PM2.5 induces a senescent state in mouse AT2 cells

Full text

Environmental Pollution 347 (2024) 123686
Available online 29 February 2024
0269-7491/© 2024 Elsevier Ltd. All rights reserved.
PM
2.5
induces a senescent state in mouse AT2 cells
☆
Peiyong Cheng
a
,
1
, Yongqi Chen
b
,
1
, Jianhai Wang
a
,
c
,
1
, Ziyu Han
b
, De Hao
a
, Yu Li
a
,
c
,
Feifei Feng
d
, Xuexin Duan
b
, Huaiyong Chen
a
,
c
,
e
,
f
,
*
a
Department of Basic Medicine, Haihe Hospital, Tianjin University, Tianjin, 300350, China
b
State Key Laboratory of Precision Measuring Technology and Instrument, College of Precision Instrument and Opto-electronics Engineering, Tianjin University, Tianjin,
300072, China
c
Key Research Laboratory for Infectious Disease Prevention for State Administration of Traditional Chinese Medicine, Tianjin Institute of Respiratory Diseases, Tianjin,
300350, China
d
Department of Toxicology, Zhengzhou University School of Public Health, Zhengzhou, Henan Province, China
e
Tianjin Key Laboratory of Lung Regenerative Tianjin University Medicine, Tianjin, 300350, China
f
College of Pulmonary and Critical Care Medicine, 8th Medical Center, Chinese PLA General Hospital, Beijing, 100091, China
ARTICLE INFO
Keywords:
PM
2.5
Organoid culture
Microuidic chip
Lung stem cells
Membrane permeability
Senescence
ABSTRACT
PM
2.5
is known to induce lung injury, but its toxic effects on lung regenerative machinery and the underlying
mechanisms remain unknown. In this study, primary mouse alveolar type 2 (AT2) cells, considered stem cells in
the gas-exchange barrier, were sorted using uorescence-activated cell sorting. By developing microuidic
technology with constricted microchannels, we observed that both passage time and impedance opacities of
mouse AT2 cells were reduced after PM
2.5
, indicating that PM
2.5
induced a more deformable mechanical property
and a higher membrane permeability. In vitro organoid cultures of primary mouse AT2 cells indicated that PM
2.5
is able to impair the proliferative potential and self-renewal capacity of AT2 cells but does not affect AT1 dif-
ferentiation. Furthermore, cell senescence biomarkers, p53 and γ-H2A.X at protein levels, P16
ink4a
and P21 at
mRNA levels were increased in primary mouse AT2 cells after PM
2.5
stimulations as shown by immunouo-
rescent staining and quantitative PCR analysis. Using several advanced single-cell technologies, this study sheds
light on new mechanisms of the cytotoxic effects of atmospheric ne particulate matter on lung stem cell
behavior.
1. Introduction
Airborne particulate matter (PM) can persist in the air for extended
periods and may enter the body through inhalation. Upon inhalation,
these particles can accumulate in the trachea or lungs, potentially
affecting respiratory health. PM exposure is associated with morbidity
and mortality from respiratory and cardiovascular diseases (Guo et al.,
2022; Han et al., 2020; Losacco and Perillo, 2018; Yu et al., 2022).
Although most of the inhaled airborne particles are cleared by airway
mucociliary systems, particles with aerodynamic diameter below 5
μ
m
may penetrate and retain in the respiratory system (Grzywa-Celinska
et al., 2020; Guo et al., 2022). As a ne particle with an aerodynamic
diameter of less than 2.5
μ
m, PM
2.5
is estimated to account for more than
96% of the particles found in human lungs (Yan et al., 2022). Sources
and composition of PM
2.5
vary from location to location, depending on
the agricultural, industrial, environmental, and cultural settings. PM
2.5
is usually composed of inorganic components, organic components, and
microorganisms (Nan et al., 2023). Particulate matter can transport and
spread pathogens, leading to lung infections such as SARS-COV-2 virus
(Comunian et al., 2020). Other toxic elements of PM
2.5
include various
heavy metals such as arsenic, cadmium, nickel, lead, and hexavalent
chromium, which may cause redox reactions and epithelial barrier
damage in the lung (Chen et al., 2022b; Fuertes et al., 2014; Gini et al.,
2022).
Mammalian lungs have sophisticated regenerative and repair pro-
grams at steady-state and after lung injury (Basil et al., 2020; Li et al.,
2020b; Zhao et al., 2022a). The gas-exchanging alveolar space mainly
consists of two epithelial cell types: column AT2 cells and at
☆
This paper has been recommended for acceptance by Admir Cr´
eso Targino.
* Corresponding author. Department of Basic Medicine, Haihe Hospital, Tianjin University, Tianjin, 300350, China.
E-mail address: huaiyong_chen@tju.edu.cn (H. Chen).
1
Contributed equally
Contents lists available at ScienceDirect
Environmental Pollution
journal homepage: www.elsevier.com/locate/envpol
https://doi.org/10.1016/j.envpol.2024.123686
Received 1 October 2023; Received in revised form 24 February 2024; Accepted 28 February 2024

Environmental Pollution 347 (2024) 123686
2
gas-exchanging AT1 cells. AT2 cells self-renew, proliferate, and differ-
entiate into AT1 epithelial cells, thereby maintaining homeostasis of the
alveolar epithelium (Barkauskas et al., 2013; Li et al., 2020a). In addi-
tion, AT2 cells exhibit multiple functions, including secretion of sur-
factants, transport of sodium and uid, and regulation of immune
responses. Therefore, AT2 cells act as facultative alveolar epithelial stem
cells for alveolar epithelial maintenance, repair, and regeneration
(Chong et al., 2023). Studies in mice indicated that AT2 cell senescence
and apoptosis lead to lung injury and brosis (Lehmann et al., 2017; Yao
et al., 2021; Zhang et al., 2021). Senescent cells produce various proteins
known as senescent cell-associated secretory phenotypes, such as p53
and γ-H2A.X. The expression of senescence markers was enhanced in
human aortic smooth muscle cells after PM
2.5
exposure (Jun et al.,
2018). PM exposure promotes cellular senescence in human immortal-
ized A549 cells and primary epithelial cells, however, it remains un-
known whether PM
2.5
induces senescence of AT2 cells, the machinery of
alveolar epithelial repair and regeneration after lung injures.
Senescent and apoptotic cells undergo notable membrane deforma-
tion and cytoskeletal reorganization, leading to dramatic changes in cell
stiffness (Moujaber et al., 2019). Proper mechanical tension favors AT2
cell proliferation; however, excessive mechanical stress has been shown
to drive pulmonary brosis in mice (Liu et al., 2016; Wu et al., 2021).
Therefore, AT2 cell deformability may reect the healthy state of the
cells and their capacity for alveolar epithelial regeneration. In the eld
of cellular biology, it has not been possible to quantify AT2 cell
deformability. Microuidic technology has been developed and opti-
mized over the past decade, and has now become a powerful platform
for measuring cell deformability by precisely owing cells of interest
through microstructures at the cellular scale (Matthews et al., 2022).
Previous studies have suggested that the electrical impedance of cells
decreases with age (Cha et al., 2016; Park et al., 2016). However, the
biophysical behavior (e.g., impedance change) at the single-cell level
during the AT2 cell injury remains unclear. In this study, we isolated
single primary AT2 cells from mouse lungs by uorescence-activated
cell sorting (FACS). 3-D organoid culture methodology was established
to evaluate the effects of PM
2.5
on sorted mouse AT2 cells. A micro-
fabricated microuidic impedance ow cytometer was used to measure
mechanical and electrical changes in single mouse AT2 cells 24 h after
PM
2.5
stimulations. Furthermore, immunouorescence staining and
quantitative polymerase chain reaction (PCR) analysis were applied to
evaluate the PM
2.5
-induced senescence of mouse AT2 cells. We observed
that PM
2.5
can induce a senescent state in mouse AT2 cells, deformable
mechanical property, and membrane permeability which may be asso-
ciated with the impairment of AT2 cell proliferation and self-renewal
capacity.
2. Materials and methods
2.1. Reagents
Detailed information is included in Table 1.
2.2. Microuidic chip fabrication
The microuidic chip consisted of a glass substrate with microelec-
trodes and a polydimethylsiloxane (PDMS) chip with a constriction
channel (Fig. 2). Microelectrodes were fabricated using a traditional lift-
off process. Ti (50 nm) and Au (150 nm) were successively deposited on
a BF33 glass substrate. The microchannel was manufactured using
standard soft lithography. A microuidic channel master mold with a
height of 20
μ
m was fabricated by spin-coating negative photoresist SU-
8 2015 (Micro Chem) onto a silicon wafer at 1600 rpm, and subse-
quently soft baked the wafer at a 95 ◦C hot plate for 3 min. The wafer
was aligned to a predesigned chrome mask and patterned under UV
exposure. Post exposure, the wafer was baked on a hot plate at 95 ◦C for
5 min, and nally developed at 3 min 30 s, and the remaining photo-
resist SU8-2015 on the silicon wafer was the mode of the microchannel.
The PDMS base agent and curing agent were mixed at a 10:1 ratio,
poured onto the SU-8 mold, and then the mold was baked in a 90 ◦C oven
for 1 h. After peeling off the microchannel mold, the PDMS lm was cut
into individual chips and punched for liquid inlets and outlets. The
PDMS chip and microelectrode substrate were aligned and bonded after
oxygen plasma treatment. The fabricated chip was subsequently baked
at 90 ◦C for 1 h to strengthen the adhesion between PDMS and glass
substrate, and then connected to pre-designed PCB board to transmit the
detection signal.
2.3. Microuidic chip setup
Microuidic chip setup was described as previously (Han et al.,
2020). In brief, two pairs of electrodes were symmetrically placed at the
entrance and exit of the constriction channel, which is 8
μ
m in width, 20
μ
m in height, and 600
μ
m in length. An AC stimulus (1 V) comprising 5
MHz and 500 kHz components was applied to the middle two electrodes,
while the currents on the other two side electrodes were amplied by the
current preamplier, and the differential current responses were
recorded by the impedance analyzer. The suspended cells were contin-
uously pumped into the microchannel at constant pressure (20 mbar)
using a pressure-actuated system. An inverted uorescence microscope
(IX73; Olympus, Japan) was used to ensure that the microuidic chip
functioned properly. A pressure-actuated pump (MFCS-EZ, Fluigent,
France) was used to pump suspended cells into the microuidic chip. An
excitation signal (1 V, 500 kHz, and 5 MHz) generated by an impedance
analyzer (HF2IS, Zurich Instruments, Switzerland) was applied to the
two middle electrodes of the microuidic chip. The other two electrodes
were connected to a current amplier (HF2TA, Zurich Instruments,
Switzerland) to pre-amplify the differential current signals 1000 times.
The data were recorded using Zi-control and processed using MATLAB,
Table 1
Reagents.
Reagents MAKER
Ethylene glycol-bis (2-aminoethylether)-N,N,N
′
,N’-
tetraacetic acid (EGTA)
Sigma-Aldrich
Elastase Worthington Biochemical
Corporation
Ham’s F12 medium Corning
Dulbecco’s Modied Eagle’s Medium/Nutrient Mixture
F12 (DMEM/F12) medium (50/50)
Corning
Fetal bovine serum (FBS) Gibco
Insulin transferrin selenium medium Sigma-Aldrich
Penicillin/streptomycin Gibco
Hydroxyethylpiperazine ethane sulfonic acid (HEPES) Sigma-Aldrich
Hanks Balanced Salt Solution (HBSS) Solarbio
Deoxyribonuclease I (DNase I) from bovine pancreas Sigma-Aldrich
Red blood cell (RBC) lysis buffer Invitrogen
7-AAD viability staining solution eBioscience
PE-conjugated anti-mouse CD24 antibody eBioscience
APC-conjugated anti-mouse Sca-1 antibody eBioscience
PE-CY7-conjugated anti-mouse Ep-CAM antibody Biolegend
Biotin-conjugated anti-mouse CD31 antibody eBioscience
Biotin-conjugated anti-mouse CD34 antibody eBioscience
Biotin-conjugated anti-mouse CD45 antibody eBioscience
APC-Cy7-conjugated streptavidin
Rabbit anti-mouse surfactant protein C (SP–C)
polyclonal antibody
Syrian hamster anti-mouse T1
α
monoclonal antibody
Donkey anti-rabbit secondary antibody, Alexa Fluor
594
Goat anti-Syrian hamster secondary antibody, Alexa
Fluor 488
eBioscience
Millipore
Invitrogen
Invitrogen
Invitrogen
Rabbit anti-mouse p53 monoclonal antibody Biyuntian Biotechnology
Rabbit anti-mouse γ-H2AX monoclonal antibody Biyuntian Biotechnology
4
′
,6-diamidino-2-phenylindole (DAPI) Sigma-Aldrich
Matrigel Corning
Y27632 Sigma-Aldrich
SB431542 Sigma-Aldrich
P. Cheng et al.

Environmental Pollution 347 (2024) 123686
3
and the extracted passage time and impedance opacity were plotted
using Origin software. The performance and functionality testing of the
chip was examined (Supplementary Material).
2.4. Working principle of microuidic chip
The conductive liquid is replaced by cells with greater impedance
when they pass above the electrodes, resulting in a transient differential
current pulse. A negative pulse indicates that a cell passes across the
entrance electrodes of the constriction channel, whereas a positive pulse
indicates that the cell exits the constriction channel (Li and Ai, 2021;
Zhou et al., 2018). The number of cells was counted using pulse pairs,
and the mean detection throughput was 92 cells/m. The electrical and
mechanical properties can be extracted from real-time electrical signals.
The amplitude of the pulse signals is dened as the impedance of the
cells, and the time interval between the negative and positive pulses is
dened as the passage time, which is related to the mechanical prop-
erties because cells with poor deformability need to spend more time to
deform themselves to squeeze into a constriction channel that is smaller
than their diameter (Han et al., 2020). These changes reected different
information with changes in the frequency of the excitation signal. The
size of a cell has a signicant effect on its impedance at low frequencies
(<1 MHz), whereas the capacitance of the cellular membrane has a
signicant impact on the impedance at middle frequency (0.5–10 MHz)
(McGrath et al., 2017). The impedance of the electrical double layer
(EDL) near the surface of the electrodes is dominant in the
low-frequency regime (<300 kHz) (Gong et al., 2021). In this study, AC
frequencies of 5 MHz and 500 kHz were introduced to detect cellular
impedance, and impedance opacity (i.e., the ratio of differential current
pulse magnitudes measured at high and low frequencies) was introduced
to reduce the effect of cell size and cell height in the channel on the
amplitude of current pulses (Simon et al., 2016).
2.5. PM
2.5
sample collection
PM
2.5
samples were collected in Tianjin, China using the third stage
of the 2030 Laoshan medium-ow TSP intelligent sampler (LY2030,
LAOYING, China) (collecting particles below the size of 2.5
μ
m in
diameter). A quartz lter membrane (diameter: 80 mm) was chosen for
sampling, followed by ultrasonic vibration and ltration through sterile
gauze. The ltrate was placed in −80 ◦C overnight, and then passed
through a vacuum freeze dryer to generate PM
2.5
dry powder. Induc-
tively coupled plasma mass spectrometry (ICP-MS) was employed to
characterize the composition of PM
2.5
samples which was described in
Supplementary Material and our previous study (Li et al., 2023). A stock
solution with a concentration of 1 mg/mL was prepared with PBS, and
the PM
2.5
were ultrasonically treated with an ultrasonic cleaner at a low
temperature for 1 h to make the PM
2.5
suspension better pulverized and
mixed. Primary mouse AT2 cells were co-incubated by mixing the pre-
pared 1 mg/mL PM
2.5
stock solution with a vortex mixer and preparing
suspensions at different concentrations (0, 0.1, 0.2 mg/mL) using a
culture medium.
2.6. Experimental mice
C57BL/6 mice were purchased from Sipeifu Bioscience Co., Ltd.
(Beijing, China) and housed in a specic pathogen-free animal facility at
Haihe Hospital, Tianjin University (License Number: SYXK (Tianjin)
2021-0002). The mice were maintained in accordance with the standard
feeding conditions as the environmental temperature at 20–26 ◦C, the
humidity between 40% and 70%, alternating 12-h light/dark cycle, free
access to food or water. Mice age 8–12 weeks were used in this study.
This study complied with the ethical principles and was approved by the
Animal Care and Use Committee of Haihe Hospital, Tianjin University
(2017-kt-04).
2.7. Fluorescence activated cell sorting (FACS)
Individual AT2 cells were sorted from mouse lungs, as previously
described (Chen et al., 2012; Zhao et al., 2022b). In brief, the mice were
anesthetized with 1% pentobarbital sodium, and the whole lung tissue
was removed. The elastase was intratracheally injected into each lung
tissue, with the rst injection of 1 mL and the remaining four injections
of 0.5 mL each at an interval of 5 min. After the enzyme digestion, lung
tissue was minced with a razor blade, and then treated with 5 mL of
DNase I at 37 ◦C CO
2
incubator for 15 min to break cell-cell adhesion.
Pre-cooled Hanks’ balanced salt solution were added to terminate the
reaction, and the mixture was transferred through a 70
μ
m cell strainer.
The resulting cell suspension was centrifuged at 600 g for 5 min at 4 ◦C.
After centrifugation, 1 mL of RBC lysis buffer was added to the cell pellet
and incubated on ice for 90 s to remove RBCs. Precooled HBSS con-
taining 2% FBS was added to terminate the reaction. After centrifuge at
700 g for 8 min at 4 ◦C, cell pellets were resuspended with pre-chilled
HBSS and incubated with primary antibodies against CD24, Ep-CAM,
Sca-1, CD31, CD34, CD45 antibody, and 7-AAD viability staining solu-
tion for 45 min on ice. After washing with HBSS, the cells were incu-
bated with the secondary antibody, APC-Cy7-conjugated streptavidin,
for 40 min on ice. The cell suspension was then centrifuged and resus-
pended in HBSS for individual AT2 cell sorting using FACS (FACS Aria
III, BD, USA).
2.8. In vitro 3D organoid culture
Single AT2 cells can grow into organoids in the presence of sup-
porting lung broblast cells (MLg) in vitro as described previously (Chen
et al., 2012). MLg cells were maintained in DMEM supplemented with
10% FBS, 100 IU/mL penicillin, and 100
μ
g/mL streptomycin in a hu-
midied incubator at 37 ◦C and 5% CO
2
. FACS-sorted AT2 cells were
mixed with MLg cells in DMEM/F12 culture medium supplemented with
10% FBS, 100 IU/mL penicillin, and 100
μ
g/mL streptomycin (desig-
nated as basal stem cell culture medium), which was then mixed with
Matrigel and transferred to transwells (100
μ
L per transwell with 2 ×10
4
AT2 cells and 2 ×10
5
MLg cells). Transwells were then placed on a
24-well plate containing 410
μ
L basal culture medium supplemented
with 10
μ
M SB43142. Y27632 was added to the cultures for the rst two
days to limit cell death. Organoid cultures were maintained at 37 ◦C in a
5% CO
2
incubator, and the culture medium was replaced every other
day. At tenth day, the organoids derived from individual AT2 cells were
photographed using an inverted uorescence microscope (IX73,
Olympus, Japan). Cellseens Dimension software was used to determine
the number and size of the organoids. Organoid-forming efciency
(OFE) represents the number of organoids as a percentage of the input
AT2 cells in each culture, reecting the self-renewal capacity. Organoid
size reects the proliferation potential of AT2 cells.
2.9. Immunouorescent staining
For regenerative experiments of AT2 cells, after PM
2.5
treatments,
organoid cultures were xed in 4% paraformaldehyde at 4 ◦C for 2 h and
embedded in OCT compound. Five-micrometer sections were then
collected for immunouorescent staining with antibodies targeting on
SPC (AT2 cells) or T1
α
(AT1 cells), followed by incubating with
urochrome-conjugated secondary antibodies, For AT2 cell aging ex-
periments, after PM
2.5
stimulation, mouse AT2 cells were transferred
onto slides. Cells were xed with 4% paraformaldehyde at 4 ◦C for 15
min. After washing with PBS, slides were staining with rabbit anti-p53
monoclonal antibody or rabbit anti-phosphor-histone γ-H2A.X
(Ser139) monoclonal antibody at 4 ◦C overnight. Alexa Fluor 488-conju-
gated goat anti-rabbit secondary antibody (1:200; Invitrogen) was
added and incubated at room temperature for one and half hour. After
washing with phosphate-buffered saline (PBS), the slides were mounted
with Fluoromount G and DAPI to stain the nuclei. Stained slides were
P. Cheng et al.

Environmental Pollution 347 (2024) 123686
4
imaged using an inverted uorescence microscope (IX73, Olympus,
Japan). Three or more random elds were selected from each stained
slide for quantitative analyses.
2.10. RNA isolation and quantitative PCR
Total RNA was extracted from mouse AT2 cells using TRIzol reagent
following established protocols. Subsequently, RNA was reverse-
transcribed into cDNA by HiScript Reverse Transcriptase in accor-
dance with the manufacturer’s guidelines. qPCR was performed on a
LightCycler 96 real-time PCR system (LightCycler 96, Roche,
Switzerland) using SYBR Green master mix, as previously outlined. Gene
expression was measured relative to the level of the endogenous refer-
ence gene β-actin. The qPCR primer sequences employed were as fol-
lows: Actb-F: 5ʹ- CATTGCTGACAGGATGCAGAAGG -3ʹ, Actb-R: 5ʹ-
TGCTGGAAGGTGGACAGTGAGG -3ʹ; T1
α
-F: 5ʹ-TGCTACTGGAGGGCT-
TAATGA-3ʹ, T1
α
–R: 5ʹ-TGCTGAGGTGGACAGTTCCT-3ʹ; P16
ink4a
-F: 5ʹ-
TGTTGAGGCTAGAGAGGATCTTG-3ʹ, P16
ink4a
-R: 5ʹ-CGAATCTG-
CACCGTAGTTGAGC-3ʹ; P21–F: 5ʹ-TCGCTGTCTTGCACTCTGGTGT-3ʹ,
P21-R: 5
′
-CCAATCTGCGCTTGGAGTGATAG-3ʹ.
2.11. Statistical analysis
SPSS software (version 22.0) was used to analyze the data, and all
experiments were conducted three times independently. Data are
expressed as mean ±standard deviation (SD), and comparisons were
made using the t-test for independent samples. A p-value <0.05 was
considered to be statistically signicant.
3. Results
3.1. Organoid culture setup for evaluating effects of PM
2.5
on AT2 cell
function
In order to study the toxic effect of PM
2.5
on mouse lung epithelial
stem cells, AT2 cells were sorted by FACS based on their surface marker
expression, EpCAM
+
CD31
−
CD34
−
CD45
−
CD24
−
Sca-1
-
(Fig. 1A). We
established in vitro atmospheric ne particulate matter toxicity organoid
culture model (Fig. 1B). Treatment of PM
2.5
at 0.01 mg/mL had minor
effect on organoid formation or AT2 cell differentiation in these orga-
noids (Fig. 1C, D, E, F, and G), but no organoids were formed at 0.5 mg/
mL (data not shown). Consistent with relevant studies (Chen et al.,
2022a; Jiao et al., 2022; Yue et al., 2023), the PM
2.5
solution concen-
trations chosen were 0.1 and 0.2 mg/mL to investigate toxic effects of
PM
2.5
on mouse AT2 cells. Treatment with PM
2.5
signicantly reduced
the organoid-forming efciency (OFE) of AT2 cells as well as the size of
the organoids (Fig. 1C, D, and E). PM
2.5
decreased the expression of SPC
and induced morphological changes in AT2 cell-derived organoids.
These organoids exhibited more luminal after PM
2.5
stimulations
(Fig. 1C and F), but the distribution of AT1 and AT2 cells was not altered
in the organoids (AT1 cells surrounded by AT2 cells) (Fig. 1F). We found
that PM
2.5
did not interrupt the differentiation of AT2 cells to AT1 cells
(Fig. 1G). These data suggest that PM
2.5
at 0.1 or 0.2 mg/mL inhibits the
proliferation potential and self-renewal capacity of mouse AT2 cells, but
does not affect AT1 cell differentiation.
3.2. PM
2.5
changes AT2 cell mechanical and electrical properties
Next, mouse AT2 cells were untreated or treated with PM
2.5
, at 0.1
mg/mL, or 0.2 mg/mL for 24 h respectively. A microuidic impedance
Fig. 1. PM
2.5
can inhibit the proliferation of mouse AT2 cells in vitro. (A) Sorting strategy of alveolar epithelial CD24
-
Sca1
-
AT2 cells from mouse lungs by FACS. (B)
Schematic illustration of the PM
2.5
-AT2-MLg co-culture organoid model. (C) Representative micrographs of organoid cultures of mouse AT2 cells isolated from
C57BL/6 mice 10 days after PM
2.5
stimulations (0.01 mg/mL, 0.1 mg/mL, 0.2 mg/mL). Scale bar: 200
μ
m. (D and E) OFEs (E) and sizes (F) of organoid colonies from
C57BL/6 mice at day 10 after PM
2.5
stimulation (n =4). (F) Immunouorescent staining of AT2 organoids (day 10 after seeding) with SPC (AT2 cell marker) and T1
α
(AT1 cell marker). Scale bar: 50
μ
m. (G) mRNA expression of T1
α
was determined in AT2 organoids at day 10 after PM
2.5
stimulations (n =4). Statistical signicance
was dened as *p <0.05; **p <0.01; ***p <0.001).
P. Cheng et al.

Environmental Pollution 347 (2024) 123686
5
ow cytometer with a constriction channel was then used to study
changes of the electrical and mechanical properties of AT2 cells after
PM
2.5
treatments by measuring the electrical impedance and passage
time, respectively (Fig. 2). The number of cells was counted using pulse
pairs, and the mean detection throughput was 92 cells/min. The passage
time of mouse AT2 cells at a PM
2.5
concentrations of 0.1 mg/mL (45.97
±8.92 ms) or 0.2 mg/mL (45.11 ±7.73 ms) was signicantly shorter
than untreated AT2 cells (47.26 ±11.10 ms) (Fig. 3A). These data
suggest that the deformability of AT2 cells is enhanced by PM
2.5
. Simi-
larly, the impedance opacity of AT2 cells after PM
2.5
stimulations was
also reduced compared with that of the untreated group (Fig. 3B).
Considering that the AC signal frequencies chosen were 5 MHz and 500
kHz, which are related to the capacitance of the membrane and the
cellular size, respectively, the increase in the capacitance of the AT2
cellular membrane may be the reason for the decrease in cell impedance
at a high frequency (5 MHz). Scatter plots of impedance opacity vs.
current pulse magnitude at 0.5 MHz also indicated that there were sig-
nicant differences in impedance opacity between untreated AT2 cells
and PM
2.5
stimulated AT2 cells (Fig. 3C). The impedance at 500 kHz of
AT2 cells, untreated or treated with PM
2.5
almost coincided, suggesting
that PM
2.5
does not have a distinguishing effect on cell size.
3.3. PM
2.5
promotes AT2 cell senescence
PM
2.5
is known to induce broad cytotoxicity (Chowdhury et al.,
2023). Previous studies have shown that PM exposure promotes cellular
senescence in immortalized human A549 and primary epithelial cells.
We next investigated whether the PM
2.5
stimulation induces cellular
senescence of mouse AT2 cells. Immunouorescence staining was con-
ducted on mouse AT2 cells which were untreated or treated with PM
2.5
for 24 h using p53 and γ-H2A.X, common markers of cellular senescence
(Zhang et al., 2023). We observed that the proportion of p53-positive or
γ-H2A.X-positive AT2 cells over all AT2 cells was increased and the
expression of p53 or γ-H2A.X in individual cells as well after PM
2.5
treatment (Fig. 4A–F). qPCR data showed that the mRNA expression of
P16
ink4a
and P21 was also elevated after PM
2.5
(Fig. 4G–H). These results
suggested that PM
2.5
, induces a senescent state in AT2 cells within 24 h
in vitro.
4. Discussion
In this study, using microuidic and organoid tools, we found for the
rst time that PM
2.5
alters the biophysical properties and impairs the
regenerative functions of alveolar stem cells. Mouse AT2 cells after
PM
2.5
stimulation exhibited more deformable mechanical properties,
higher membrane permeability, and increased expression of senescent
markers. These characteristic changes may be associated with impaired
AT2 cell proliferation and self-renewal capacity.
The deleterious impact of PM
2.5
on the human respiratory system has
been acknowledged. Abundant epidemiological studies have substanti-
ated the association between exposure to PM
2.5
and respiratory ailments
such as lung cancer, cystic brosis, pulmonary damage, bronchitis,
asthma, respiratory infections, and chronic obstructive pulmonary dis-
ease. Existing studies have predominantly employed lung epithelial cell
lines to explore the cytotoxic effects of certain harmful components of
PM
2.5
. For instance, BEAS-2B bronchial epithelial cells or A549 alveolar
epithelial cells were incubated with soluble fraction of PM
2.5
extracts at
different concentrations for 24 h, resulting in a dose-dependent reduc-
tion in cell viability (Zhao et al., 2020). In present study, we employ
organoid technology to investigate the impact of PM
2.5
on primary lung
epithelial cells, a methodology that can more authentically reect the in
vivo environment compared with immortalized cell lines.
Organoids are tissue-like structures formed through the in vitro three-
dimensional (3D) cultivation of adult stem cells or pluripotent stem
cells, providing a spatial structure (Li and Izpisua Belmonte, 2019).
Although they are not true organs, organoids can mimic real organs in
some aspects of tissue structure and function, displaying a cellular
composition and behavior close to physiology. Organoids maintain
genomic stability and are suitable for biosample repositories,
high-throughput screening, and toxicology evaluation (Fernandes,
2023). Alveolar organoids specically represent cultures formed under
3D support cultivation of alveolar stem cells, resembling alveolar cell
types and certain structures, expressing alveolar epithelial cell markers,
and including some lung interstitial cells (Jain et al., 2023). This tech-
nology allowed us to evaluate the toxic effects of PM
2.5
and observed
that the proliferative and self-renewal functions—but not the differen-
tiation function—of mouse AT2 cells are impaired. Our data suggested
that PM
2.5
changes the morphology of organoids and does not inuence
the distribution of AT1 and AT2 cells in organoids. Considering the
complex composition of PM
2.5
samples, we were not able to identify
components that are toxic to AT2 cells. Future studies may evaluate the
effect of individual component on AT2 cell behavior using this organoid
culture system. In addition, it can also be used to investigate effects of
PM
2.5
on other epithelial stem/progenitor cells in the lungs.
Alveoli undergo rhythmic and dynamic deformation during respi-
ratory activities, commonly referred to as mechanical strain. Studies
have demonstrated a correlation between the magnitude of the alveolar
mechanical strain and alveolar function. Mechanical forces during
alveolar development regulate cellular behaviors such as the prolifera-
tion and differentiation of lung epithelial cells (Li et al., 2018). Micro-
uidic chips, a technological platform that combines chemistry, physics,
and biology, have made signicant strides in the eld of cellular
biomechanics (Wei, 2020). Our study utilized a microuidic chip to
detect the mechanical properties and impedance of AT2 cells, revealing
that PM
2.5
affects both the mechanics and impedance of AT2 cells.
Impedance opacities hinder cells from alternating currents and are
closely related to factors such as ion concentration inside and outside the
cell, integrity of the cell membrane, and cell morphology. Generally, it is
associated with the impedance of the cell membrane, which is inu-
enced by factors such as membrane integrity, degree of ion channel
Fig. 2. Microuidic chip devices for detecting the electrical and mechanical
properties of mouse AT2 cells. (A) A schematic diagram of signals for detecting
the electrical and mechanical properties of cells. An AC stimulus (1 V)
comprising of 5 MHz and 500 kHz components was applied to the middle two
microelectrodes. (B) A schematic diagram of system connection. The amplied
current was sent to the impedance analyzer for differential processing.
P. Cheng et al.

Environmental Pollution 347 (2024) 123686
6
opening, and voltage on the cell membrane. In a study involving frog
heart muscle cells, the impedance was closely associated with cell aging
and served as an indicator of cellular senescence (Cha et al., 2016).
Impedance is related to the histological and morphological
characteristics of muscle bers and is a biomarker of aging (Aaron et al.,
2006; Clark-Matott et al., 2019; Pandeya et al., 2021; Rutkove et al.,
2023). These studies suggested that the electrical properties of cells
gradually change during the aging process with alterations in cellular
Fig. 3. PM
2.5
induces changes to AT2 cell mechanical and electrical properties using microuidic impedance ow cytometry. (A) Comparison of passage time of AT2
cells among control group and experimental groups stimulated by 0.1/0.2 mg/mL PM
2.5
. (B) Comparison of impedance opacity of AT2 cells among control group and
experimental groups stimulated by 0.1/0.2 mg/mL PM
2.5
. (C) Scatter plots of impedance opacity vs current pulse magnitude at 0.5 MHz among control group and
experimental groups stimulated by 0.1/0.2 mg/mL PM
2.5
. ***p <0.01; ****p <0.001.
Fig. 4. PM
2.5
induces a senescent state in AT2 cells. (A and B) Immunouorescence staining of AT2 cells with p53 (A) andγ-H2A.X (B). (C and D) Quantication of
fractions of p53
+
cells (C) and γ-H2A.X +cells (D) in total AT2 cells. (E and F) Relative intensity of p53 and γ-H2A.X uorescence. (G and H) mRNA expression of P21
and P16
ink4a
were determined in AT2 cells. The staining experiments were repeated three or more times, and the trend was considered to be consistent. The yellow
dotted box is an enlarged area of the original image (white dotted box). Scale bar: 50
μ
m *p <0.05; **p <0.01; ****p <0.0001. (For interpretation of the references
to colour in this gure legend, the reader is referred to the Web version of this article.)
P. Cheng et al.

Environmental Pollution 347 (2024) 123686
7
components, making impedance analysis a viable method for studying
cellular aging. Our results indicated a decrease in impedance in AT2
cells stimulated with PM
2.5
, suggesting an induction of cellular senes-
cent status, with consistent ndings between the senescence indicators
and impedance features.
This study had several limitations. To verify the observed effects of
PM
2.5
on AT2 cell features, senescent inhibitors should be considered in
future studies. PM
2.5
-induced senescent phenotype in primary mouse
AT2 cells needs to be veried using other related methods. The micro-
uidic technology used in this study provided only some properties of
the AT2 cells for mechanical responses. More tools are required to fully
reveal other cellular features of AT2 cells in response to mechanical
stress.
5. Conclusions
In conclusion, our study demonstrated that PM
2.5
causes senescence
of mouse AT2 cells and alters their biophysical properties and regener-
ative function, using several single-cell technologies including FACS,
microuidic, and organoid tools. This study explored the underlying
facets of cellular deformability, membrane permeability, and mechani-
cal attributes of cells post PM
2.5
exposures. To understand the impact of
PM
2.5
on lung injury and repair, this study is important not only for the
eld of fundamental lung biology but also for extending its relevance to
broader public health concerns. These ndings are invaluable for the
development of effective preventive and therapeutic strategies against
respiratory diseases caused or exacerbated by air pollution.
CRediT authorship contribution statement
Peiyong Cheng: Writing – review & editing, Writing – original draft,
Validation, Methodology, Investigation, Formal analysis. Yongqi Chen:
Writing – review & editing, Writing – original draft, Validation, Meth-
odology, Investigation, Formal analysis. Jianhai Wang: Writing – re-
view & editing, Writing – original draft, Validation, Methodology,
Investigation, Formal analysis. Ziyu Han: Writing – original draft,
Methodology, Investigation, Formal analysis. De Hao: Methodology,
Investigation. Yu Li: Methodology, Formal analysis. Feifei Feng:
Writing – review & editing. Xuexin Duan: Writing – original draft,
Conceptualization. Huaiyong Chen: Writing – review & editing,
Writing – original draft, Supervision, Funding acquisition,
Conceptualization.
Declaration of competing interest
The authors declare that they have no known competing nancial
interests or personal relationships that could have appeared to inuence
the work reported in this paper.
Data availability
Data will be made available on request.
Acknowledgements
This study was supported by the National Natural Science Founda-
tion of China (82100077, 81773394, and 82070001), the Natural Sci-
ence Foundation of Tianjin (21JCZDJC00430, 21JCQNJC00550, and
21JCQNJC00410), and Tianjin Young Medical Emerging Talent
(TJSQNYXXR-D2-070).
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.envpol.2024.123686.
References
Aaron, R., Esper, G.J., Shiffman, C.A., Bradonjic, K., Lee, K.S., Rutkove, S.B., 2006.
Effects of age on muscle as measured by electrical impedance myography. Physiol.
Meas. 27, 953–959.
Barkauskas, C.E., Cronce, M.J., Rackley, C.R., Bowie, E.J., Keene, D.R., Stripp, B.R.,
Randell, S.H., Noble, P.W., Hogan, B.L., 2013. Type 2 alveolar cells are stem cells in
adult lung. J. Clin. Invest. 123, 3025–3036.
Basil, M.C., Katzen, J., Engler, A.E., Guo, M., Herriges, M.J., Kathiriya, J.J.,
Windmueller, R., Ysasi, A.B., Zacharias, W.J., Chapman, H.A., Kotton, D.N., Rock, J.
R., Snoeck, H.W., Vunjak-Novakovic, G., Whitsett, J.A., Morrisey, E.E., 2020. The
cellular and physiological basis for lung repair and regeneration: past, present, and
future. Cell Stem Cell 26, 482–502.
Cha, J.J., Park, Y., Yun, J., Kim, H.W., Park, C.J., Kang, G., Jung, M., Pak, B., Jin, S.W.,
Lee, J.H., 2016. Cell electrical impedance as a novel approach for studies on
senescence not based on biomarkers. BioMed Res. Int. 2016, 8484217.
Chen, H., Matsumoto, K., Brockway, B.L., Rackley, C.R., Liang, J., Lee, J.H., Jiang, D.,
Noble, P.W., Randell, S.H., Kim, C.F., Stripp, B.R., 2012. Airway epithelial
progenitors are region specic and show differential responses to bleomycin-induced
lung injury. Stem Cell. 30, 1948–1960.
Chen, Q., Wang, Y., Yang, L., Sun, L., Wen, Y., Huang, Y., Gao, K., Yang, W., Bai, F.,
Ling, L., Zhou, Z., Zhang, X., Xiong, J., Zhai, R., 2022a. PM2.5 promotes NSCLC
carcinogenesis through translationally and transcriptionally activating DLAT-
mediated glycolysis reprograming. J. Exp. Clin. Cancer Res. 41, 229.
Chen, S.Y., Wu, C.F., Wu, C., Chan, C.C., Hwang, J.S., Su, T.C., 2022b. Urban ne
particulate matter and elements associated with subclinical atherosclerosis in
adolescents and Young adults. Environ. Sci. Technol. 56, 7266–7274.
Chong, L., Ahmadvand, N., Noori, A., Lv, Y., Chen, C., Bellusci, S., Zhang, J.S., 2023.
Injury activated alveolar progenitors (IAAPs): the underdog of lung repair. Cell. Mol.
Life Sci. 80, 145.
Chowdhury, S., Pillarisetti, A., Oberholzer, A., Jetter, J., Mitchell, J., Cappuccilli, E.,
Aamaas, B., Aunan, K., Pozzer, A., Alexander, D., 2023. A global review of the state
of the evidence of household air pollution’s contribution to ambient ne particulate
matter and their related health impacts. Environ. Int. 173, 107835.
Clark-Matott, J., Nagy, J.A., Sanchez, B., Taylor, R., Riveros, D., Abraham, N.A.,
Simon, D.K., Rutkove, S.B., 2019. Altered muscle electrical tissue properties in a
mouse model of premature aging. Muscle Nerve 60, 801–810.
Comunian, S., Dongo, D., Milani, C., Palestini, P., 2020. Air pollution and covid-19: the
role of particulate matter in the spread and increase of covid-19’s morbidity and
mortality. Int. J. Environ. Res. Publ. Health 17.
Fernandes, T.G., 2023. Organoids as complex (bio)systems. Front. Cell Dev. Biol. 11,
1268540.
Fuertes, E., MacIntyre, E., Agius, R., Beelen, R., Brunekreef, B., Bucci, S., Cesaroni, G.,
Cirach, M., Cyrys, J., Forastiere, F., Gehring, U., Gruzieva, O., Hoffmann, B.,
Jedynska, A., Keuken, M., Klumper, C., Kooter, I., Korek, M., Kramer, U., Molter, A.,
Nieuwenhuijsen, M., Pershagen, G., Porta, D., Postma, D.S., Simpson, A., Smit, H.A.,
Sugiri, D., Sunyer, J., Wang, M., Heinrich, J., 2014. Associations between particulate
matter elements and early-life pneumonia in seven birth cohorts: results from the
ESCAPE and TRANSPHORM projects. Int. J. Hyg Environ. Health 217, 819–829.
Gini, M., Manousakas, M., Karydas, A.G., Eleftheriadis, K., 2022. Mass size distributions,
composition and dose estimates of particulate matter in Saharan dust outbreaks.
Environ. Pollut. 298, 118768.
Gong, L., Petchakup, C., Shi, P., Tan, P.L., Tan, L.P., Tay, C.Y., Hou, H.W., 2021. Direct
and label-free cell status monitoring of spheroids and microcarriers using
microuidic impedance cytometry. Small 17, e2007500.
Grzywa-Celinska, A., Krusinski, A., Milanowski, J., 2020. ’Smoging kills’ - effects of air
pollution on human respiratory system. Ann. Agric. Environ. Med. 27, 1–5.
Guo, C., Lv, S., Liu, Y., Li, Y., 2022. Biomarkers for the adverse effects on respiratory
system health associated with atmospheric particulate matter exposure. J. Hazard
Mater. 421, 126760.
Han, Z., Chen, L., Zhang, S., Wang, J., Duan, X., 2020. Label-free and simultaneous
mechanical and electrical characterization of single plant cells using microuidic
impedance ow cytometry. Anal. Chem. 92, 14568–14575.
Jain, K.G., Xi, N.M., Zhao, R., Ahmad, W., Ali, G., Ji, H.L., 2023. Alveolar type 2
epithelial cell organoids: focus on culture methods. Biomedicines 11.
Jiao, J., Hu, P., Li, Y., Cai, C., Wang, X., Zhang, L., 2022. PM2.5 upregulates the
expression of MUC5AC via the EGFR-PI3K pathway in human sinonasal epithelial
cells. Int. Arch. Allergy Immunol. 183, 361–374.
Jun, X., Jin, G., Fu, C., Jinxuan, Z., Xueling, L., Jiaxin, H., Shuaihua, Q., Anqi, S.,
Jianzhou, C., Lian, Z., Xiwen, Z., Baoli, Z., Biao, X., 2018. PM2.5 promotes
abdominal aortic aneurysm formation in angiotensin II-infused apoe-/- mice.
Biomed. Pharmacother. 104, 550–557.
Lehmann, M., Korfei, M., Mutze, K., Klee, S., Skronska-Wasek, W., Alsafadi, H.N., Ota, C.,
Costa, R., Schiller, H.B., Lindner, M., Wagner, D.E., Gunther, A., Konigshoff, M.,
2017. Senolytic drugs target alveolar epithelial cell function and attenuate
experimental lung brosis ex vivo. Eur. Respir. J. 50.
Li, Y., Lin, B., Hao, D., Du, Z., Wang, Q., Song, Z., Li, X., Li, K., Wang, J., Zhang, Q.,
Wu, J., Xi, Z., Chen, H., 2023. Short-term PM(2.5) exposure induces transient lung
injury and repair. J. Hazard. Mater. 459, 132227.
Li, J., Wang, Z., Chu, Q., Jiang, K., Li, J., Tang, N., 2018. The strength of mechanical
forces determines the differentiation of alveolar epithelial cells. Dev. Cell 44,
297–312 e295.
Li, M., Izpisua Belmonte, J.C., 2019. Organoids - preclinical models of human disease.
N. Engl. J. Med. 380, 569–579.
Li, P., Ai, Y., 2021. Label-free multivariate biophysical phenotyping-activated acoustic
sorting at the single-cell level. Anal. Chem. 93, 4108–4117.
P. Cheng et al.

Environmental Pollution 347 (2024) 123686
8
Li, X., Wu, J., Sun, X., Wu, Q., Li, Y., Li, K., Zhang, Q., Li, Y., Abel, E.D., Chen, H., 2020a.
Autophagy reprograms alveolar progenitor cell metabolism in response to lung
injury. Stem Cell Rep. 14, 420–432.
Li, Y., Wu, Q., Sun, X., Shen, J., Chen, H., 2020b. Organoids as a powerful model for
respiratory diseases. Stem Cell. Int. 2020, 5847876.
Liu, Z., Wu, H., Jiang, K., Wang, Y., Zhang, W., Chu, Q., Li, J., Huang, H., Cai, T., Ji, H.,
Yang, C., Tang, N., 2016. MAPK-mediated YAP activation controls mechanical-
tension-induced pulmonary alveolar regeneration. Cell Rep. 16, 1810–1819.
Losacco, C., Perillo, A., 2018. Particulate matter air pollution and respiratory impact on
humans and animals. Environ. Sci. Pollut. Res. Int. 25, 33901–33910.
Matthews, K., Lamoureux, E.S., Myrand-Lapierre, M.E., Duffy, S.P., Ma, H., 2022.
Technologies for measuring red blood cell deformability. Lab Chip 22, 1254–1274.
McGrath, J.S., Honrado, C., Spencer, D., Horton, B., Bridle, H.L., Morgan, H., 2017.
Analysis of parasitic Protozoa at the single-cell level using microuidic impedance
cytometry. Sci. Rep. 7, 2601.
Moujaber, O., Fishbein, F., Omran, N., Liang, Y., Colmegna, I., Presley, J.F., Stochaj, U.,
2019. Cellular senescence is associated with reorganization of the microtubule
cytoskeleton. Cell. Mol. Life Sci. 76, 1169–1183.
Nan, N., Yan, Z., Zhang, Y., Chen, R., Qin, G., Sang, N., 2023. Overview of PM(2.5) and
health outcomes: focusing on components, sources, and pollutant mixture co-
exposure. Chemosphere 323, 138181.
Pandeya, S.R., Nagy, J.A., Riveros, D., Semple, C., Taylor, R.S., Mortreux, M.,
Sanchez, B., Kapur, K., Rutkove, S.B., 2021. Estimating myober cross-sectional area
and connective tissue deposition with electrical impedance myography: a study in
D2-mdx mice. Muscle Nerve 63, 941–950.
Park, Y., Cha, J.J., Seo, S., Yun, J., Woo Kim, H., Park, C., Gang, G., Lim, J., Lee, J.H.,
2016. Ex vivo characterization of age-associated impedance changes of single
vascular endothelial cells using micro electrical impedance spectroscopy with a cell
trap. Biomicrouidics 10, 014114.
Rutkove, S.B., Callegari, S., Concepcion, H., Mourey, T., Widrick, J., Nagy, J.A., Nath, A.
K., 2023. Electrical impedance myography detects age-related skeletal muscle
atrophy in adult zebrash. Sci. Rep. 13, 7191.
Simon, P., Frankowski, M., Bock, N., Neukammer, J., 2016. Label-free whole blood cell
differentiation based on multiple frequency AC impedance and light scattering
analysis in a micro ow cytometer. Lab Chip 16, 2326–2338.
Wei, T., 2020. All-in-one design integrates microuidic cooling into electronic chips.
Nature 585, 188–189.
Wu, H., Yu, Y., Huang, H., Hu, Y., Fu, S., Wang, Z., Shi, M., Zhao, X., Yuan, J., Li, J.,
Yang, X., Bin, E., Wei, D., Zhang, H., Zhang, J., Yang, C., Cai, T., Dai, H., Chen, J.,
Tang, N., 2021. Progressive pulmonary brosis is caused by elevated mechanical
tension on alveolar stem cells. Cell 184, 845–846.
Yan, M., Ge, H., Zhang, L., Chen, X., Yang, X., Liu, F., Shan, A., Liang, F., Li, X., Ma, Z.,
Dong, G., Liu, Y., Chen, J., Wang, T., Zhao, B., Zeng, Q., Lu, X., Liu, Y., Tang, N.J.,
2022. Long-term PM(2.5) exposure in association with chronic respiratory diseases
morbidity: a cohort study in Northern China. Ecotoxicol. Environ. Saf. 244, 114025.
Yao, C., Guan, X., Carraro, G., Parimon, T., Liu, X., Huang, G., Mulay, A., Soukiasian, H.
J., David, G., Weigt, S.S., Belperio, J.A., Chen, P., Jiang, D., Noble, P.W., Stripp, B.R.,
2021. Senescence of alveolar type 2 cells drives progressive pulmonary brosis. Am.
J. Respir. Crit. Care Med. 203, 707–717.
Yu, Y., Sun, Q., Li, T., Ren, X., Lin, L., Sun, M., Duan, J., Sun, Z., 2022. Adverse outcome
pathway of ne particulate matter leading to increased cardiovascular morbidity and
mortality: an integrated perspective from toxicology and epidemiology. J. Hazard
Mater. 430, 128368.
Yue, D., Zhang, Q., Zhang, J., Liu, W., Chen, L., Wang, M., Li, R., Qin, S., Song, X., Ji, Y.,
2023. Diesel exhaust PM2.5 greatly deteriorates brosis process in pre-existing
pulmonary brosis via ferroptosis. Environ. Int. 171, 107706.
Zhang, M., Bi, X., Liu, S., Liu, Y., Wang, Q., 2023. The novel polyuoroalkyl
benzenesulfonate OBS exposure induces cell cycle arrest and senescence of rat
pituitary cell GH3 via the p53/p21/RB pathway. Toxicology 490, 153511.
Zhang, Y., Huang, W., Zheng, Z., Wang, W., Yuan, Y., Hong, Q., Lin, J., Li, X., Meng, Y.,
2021. Cigarette smoke-inactivated SIRT1 promotes autophagy-dependent
senescence of alveolar epithelial type 2 cells to induce pulmonary brosis. Free
Radic. Biol. Med. 166, 116–127.
Zhao, C., Wang, Y., Su, Z., Pu, W., Niu, M., Song, S., Wei, L., Ding, Y., Xu, L., Tian, M.,
Wang, H., 2020. Respiratory exposure to PM2.5 soluble extract disrupts mucosal
barrier function and promotes the development of experimental asthma. Sci. Total
Environ. 730, 139145.
Zhao, F., Ma, Q., Yue, Q., Chen, H., 2022a. SARS-CoV-2 infection and lung regeneration.
Clin. Microbiol. Rev. 35, e0018821.
Zhao, F., Wang, J., Wang, Q., Hou, Z., Zhang, Y., Li, X., Wu, Q., Chen, H., 2022b.
Organoid technology and lung injury mouse models evaluating effects of
hydroxychloroquine on lung epithelial regeneration. Exp. Anim. 71, 316–328.
Zhou, Y., Yang, D., Zhou, Y., Khoo, B.L., Han, J., Ai, Y., 2018. Characterizing
deformability and electrical impedance of cancer cells in a microuidic device. Anal.
Chem. 90, 912–919.
P. Cheng et al.