rs2736098, a synonymous polymorphism, is associated with carcinogenesis and cell count in multiple tissue types by regulating TERT expression

Abstract

rs2736098 is a synonymous polymorphism in TERT (telomerase reverse transcriptase), an enzyme involved in tumor onset of multiple tissues, and should play no roles in carcinogenesis. However, a search in cancer somatic mutation database indicated that the mutation frequency at rs2736098 is much higher than the average one for TERT. Moreover, there are significant H3K4me1 and H3K27Ac signals, two universal histone modifications for active enhancers, surrounding rs2736098. Therefore, we hypothesized that rs2736098 might be within an enhancer region, regulate TERT expression and influence cancer risk. Through luciferase assay, it was verified that the enhancer activity of rs2736098C allele is significantly higher than that of T in multiple tissues. Transfection of plasmids containing TERT coding region with two different alleles indicated that rs2736098C allele can induce a significantly higher TERT expression than T. By chromatin immunoprecipitation, it was observed that the fragment spanning rs2736098 can interact with USF1 (upstream transcription factor 1). The two alleles of rs2736098 present evidently different binding affinity with nuclear proteins. Database and literature search indicated that rs2736098 is significantly associated with carcinogenesis in multiple tissues and count of multiple cell types. All these facts indicated that rs2736098 is also an oncogenic polymorphism and plays important role in cell proliferation.

Full text

Heliyon 10 (2024) e27802
Available online 8 March 2024
2405-8440/© 2024 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
Research article
rs2736098, a synonymous polymorphism, is associated with
carcinogenesis and cell count in multiple tissue types by regulating
TERT expression
Xin-Xin Zhang
a
, Xin-Yi Yu
a
, Shuang-Jia Xu
a
, Xiao-Qian Shi
a
, Ying Chen
a
,
Qiang Shi
b
,
**
, Chang Sun
a
,
*
a
College of Life Sciences, Shaanxi Normal University, Xi’an, Shaanxi, 710119, PR China
b
College of Biology Pharmacy and Food Engineering, Shangluo University, Shangluo, Shaanxi, 726000, PR China
ARTICLE INFO
Keywords:
Breast cancer
TERT
rs2736108
rs2736098
Cell proliferation
ABSTRACT
rs2736098 is a synonymous polymorphism in TERT (telomerase reverse transcriptase), an enzyme
involved in tumor onset of multiple tissues, and should play no roles in carcinogenesis. However,
a search in cancer somatic mutation database indicated that the mutation frequency at rs2736098
is much higher than the average one for TERT. Moreover, there are signicant H3K4me1 and
H3K27Ac signals, two universal histone modications for active enhancers, surrounding
rs2736098. Therefore, we hypothesized that rs2736098 might be within an enhancer region,
regulate TERT expression and inuence cancer risk. Through luciferase assay, it was veried that
the enhancer activity of rs2736098C allele is signicantly higher than that of T in multiple tissues.
Transfection of plasmids containing TERT coding region with two different alleles indicated that
rs2736098C allele can induce a signicantly higher TERT expression than T. By chromatin
immunoprecipitation, it was observed that the fragment spanning rs2736098 can interact with
USF1 (upstream transcription factor 1). The two alleles of rs2736098 present evidently different
binding afnity with nuclear proteins. Database and literature search indicated that rs2736098 is
signicantly associated with carcinogenesis in multiple tissues and count of multiple cell types.
All these facts indicated that rs2736098 is also an oncogenic polymorphism and plays important
role in cell proliferation.
1. Introduction
Telomere is a special region of repetitive DNA at the both ends of chromosome and can protect chromosome ends [1]. In cell
division, the telomere is shortened slightly [1]. When telomere length is reaching a specic threshold, cell division can not be initiated
and apoptosis will be induced [2]. Therefore, telomere lengthening after each cell division plays an important role in cancer and
self-renewing cells. This process is conducted by telomerase, a nucleoprotein complex [3]. Among this complex, TERT (telomerase
reverse transcriptase) is the most important and rate-limiting catalytic subunit [4]. TERT overexpression has been frequently observed
in numerous tumor tissues [5]. Moreover, multiple genetic variations which can increase TERT expression have been suggested to be
* Corresponding author. Shaanxi Normal University Xi’an, Shaanxi, 710119, PR China.
** Corresponding author. Shangluo University, Shangluo, Shaanxi, 726000, PR China.
E-mail addresses: 202229@slxy.edu.cn (Q. Shi), sunchang@snnu.edu.cn (C. Sun).
Contents lists available at ScienceDirect
Heliyon
journal homepage: www.cell.com/heliyon
https://doi.org/10.1016/j.heliyon.2024.e27802
Received 18 December 2023; Received in revised form 19 February 2024; Accepted 6 March 2024

Heliyon 10 (2024) e27802
2
involved in carcinogenesis [6,7]. Based on these results, TERT has been proposed to be an oncogene for multiple cancer types [8].
Breast cancer is the most common cancer type in woman [9]. Recent genome-wide association studies (GWAS) have suggested that
C allele of rs2736108 is signicantly associated with breast cancer risk (see GWAS Catalog at https://www.ebi.ac.uk/gwas/for detail)
[10–14]. This association has been veried by multiple association studies (see PubMed at https://pubmed.ncbi.nlm.nih.gov for
detail). Linkage disequilibrium (LD) analysis on 1000 genomes project data indicated that there are another four SNPs, rs2736098 (in
coding region), rs2853669 (−245 relative to TERT translation start in genome; the same for following mutations), rs2736109 (−1655)
and rs2736107 (−2750), are in strong LD (r
2
≥0.80) with rs2736108 (−2384; see Table S1) in three representative populations, CEU
(Utah Residents with Northern and Western European Ancestry), CHB (Han Chinese in Beijing) and YRI (Yoruba in Ibadan, Nigeria).
Consequently, two distinct haplotypes can be observed (see Table 1). Functional genomics work observed that the allele in common
haplotype, i.e., C of rs2736107, rs2736108 and rs2736109 and A of rs2853669, can increase TERT promoter activity [15–17]. Further
analysis veried that rs2736108 is signicantly associated with telomere length [17–21]. All these efforts illuminated the connection
between genetic variations in this locus and breast cancer risk.
Within these two haplotypes, rs2736098 (915 relative to TERT translation start in mRNA) is a synonymous polymorphism and
located at the second exon. Therefore, it seems that this polymorphism is not likely to inuence carcinogenesis. However, a search in
COSMIC (https://cancer.sanger.ac.uk), a database for cancer somatic mutations database, indicated that the mutation probability at
rs2736098 is much higher than nearby positions (see Fig. S1). Indeed, TERT coding region is with a length 3399 bases and only 1773
somatic mutation events occur in all cancer types (If we limit the search in breast cancer, the mutation events are too small to draw a
conclusion.). In contrast, 17 somatic mutation events are observed at rs2736098 position, which is ~31.6-fold higher than the average
frequency. If this synonymous polymorphism play no roles in carcinogenesis, it is difcult to image such a phenomenon. Moreover, a
search in ENCODE project (https://www.encodeproject.org/) indicated that there are strong H3K4me1 and H3K27ac signals, two
common histone modication in active enhancers [22], appearing in multiple cell lines, including breast ones (see Fig. S2). Therefore,
we hypothesized that rs2736098 might be within an enhancer region for TERT and further inuence breast cancer risk.
In this study, we compared the enhancer activity and TERT expression difference induced by rs2736098 through plasmids con-
struction and transfection. Further mechanism was also investigated.
2. Materials and methods
2.1. Reporter gene assay
Genomic DNA was isolated from MCF-7 cell line by starndard phenol-chloroform method. rs2736098 nearby region (~1.5 kb; chr5:
1293195–1294669; corresponding to partial exon 2 and intron 2 of TERT) was amplied by using primers in Table S2 from MCF-7
DNA. After digestion by restriction enzymes KpnI and XhoI (NEB, Ipswich, MA), the PCR product and pGL3-promoter plasmid
(Promega, Madison, WI) were ligated by utilizing T4 DNA ligase (NEB). PCR was carried out with Q5 High-Fidelity DNA Polymerase
(NEB) to exclude articial mutations. The plasmid containing the corresponding allele for rs2736098 was constructed using Q5 Site-
Directed Mutagenesis Kit (NEB) and the primers listed in Table S2. All recombinant plasmids were sequenced to avoid the possibilities
of any articial mutations and conrm the haplotypes orientation of mutated and wild-type DNA segments. Besides rs2736098, there
were no other SNPs in the cloned region between the two plasmids.
Breast cancer cell line MCF-7 was maintained in Dulbecco’s modied Eagle’s medium (high glucose; HyClone, Logan, UT) with
10% fetal bovine serum (Biological Industries, Cromwell, CT) in 5% CO
2
at 37 ◦C. Before transfection, MCF-7 cells (~10
5
) were grown
in 24-well plates. After 24 h of cultivation, 475 ng constructed plasmid and 25 ng pRL-TK (Promega) were transiently co-transfected
into MCF-7 cell utilizing Lipofectamine 2000 (Thermo Fisher Scientic, Grand Island, NY) according to the manufacturer’s guidance.
After 48 h of transfection, cells were lysed and luciferase activity was assessed by utilizing Dual-Luciferase Reporter Assay System
(Promega) according to the manufacturer’s instructions. Six independently replicates were carried out for this experiment.
2.2. Overexpression plasmid construction and TERT expression measurement
TERT coding region was amplied by nested PCR with primers in Table S3 and Q5 High-Fidelity DNA Polymerase (NEB) from MCF-
7 cDNA. After NheI and EcoRI (NEB) digestion, PCR product was inserted into overexpression vector pEGFP-N1 (Clontech, Mountain
View, CA). The plasmid containing another allele of rs2736098 was obtained by mutagenesis as abovementioned. The two over-
expression plasmids (500 ng) were transfected into MCF-7 cell line as abovementioned. After 48 h culture, total RNA was isolated by
Table 1
SNPs in core haplotypes.
rs ID position
a
Common haplotype Rare haplotype
rs2736098 1294086 C T
rs2853669 1295349 A G
rs2736109 1296759 C T
rs2736108 1297488 C T
rs2736107 1297854 C T
a
Based on human genome build 37.
X.-X. Zhang et al.

Heliyon 10 (2024) e27802
3
TRIzol (Thermo Fisher Scientic) and cDNA library was prepared by RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher
Scientic). TERT expression was assessed by quantitative PCR (qPCR) with iQ SYBR green (Bio-Rad, Hercules, CA) and primer pair
AGAGGGGAAAGGGTGTCCATGG and GTGAAAGGCAAGGAGCAGACGG. GAPDH (glyceraldehyde-3-phosphate dehydrogenase)
expression was also measured as a control as abovementioned with published primer [23]. Three independently replicates were carried
out for this experiment.
2.3. Chromatin immunoprecipitation (ChIP)
Potential transcription factors (TFs) USF1 (upstream transcription factor 1) and MYC (MYC proto-oncogene, bHLH transcription
factor) were predicted by TRANSFAC (http://www.gene-regulation.com/) to bind rs2736098 surrounding. ChIP assay was conducted
in MCF-7 cell line by using ChIP Assay Kit (Beyotime Biotechnology, Shanghai, China) following the manufacturer’s guidance. In brief,
approximately 1 ×10
7
MCF-7 cells were xed by adding formaldehyde (1% nal concentration) and incubated for 10 min at 37 ◦C. To
end cross-linking, glycine was added for 5 min at 25 ◦C. After harvesting, cells were lysed for 10 min on ice and sonicated by Ultrasonic
Cell Disruptor (Scientz Biotechnology, Ningbo, China) to obtain 200-800 bp DNA fragments. Chromatin samples were immunopre-
cipitated utilizing anti-mouse USF1 antibody, anti-mouse MYC antibody or IgG (Santa Cruz Biotechnology, Santa Cruz, CA). After
immunoprecipitating, DNA was puried by GeneJET Gel Extraction Kit (Thermo Fisher Scientic) and subjected to qPCR to assess the
enrichment with the following primer air GGCGTACACCGGGGGACAAG and CAGGACGCGTGGACCGAGTGACC. The APLN (apelin)
promoter region, which was veried to be USF1 binding site in breast tissues [24], was amplied by primer pair GCTGCA-
GAGTGCGTGCCTGGAG and GAGCGGCAGCGGCGAGCTCTTTCTTAG as a positive control. In contrast, one random selected region,
which was without USF1 binding prediction, was amplied by primer pair AGCAGCTCAGGCACACTTCTT and AGTCTCT-
GAACCCTTGGCTCC as a negative control.
2.4. Electrophoretic mobility shift assay (EMSA)
Nuclear extracts (5
μ
g) were prepared from MCF-7 cells utilizing the Nuclear Protein Extraction Kit (Beyotime). The probe consisted
of 27 bp sequences centered on the rs2736098 SNP alleles were shown in Table S4 and labeled by 3
′
-Biotin labeling kit (Beyotime,
Shanghai, China). After annealing, the duplex probes (10 fmol) were incubated with the nuclear extracts at 37 ◦C for 20 min. The
biotin-labeled probes without nuclear protein as controls and unlabeled probes (200-fold molar excess) were added as competition
reactions. The reaction samples were electrophoresed on a 4.9% polyacrylamide gel for 60 min at 100 V and then transferred to a
positively charged nylon membrane (Beyotime). After transferring, the membrane was incubated with Streptavidin-HRP (horseradish
peroxidase) conjugate and image was gained on Luminescent Imaging Workstation system (Tanon, Shanghai, China).
Fig. 1. The different enhancer activities between rs2736098 alleles in MCF-7 (a), HCT116 (b), HeLa (c), SK-OV-3 (d), SGC-7901 (e), HepG2 (f),
Beas-2B (g) and PA-TU-8988T (h) cells. The x axis represents the relative luciferase expression amount. All data are displayed as mean ±standard
deviation (SD). *P <0.0001.
X.-X. Zhang et al.

Heliyon 10 (2024) e27802
4
3. Statistics
Independent student’s t-test was used to compare relative luciferase activity, TERT expression and ChIP enrichment. All statistics
analysis was performed in SPSS 20.0 (IBM, Armonk, NY). When P <0.05, the difference was supposed to be signicant.
4. Result
4.1. Function of rs2736098
To disclose the potential enhancer activity difference induced by rs2736098, we generated the plasmids with different rs2736098
alleles and transfected them into MCF-7 cell line. As shown in Fig. 1a, the relative luciferase activity of C allele is approximately 2.36
fold higher than that of the T (P =6.03 ×10−
8
), thus verifying that rs2736098 should be functional in breast tissue.
To verify whether the function of rs2736098 is limited in breast cell, we further cultured colon cancer cell line HCT116, cervical
cancer cell line HeLa, ovarian cancer cell line SK-OV-3, gastric cancer cell line SGC-7901, hepatocellularcarcinoma cell line HepG2,
lung/bronchus epithelial cell line Beas-2B and pancreatic cancer cell line PA-TU-8988T in the same condition with MCF-7 and
transfected the two plasmids. As shown in Fig. 1, C allele of rs2736098 displays a signicantly higher luciferase expression than T in
HCT116 (Fig. 1b), HeLa (Fig. 1c), SK-OV-3 (Fig. 1d) and SGC-7901 (Fig. 1e; all P <0.0001). In contrast, no signicant difference was
observed in HepG2 (Fig. 1f), Beas-2B (Fig. 1g) and PA-TU-8988T (Fig. 1h; all P >0.60). These results indicated that rs2736098 can
inuence enhancer activity in multiple tissues.
4.2. Effect of rs2736098 in TERT expression
Considering the function and location of rs2736098, it is highly possible that rs2736098 can inuence TERT expression. However,
due to the close distance between rs2736098 and TERT promoter (1018 bp), the classic loop model between enhancer and promoter
might not apply to this case and chromosome conformation capture might not disclose the interaction between them. To substantiate
the effect of rs2736098 on TERT expression, we further generated overexpression plasmids containing two alleles of rs2736098,
transfected them into MCF-7 and measured TERT expression. Compared with the cell without transfection, TERT expression in
transfected cell increases ~8000 fold (result not shown), which indicated that intrinsic TERT expression is negligible in our experi-
ment. As shown in Fig. 2, TERT expression of the plasmid containing C allele is ~6.06 fold higher than that of T (P =0.02), which was
consistent with our luciferase result. All these facts indicate that rs2736098 indeed can inuence TERT expression.
4.3. TF interacting with rs2736098
Our above results identied that rs2736098 is a functional SNP. Since rs2736098 is located in enhancer, it seems reasonable to
Fig. 2. Differential TERT expression between rs2736098 alleles. The x axis denotes different alleles of rs2736098 while y axis represents TERT
expression. All data are displayed as mean ±SD. *P <0.05.
X.-X. Zhang et al.

Heliyon 10 (2024) e27802
5
assume that it could interact with TF and inuence TF binding afnity. Bioinformatics prediction suggested that the substitution from
T to C at rs2736098 may inuence the binding afnity of MYC and USF1. To verify this prediction, ChIP assay was carried out using
MCF-7 cell line with related antibodies and qPCR was used to assess the relative chromatin enrichment. For both antibodies, we
included positive and negative controls. The result indicated that positive control region can be immunoprecipitated while the
negative one not (results not shown), thus suggesting that our assay is effective to detect TF for rs2736098 surrounding region. As
shown in Fig. S3, the MYC antibody failed to enrich chromatin compared with IgG (P =0.66). In contrast, compared with IgG, the
region containing rs2736098 was signicantly enriched by USF1 antibody (P =0.042; see Fig. 3a), thus verifying that USF1 could bind
the rs2736098 surrounding region in MCF-7 cell.
4.4. Different TF binding afnity between rs2736098 alleles
We next performed EMSA to verify the possibility that rs2736098 interacts with USF1 in an allele specic pattern. It can be
observed that there is a specic protein-DNA complex band composed of the core sequence containing rs2736098C allele and nuclear
proteins, which veried that the rs2736098C allele could interact with protein factors (see Fig. 3b and Fig. S4). In contrast, this band is
almost disappearing for T allele of rs2736098 (see Fig. 3b and Fig. S4), thus verifying the low afnity between rs2736098 T allele and
protein factors. This pattern was consistent with our luciferase and TERT expression result.
5. Discussion
In current study, we used functional genomics approaches to investigate the role of rs2736098 in TERT expression. The result
indicated that the common allele of rs2736098, C, is with the ability to enhance TERT expression. Interestingly, the common allele at
other four positions (see Table 1) can also increase TERT promoter activity [15–17], thus constituting a haplotype with high expression
and leading to a signicant signal at rs2736108 in GWAS [10–14].
In current stage, most identied enhancers are located in non-coding region. However, enhancers in coding region have also been
reported [25–27]. Most enhancers in coding region can regulate nearby gene expression [26]. Therefore, it is not surprising to observe
that rs2736098 is a novel cis-regulatory element for TERT.
Our luciferase result indicated that rs2736098 effects through a tissue-specic manner. Indeed, the cis-regulatory function of
rs2736098 is lost in some tissues. This phenomenon has also been reported [28] and can be explained by the trans-regulatory envi-
ronment in different tissues. Indeed, rs2736098 will lose its function if the supposed TF, i.e., USF1, is absent or rs2736098 surrounding
region is competitively occupied by other proteins.
rs2736098 has been suggested to be signicantly associated with carcinogenesis in multiple tissues besides breast, including lung,
basal cell, bladder, prostate, cervix, liver, pancreas, colon, ovary, B cell, head and neck [29–41]. Further search in GWAS Catalog, UK
BioBank (https://www.ukbiobank.ac.uk) and FinnGen (https://www.nngen./) indicate that rs2736098 is also signicantly
Fig. 3. Interaction between USF1 and rs2736098. Part a displays the relative enrichment of chromatin surrounding rs2736098 by USF1 antibody.
*P <0.05. Part b indicates binding afnity difference between rs2736098 alleles. The top line indicates different alleles. NE denotes nuclear ex-
tracts, and the arrow points out the position of protein-probe complex. The original image for part b is Fig. S4
chromatin immunoprecipitation, ChIP; electrophoretic mobility shift assay, EMSA; genome-wide association study, GWAS; Han Chinese in Beijing,
CHB; Linkage disequilibrium, LD; MYC proto-oncogene, bHLH transcription factor, MYC; telomerase reverse transcriptase, TERT; transcription
factor, TF; upstream transcription factor 1, USF1; Utah Residents with Northern and Western European Ancestry, CEU; Yoruba in Ibadan,
Nigeria, YRI.
X.-X. Zhang et al.

Heliyon 10 (2024) e27802
6
associated with count of platelet, red and white blood cell, neutrophil, basophil neutrophil and monocyte (all P <5 ×10
−8
; results not
shown) [42–44]. Considering the role of rs2736098 and the LD pattern in this locus, it can be concluded that the association is resulting
from, at least partially, the cis-regulation of TERT by rs2736098.
Our and previous functional genomics work indicated that the allele in common haplotype, i.e., C of rs2736098, rs2736107,
rs2736108 and rs2736109 and A of rs2853669, is the high expression one for TERT [15–17]. Therefore, the common haplotype should
induce a high TERT expression. Moreover, there might be some synergistic effects among these ve SNPs. However, due to the
relatively long distance between rs2736098 and other four SNPs (>1264bp), we can not clone them into one segment and evaluate the
synergistic effect by mutagenesis. Further gene expression analysis in individuals with recombination at this locus might better
illuminate this issue.
The frequency of rs2736098 varies signicantly in human populations. As shown in Fig. S5, the frequency of rs2736098C allele is
~54%, ~62%, ~73%, ~78% and ~92% in South Asian, East Asian, European, American and African from 1000 genomes project,
respectively. Considering the function of rs2736098C allele, it can be concluded that TERT expression distribution might be different
among populations. However, since cancer is a group of complex diseases due to multiple loci in genome, it is difcult to deduce the
effect in cancer morbidity.
Funding
This work was supported by National Natural Science Foundation of China (No. 31370129), Project of Shangluo University (No.
23SKY003) and Fundamental Research Funds for the Central Universities (GK202302003).
Data availability
The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable
request.
CRediT authorship contribution statement
Xin-Xin Zhang: Writing – original draft, Visualization, Validation, Investigation. Xin-Yi Yu: Investigation. Shuang-Jia Xu:
Investigation. Xiao-Qian Shi: Investigation. Ying Chen: Investigation. Qiang Shi: Writing – original draft, Funding acquisition,
Conceptualization. Chang Sun: Writing – review & editing, Writing – original draft, Funding acquisition, Conceptualization.
Declaration of competing interest
The authors declare that they have no known competing nancial interests or personal relationships that could have appeared to
inuence the work reported in this paper.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.org/10.1016/j.heliyon.2024.e27802.
References
[1] E.H. Blackburn, E.S. Epel, J. Lin, Human telomere biology: a contributory and interactive factor in aging, disease risks, and protection, Science 350 (2015)
1193–1198, https://doi.org/10.1126/science.aab3389.
[2] L. Xu, S. Li, B.A. Stohr, The role of telomere biology in cancer, Annu. Rev. Pathol. 8 (2013) 49–78, https://doi.org/10.1146/annurev-pathol-020712-164030.
[3] J.C. Schmidt, T.R. Cech, Human telomerase: biogenesis, trafcking, recruitment, and activation, Genes Dev. 29 (2015) 1095–1105, https://doi.org/10.1101/
gad.263863.115.
[4] J.D. Podlevsky, J.J. Chen, It all comes together at the ends: telomerase structure, function, and biogenesis, Mutat. Res. 730 (2012) 3–11, https://doi.org/
10.1016/j.mrfmmm.2011.11.002.
[5] R. Hannen, J.W. Bartsch, Essential roles of telomerase reverse transcriptase hTERT in cancer stemness and metastasis, FEBS Lett. 592 (2018) 2023–2031,
https://doi.org/10.1002/1873-3468.13084.
[6] D.M. Baird, Variation at the TERT locus and predisposition for cancer, Expet Rev. Mol. Med. 12 (2010) e16, https://doi.org/10.1017/S146239941000147X.
[7] B. Heidenreich, P.S. Rachakonda, K. Hemminki, R. Kumar, TERT promoter mutations in cancer development, Curr. Opin. Genet. Dev. 24 (2014) 30–37, https://
doi.org/10.1016/j.gde.2013.11.005.
[8] A.J. Colebatch, A. Dobrovic, W.A. Cooper, TERT gene: its function and dysregulation in cancer, J. Clin. Pathol. 72 (2019) 281–284, https://doi.org/10.1136/
jclinpath-2018-205653.
[9] H. Sung, J. Ferlay, R.L. Siegel, et al., Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries,
CA, A Cancer Journal for Clinicians 71 (2021) 209–249, https://doi.org/10.3322/caac.21660.
[10] K. Michailidou, J. Beesley, S. Lindstrom, et al., Genome-wide association analysis of more than 120,000 individuals identies 15 new susceptibility loci for
breast cancer, Nat. Genet. 47 (2015) 373–380, https://doi.org/10.1038/ng.3242.
[11] F.J. Couch, K.B. Kuchenbaecker, K. Michailidou, et al., Identication of four novel susceptibility loci for oestrogen receptor negative breast cancer, Nat.
Commun. 7 (2016) 11375, https://doi.org/10.1038/ncomms11375.
X.-X. Zhang et al.

Heliyon 10 (2024) e27802
7
[12] H. Guo, W. Cao, Y. Zhu, T. Li, B. Hu, A genome-wide cross-cancer meta-analysis highlights the shared genetic links of ve solid cancers, Front. Microbiol. 14
(2023) 1116592, https://doi.org/10.3389/fmicb.2023.1116592.
[13] N. Brandes, N. Linial, M. Linial, Genetic association studies of alterations in protein function expose recessive effects on cancer predisposition, Sci. Rep. 11
(2021) 14901, https://doi.org/10.1038/s41598-021-94252-y.
[14] K.S. Purrington, S. Slager, D. Eccles, et al., Genome-wide association study identies 25 known breast cancer susceptibility loci as risk factors for triple-negative
breast cancer, Carcinogenesis 35 (2014) 1012–1019, https://doi.org/10.1093/carcin/bgt404.
[15] S. Helbig, L. Wockner, A. Bouendeu, et al., Functional dissection of breast cancer risk-associated TERT promoter variants, Oncotarget 8 (2017) 67203–67217,
https://doi.org/10.18632/oncotarget.18226.
[16] J. Beesley, H.A. Pickett, S.E. Johnatty, et al., Functional polymorphisms in the TERT promoter are associated with risk of serous epithelial ovarian and breast
cancers, PLoS One 6 (2011) e24987, https://doi.org/10.1371/journal.pone.0024987.
[17] S.E. Bojesen, K.A. Pooley, S.E. Johnatty, et al., Multiple independent variants at the TERT locus are associated with telomere length and risks of breast and
ovarian cancer, Nat. Genet. 45 (2013) 371–384, https://doi.org/10.1038/ng.2566, 384e371-372.
[18] Y. Lu, C. Yan, J. Du, et al., Genetic variants affecting telomere length are associated with the prognosis of esophageal squamous cell carcinoma in a Chinese
population, Mol. Carcinog. 56 (2017) 1021–1029, https://doi.org/10.1002/mc.22567.
[19] S.K. Do, S.S. Yoo, Y.Y. Choi, et al., Replication of the results of genome-wide and candidate gene association studies on telomere length in a Korean population,
Korean J Intern Med 30 (2015) 719–726, https://doi.org/10.3904/kjim.2015.30.5.719.
[20] M. Kroupa, S. Rachakonda, V. Vymetalkova, et al., Telomere length in peripheral blood lymphocytes related to genetic variation in telomerase, prognosis and
clinicopathological features in breast cancer patients, Mutagenesis 35 (2020) 491–497, https://doi.org/10.1093/mutage/geaa030.
[21] E. Rampazzo, E. Cecchin, P. Del Bianco, et al., Genetic variants of the TERT gene, telomere length, and Circulating TERT as prognostic markers in rectal cancer
patients, Cancers 12 (2020), https://doi.org/10.3390/cancers12113115.
[22] E. Calo, J. Wysocka, Modication of enhancer chromatin: what, how, and why? Mol. Cell 49 (2013) 825–837, https://doi.org/10.1016/j.molcel.2013.01.038.
[23] Y.K. Li, X.X. Zhang, Y. Yang, et al., Convergent evidence supports TH2LCRR as a novel asthma susceptibility gene, Am. J. Respir. Cell Mol. Biol. 66 (2022)
283–292, https://doi.org/10.1165/rcmb.2020-0481OC.
[24] G. Wang, X. Qi, W. Wei, E.W. Englander, G.H. Greeley Jr., Characterization of the 5’-regulatory regions of the rat and human apelin genes and regulation of
breast apelin by USF, Faseb. J. 20 (2006) 2639–2641, https://doi.org/10.1096/fj.06-6315fje.
[25] D.I. Ritter, Z. Dong, S. Guo, J.H. Chuang, Transcriptional enhancers in protein-coding exons of vertebrate developmental genes, PLoS One 7 (2012) e35202,
https://doi.org/10.1371/journal.pone.0035202.
[26] R.Y. Birnbaum, E.J. Clowney, O. Agamy, et al., Coding exons function as tissue-specic enhancers of nearby genes, Genome Res. 22 (2012) 1059–1068, https://
doi.org/10.1101/gr.133546.111.
[27] Y. Li, C. Ma, W. Li, et al., A missense variant in NDUFA6 confers schizophrenia risk by affecting YY1 binding and NAGA expression, Mol. Psychiatr. 26 (2021)
6896–6911, https://doi.org/10.1038/s41380-021-01125-x.
[28] C. Sun, C. Southard, D.B. Witonsky, O.I. Olopade, A. Di Rienzo, Allelic imbalance (AI) identies novel tissue-specic cis-regulatory variation for human
UGT2B15, Hum. Mutat. 31 (2010) 99–107, https://doi.org/10.1002/humu.21145.
[29] Z. Liu, G. Li, S. Wei, et al., Genetic variations in TERT-CLPTM1L genes and risk of squamous cell carcinoma of the head and neck, Carcinogenesis 31 (2010)
1977–1981, https://doi.org/10.1093/carcin/bgq179.
[30] T. Rafnar, P. Sulem, S.N. Stacey, et al., Sequence variants at the TERT-CLPTM1L locus associate with many cancer types, Nat. Genet. 41 (2009) 221–227,
https://doi.org/10.1038/ng.296.
[31] H. Wu, N. Qiao, Y. Wang, et al., Association between the telomerase reverse transcriptase (TERT) rs2736098 polymorphism and cancer risk: evidence from a
case-control study of non-small-cell lung cancer and a meta-analysis, PLoS One 8 (2013) e76372, https://doi.org/10.1371/journal.pone.0076372.
[32] C. Zhang, Y.P. Tian, Y. Wang, F.H. Guo, J.F. Qin, H. Ni, hTERT rs2736098 genetic variants and susceptibility of hepatocellular carcinoma in the Chinese
population: a case-control study, Hepatobiliary Pancreat. Dis. Int. 12 (2013) 74–79, https://doi.org/10.1016/s1499-3872(13)60009-0.
[33] Z. Wang, B. Zhu, M. Zhang, et al., Imputation and subset-based association analysis across different cancer types identies multiple independent risk loci in the
TERT-CLPTM1L region on chromosome 5p15.33, Hum. Mol. Genet. 23 (2014) 6616–6633, https://doi.org/10.1093/hmg/ddu363.
[34] Z. Yang, X. Zhang, S. Fang, et al., Increased risk of developing lung cancer in Asian patients carrying the TERT rs2736098 G>A polymorphism: evidence from
3,354 cases and 3,518 controls, OncoTargets Ther. 8 (2015) 2757–2765, https://doi.org/10.2147/OTT.S87534.
[35] Y. Bao, J. Prescott, C. Yuan, et al., Leucocyte telomere length, genetic variants at the TERT gene region and risk of pancreatic cancer, Gut 66 (2017) 1116–1122,
https://doi.org/10.1136/gutjnl-2016-312510.
[36] S. Karami, Y. Han, M. Pande, et al., Telomere structure and maintenance gene variants and risk of ve cancer types, Int. J. Cancer 139 (2016) 2655–2670,
https://doi.org/10.1002/ijc.30288.
[37] E.S. Essa, H.A. Alagizy, Association of MNS16A VNTR and hTERT rs2736098: G>A polymorphisms with susceptibility to diffuse large B-cell lymphoma, Tumori
104 (2018) 165–171, https://doi.org/10.5301/tj.5000653.
[38] S. Wang, Y. Zheng, T.O. Ogundiran, et al., Association of pancreatic cancer susceptibility variants with risk of breast cancer in women of European and african
Ancestry, Cancer Epidemiol. Biomarkers Prev. 27 (2018) 116–118, https://doi.org/10.1158/1055-9965.EPI-17-0755.
[39] M. Zhou, B. Jiang, M. Xiong, X. Zhu, Association between TERT rs2736098 polymorphisms and cancer risk-A meta-analysis, Front. Physiol. 9 (2018) 377,
https://doi.org/10.3389/fphys.2018.00377.
[40] C. Adolphe, A. Xue, A.T. Fard, L.A. Genovesi, J. Yang, B.J. Wainwright, Genetic and functional interaction network analysis reveals global enrichment of
regulatory T cell genes inuencing basal cell carcinoma susceptibility, Genome Med. 13 (2021) 19, https://doi.org/10.1186/s13073-021-00827-9.
[41] F.R. Schumacher, A.A. Al Olama, S.I. Berndt, et al., Association analyses of more than 140,000 men identify 63 new prostate cancer susceptibility loci, Nat.
Genet. 50 (2018) 928–936, https://doi.org/10.1038/s41588-018-0142-8.
[42] M.H. Chen, L.M. Rafeld, A. Mousas, et al., Trans-ethnic and ancestry-specic blood-cell genetics in 746,667 individuals from 5 global populations, Cell 182
(2020) 1198–1213 e1114, https://doi.org/10.1016/j.cell.2020.06.045.
[43] A.R. Barton, M.A. Sherman, R.E. Mukamel, P.R. Loh, Whole-exome imputation within UK Biobank powers rare coding variant association and ne-mapping
analyses, Nat. Genet. 53 (2021) 1260–1269, https://doi.org/10.1038/s41588-021-00892-1.
[44] D. Vuckovic, E.L. Bao, P. Akbari, et al., The polygenic and monogenic basis of blood traits and diseases, Cell 182 (2020) 1214–1231 e1211, https://doi.org/
10.1016/j.cell.2020.08.008.
X.-X. Zhang et al.