 3 of 23
Once the biosynthetic steps of the MEP pathway were elucidated, researchers began to
study the regulation of this pathway [
28
]. Regulatory control has been found to be exerted
at different steps and different levels [
24
,
29
–
33
] and to vary under different environmental
conditions such as drought and herbivore attack [
34
,
35
]. Major insights came from studies
on the model plant Arabidopsis thaliana, where diverse experimental evidence demonstrates
that the first step, DXS, is a critical regulation point [
29
,
36
]. Analysis of transgenic lines
with altered DXS levels show increased or decreased levels of various isoprenoids end
products including chlorophylls, carotenoids or tocopherols [
37
,
38
]. Similar results have
been obtained in other plants including tomato [39,40], potato [41], and ginkgo [42].
Most of the research on the regulation of the MEP pathway was done in herbaceous
plants, which in general do not emit the C
5
gas isoprene, derived directly from DMADP.
Isoprene is a volatile organic compound (VOC) that represents a major fraction of all
hydrocarbons released to the atmosphere [
43
–
45
]. Isoprene has long been studied as a
compound that protects plants during high temperature and oxidative stress [46–50], and
it has been featured in studies on regulation due to the ease of making rapid, repeatable
measurements of its rate of release from a single plant [
51
]. Isoprene has been implicated
in resilience to high temperature by stabilizing chloroplast membranes [
52
] due to its
suggested ability to partition in the lipid phase [
53
]. Isoprene has also been proposed
to quench reactive oxygen species, such as hydrogen peroxide [
54
], singlet oxygen [
55
],
and reactive nitrogen species [
56
]. For example, the inhibition of isoprene emission after
fosmidomycin treatment of Phragmites australis increases hydrogen peroxide by up to
45% [57].
Isoprene emission from plants is well documented to be highly temperature, light,
and CO
2
dependent [
53
,
54
,
58
] and to be affected by stress conditions like drought or
nutritional constraints [
59
–
61
]. In addition, it has been known for many years that in
trees such as aspen and poplar, isoprene may represent the bulk of the MEP pathway
carbon flux in mature leaves [
62
]. Thus, measuring the isoprene emission rate could be
a powerful tool to analyze carbon flux through the MEP pathway. To follow the flux
into isoprene, labeling methods have been employed, such as exposing plants to
13
CO
2
,
since in photosynthetically-active leaves, the MEP pathway uses metabolites formed from
newly fixed carbon as a substrate [
30
,
34
,
51
,
63
,
64
]. Flux measurements in combination
with determining the activities of specific enzymes in the MEP pathway can be used to
calculate flux control coefficients (FCCs), which indicates the degree of control that each
enzyme exerts on flux through a metabolic pathway [
65
–
68
]. Measurement of FCC typically
involves the manipulation of enzymatic activity by genetic or biochemical methods to
determine the effect of fractional changes in activity on fractional changes in carbon flux or
metabolite concentration.
Here, we estimated the flux control of DXS in the MEP pathway under different
environmental conditions in young leaves of grey poplar trees (Populus
×
canescens) via
in vivo 13
C-labeling. We established transgenic DXS lines and measured their isoprene
emissions, the incorporation of isotopic label into isoprene, and the pool sizes of the main
metabolites from the MEP pathway (DXP, MEcDP, and IDP+DMADP), which allowed us to
calculate the carbon flux through the MEP pathway and then the FCC of DXS. In the DXS
transgenic lines, we not only measured isoprene emission, but also the accumulation of
non-volatile isoprenoids, including the chlorophylls and major carotenoids. Using these
two approaches, we conclude that DXS is not a major rate-controlling enzyme of the MEP
pathway in photosynthetically-active leaves of poplar.
2. Results
2.1. Varying Light and Temperature Conditions Have Significant Effects on Isoprene Emission
To determine if variable MEP pathway flux rates in grey poplar could be achieved
under different environmental conditions, we first measured how light and temperature
affect a well-known marker for MEP pathway flux—the isoprene emission. Light and
temperature have frequently been described as influencing the emission of isoprene in other
Int. J. Mol. Sci. 2024,25, 4181 4 of 23
species [
54
,
58
,
69
]. In grey poplar, we measured isoprene emission under light intensities
of 1000 or 250
µ
mol m
−2
s
−1
of incident photosynthetically-active quantum flux density
(PPFD) and temperatures of 30
◦
C or 21
◦
C. Isoprene emission varied significantly under
the different environmental conditions tested (p= 0.00307, one-way ANOVA), showing a
higher emission rate under high light (1000 PPFD) and high temperature (30
◦
C) conditions,
compared with low light (250 PPFD) and low temperature (21 ◦C) conditions (Figure 2).
Int. J. Mol. Sci. 2024, 25, x FOR PEER REVIEW 4 of 25
temperature have frequently been described as influencing the emission of isoprene in
other species [54,58,69]. In grey poplar, we measured isoprene emission under light inten-
sities of 1000 or 250 µmol m−2 s−1 of incident photosynthetically-active quantum flux den-
sity (PPFD) and temperatures of 30 °C or 21 °C. Isoprene emission varied significantly
under the different environmental conditions tested (p = 0.00307, one-way ANOVA), show-
ing a higher emission rate under high light (1000 PPFD) and high temperature (30 °C) con-
ditions, compared with low light (250 PPFD) and low temperature (21 °C) conditions (Figure
2).
Figure 2. Effect of varying light and temperature conditions on isoprene emission in wild-type grey
poplar under 1000 or 250 µmol m−2 s−1 of incident photosynthetically-active quantum flux density
(PPFD) and a temperature of 30 °C or 21 °C and 380 µL L−1 CO2. Emission of isoprene was normal-
ized to the leaf area. Means of n = 5 ± SE are shown. Significance differences (one-way ANOVA
followed by Tukey’s test) at p < 0.05 are indicated with different letters.
2.2. The MEP Pathway to Isoprene Maintains Metabolic Steady State during 13CO2 Labeling
Next, we evaluated whether 13CO2 labeling in grey poplar leaves could be used to
track the carbon flux in the MEP pathway. For each of the environmental conditions tested
above, short-term kinetic labeling was performed in a dynamic flow cuvette with a proton
transfer reaction mass spectrometer (PTR-MS) and a portable photosynthesis system at-
tached. The incorporation of a 13C label into isoprene is depicted for one of these condi-
tions in Figure 3. The 13C incorporation was evident after only a few minutes. The isoprene
isotopologue with all five carbon atoms labeled became the major species present at about
10 min. Total 13C incorporation in the isoprene reached between 85–95% of labeling after
20 min in a 13CO2 atmosphere (Figure 3).
Figure 2. Effect of varying light and temperature conditions on isoprene emission in wild-type
grey poplar under 1000 or 250
µ
mol m
−2
s
−1
of incident photosynthetically-active quantum flux
density (PPFD) and a temperature of 30
◦
C or 21
◦
C and 380
µ
L L
−1
CO
2
. Emission of isoprene
was normalized to the leaf area. Means of n= 5
±
SE are shown. Significance differences (one-way
ANOVA followed by Tukey’s test) at p< 0.05 are indicated with different letters.
2.2. The MEP Pathway to Isoprene Maintains Metabolic Steady State during 13CO2Labeling
Next, we evaluated whether
13
CO
2
labeling in grey poplar leaves could be used to
track the carbon flux in the MEP pathway. For each of the environmental conditions
tested above, short-term kinetic labeling was performed in a dynamic flow cuvette with
a proton transfer reaction mass spectrometer (PTR-MS) and a portable photosynthesis
system attached. The incorporation of a
13
C label into isoprene is depicted for one of these
conditions in Figure 3. The
13
C incorporation was evident after only a few minutes. The
isoprene isotopologue with all five carbon atoms labeled became the major species present
at about 10 min. Total
13
C incorporation in the isoprene reached between 85–95% of labeling
after 20 min in a 13CO2atmosphere (Figure 3).
Isoprene is formed in a single enzyme-catalyzed step from the last metabolite of the MEP
pathway, DMADP. Our measurements of the
13
C’s incorporation into the chromatographically-
inseparable IDP+DMADP pool after 50 min under
13
CO
2
atmosphere show label incorpora-
tion similar to that of isoprene (p
13C
incorporation = 0.941, two-way ANOVA) (Figure 4),
making isoprene emission an accurate tool to track carbon flux in the MEP pathway of grey
poplar leaves, as in other species [
70
,
71
]. In addition to being a product of the MEP pathway
in the plastids, DMADP is also produced in the cytosol via the mevalonate pathway from
acetyl-CoA. The fact that 85–95% of the total IDP+DMADP pool in the cell can be labeled
via
13
CO
2
suggests that the mevalonate pathway is scarcely active in the leaves measured.
An active mevalonate pathway would reduce the incorporation in IDP+DMADP of the
label from
13
CO
2
, but not affect
13
C labeling in isoprene, which is produced in the plastids
from DMADP derived from the MEP pathway [72–74].
Int. J. Mol. Sci. 2024,25, 4181 5 of 23
Int. J. Mol. Sci. 2024, 25, x FOR PEER REVIEW 5 of 25
Figure 3. Dynamics of
13
C incorporation into isoprene in WT P. × canescens leaves under one set of
environmental conditions, 1000 PPFD and 30 °C. Leaves were fed for 50 min with 380 µL L
−1
13
CO
2
,
99.9%.
13
C labeling began at 0 min. The isotopologue masses of isoprene are shown using different
colors, representing the incorporation of different numbers of
13
C-labeled carbon atoms: red,
13
C
0
;
purple,
13
C
1
; blue,
13
C
2
; green,
13
C
3
; yellow,
13
C
4
; orange,
13
C
5
. The dashed black line represents the
overall
13
C labeling incorporation over the time.
Isoprene is formed in a single enzyme-catalyzed step from the last metabolite of the
MEP pathway, DMADP. Our measurements of the
13
C’s incorporation into the chromato-
graphically-inseparable IDP+DMADP pool after 50 min under
13
CO
2
atmosphere show
label incorporation similar to that of isoprene (p
13C
incorporation = 0.941, two-way
ANOVA) (Figure 4), making isoprene emission an accurate tool to track carbon flux in the
MEP pathway of grey poplar leaves, as in other species [70,71]. In addition to being a
product of the MEP pathway in the plastids, DMADP is also produced in the cytosol via
the mevalonate pathway from acetyl-CoA. The fact that 85–95% of the total IDP+DMADP
pool in the cell can be labeled via
13
CO
2
suggests that the mevalonate pathway is scarcely
active in the leaves measured. An active mevalonate pathway would reduce the incorpo-
ration in IDP+DMADP of the label from
13
CO
2
, but not affect
13
C labeling in isoprene,
which is produced in the plastids from DMADP derived from the MEP pathway [72–74].
Figure 4. Incorporation of
13
C into IDP+DMADP (orange) and isoprene (light red) in WT P. × ca-
nescens leaves after feeding them for 50 min with 380 µL L
−1
13
CO
2
, 99.9%, under different conditions
of light (1000 or 250 PPFD) and temperature (30 or 21 °C). Shown are means (±SE) of five biological
replicates.
Figure 3. Dynamics of
13
C incorporation into isoprene in WT P.
×
canescens leaves under one set of
environmental conditions, 1000 PPFD and 30
◦
C. Leaves were fed for 50 min with 380
µ
L L
−1 13
CO
2
,
99.9%.
13
C labeling began at 0 min. The isotopologue masses of isoprene are shown using different
colors, representing the incorporation of different numbers of
13
C-labeled carbon atoms: red,
13
C
0
;
purple,
13
C
1
; blue,
13
C
2
; green,
13
C
3
; yellow,
13
C
4
; orange,
13
C
5
. The dashed black line represents the
overall 13C labeling incorporation over the time.
Int. J. Mol. Sci. 2024, 25, x FOR PEER REVIEW 5 of 25
Figure 3. Dynamics of
13
C incorporation into isoprene in WT P. × canescens leaves under one set of
environmental conditions, 1000 PPFD and 30 °C. Leaves were fed for 50 min with 380 µL L
−1
13
CO
2
,
99.9%.
13
C labeling began at 0 min. The isotopologue masses of isoprene are shown using different
colors, representing the incorporation of different numbers of
13
C-labeled carbon atoms: red,
13
C
0
;
purple,
13
C
1
; blue,
13
C
2
; green,
13
C
3
; yellow,
13
C
4
; orange,
13
C
5
. The dashed black line represents the
overall
13
C labeling incorporation over the time.
Isoprene is formed in a single enzyme-catalyzed step from the last metabolite of the
MEP pathway, DMADP. Our measurements of the
13
C’s incorporation into the chromato-
graphically-inseparable IDP+DMADP pool after 50 min under
13
CO
2
atmosphere show
label incorporation similar to that of isoprene (p
13C
incorporation = 0.941, two-way
ANOVA) (Figure 4), making isoprene emission an accurate tool to track carbon flux in the
MEP pathway of grey poplar leaves, as in other species [70,71]. In addition to being a
product of the MEP pathway in the plastids, DMADP is also produced in the cytosol via
the mevalonate pathway from acetyl-CoA. The fact that 85–95% of the total IDP+DMADP
pool in the cell can be labeled via
13
CO
2
suggests that the mevalonate pathway is scarcely
active in the leaves measured. An active mevalonate pathway would reduce the incorpo-
ration in IDP+DMADP of the label from
13
CO
2
, but not affect
13
C labeling in isoprene,
which is produced in the plastids from DMADP derived from the MEP pathway [72–74].
Figure 4. Incorporation of
13
C into IDP+DMADP (orange) and isoprene (light red) in WT P. × ca-
nescens leaves after feeding them for 50 min with 380 µL L
−1
13
CO
2
, 99.9%, under different conditions
of light (1000 or 250 PPFD) and temperature (30 or 21 °C). Shown are means (±SE) of five biological
replicates.
Figure 4. Incorporation of
13
C into IDP+DMADP (orange) and isoprene (light red) in WT
P. ×canescens
leaves after feeding them for 50 min with 380
µ
L L
−1 13
CO
2
, 99.9%, under differ-
ent conditions of light (1000 or 250 PPFD) and temperature (30 or 21
◦
C). Shown are means (
±
SE) of
five biological replicates.
2.3. DXS Overexpression or RNA Interference Have No Effect on Transcript Levels of Other MEP
or Mevalonate Pathway Genes
We created transgenic grey poplar lines with altered DXS activity to check the contri-
bution of this enzyme to MEP pathway flux and to look for changes in the accumulation
of isoprenoid end products derived from the MEP pathway. Plant lines with silenced
(iRNA-DXS1) and overexpressing (DXS1+) PcDXS1 genes were compared to wild-type
(WT) and empty vector (EV) lines by quantitative PCR. Since genes in the MEP pathway are
known to follow a diurnal rhythm in plants [
75
,
76
], we measured midday transcript levels.
In general, PcDXS1 and PcDXS2 (p< 0.001, one-way ANOVA), showed altered transcript
levels among overexpression, silenced, and control lines. In PcDXS1 silenced lines, both
PcDXS1 and PcDXS2 transcript levels were 4-fold decreased compared to wild-type and
empty vector control lines (p< 0.001, Tukey’s test) (Figure 5). Meanwhile, in the trans-
Int. J. Mol. Sci. 2024,25, 4181 6 of 23
genic lines overexpressing PcDXS1, transcript levels of PcDXS1 were 5–16 times increased
(
p< 0.001,
Tukey’s test), while PcDXS2 remained unaltered in comparison to the control
plants (p> 0.05, Tukey’s test) (Figure 5). The expression of other selected MEP pathway
genes (PcDXR1 p = 0.360, PcDXR2 p = 0.113, PcCMK p = 0.368; PcHDR p = 0.063, one-way
ANOVAs), as well as mevalonate pathway genes (PcHMGR p = 0.209, PcMVK p = 0.147,
one-way ANOVAs) was not affected by PcDXS1 silencing or overexpression (Supplemental
Figure S1).
Int. J. Mol. Sci. 2024, 25, x FOR PEER REVIEW 6 of 25
2.3. DXS Overexpression or RNA Interference Have No Effect on Transcript Levels of Other
MEP or Mevalonate Pathway Genes
We created transgenic grey poplar lines with altered DXS activity to check the con-
tribution of this enzyme to MEP pathway flux and to look for changes in the accumulation
of isoprenoid end products derived from the MEP pathway. Plant lines with silenced
(iRNA-DXS1) and overexpressing (DXS1+) PcDXS1 genes were compared to wild-type
(WT) and empty vector (EV) lines by quantitative PCR. Since genes in the MEP pathway
are known to follow a diurnal rhythm in plants [75,76], we measured midday transcript
levels. In general, PcDXS1 and PcDXS2 (p < 0.001, one-way ANOVA), showed altered
transcript levels among overexpression, silenced, and control lines. In PcDXS1 silenced
lines, both PcDXS1 and PcDXS2 transcript levels were 4-fold decreased compared to wild-
type and empty vector control lines (p < 0.001, Tukey’s test) (Figure 5). Meanwhile, in the
transgenic lines overexpressing PcDXS1, transcript levels of PcDXS1 were 5–16 times in-
creased (p < 0.001, Tukey’s test), while PcDXS2 remained unaltered in comparison to the
control plants (p > 0.05, Tukey’s test) (Figure 5). The expression of other selected MEP
pathway genes (PcDXR1 p = 0.360, PcDXR2 p = 0.113, PcCMK p = 0.368; PcHDR p = 0.063,
one-way ANOVAs), as well as mevalonate pathway genes (PcHMGR p = 0.209, PcMVK p
= 0.147, one-way ANOVAs) was not affected by PcDXS1 silencing or overexpression (Sup-
plemental Figure S1).
Figure 5. Transcript levels of grey poplar PcDXS1 and PcDXS2 genes at midday in transgenic si-
lenced (iRNA-DXS1-2, iRNA-DXS1-3, iRNA-DXS1-4), and overexpression (DXS1+-5, DXS1+-6,
DXS1+-14, DXS1+-15) lines compared with wild-type (WT) and empty vector (pCam) controls.
Leaves were subjected to 250 µmol m−2 s−1 of incident PPFD, 21 °C leaf temperature and 380 µmol
mol−1 of CO2 for 50 min before taking samples. Relative quantification was performed according to
the efficiency corrected model [77]. Efficiencies were obtained from the slope of dilution curves us-
ing control cDNA diluted from 1 to 1024 times at 4x intervals. Target gene expression was normal-
ized to PcActin2 and fold-change values for each gene were calculated by comparison with the mean
expression of the same gene in wild-type control plants (dark blue). Error bars indicate the SE of
three biological replicates (n = 3) analyzed in triplicate SYBR green assays. Significance differences
(one-way ANOVA followed by Tukey’s test) at p < 0.05 are indicated with different letters.
Figure 5. Transcript levels of grey poplar PcDXS1 and PcDXS2 genes at midday in transgenic silenced
(iRNA-DXS1-2, iRNA-DXS1-3, iRNA-DXS1-4), and overexpression (DXS1+-5,DXS1+-6,DXS1+-14,
DXS1+-15) lines compared with wild-type (WT) and empty vector (pCam) controls. Leaves were
subjected to 250
µ
mol m
−2
s
−1
of incident PPFD, 21
◦
C leaf temperature and 380
µ
mol mol
−1
of CO
2
for 50 min before taking samples. Relative quantification was performed according to the efficiency
corrected model [
77
]. Efficiencies were obtained from the slope of dilution curves using control cDNA
diluted from 1 to 1024 times at 4
×
intervals. Target gene expression was normalized to PcActin2
and fold-change values for each gene were calculated by comparison with the mean expression of
the same gene in wild-type control plants (dark blue). Error bars indicate the SE of three biological
replicates (n= 3) analyzed in triplicate SYBR green assays. Significance differences (one-way ANOVA
followed by Tukey’s test) at p< 0.05 are indicated with different letters.
2.4. DXS-Silenced Lines Have Reduced DXS Enzyme Activity While Overexpression of DXS
Increases Activity
To check whether PcDXS transcript changes cause changes in DXS enzyme activity,
the condensation of pyruvate and glyceraldehyde 3-phosphate to form DXP was measured
in vitro
in extracts of leaves from the different genetic lines that had been kept under
different conditions of light and temperature for 50 min. Statistical analysis showed that
only the genetic background of the line affected the DXS activity (p< 0.001, two-way
ANOVA), while the environmental conditions had no effect (p= 0.101, two-way ANOVA).
After grouping all environmental conditions together, the DXS activity in silenced lines
was 55% lower than the DXS activity in empty vector control plants (p< 0.001, Tukey’s test)
(Figure 6), in correlation with the lower transcript levels of PcDXS1 (Figure 5). On the other
hand, overexpression lines showed an increase of 25% in DXS activity compared with the
empty vector control plants (p= 0.0073, Tukey’s test) despite the much higher increase in
PcDXS transcript levels measured by quantitative PCR (Figure 5).
Int. J. Mol. Sci. 2024,25, 4181 7 of 23
Int. J. Mol. Sci. 2024, 25, x FOR PEER REVIEW 7 of 25
2.4. DXS-Silenced Lines Have Reduced DXS Enzyme Activity While Overexpression of DXS
Increases Activity
To check whether PcDXS transcript changes cause changes in DXS enzyme activity,
the condensation of pyruvate and glyceraldehyde 3-phosphate to form DXP was meas-
ured in vitro in extracts of leaves from the different genetic lines that had been kept under
different conditions of light and temperature for 50 min. Statistical analysis showed that
only the genetic background of the line affected the DXS activity (p < 0.001, two-way
ANOVA), while the environmental conditions had no effect (p = 0.101, two-way ANOVA).
After grouping all environmental conditions together, the DXS activity in silenced lines
was 55% lower than the DXS activity in empty vector control plants (p < 0.001, Tukey’s
test) (Figure 6), in correlation with the lower transcript levels of PcDXS1 (Figure 5). On
the other hand, overexpression lines showed an increase of 25% in DXS activity compared
with the empty vector control plants (p = 0.0073, Tukey’s test) despite the much higher
increase in PcDXS transcript levels measured by quantitative PCR (Figure 5).
Figure 6. In vitro grey poplar DXS activity in PcDXS1 transgenic silenced (green) and overexpres-
sion (blue) lines compared to empty vector control (red) lines. Activity was measured in vitro in
protein extracts obtained from leaves grown under different conditions of light (1000 or 250 PPFD)
and temperature (30 or 21 °C). The quantity of DXP produced was determined using an external
standard curve and normalized to an internal standard of [13C5]DXP. Boxplots show medians, quar-
tiles, and outliers. The sample size of each box is given in Table 1. Boxes are filled according the
different environmental conditions tested. Significance differences (two-way ANOVA followed by
Tukey’s test) at p < 0.05 are indicated with different letters. EC, environmental conditions; TL, trans-
genic lines.
Figure 6.
In vitro
grey poplar DXS activity in PcDXS1 transgenic silenced (green) and overexpression
(blue) lines compared to empty vector control (red) lines. Activity was measured
in vitro
in protein
extracts obtained from leaves grown under different conditions of light (1000 or 250 PPFD) and
temperature (30 or 21
◦
C). The quantity of DXP produced was determined using an external standard
curve and normalized to an internal standard of [
13
C
5
]DXP. Boxplots show medians, quartiles, and
outliers. The sample size of each box is given in Table 1. Boxes are filled according the different
environmental conditions tested. Significance differences (two-way ANOVA followed by Tukey’s test)
at p< 0.05 are indicated with different letters. EC, environmental conditions; TL, transgenic lines.
Table 1. Comparison of carbon flux through the MEP pathway in poplar lines with different DXS
expression determined under different environmental condition. Carbon flux through the MEP
pathway was measured in transgenic DXS1-silenced (RNAi-DXS1) and overexpression (DXS1+) lines
compared to empty vector controls (EV) under different conditions of light (1000 or 250 PPFD) and
temperature (30 or 21
◦
C). The column “n” indicates the number of biological replicates. To calculate
flux, the time course of
13
C label incorporation into isoprene, which closely reflected the labeling of
the IDP+DMADP pool (Figure 4), was fitted to a function that also took the pool sizes of DXP, MEcDP,
and IDP+DMADP as input (see Section 4for details).
Environmental
Condition Plant Line nMaximum Isoprene
Labeling
DXP Pool
Size
MEcDP Pool
Size
IDP/DMADP
Pool Size Flux
pmol mg−1
DW
pmol mg−1
DW
pmol mg−1
DW
pmol min−1
mg−1DW
1000 PPFD
30 ◦C
EV 10 0.912 ±0.007 41.65 ±2.22 85.59 ±14.43 38.09 ±4.01 28.65 ±2.95
RNAi-DXS1 14 0.912 ±0.005 46.01 ±3.86 124.9 ±12.14 47.74 ±4.67 38.94 ±2.62
DXS1+ 18 0.902 ±0.006 58.61 ±3.21 139.4 ±15.89 41.20 ±4.76 38.52 ±2.56
250 PPFD
30 ◦C
EV 10 0.823 ±0.036 28.53 ±1.49 54.98 ±4.06 18.47 ±3.23 15.66 ±1.42
RNAi-DXS1 15 0.870 ±0.008 25.61 ±1.29 46.99 ±2.66 22.03 ±1.68 16.49 ±0.96
DXS1+ 20 0.865 ±0.018 35.97 ±2.55 65.43 ±5.23 19.41 ±2.44 19.69 ±1.24
1000 PPFD
21 ◦C
EV 9 0.932 ±0.008 27.18 ±1.45 48.57 ±6.53 13.64 ±0.78 9.79 ±0.87
RNAi-DXS1 13 0.929 ±0.009 28.64 ±1.96 48.19 ±3.39 19.44 ±1.35 12.15 ±0.55
DXS1+ 16 0.943 ±0.005 33.51 ±1.93 53.36 ±3.79 16.90 ±1.14 13.50 ±0.93
250 PPFD
21 ◦C
EV 8 0.946 ±0.009 21.99 ±1.29 35.74 ±4.54 13.31 ±1.89 7.43 ±0.65
RNAi-DXS1 10 0.940 ±0.005 22.29 ±1.70 36.92 ±3.85 19.57 ±2.04 7.91 ±0.73
DXS1+ 19 0.957 ±0.006 24.59 ±0.97 43.21 ±3.37 13.18 ±1.32 9.55 ±0.64
Int. J. Mol. Sci. 2024,25, 4181 8 of 23
2.5. The Rate of
13
C Incorporation into Isoprene and the Pool Sizes of the Three Major Metabolites
of the MEP Pathway Were Used to Calculate the Carbon Flux
We first checked that the transgenic DXS lines, like our wild-type line (Figure 2),
varied their isoprene emission under different environmental conditions. Transgenic DXS-
silenced (iRNA-DXS1) and overexpression lines (DXS1+) were compared to empty vector
control plants by PTR-MS. Our results indeed showed a significant influence of the tested
conditions (p< 0.0001, GLS model comparison), with an increased emission under higher
light and temperature conditions. However, isoprene emission did not differ significantly
between DXS-silenced or overexpression plants and the controls (p= 0.173, GLS model
comparison, Figure 7), although DXS enzyme activity was 55% lower in silenced lines and
increased by 25% in overexpression lines (Figure 5).
Int. J. Mol. Sci. 2024, 25, x FOR PEER REVIEW 9 of 25
Figure 7. Isoprene emission of grey poplar from transgenic DXS1-silenced (iRNA-DXS1) and over-
expression (DXS1+) lines compared to empty vector controls (Control), under different conditions
of light (1000 or 250 PPFD) and temperature (30 or 21 °C). Boxplots show medians, quartiles, and
outliers. T sample size of each box is given in Table 1. Significance differences (GLS model compar-
ison after sequential factor removal) at p < 0.05 are indicated with different letters. EC, environmen-
tal conditions; TL, transgenic lines.
For flux calculations, it was also necessary to measure the pool sizes of DXP, MEcDP,
and IDP+DMADP, the main metabolites in the MEP pathway. There were few differences
between DXS transgenic and control lines, except under 250 PPFD and 30 °C, in which there
was a significant increase in DXP pools in overexpressing lines compared to the controls (p
= 0.0117, one-way ANOVA). There was also a significant increase in MEcDP pools in over-
expressing lines compared to silenced lines, but not compared with empty vector controls
(p = 0.0441, one-way ANOVAs with correction for multiple testing following Holm [78])
(Figure 8). On the other hand, under 1000 PPFD and 30 °C, the MEcDP pool was significantly
increased in silenced and overexpression lines compared with empty vector controls (p =
0.0464 one-way ANOVA with correction for multiple testing following Holm [78]) (Figure
8). However, in the case of IDP+DMADP pools, we did not find any significant difference
between transgenic lines under the various light and temperature conditions.
Figure 7. Isoprene emission of grey poplar from transgenic DXS1-silenced (iRNA-DXS1) and over-
expression (DXS1+) lines compared to empty vector controls (Control), under different conditions
of light (1000 or 250 PPFD) and temperature (30 or 21
◦
C). Boxplots show medians, quartiles, and
outliers. T sample size of each box is given in Table 1. Significance differences (GLS model comparison
after sequential factor removal) at p< 0.05 are indicated with different letters. EC, environmental
conditions; TL, transgenic lines.
For flux calculations, it was also necessary to measure the pool sizes of DXP, MEcDP,
and IDP+DMADP, the main metabolites in the MEP pathway. There were few differences
between DXS transgenic and control lines, except under 250 PPFD and 30
◦
C, in which
there was a significant increase in DXP pools in overexpressing lines compared to the
controls (p= 0.0117, one-way ANOVA). There was also a significant increase in MEcDP
pools in overexpressing lines compared to silenced lines, but not compared with empty
vector controls (p= 0.0441, one-way ANOVAs with correction for multiple testing following
Holm [
78
]) (Figure 8). On the other hand, under 1000 PPFD and 30
◦
C, the MEcDP
pool was significantly increased in silenced and overexpression lines compared with
empty vector controls (p= 0.0464 one-way ANOVA with correction for multiple testing
following Holm [
78
]) (Figure 8). However, in the case of IDP+DMADP pools, we did
not find any significant difference between transgenic lines under the various light and
temperature conditions.
Int. J. Mol. Sci. 2024,25, 4181 9 of 23
Int. J. Mol. Sci. 2024, 25, x FOR PEER REVIEW 10 of 25
Figure 8. Pool sizes of (A) DXP, (B) MEcDP, and (C) IDP+DMADP in transgenic DXS1-silenced
(RNAi-DXS1) and overexpression (DXS1+) lines compared to empty vector controls (Control) under
different conditions of light (1000 or 250 PPFD) and temperature (30 or 21 °C). The concentrations of
DXP, MEcDP and IDP+DMADP were determined using an external standard curve and normalized
to internal unlabeled standards. Boxplots show medians, quartiles, and outliers. The sample size of
each box is given in Table 1. Significance differences (one-way ANOVA followed by Tukey’s test with
correction for multiple testing following Holm [78]) at p < 0.05 are indicated with different letters.
Figure 8. Pool sizes of (A) DXP, (B) MEcDP, and (C) IDP+DMADP in transgenic DXS1-silenced
(RNAi-DXS1) and overexpression (DXS1+) lines compared to empty vector controls (Control) under
different conditions of light (1000 or 250 PPFD) and temperature (30 or 21
◦
C). The concentrations of
DXP, MEcDP and IDP+DMADP were determined using an external standard curve and normalized
to internal unlabeled standards. Boxplots show medians, quartiles, and outliers. The sample size of
each box is given in Table 1. Significance differences (one-way ANOVA followed by Tukey’s test with
correction for multiple testing following Holm [78]) at p< 0.05 are indicated with different letters.
Int. J. Mol. Sci. 2024,25, 4181 10 of 23
Information on the pool sizes of the MEP pathway intermediates was combined with
data on
13
CO
2
incorporation into isoprene, as previously described, to calculate the carbon
fluxes in the MEP pathway in the different genetic backgrounds (Table 1, Supplemental
Figure S2). Flux varied significantly under the different environmental conditions used,
with higher carbon flux under higher light and temperature conditions (p< 0.001, two-
way ANOVA) (Figure 9). There were also significant differences between control and
transgenic plants (p< 0.001, two-way ANOVA), with a 25–35% increase in carbon flux in
DXS-overexpressing lines compared to empty vector controls, and no differences between
silenced lines and controls.
Int. J. Mol. Sci. 2024, 25, x FOR PEER REVIEW 11 of 25
Information on the pool sizes of the MEP pathway intermediates was combined with
data on 13CO2 incorporation into isoprene, as previously described, to calculate the carbon
fluxes in the MEP pathway in the different genetic backgrounds (Table 1, Supplemental
Figure S2). Flux varied significantly under the different environmental conditions used,
with higher carbon flux under higher light and temperature conditions (p < 0.001, two-
way ANOVA) (Figure 9). There were also significant differences between control and
transgenic plants (p < 0.001, two-way ANOVA), with a 25–35% increase in carbon flux in
DXS-overexpressing lines compared to empty vector controls, and no differences between
silenced lines and controls.
Figure 9. MEP pathway carbon flux in transgenic DXS1-silenced (iRNA-DXS1) and overexpression
(DXS1+) lines under different conditions of light (1000 or 250 PPFD) and temperature (30 or 21 °C).
Boxplots show medians, quartiles, and outliers. Sample size of each box is given in Table 1. Signifi-
cant differences (two-way ANOVA followed by Tukey’s test) at p < 0.05 are indicated with different
letters. EC, environmental conditions; TL, transgenic lines.
2.6. The Flux Control Coefficients for DXS Are Low under All Environmental Conditions Tested
The flux control coefficient (FCC) specifies the degree of control that each enzyme
exerts on flux through a metabolic pathway. The calculated flux values of the transgenic
DXS-silenced and overexpression lines and those of the empty vector control lines were
plotted as a function of their corresponding enzyme activities in a double-logarithmic
space (Supplemental Figure S3) and the FCCs for the different environmental conditions
were calculated from the slope of the linear regression of these data. In a linear pathway,
the FCC value for a specific enzyme, which indicates the fractional change in flux due to
a fractional change in that enzyme activity, has a range between 0 and 1. While an FCC
value of 0 indicates that an alteration of enzyme activity will have no effect on flux, a value
of 1 would correspond to a directly proportional relationship between enzyme concentra-
tion and pathway flux [79]. However, our experiments showed relatively low values for
FCC of DXS under all environmental conditions tested (statistically indistinguishable
from zero for all but the high light intensity-low temperature condition, where the FCC
Figure 9. MEP pathway carbon flux in transgenic DXS1-silenced (iRNA-DXS1) and overexpression
(DXS1+) lines under different conditions of light (1000 or 250 PPFD) and temperature (30 or 21
◦
C).
Boxplots show medians, quartiles, and outliers. Sample size of each box is given in Table 1. Significant
differences (two-way ANOVA followed by Tukey’s test) at p< 0.05 are indicated with different letters.
EC, environmental conditions; TL, transgenic lines.
2.6. The Flux Control Coefficients for DXS Are Low under All Environmental Conditions Tested
The flux control coefficient (FCC) specifies the degree of control that each enzyme
exerts on flux through a metabolic pathway. The calculated flux values of the transgenic
DXS-silenced and overexpression lines and those of the empty vector control lines were
plotted as a function of their corresponding enzyme activities in a double-logarithmic space
(Supplemental Figure S3) and the FCCs for the different environmental conditions were
calculated from the slope of the linear regression of these data. In a linear pathway, the
FCC value for a specific enzyme, which indicates the fractional change in flux due to a
fractional change in that enzyme activity, has a range between 0 and 1. While an FCC value
of 0 indicates that an alteration of enzyme activity will have no effect on flux, a value of
1 would correspond to a directly proportional relationship between enzyme concentration
and pathway flux [
79
]. However, our experiments showed relatively low values for FCC of
DXS under all environmental conditions tested (statistically indistinguishable from zero
for all but the high light intensity-low temperature condition, where the FCC value was
0.18, see Supplemental Figure S3). These results stand in marked contrast to the results
previously reported for the FCC of DXS in Arabidopsis, which had an FCC of 0.82 [29].
Int. J. Mol. Sci. 2024,25, 4181 11 of 23
2.7. Silencing DXS Results in Decreases in Some Isoprenoid End Products Compared with
Overexpression Lines
The role of DXS in controlling flux through the MEP pathway can also be estimated
by measuring changes in levels of isoprenoid metabolites in plant lines with altered DXS
activity. We analyzed the levels of several isoprenoids known to be produced from the
MEP pathway, including the chlorophylls and major carotenoids (Figure 10). We found
a significant 20–30% decrease in several compounds in PcDXS1-silenced lines compared
with overexpression lines: lutein (p= 0.0213, one-way ANOVA; p= 0.0236 Tukey’s test),
neoxanthin (p= 0.0103, one-way ANOVA; p= 0.0097, Tukey’s test), chlorophyll a (p= 0.0357,
one-way ANOVA; p= 0.0325 Tukey’s test) and chlorophyll b (p= 0.0237, one-way ANOVA;
p= 0.0236 Tukey’s test), but no significant differences between the other lines (p> 0.05,
Tukey’s test). We did not find any overall differences in
β
-carotene (p= 0.412, one-way
ANOVA) or violaxanthin (p= 0.0798, one-way ANOVA) (Figure 10).
Int. J. Mol. Sci. 2024, 25, x FOR PEER REVIEW 12 of 25
value was 0.18, see Supplemental Figure S3). These results stand in marked contrast to the
results previously reported for the FCC of DXS in Arabidopsis, which had an FCC of 0.82
[29].
2.7. Silencing DXS Results in Decreases in Some Isoprenoid End Products Compared with
Overexpression Lines
The role of DXS in controlling flux through the MEP pathway can also be estimated
by measuring changes in levels of isoprenoid metabolites in plant lines with altered DXS
activity. We analyzed the levels of several isoprenoids known to be produced from the
MEP pathway, including the chlorophylls and major carotenoids (Figure 10). We found a
significant 20–30% decrease in several compounds in PcDXS1-silenced lines compared
with overexpression lines: lutein (p = 0.0213, one-way ANOVA; p = 0.0236 Tukey’s test),
neoxanthin (p = 0.0103, one-way ANOVA; p = 0.0097, Tukey’s test), chlorophyll a (p =
0.0357, one-way ANOVA; p = 0.0325 Tukey’s test) and chlorophyll b (p = 0.0237, one-way
ANOVA; p = 0.0236 Tukey’s test), but no significant differences between the other lines (p
> 0.05, Tukey’s test). We did not find any overall differences in β-carotene (p = 0.412, one-
way ANOVA) or violaxanthin (p = 0.0798, one-way ANOVA) (Figure 10).
Figure 10. Content of carotenoids and chlorophylls in transgenic DXS1-silenced (iRNA-DXS1) and
overexpression (DXS1+) lines. Leaves were acclimated under steady-state conditions (incident
PPFD of 250 µmol m−2 s−2, leaf temperature 21 °C, and CO2 concentration of 380 µmol mol−1) before
harvesting. Boxplots show medians, quartiles, and outliers. Sample sizes are given in Table 1. Sig-
nificance differences between lines were tested with one-way ANOVA (Tukey’s test) at p < 0.05 and
are indicated with different letters. ß-Car, ß-carotene; Lut, lutein; Nx, neoxanthin; Vx, violaxanthin;
Chl-a, chlorophyll a; Chl-b, chlorophyll b.
Figure 10. Content of carotenoids and chlorophylls in transgenic DXS1-silenced (iRNA-DXS1) and
overexpression (DXS1+) lines. Leaves were acclimated under steady-state conditions (incident
PPFD of 250
µ
mol m
−2
s
−2
, leaf temperature 21
◦
C, and CO
2
concentration of 380
µ
mol mol
−1
)
before harvesting. Boxplots show medians, quartiles, and outliers. Sample sizes are given in Table 1.
Significance differences between lines were tested with one-way ANOVA (Tukey’s test) at p< 0.05 and
are indicated with different letters. ß-Car, ß-carotene; Lut, lutein; Nx, neoxanthin; Vx, violaxanthin;
Chl-a, chlorophyll a; Chl-b, chlorophyll b.
3. Discussion
3.1. Photosynthetically Fixed Carbon Supplies the MEP Pathway in Grey Poplar Leaves
The localization of the MEP pathway in chloroplasts as well as other plastids suggests
that photosynthetic products could be a major source of substrate for the pathway. Our
13
CO
2
labeling of photosynthetically-active grey poplar leaves supports the assertion that
newly fixed carbon derived from CO
2
through the Calvin-Benson cycle is the principal
source of carbon for the MEP pathway, as measured by the emission of isoprene. The
consecutive appearance of the labeled isotopologues of isoprene after only 5–20 min of
13
CO
2in vivo
feeding (Figure 3) demonstrates the close connection between photosynthesis
and isoprene emission. The tight link between isoprene emission and the MEP pathway is
Int. J. Mol. Sci. 2024,25, 4181 12 of 23
confirmed by the very similar degree of labeling of the pathway metabolites IDP+DMADP
and isoprene under all environmental conditions tested (Figure 4). The results also indicate
that there is negligible exchange of IDP and DMADP between the plastid and the cytosol
within the 50 min of total measurement after
13
C labeling [
29
,
51
,
73
,
74
]. Previously reported
13
CO
2
-feeding experiments showed that approximately 90% of the carbon atoms emitted as
isoprene are rapidly labeled by
13
C [
80
], although this percentage can vary with species [
81
]
and leaf developmental stage [
72
]. It is also well known that isoprene emission is affected
by light and temperature [
69
], and our data also show that changes in these conditions
rapidly affect isoprene emission (Figure 7) as well as the metabolite pools of the MEP
pathway (Figure 8). These results are completely consistent with previous work on the
light dependency of the pathway [58,82].
Since the maximum amount of
13
C label incorporation in isoprene was 90% (Figure 3,
a small portion of the MEP pathway substrate might be supplied from carbon sources other
than photosynthetic fixation [
83
]. In recent years, different sources have been proposed,
such as starch breakdown in the chloroplast [
84
], deoxyxylulose phosphate derived from
the pentose phosphate pathway [
85
], and extrachloroplastidic metabolites such as xylem-
transported carbohydrates [
86
,
87
]. However, the lack of full 100% labeling of isoprene after
13
CO
2
administration could also arise from the lack of full labeling of the Calvin-Benson
cycle by CO2fixation due to a cytosolic shunt re-entering the cycle [88].
3.2. DXS Is Not a Major Rate-Controlling Enzyme of the MEP Pathway in Poplar
To determine the influence of DXS on the MEP pathway in grey poplar, two approaches
were followed. First, we created transgenic DXS-overexpressing and silenced lines and
investigated whether these caused any alterations in MEP pathway flux compared to wild-
type controls or controls transformed with only an empty vector. Overexpression of DXS
resulted in nearly 10-fold increases of transcript levels, while silencing with interference
RNA decreased transcript levels by approximately 4-fold (Figure 5). These changes in gene
expression resulted in a 25% increase in DXS enzyme activity in overexpressing lines and a
50% decrease in activity in silenced lines (Figure 6). At the flux level, overexpressing lines
displayed a 25–35% increase in flux compared to the empty vector controls, but were not
significantly different from the silenced lines. Thus, DXS can be considered to have at most
a modest effect on MEP pathway flux.
Indeed, when we calculated flux control coefficients (FCCs), the fraction change in
flux due to a fractional change in DXS activity, under four different light and temperature
regimes, we obtained very low values. These values were not significantly different from
zero for three regimes and only 0.18 for the fourth regime. FCC values range from 0 to 1,
with 0 indicating that an alteration of enzyme activity has no effect on flux and a value
of 1 indicating a direct proportional relationship between enzyme activity and pathway
flux. In contrast to grey poplar, the calculated FCC for DXS in Arabidopsis was found to
be 0.83 [
29
], suggesting that the MEP pathway in Arabidopsis is regulated in a different
manner than that of grey poplar. Although FCCs for DXS have not been calculated for
other plant species, a recent investigation of another woody plant, the gymnosperm Picea
glauca, compared DXS activity and MEP pathway flux under different water regimes [
34
].
The close correlation of DXS activity and flux under well-watered and moderate drought
conditions, but not under severe drought, indicates that the regulatory role of DXS may be
contingent on environmental conditions.
As a second approach to studying the impact of DXS on MEP pathway flux, we
analyzed the abundance of particular isoprenoid end products in our transgenic lines, such
as isoprene, chlorophyll, and carotenoids, which are known to be produced out of building
blocks supplied by the MEP pathway. Our measurements of isoprene demonstrated that
DXS manipulation had no significant effect on emission. Although isoprene emission
varied significantly under the different light and temperature conditions tested, no effect
of the DXS genetic background on the isoprene was recorded. However, the results with
chlorophylls and carotenoids showed a different trend. For both chlorophylls and two of
Int. J. Mol. Sci. 2024,25, 4181 13 of 23
the four carotenoids measured, there were 20–30% declines in DXS-silenced lines compared
with DXS overexpression lines, but no difference between either silenced or overexpressing
lines compared to the empty vector control. These results are consistent with previous
reports showing changes in isoprenoid end products when DXS transcript levels are altered.
For example, in Arabidopsis, overexpression increased and silencing decreased carotenoids,
chlorophylls,
α
-tocopherol and the hormones GA and ABA, although the degree of increase
was variable [
37
,
51
]. Overexpression also increased carotenoids in tomato fruit [
39
,
40
]
and carotenoids and cytokinins in potato tubers [
41
]. In lavender, DXS overexpression
increased the amount of monoterpene-dominated essential oil by over 3-fold, but the levels
of chlorophylls and carotenoids were unchanged or decreased [38].
3.3. The MEP Pathway and the Role of Isoprene
Our results may also have some relevance for understanding the biological role of
isoprene, which has remained enigmatic after many years of study. Researchers must
explain why isoprene is a major sink for fixed carbon, for example up to 10% in mature
poplar leaves, but is only released by approximately 20% of the world’s plant species [
89
,
90
].
While isoprene was long thought to quench reactive oxygen species and stabilize chloroplast
membranes [
91
], calculations of the amounts of isoprene within the leaf revealed that this
substance is present at concentrations too low to fulfill a protective role [92].
A more recent concept is that isoprene instead acts as a stress signal that alters gene
expression [
27
], protein abundance [
55
,
93
], and hormone levels [
56
]. For example, the sup-
pression of isoprene emission in gray poplar mediated by RNA interference (RNAi) resulted
in the down-regulation of genes encoding enzymes and regulatory proteins involved in
phenylpropanoid biosynthesis [
52
]. Similarly, transgenic tobacco emitting isoprene exhib-
ited higher levels of phenylpropanoid accumulation compared to non-emitting wild-type
controls [
94
]. Microarray analysis of Arabidopsis plants fumigated with a physiologi-
cally relevant concentration of isoprene revealed alterations in the expression of genes
associated with various pathways, including those involved in stress response, such as
phenylpropanoid biosynthesis [
95
]. In addition, Arabidopsis and tobacco engineered to
emit isoprene demonstrated increased expression of genes related to stress tolerance [27].
From a different perspective, isoprene has been suggested to have a metabolic role,
serving as a way for plants to decrease high amounts of DMADP while recovering the
pyrophosphate moiety [
96
]. DMADP accumulation not only ties up large quantities of
intracellular phosphate, but can also decrease MEP flux by feedback inhibition of DXS [
33
].
In fact, when isoprene formation is blocked at DMADP by silencing isoprene synthase, the
flux rate through the MEP pathway is dramatically decreased [
51
]. The close correlation
between DMADP and isoprene emission we found here is consistent with such a metabolic
role for isoprene.
4. Materials and Methods
4.1. Plant Material and Experimental Set-Up
All experiments were carried out with individual transgenic DXS grey poplar (Populus
×
canescens) and wild-type plants transformed with an empty vector as controls. Plants
were amplified by micropropagation as described by [
97
]. Saplings of 10-cm height were re-
potted to soil (Klasmann potting substrate, Klasmann-Deilmann GmbH, Geeste, Germany)
and propagated in a controlled environment chamber (day, 22
◦
C; night, 18
◦
C; 65% relative
humidity; 16-h/8-h light/dark cycle) before they were transferred to the greenhouse (day,
23 to 25
◦
C; night, 19 to 23
◦
C; 50 to 60% relative humidity; 16-h/8-h light/dark cycle).
Plants were then grown under these conditions until they reached a height of about 1.5 m
(Supplemental Figure S4).
A custom-built cuvette for a single Populus
×
canescens leaf was used together with
a LI-6400XT Portable Photosynthesis System (Li-Cor Biosciences, Bad Homburg vor der
Höhe, Germany) and a proton transfer reaction mass spectrometer (PTR-MS; Ionicon
Analytik GmbH, Innsbruck, Austria) to monitor and record gas exchange parameters and
Int. J. Mol. Sci. 2024,25, 4181 14 of 23
isoprene emission in real time, and to carry out
13
CO
2in vivo
labeling. Ambient air was
conditioned by passing through a wash bottle and a CO
2
scrubber kept at 4
◦
C, providing
a relative humidity of between 50–60% to the system. CO
2
was maintained at a steady
concentration with a supplemental CO
2
gas cartridge. The cuvette held a single poplar leaf
(13 cm diameter
×
3 cm high) and delivered mixed air evenly across the leaf surface, helped
by an integrated mixing fan and a Peltier element that maintained temperature. Previous
studies have shown the importance of leaf stage development in isoprene emission [
98
,
99
],
for this reason we used the 7th or 8th leaf in all plants to perform the experiments. Leaf
temperature was monitored with a thermocouple in contact with the abaxial leaf surface.
The total photosynthetic surface area was estimated by photography of a leaf together with
a standardized area plot, both measured with Photoshop software (Version 12.0
×
64). Light
was provided by an LED lamp localized above the cuvette, giving the required experimental
light intensity monitored with a LI-250 hand-held quantum sensor (Li-Cor Biosciences). We
conducted steady-state experiments under different light (PPFD = 1000 or 250
µ
mol m
−2
s
−1
) and temperature (30
◦
C or 21
◦
C) conditions and 380
µ
mol mol
−1
CO
2
at a flow rate of
0.8 L min
−1
. Before starting the experiment with
13
CO
2
, leaves were always acclimatized
for at least 15 min in the cuvette until the release of water and CO
2
, isoprene emission and
photosynthesis had reached steady-state conditions.
In vivo
labeling was performed for
50 min by a single change step to a labeling atmosphere that was identical to the acclimation
conditions except that all CO
2
was replaced with
13
CO
2
(380
µ
mol mol
−1
> 99 atom %
13
C,
Linde, Munich, Germany). In similar experiments, we used leaves from intact plants to
investigate the effect of DXS activity in the transgenic lines under different environmental
conditions (PPFD = 1000 and 250
µ
mol m
−2
s
−1
, temperature = 30
◦
C and 21
◦
C) on the
MEP pathway. The outlet air was directed through the PTR-MS to determine the isotopic
composition of the isoprene emission in real time. At the end of the labeling period, the leaf
was quickly cut and flash frozen in liquid nitrogen. Each labeled leaf was ground to a fine
powder in liquid nitrogen, keeping part of the tissue for RNA extraction and carotenoid
analysis and lyophilizing the rest to dryness prior to analysis of label incorporation and
characterization of DXS activity. Labeling experiments were restricted to a time period
between 9:00 h and 16:00 h (summer time) in order to eliminate any influence of diurnal
rhythm, which has been described for the MEP pathway [76,100].
4.2. Vector Construction and Transformation of Populus ×canescens
In order to assess the effect of DXS on the MEP pathway, transgenic plants were
made carrying an RNA interference (RNAi) construct specific to the two encoding genes,
PcDXS1 and PcDXS2. For that, a 305-bp region of the coding sequence was PCR-amplified
by using the oligonucleotides PcDXS-RNAi-for (tgctctagagcatcatgctgcaatgggaggag) and
PcDXS-RNAi-rev(cgggatcccggggggaggcatgccatgtaagt), then cloned in sense and antisense
orientations into the multiple cloning sites of the pTRAIN vector on either side of an intron
as described by [
101
]. After HindIII digestion, the excised RNAi cassette, including an
upstream maize ubiquitin promotor, was ligated into the multiple cloning site of the pCAM-
BIA 1305.2 vector www.cambia.org (accessed on 11 June 2014).
Agrobacterium tumefaciens
-
mediated stable transformation of the P.
×
canescens clone INRA 7171-B4 was performed
following a protocol published by [
102
]. Transgenic RNAi poplar plants were amplified
by micropropagation as described by [
97
]. To test the level of transgenicity, plants of
four independent kanamycin-resistant transgenic lines plus an empty vector control line
were characterized by qPCR, using four plants per line. For this, primer PcDXS-qPCR-for
atgggaggagggacaggc and PcDXS-qPCR-rev gcagcaaagtaacagcatgctg were used.
4.3. Quantification and Label Incorporation Measurements of DXP, MEcDP and IDP/DMADP
The extraction and quantification of MEP metabolites was performed as described
previously [
103
]. Briefly, 5 mg lyophilized material was extracted twice with a 250
µ
L
solution of 50% (v/v) acetonitrile containing 10 mM ammonium acetate, pH 9, by vortexing
for 5 min and centrifuging in a microcentrifuge for 5 min. 200
µ
L from each extraction was
Int. J. Mol. Sci. 2024,25, 4181 15 of 23
pooled in a new tube and dried under a nitrogen stream at 40
◦
C. The residue was dissolved
in 100
µ
L ammonium acetate, pH 9, then extracted with 100
µ
L chloroform, and the phases
separated by centrifugation. A 50
µ
L quantity of the upper phase was transferred to a new
tube, diluted with 50
µ
L of acetonitrile, and centrifuged to remove any precipitate. The
supernatant was transferred to an HPLC vial.
MEP pathway metabolites and their
13
C incorporation were analyzed on an Agilent
1200 Infinity HPLC system (Agilent Technologies, Santa Clara, CA, USA) connected to
an API 5000 triple quadrupole mass spectrometer (AB Sciex, Framingham, MA, USA).
For separation, a HILIC-XBridge BEH Amide XP column (2.5
µ
m, 150
×
2.1 mm; Waters,
Milford, MA, USA) together with a guard column containing the same sorbent (2.5
µ
m,
10
×
2.1 mm) and an SSI
TM
high-pressure precolumn filter (Sigma-Aldrich, Taufkirchen,
Germany) was used. The solvents used were 20 mM ammonium bicarbonate, pH 10.5,
as solvent A and 80% (v/v) acetonitrile with 20 mM ammonium bicarbonate, pH 10.5 as
solvent B; liquid-chromatography-mass spectrometry-grade ammonium hydroxide was
used for pH adjustments. Separation was achieved with a flow rate of 500
µ
L min
−1
and a column temperature of 25
◦
C, with a 5
µ
L sample injected. The solvent gradient
profile started with a linear gradient from 0 to 16% A over 5 min, followed by an isocratic
separation for another 5 min, a wash step at 40% A for 5 min, and a return to 0% A for 15 min
of further equilibration. The mass spectrometer was used in the negative ionization mode
with the following instrument settings: ion spray voltage −4500 V, turbo gas temperature
700
◦
C, nebulizer gas 70 psi, heating gas 30 psi, curtain gas 30 psi, and collision gas 10 psi.
DXP and its isotope distribution were monitored by the following precursor ion
→
product
ion reactions: m/z212.9
→
96.9, m/z213.9
→
96.9, m/z214.9
→
96.9, m/z215.9
→
96.9, m/z
216.9
→
96.9, m/z217.9
→
96.9 (collision energy [CE],
−
16 V; declustering potential [DP],
−
60 V; and cell exit potential [CXP],
−
15 V). MEcDP and its distribution were monitored by
the following precursor ion
→
product ion reactions: m/z277.0
→
78.9, m/z278.0
→
78.9,
m/z279.0
→
78.9, m/z280.0
→
78.9, m/z281.0
→
78.9, m/z282.0
→
78.9, m/z(CE,
−
38 V;
DP,
−
50 V; CXP,
−
11 V). IDP/DMADP and their isotope distributions were monitored by
the following precursor ion
→
product ion reactions: m/z244.9
→
78.9, m/z245.9
→
78.9,
m/z246.9
→
78.9, m/z247.9
→
78.9, m/z248.9
→
78.9, m/z249.9
→
78.9 (CE,
−
24 V; DP,
−
45 V; CXP,
−
11 V). Analyst 1.6 software (Applied Biosystems, Waltham, MA, USA) was
used for data acquisition and processing.
The DXP, MEcDP and IDP+DMADP contents in plant extracts were quantified using
external standard curves and normalized to unlabeled standards added in the approximate
amount occurring in plant extracts after correction for natural
13
C abundance. Normal-
ization to added unlabeled standards was accomplished by analyzing each plant sample
twice, once with and once without the addition of internal standards (ISTD) dissolved in
10
µ
L of water. The ITSD were added directly to the first extraction. To determine the
amounts of metabolites originating from the plant material, the relative amounts of masses
containing 3, 4, and 5
13
C atoms in the sample with added ISTD were compared with the
values obtained without any ISTD. This accounted for losses due to the matrix effect during
extraction and ion suppression effects in the mass spectrometer.
4.4. Measurement of Isoprene Emission and Determination of Stable 13C Isotopes of Isoprene
with PTR-MS
The PTR-MS (Model 500, Ionicon Analytik GmbH, Innsbruck, Austria) was employed to
measure isoprene emission and determine in real time the kinetic dynamics of
12
C replaced
with
13
C in the isoprene molecule. The drift tube pressure was 2.2–2.3 mbar and the E/N
ratio (electric field/particle density) was 130 Td (
1 Td = 1 Townsend = 10−17 cm2V−1s−1
.
Isoprene was monitored with the mass signal m/z69. The raw PTR-MS count-rate signal
intensity (cps) was normalized (ncps) to the primary ion signal (hydronium (H
3
O
+
)m/z21),
hydronium dimer (H
3
O
+·
(H
2
O) m/z37), and hydronium trimer (H
3
O
+·
(H
2
O)
2
m/z55)
and drift tube pressure. The average of the normalized signal during the steady-state period
was used to calculate the isoprene emission, after subtracting the background (empty cham-
Int. J. Mol. Sci. 2024,25, 4181 16 of 23
ber without leaf). Afterward, isoprene emission was normalized to the leaf area.
In vivo
labeling was accomplished by replacing the normal air (380
µ
mol mol
−1 12
CO
2
including
1.1%
13
CO
2
) entering the cuvette with labeling atmosphere (
380 µmol mol−1 13CO2
, 99.9%).
Before initiating the labeling, single leaves were maintained for at least 15 min under
normal air to ensure that isoprene emission and photosynthesis were stable. Labeling was
performed for 50 min. The appearance of protonated masses of isoprene was followed in the
PTR-MS by monitoring m/z 70 (
13
C
112
C
4
H
9
), m/z71 (
13
C
212
C
3
H
9
), m/z72 (
13
C
312
C
2
H
9
),
m/z73 (
13
C
412
C
1
H
9
), and m/z74 (
13
C
5
H
9
). The percentage of
13
C labeling was calculated
by summing all
13
C atoms incorporated in the isoprene isotopes, and dividing this number
by the overall sum of unlabeled and labeled carbon atoms of isoprene [86].
4.5. Determination of Flux by Label Incorporation through the MEP Pathway and Isoprene
Plastidial concentrations of DXP, MEcDP, and IDP+DMADP were estimated by assum-
ing that IDP+DMADP only occurred in the chloroplast, and that only plastidial DXP and
MEcDP pools would be labeled on the time-scale of the labeling experiment (50 min). Thus,
the plastidial concentrations of DXP and MEcDP were estimated by calculating the ratio of
their final 13C-label incorporation to that of IDP+DMADP.
As isoprene labeling could be followed on-line instantaneously with the PTR-MS
without the need for individual sampling, these measurements were taken as the instan-
taneous labeling state of the IDP+DMADP pool. This assumption was justified, since
isoprene is produced from DMADP in a single enzymatic step, and the volatile isoprene
gas escapes from the leaf. Moreover, the assumption was verified experimentally; the
final label incorporation after 50 min in isoprene and in the IDP+DMADP pools was
identical (Figure 4).
Following an approach similar to [
104
], the differential equations for label incorpo-
ration were integrated to obtain an analytical expression for the fractional labeling of
the IDP+DMADP pool, with time as a function of the pool sizes of DXP, MEcDP, and
IDP+DMADP, as well as the flux through the pathway:
f(t)=m1−A2
(A−B)(A−C)exp−J
At−B2
(B−A)(B−C)exp−J
Bt−C2
(C−A)(C−B)exp−J
Ct (1)
where f(t) is the fractional labeling of isoprene (which equates to the fractional labeling of
IDP+DMADP) as a function of time, mis the maximal fractional labeling at the end of the
run, A,B, and Care the pool sizes of DXP, MEcDP, and IDP+DMADP, respectively, Jis the
pathway flux and tis time. Equation (1) assumes that the pools of the other MEP pathway
intermediates (MEP, ME-CDP, MEP-CDP, and HMBDP) are too small to significantly delay
the label incorporation into downstream metabolites; these intermediates were below the
limit of detection in the HPLC-MS analysis.
To calculate the flux, Equation (1) was fitted to isoprene labeling time-courses obtained
from the PTR-MS [f(t)] (cf. Figure 3), with experimentally determined pool sizes of DXP,
MEcDP, and IDP+DMADP (cf. Figure 8and Table 1) entered as parameters A,B, and C,
respectively. The parameters mand Jwere obtained by minimizing the sum of the squares
of the differences between model and data with the Levenberg-Marquardt algorithm, as
implemented in the Python LMFIT module [
105
]. The calculated fluxes are summarized in
Figure 9and Table 1.
4.6. Determination of In Vitro PcDXS Activity
The DXS enzyme assay was performed by a method previously described in [
106
].
Briefly, activities were measured under saturating substrate conditions in total protein extracts
of 5 mg of lyophilized plant tissues, extracted gently with 1 mL of extraction buffer (50 mM
Tris-HCl, pH 8, 10% (v/v) glycerol, 0.5% (v/v) Tween 20, 1% (w/v) polyvinylpolypyrrolidone
(average molecular weight = 360,000), 100
µ
M thiamine pyrophosphate, 10 mM DTT, 1 mM
ascorbate, 2 mM imidazole, 1 mM sodium fluoride, 1.15 mM sodium molybdate, and 1%
protease inhibitor cocktail (Sigma-Aldrich)) at 4
◦
C during 15 min in a rotating wheel
Int. J. Mol. Sci. 2024,25, 4181 17 of 23
followed by a centrifugation at 20,000
×
gfor 20 min. A 30
µ
L aliquot of the supernatant
was mixed with 70
µ
L of enzyme reaction buffer (50 mM Tris-HCl, pH 8, 10 mM MgCl
2
,
10% (v/v) glycerol, 2.5 mM DTT, 1 mM thiamine pyrophosphate, 10 mM pyruvate, 10 mM
glyceraldehyde 3-phosphate, 2 mM imidazole, 1 mM sodium fluoride, 1.15 mM sodium
molybdate, and 1% protease inhibitor cocktail) for 2 h at 25
◦
C. The enzyme reaction was
stopped by vigorously vortexing for 5 min with 100
µ
L of chloroform and centrifuging
at 20,000
×
gfor 5 min. 45
µ
L of the aqueous phase was transferred to an HPLC vial
containing 5
µ
L of labeled [
13
C
5
]-DXP dissolved in water as the internal standard obtained
as described in [
103
]). The analysis of DXP was carried out as described above. The DXP
produced by the DXS enzyme reaction was quantified using external standard curves and
normalized to the [13C5]-DXP internal standard.
4.7. Calculation of Flux Control Coefficients
Control coefficients were calculated as described previously in [
67
,
107
] from the
general formula
Cy
v=dy/y
dv/v=dlogy
dlogv
where
Cy
v
is the flux control coefficient,
y
is the flux, and
v
is the DXS activity (determined as described above). Data from empty vector control lines
and DXS transgenic lines were combined, and the term
dlogy/dlogv
was calculated from
the linear regression of a plot of the flux against DXS activity in a double-logarithmic space.
4.8. RNA Extraction, cDNA Synthesis, and Quantitative Real-Time PCR
RNA was extracted from poplar leaves harvested after 50 min of labeling using the
InviTrap Spin Plant RNA Mini Kit (Stratec Biomedical) following the protocols of the
manufacturer, with an additional DNase treatment step (RNase-Free DNase Set; Qiagen,
Hilden, Germany). The first washing step was realized with 300
µ
L of wash buffer R1,
followed by a DNase treatment (30 Kunitz units in 80
µ
L volume; 10
µ
L of RNase free
water, and 70
µ
L of buffer RDD) added to the column and incubated for 15 min at room
temperature. The column was washed with an additional 300
µ
L of wash buffer R1 continu-
ing with the manufacturer’s protocol. RNA samples were quantified by spectrophotometry
(Thermo Scientific, Waltham, MA, USA, NanoDrop 2000). Complementary DNA (cDNA)
was synthesized using 1
µ
g of RNA using Superscript II reverse transcriptase (Invitrogen,
Thermo Scientific Waltham, MA, USA) and 50 pmol of oligo(dT)
12–18
primer (Invitrogen)
in a 20 µL reaction volume, and diluted 5-fold with sterile water.
Primers for the gene encoding 1-deoxy-D-xylulose-5-phosphate synthase (PcDXS1,
PcDXS2) were designed and tested for their specificity (for the primer sequences, see
Supplemental Table S1). The primers for the genes 1-deoxy-D-xylulose-reductoisomerase
(PcDXR1,PcDXR2), diphosphocytidylmethylerythritol reductase (PcCMK), and 4-hydroxy-
3-methylbut-2-en-1-yl diphosphate reductase (PcHDR) from the