Effects of α-amylase and coated α-amylase supplementation on growth performance, nutrient digestion, and rumen fermentation in Holstein bulls

Abstract

This study evaluated the impacts of α-amylase (AM) and coated α-amylase (CAM) on bull performance, nutrient digestibility, and ruminal fermentation. This study randomized 60 Holstein bulls of 365 ± 11.5 days of age and 457.5 ± 9.35 kg body weight into three groups: without AM addition, adding AM 0.6 g/kg dry matter (DM), and adding CAM 0.6 g AM/kg DM, separately. This whole experimental period was 80 days, including a 20-day adaptation period and a 60-day data and sample acquisition period. In comparison with the unsupplemented control, dry matter intake (DMI) was unaltered; however, average daily gain (ADG) and feed efficiency (FE) were greater for AM or CAM addition. Bulls receiving AM or CAM supply had greater total-tract nutrient digestibility, ruminal total volatile fatty acids (VFA) content, propionate molar proportion, cellulolytic enzyme and AM activities, and the number of microorganisms. In addition, the activities of AM and trypsin in the jejunum and ileum and glucose, albumin, and total protein concentrations in serum were greater for AM or CAM addition compared to the control. When comparing the supplementation mode of AM, bulls receiving CAM addition had greater ADG and FE. The crude protein and starch digestibility and intestinal AM and trypsin activity were higher, while acid detergent fiber (ADF) digestibility was lower for CAM addition than for AM addition. The lower propionate molar proportion and cellobiase and carboxymethyl cellulase activities, together with Ruminococcus albus, Ruminococcus flavefaciens, and Fibrobacter succinogenes populations were observed for CAM addition compared with AM addition. However, there were greater glucose, albumin, and total protein concentrations in serum after adding CAM. According to the data, the supply of AM improved ADG, nutrient digestion, and rumen fermentation. Notably, the optimum supplementation mode was in the form of CAM in bulls.

Full text

Frontiers in Veterinary Science 01 frontiersin.org
Eects of α-amylase and coated
α-amylase supplementation on
growth performance, nutrient
digestion, and rumen
fermentation in Holstein bulls
XiaomingZhang
1, FengXue
2, KailinXu
1, QiangLiu
1
*, GangGuo
1,
WenjieHuo
1, YaweiZhang
1 and CongWang
1
1 College of Animal Science, Shanxi Agricultural University, Jinzhong, China, 2 DSM Nutritional
Products Animal Nutrition & Health, Shanghai, China
This study evaluated the impacts of α-amylase (AM) and coated α-amylase (CAM)
on bull performance, nutrient digestibility, and ruminal fermentation. This study
randomized 60 Holstein bulls of 365 ± 11.5 days of age and 457.5 ± 9.35 kg body
weight into three groups: without AMaddition, adding AM0.6 g/kg dry matter
(DM), and adding CAM 0.6 g AM/kg DM, separately. This whole experimental
period was 80 days, including a 20-day adaptation period and a 60-day data and
sample acquisition period. In comparison with the unsupplemented control,
dry matter intake (DMI) was unaltered; however, average daily gain (ADG) and
feed eciency (FE) were greater for AMor CAM addition. Bulls receiving AMor
CAM supply had greater total-tract nutrient digestibility, ruminal total volatile
fatty acids (VFA) content, propionate molar proportion, cellulolytic enzyme and
AMactivities, and the number of microorganisms. In addition, the activities of
AMand trypsin in the jejunum and ileum and glucose, albumin, and total protein
concentrations in serum were greater for AM or CAM addition compared to
the control. When comparing the supplementation mode of AM, bulls receiving
CAM addition had greater ADG and FE. The crude protein and starch digestibility
and intestinal AM and trypsin activity were higher, while acid detergent fiber
(ADF) digestibility was lower for CAM addition than for AMaddition. The lower
propionate molar proportion and cellobiase and carboxymethyl cellulase
activities, together with Ruminococcus albus, Ruminococcus flavefaciens,
and Fibrobacter succinogenes populations were observed for CAM addition
compared with AMaddition. However, there were greater glucose, albumin, and
total protein concentrations in serum after adding CAM. According to the data,
the supply of AMimproved ADG, nutrient digestion, and rumen fermentation.
Notably, the optimum supplementation mode was in the form of CAM in bulls.
KEYWORDS
α-amylase, growth performance, nutrient digestion, rumen fermentation, bulls
1 Introduction
Dietary starch is the main energy source for rumen microorganisms and ruminants. Starch
in the diet is degraded to propionate and hydrolyzed to glucose in the rumen and small intestine,
respectively (1, 2). Approximately 80% of rumen propionate is used to synthesize glucose by
gluconeogenesis (1). erefore, increasing rumen propionate production and/or intestine starch
OPEN ACCESS
EDITED BY
Anusorn Cherdthong,
Khon Kaen University, Thailand
REVIEWED BY
Chanadol Supapong,
Rajamangala University of Technology
Srivijaya, Thailand
Shahryar Kargar,
Shiraz University, Iran
*CORRESPONDENCE
Qiang Liu
liuqiangabc@163.com
RECEIVED 06 November 2023
ACCEPTED 20 December 2023
PUBLISHED 08 January 2024
CITATION
Zhang X, Xue F, Xu K, Liu Q, Guo G, Huo W,
Zhang Y and Wang C (2024) Eects of
α-amylase and coated α-amylase
supplementation on growth performance,
nutrient digestion, and rumen fermentation in
Holstein bulls.
Front. Vet. Sci. 10:1330616.
doi: 10.3389/fvets.2023.1330616
COPYRIGHT
© 2024 Zhang, Xue, Xu, Liu, Guo, Huo,
Zhang and Wang. This is an open-access
article distributed under the terms of the
Creative Commons Attribution License
(CC BY). The use, distribution or reproduction
in other forums is permitted, provided the
original author(s) and the copyright owner(s)
are credited and that the original publication
in this journal is cited, in accordance with
accepted academic practice. No use,
distribution or reproduction is permitted
which does not comply with these terms.
TYPE Original Research
PUBLISHED 08 January 2024
DOI 10.3389/fvets.2023.1330616

Zhang et al. 10.3389/fvets.2023.1330616
Frontiers in Veterinary Science 02 frontiersin.org
digestibility can improve dietary energy utilization eciency and cause
an increase in bull performance. It was reported that supplementing
α-amylase (AM) in diets increased average daily gain (ADG) in
nishing beef (3) and improved lactation performance in dairy cows (4,
5). Moreover, some studies found that AMaddition increased rumen
butyrate molar proportion (6), stimulated B. brisolvens D1 growth in
vitro (7), and increased AM activity and rumen propionate molar
proportion of cows (8). Others reported that supplementation with
AM increased total-tract digestibility of organic matter (OM), dry
matter (DM), neutral detergent ber (NDF), and crude protein (CP) in
cows (4, 9). e synergistic eect of exogenous enzymes and ruminal
enzymes increased nutrient degradation (10, 11). ese ndings showed
that supplementing AMin diets could potentially improve nutrient
digestibility in the rumen. e improvement was correlated with the
stimulating eects of exogenous enzymes on ruminal microbial growth.
Nevertheless, no studies evaluated the impact of AMsupplements on
ruminal fermentation and microora in bulls. Furthermore, starch
digestibility in the small intestine was only 40%–62% in ruminants (12,
13); thus, the exogenous AMsupply was required. Studies in weaned
pigs and broilers found that exogenous AMaddition increased the
activities of AMand trypsin in the small intestine (14, 15). However,
dietary AMwould bedestroyed and inactivated in the abomasum (10).
Noziere etal. (8) discovered that AMsupplementation increased starch
degradability in the rumen but did not alter total-tract starch digestion
in cows. e coated AM(CAM) supplement can avoid the negative
inuence of abomasum, releasing 25.3% of AMin the rumen and 69.5%
of AMin the intestine. Hence, supplementation with CAM might have
a greater increase in ADG than AMaddition in bulls.
Based on the research studies above, it is necessary to dene the
regulatory characteristics of exogenous AMon rumen fermentation
and microora and to nd out the proper supplementation mode of
AMin ruminant diets. As a result, the study explored the impacts of
AMand CAM addition on nutrient digestibility, growth performance,
rumen fermentation, microora, and digestive enzyme activities in the
rumen and small intestine of bulls.
2 Materials and methods
2.1 AM and CAM supplementation
e AM was generated by Bacillus licheniformis (Ronozyme
RumiStar, DSM Nutritional Products, Basel, Switzerland), and
AMactivity is 600 KNU/g. 1 KNU is the enzyme level produced
during the 2-step α-amylase/α-glucosidase reaction at 37°C and pH
7.0 with 6 μmol p-nitrophenol/min based on 1.86 mM ethylidene-G7-
pnitrophenyl-maltoheptaoside (16). e CAM (AM = 40%,
hydrogenated fat (C16:0-C18:0 ratio = 2:1) = 37%, calcium
stearate = 13%, and bentonite powder = 10%) was produced following
Wang etal.’s procedure (17). e release rates of CAM, identied using
nylon bag techniques, were 25.3% and 69.5% in the rumen and
intestine of ruminal and duodenal stula bulls, respectively (17).
2.2 Animals and experimental design
In this study, our experimental protocols gained approval from the
Animal Care and Use Committee of Shanxi Agricultural University.
In a randomized block design, 60 Holstein bulls with an age of
365 ± 11.5 days and a body weight (BW) of 457.5 ± 9.35 kg were
selected and assigned to three groups: without AMaddition, AM0.6 g/
kg DM addition, or CAM 0.6 g AM/kg DM addition, respectively. e
AMsupplementation amount was determined based on the results of
Bachmann etal. (18) and Arturo etal. (19), with the addition of
AM0.5 g/kg DM increasing milk yield in dairy cows. e AMor CAM
was added to the premix, mixed with the concentrate, and then
incorporated into the total mixed rations (TMR). e basal diet
composition and components (Table 1) were prepared as
recommended by NASEM (20). Bulls were raised in separate stalls
(3 m × 3 m), and fed at 07:00 and 19:00 daily, with free access to water
and feed. Additionally, the course of the experiment was 80 days,
including a 20-day adaptation period and a 60-day data and sample
acquisition period.
2.3 Data collection and sampling
procedures
Individual bull BW was determined on days 0/30/60 before
feeding at 07:00. Werecorded daily DM intake (DMI) for each bull.
e feed eciency (FE) was calculated by dividing ADG by
DMI. From days 51 to 57 and for each bull, TMR and refusal samples
TABLE1 Basal dietary components and nutrient levels (DM basis).
Ingredients Contents (g/kg DM)
Corn silage 400
Corn grain (ground) 408
Wheat bran 12
Soybean meal 51
Cottonseed meal 45
Distillers dried grains with soluble 24
Corn bran 18
Calcium carbonate 5
Salt 10
Dicalcium phosphate 4
Sodium bicarbonate 18
Mineral and vitamin premixa5
Chemical composition
Organic matter 945.3
Crude protein 126.8
Ether extract 35.5
Neutral detergent ber 302.2
Acid detergent ber 161.0
Starch 432.8
Calcium 7.1
Phosphorus 4.5
Net energy for gain, MJ/kg 5.60
aIncluded per kg premix: 20,000 mg Fe, 8,000 mg Mn, 7,500 mg Zn, 1,600 mg Cu, 120 mg I,
60 mg Se, 20 mg Co, 820,000 IU vitamin A, 300, 000 IU vitamin D, as well as 10, 000 IU
vitamin.

Zhang et al. 10.3389/fvets.2023.1330616
Frontiers in Veterinary Science 03 frontiersin.org
were gathered daily, and feces (300 g) were gathered from the rectum
every 6 h. TMR, refusal, and fecal samples were kept at −20°C,
composited by individual animals, dried under 65°C until an
unchanged weight was reached, and then ground using a 1-mm lter.
e method of AOAC was adopted to measure the contents of DM
(method 934.01), OM (method 942.05), acid detergent ber (ADF;
method 973.18), CP (method 990.03), and ether extract (EE; method
920.39) (21). NDF was measured according to the method proposed
by Van Soest etal. (22), whereas acid-insoluble ash was identied as
depicted by Van-Keulen and Young (23). Starch was enzymatically
analyzed in accordance with Hall (24).
On the 58th and 59th days, 200 mL of ruminal uid was collected
from each bull at 04:00, 10:00, 16:00, and 22:00 with the stomach tube.
To prevent salivary contamination, weeliminated the initial ruminal
uid (200 mL). An electric pH meter (Sartorius Basic pH Meter PB-10,
Sartorius AG) was used to determine the ruminal uid pH, followed
by ltering with the four-layer medical gauze. e collected ltrates
were preserved at −20°C and − 80°C, respectively. e AOAC method
was adopted to identify ammonia N level (21), while gas
chromatography (GC, Trace 1,300; ermo Fisher Scientic Co., Ltd.,
Shanghai, China) was conducted to measure VFA using 2-ethylbutyric
acid as the endogenous reference.
e ruminal uid samples preserved at −80°C were employed to
determine microbial enzyme activities and populations. Wemeasured
the enzyme activities according to the reports of Agarwal etal. (25)
and Miller (26). e RBB + C method was used to isolate total
microbial DNA from 1.5 mL of ruminal uid homogenate as Yu and
Morrison’s report (27). Extracted DNA purity was determined by
agarose gel electrophoresis, while its content was analyzed using a
NanoDrop 2000 spectrophotometer (ermo Scientic,
UnitedStates). Table2 presents the primer sequences of microbes.
With the use of the regular PCR, DNA standard obtained from
samples for PCR assays was acquired by pooling microbial DNA of the
treatment set. Subsequently, Pure Link TM Quick Gel Extraction and
PCR Purication Combo Kit (ermo Fisher Scientic Co., Ltd.,
Shanghai, China) was used for purifying PCR products, while the
spectrophotometer was used for quantication. In accordance with
the PCR product length as well as mass concentration, weevaluated
copy number concentration in every standard substance. e standard
curve of the target microorganism was established by 10-fold serial
dilutions method (28). e StepOneTM system (ermo Fisher
Scientic Co., Ltd., Shanghai, China) was employed for qPCR
amplication and detection. Each sample was measured thrice. e
reaction volume of 20 μL was prepared, consisting of SYBR Premix Ex
Taq TM II (10 μL, Takara Biotechnology Co., Ltd., Dalian, China),
each primer (0.8 μL), template DNA (2 μL), double-standard sterile
water (6.0 μL), and ROX Reference Dye II (0.4 μL). RT-PCR conditions
were as follows: 2-min initial denaturation under 50°C and 2 min
under 95°C, 15 s under 95°C, and 1 min under 60°C for 45 cycles,
followed by product elongation. From 60°C to 95°C, the temperature
was increased at a rate of 1°C every 30 s.
On day 60 and before the morning feeding, blood samples
were collected for all bulls via coccygeal vessels. The samples
were subjected to 15-min centrifugation at 2,000g and 4°C to
obtain serum and were preserved under −20°C. Glucose, total
protein, insulin, albumin, urea N, and lactic acid contents were
determined using ELISA kits (Shanghai Duma Biological Co.,
Ltd., Shanghai, China).
On the 61st day, weselected ve bulls from each group at random
for slaughter. Aer slaughtering, 50 cm of duodenum, anterior,
middle, and posterior segments of the jejunum, and 50 cm of the
ileum were quickly harvested. en, chyme specimens collected from
every bull were blended with the equivalent amount of 0.9% NaCl
solution and were homogenized for 15 min, prior to 10-min
centrifugation (4°C and 11,000×g) to obtain supernatants for
determining AM, trypsin, and lipase activities by ELISA kits (Shanghai
Enzyme Link Biological Co., Ltd., Shanghai, China).
2.4 Computation and statistical analysis
e SAS MIXED procedure was used to determine DMI, BW,
ADG, and FE (2002; Proc Mixed) (29). e model is shown below:
YBGHTTGTHTGH
Reijklm
ijklm ijkl jl kl jkl
m ijk
=+ ++ ++
()
+
()
+
()
++
µ
:.
Other measurement results, which were explored, are
shown below:
YBGH Reijkm
ijklm ijkmijk
=+ ++ ++µ
:.
where Y
ijklm
denotes a dependent variable; μ indicates the total
average; B
i
represents random eect of ith block; G
j
denotes xed
eects of AM(j = 0 or 0.6 g/kg DM); Hk denotes xed eects of CAM
(k = 0 or CAM 0.6 g AM/kg DM); T
l
denotes xed eect of feeding
time (30 or 60 d); (TG)jl denotes the interaction eect of feeding time
(30 or 60 d) with AM(0 or 0.6 g/kg); (TH)kl denotes interaction eect
of feeding time (30 or 60 d) with CAM (0 or CAM 0.6 g AM/kg);
(TGH)
jkl
denotes the interaction eect of feeding time (30 or 60 d),
AM(0 or 0.6 g/kg), and CAM (0 or CAM 0.6 g AM/kg); R
m
denotes
random eects of mth bull, whereas εijklm denotes a residual error.
e covariance structure for variables was rst-order autoregressive,
which was determined by the lowest Akaike’s information criterion
(AIC). p < 0.05 denotes statistically signicant eects.
3 Results
3.1 Growth performance
0.6 gAM/kg DM supplementation (AM or CAM) did not aect
DMI and BW during this trial but elevated ADG (p < 0.05) and FE
(p < 0.05) (Table3). DMI and BW were similar; however, ADG and FE
were greater (p < 0.05) aer CAM supplementation relative to
AMsupply.
3.2 Total-tract nutrient digestibility and
ruminal fermentation
Adding 0.6 g/kg DM AM(AM or CAM) could increase (p < 0.05)
total-tract digestibility of DM, OM, CP, EE, NDF, ADF, and starch
(Table4). e DM, OM, EE, and NDF digestibility were similar, CP

Zhang et al. 10.3389/fvets.2023.1330616
Frontiers in Veterinary Science 04 frontiersin.org
and starch digestibility were greater (p < 0.05), while ADF digestibility
was lower (p = 0.012) aer CAM supplementation relative to
AMaddition.
As shown in Table4, ruminal pH, acetate-to-propionate ratio,
and content of ammonia N decreased (p < 0.05), whereas the total
VFA content and molar proportion of propionate increased
(p < 0.05). In addition, acetate, butyrate, valerate, isobutyrate, and
isovalerate showed unchanged molar proportions for bulls
consuming diet supplementation with 0.6 g/kg DM AM(AM or
CAM). Bulls receiving CAM addition had similar ruminal pH,
total VFA content and acetate, butyrate, valerate, isobutyrate, and
isovalerate molar proportions, acetate-to-propionate ratio, and
concentration of ammonia N compared with those in the
AMgroup. However, propionate molar proportion was greater
(p = 0.021) aer CAM supplementation compared with
AMaddition.
TABLE3 Eects of α-amylase (AM) and coated α-amylase (CAM) on DMI, ADG, and FE of Holstein bulls.
Treatmentsap-value
Item Control AM CAM SEM Control vs. AM+CAM AM vs. CAM
DMI (kg/d)
1–30 d 10.8 11.3 11.3 0.222 0.324 0.165
31–60 d 11.5 12.1 12.6 0.230 0.143 0.125
1–60 d 11.1 11.7 12.1 0.252 0.058 0.258
Body weight (kg)
1 d 457 458 457 9.61 0.987 0.986
30 d 490 494 499 9.33 0.931 0.925
60 d 526 535 546 9.22 0.715 0.706
ADG (kg/d)
1–30 d 1.09 1.23 1.40 0.042 0.003 0.004
31–60 d 1.21 1.37 1.56 0.046 0.004 0.006
1–60 d 1.15 1.30 1.48 0.019 0.001 0.001
FE (kg/kg)
1–30 d 0.101 0.112 0.128 0.004 0.024 0.033
31–60 d 0.104 0.116 0.125 0.004 0.041 0.042
1–60 d 0.103 0.114 0.126 0.003 0.026 0.029
aControl = without AMor CAM addition; AM = AM 0.6 g AM/kg DM; CAM = CAM 0.6 g AM/kg DM.
TABLE2 List of primers used in RT-PCR assays.
Target species Sequences of primers (5′)GenBank accession no. Size (bp)
Total bacteria F: CGGCAACGAGCGCAACCC
R: CCATTGTAGCACGTGTGTAGCC AY548787.1 147
Total anaerobic fungi F: GAGGAAGTAAAAGTCGTAACAAGGTTTC
R: CAAATTCACAAAGGGTAGGATGATT GQ355327.1 120
Total protozoa F: GCTTTCGWTGGTAGTGTATT
R: CTTGCCCTCYAATCGTWCT HM212038.1 234
R. albus F: CCCTAAAAGCAGTCTTAGTTCG
R: CCTCCTTGCGGTTAGAACA CP002403.1 176
R. avefaciens F: ATTGTCCCAGTTCAGATTGC
R: GGCGTCCTCATTGCTGTTAG AB849343.1 173
B. brisolvens F: ACCGCATAAGCGCACGGA
R: CGGGTCCATCTTGTACCGATAAAT HQ404372.1 65
F. succinogenes F: GTTCGGAAT TACTGGGCGTAAA
R: CGCCTGCCCCTGAACTATC AB275512.1 121
Rb. Amylophilus F: CTGGGGAGCTGCCTGAATG
R: GCATCTGAATGCGACTGGTTG MH708240.1 102
P. ruminicola F: GAAAGTCGGATTAATGCTCTATGTTG
R: CATCCTATAGCGGTAAACCTTTGG LT975683.1 74

Zhang et al. 10.3389/fvets.2023.1330616
Frontiers in Veterinary Science 05 frontiersin.org
3.3 Ruminal enzymatic activities and
microflora
Adding 0.6 g/kg DM AM (AM or CAM) enhanced the
carboxymethyl cellulase, cellobiase, pectinase, and AM activities
(p < 0.05), but it made no dierence to xylanase or protease activity
(Table 5). In addition, cellobiase and carboxymethyl cellulase had
lower activities (p < 0.05), while xylanase, pectinase, AM, and protease
had similar activities for the CAM group than for AMaddition.
e total bacterial, fungal, protozoa, Ruminococcus albus,
Ruminococcus avefaciens, Fibrobacter succinogenes, Butyrivibrio
brisolvens, Prevotella ruminicola, and Ruminobacter amylophilus
populations were increased (p < 0.05) by 0.6 g/kg DM AM(AM or
CAM) supplementation. Bulls receiving AMsupplementation had
greater (p < 0.05) R. albus, R. avefaciens, and F. succinogenes
populations than those receiving CAM addition. Nevertheless, no
signicant dierence was found in total fungal, bacterial, protozoa,
P. ruminicola, B. brisolvens, and Rb. amylophilus populations for
AMand CAM addition.
3.4 Small intestinal enzyme activity
Adding 0.6 g/kg DM AM(AM or CAM) did not aect the activity
of lipase in the whole small intestine and the activities of AMand
trypsin in the duodenum, but increased (p < 0.05) AMand tr ypsin
activities in the proximal, middle, and distal jejunum and ileum
(Table6). e lipase activity in the whole small intestine and AMand
trypsin activities in the duodenum were similar, but AMand trypsin
activities in the jejunum and ileum increased (p < 0.05) aer CAM
supplementation compared with AMsupplementation.
3.5 Blood parameters
Adding 0.6 g/kg DM AM (AM or CAM) elevated (p < 0.05)
glucose, albumin, and total protein levels, but it made no dierence to
insulin, urea N, and lactic acid levels in the blood (Table 7). Bulls
receiving CAM supplementation exhibited increased (p < 0.05)
glucose, albumin, and total protein levels compared with bulls
receiving AM; however, no dierence was observed in insulin, urea N,
and lactic acid levels between the two groups.
4 Discussion
e present study explored the impact of supplementing AMin
bull diets on performance, nutrient digestibility, intestinal digestive
enzyme activities, ruminal fermentation, and blood metabolites. e
dietary added fat, resulting from the coated CAM, was 0.55 g/kg DM
and had a weak impact on the growth performance, nutrient digestion,
TABLE4 Eects of α-amylase (AM) and coated α-amylase (CAM) on nutrient digestion and ruminal fermentation of Holstein bulls.
Treatmentsap-value
Item Control AM CAM SEM Control vs.
AM+CAM
AM vs. CAM
Nutrient digestibility (%)
Dry matter 67.6 70.7 72.0 0.669 0.001 0.102
Organic matter 69.9 72.8 73.6 0.602 0.001 0.072
Crude protein 65.4 69.2 72.9 0.348 0.015 0.025
Ether extract 75.2 78.8 80.0 0.350 0.039 0.186
Neutral detergent ber 56.8 61.4 60.1 0.593 0.011 0.223
Acid detergent ber 50.6 56.7 54.2 0.717 0.004 0.012
Starch 94.6 95.9 97.3 0.020 0.015 0.009
Ruminal fermentation
pH 6.61 6.28 6.34 0.044 0.022 0.115
Total VFA (mM) 108 118 114 1.06 0.029 0.092
Mol/100 mol
Acetate (A) 66.9 66.2 65.8 0.274 0.398 0.385
Propionate (P) 18.5 20.0 19.1 0.198 0.019 0.021
Butyrate 11.5 11.2 10.9 0.230 0.663 0.638
Valerate 1.33 1.38 1.30 0.037 0.683 0.655
Isobutyrate 0.82 0.89 0.81 0.023 0.271 0.255
Isovalerate 1.05 1.21 1.15 0.038 0.277 0.294
A: Pb3.62 3.28 3.43 0.042 0.032 0.082
Ammonia N
(mg/100 mL) 13.6 9.60 9.88 0.588 0.041 0.458
aControl = without AMor CAM addition; AM = AM 0.6 g AM/kg DM; CAM = CAM 0.6 g AM/kg DM.
bA: P = acetate-to-propionate ratio.

Zhang et al. 10.3389/fvets.2023.1330616
Frontiers in Veterinary Science 06 frontiersin.org
TABLE5 Eects of α-amylase (AM) and coated α-amylase (CAM) on ruminal microbial enzyme activities and microflora of Holstein bulls.
Treatmentsap-value
ItembControl AM CAM SEM Control vs.
AM+CAM
AM vs. CAM
Microbial enzyme activityb
Carboxymethyl cellulase 0.163 0.182 0.172 0.003 0.013 0.005
Cellobiase 0.358 0.402 0.372 0.007 0.041 0.012
Xylanase 0.469 0.517 0.488 0.010 0.201 0.215
Pectinase 0.723 0.799 0.781 0.012 0.048 0.185
α-Amylase 0.601 0.771 0.745 0.011 0.049 0.112
Protease 1.14 1.21 1.15 0.021 0.142 0.325
Ruminal microora (copies/mL)
Total bacteria, ×1011 2.05 3.95 3.49 0.223 0.021 0.315
Total anaerobic fungi, ×1071.77 2.49 2.23 0.091 0.019 0.222
Total protozoa, ×1051.39 6.51 5.47 0.634 0.032 0.082
R. albus, ×1074.52 6.86 5.61 0.312 0.037 0.032
R. avefaciens, ×1083.01 4.57 3.58 0.219 0.029 0.028
F. succinogenes, ×1082.66 4.39 3.57 0.231 0.026 0.025
B. brisolvens, ×1084.63 7.00 6.85 0.286 0.031 0.135
P. ruminicola, ×1010 2.13 4.29 4.31 0.277 0.028 0.118
Rb. amylophilus, ×1072.60 3.68 3.29 0.156 0.043 0.062
aControl = without AMor CAM addition; AM = AM 0.6 g AM/kg DM; CAM = CAM 0.6 g AM/kg DM.
bEnzyme activity units are as follows: carboxymethyl cellulase (μmol glucose/min/mL), cellobiase (μmol glucose/min/mL), xylanase (μmol xylose/min/mL), pectinase (μmol D-galacturonic
acid/min/mL), α-amylase (μmol maltose/min/mL), and protease (μg hydrolyzed protein/min/mL).
TABLE6 Eects of α-amylase (AM) and coated α-amylase (CAM) on enzyme activity in the small intestine contents of Holstein bulls (U/g).
Treatmentsap-value
Item Control AM CAM SEM Control vs.
AM+CAM
AM vs. CAM
Duodenum
α-Amylase 10.1 10.7 11.3 0.32 0.565 0.536
Trypsin 10.3 11.0 10.7 0.28 0.338 0.365
Lipase 5.21 5.12 5.35 0.16 0.425 0.528
Proximal jejunum
α-Amylase 11.3 12.1 13.7 0.28 0.012 0.009
Trypsin 12.5 14.0 15.2 0.15 0.015 0.008
Lipase 5.98 6.05 6.11 0.12 0.288 0.328
Middle jejunum
α-Amylase 13.6 15.9 17.4 0.42 0.025 0.015
Trypsin 18.7 19.6 21.8 0.26 0.011 0.005
Lipase 12.4 12.6 12.6 0.22 0.415 0.436
Distal jejunum
α-Amylase 12.9 14.3 16.6 0.55 0.019 0.011
Trypsin 17.3 18.5 19.4 0.18 0.009 0.025
Lipase 9.52 9.68 9.63 0.09 0.125 0.153
Ileum
α-Amylase 10.6 12.8 14.2 0.43 0.012 0.005
Trypsin 11.3 12.5 13.4 0.12 0.006 0.002
Lipase 7.26 7.38 7.33 0.15 0.355 0.288
aControl = without AMor CAM addition; AM = AM 0.6 g AM/kg DM; CAM = CAM 0.6 g AM/kg DM.

Zhang et al. 10.3389/fvets.2023.1330616
Frontiers in Veterinary Science 07 frontiersin.org
and rumen fermentation of bulls. us, the eects of added fat from
CAM were not discussed.
When AMor CAM was supplemented in bull diets, the response
of DMI was limited and consistent with the results in nishing steers
(30) or dairy cows (8). As a result, the increase in ADG was caused by
the increasing nutrient digestibility as well as rumen total VFA level.
Furthermore, such increased total-tract starch digestion, rumen
propionate molar proportion, and blood glucose concentration
indicated that the addition of AMor CAM improved the energy
supply eciency of starch. e energy utilization eciency of dietary
starch was positively associated with the starch degradation rates in
the small intestine and rumen (31). Defrain etal. (32) also found that
AMsupplementation tended to increase blood glucose concentration
in postpartum dairy cows. e current results suggested that the
dietary addition of AMor CAM at 360 KUN AM/kg DM improved
feed utilization eciency in bulls as evidenced by the increase in
FE. Similarly, other studies reported that 110 or 210 KNU AM/kg DM
supplementation increased ADG in nishing steers (3), and 300 KNU
AM/kg DM addition increased feed eciency in dairy cows (9, 19).
Nevertheless, DiLorenzo etal. (30) discovered that AMaddition at 600
KNU/kg DM made no impact on ADG and FE. Such dierent ndings
might beassociated with dierent AMaddition levels. Research found
that production performance increased quadratically with increasing
supplementation levels of AM in steers (3) or lactating Holstein
cows (6).
In agreement with the results in dairy cows (4, 8, 9), dietary
AM or CAM addition increased the total-tract digestibility of
nutrients. Nutrient digestibility response was related to the enhanced
ruminal carboxymethyl cellulase, cellobiase, pectinase, and
AMactivities as well as AMand trypsin activities within the small
intestine. According to these ndings, AMor CAM supplementation
improved nutrient digestibility in the small intestine and rumen. Such
enhanced small intestine trypsin activity might beassociated with an
improvement in starch digestibility with AMor CAM addition as
starch had a negative eect on intestinal trypsin activity (33). Similarly,
studies in weaned pigs and broilers found that exogenous AMaddition
increased the activities of AM and trypsin in the small intestine
(14, 15).
e reduction of rumen pH was observed with AMor CAM
addition. e average value of rumen pH for bulls receiving AMor
CAM addition was 6.31, which was suitable for nutrient degradation
and microbial growth (34, 35). e decreased pH was related to the
increased rumen total VFA level (36). Total VFA levels were changed
due to positive responses of rumen enzyme activities and microbial
populations, indicating the stimulatory eects of exogenous AMon
nutrient degradation and microbial growth. e supplementary
AMhydrolyzed starch to maltodextrins, which was used as a substrate
for microbial growth (3). Similarly, other studies reported that
AMaddition tended to increase the total VFA concentration in cows
fed high-starch diets (8). While a limited response in acetate molar
proportion was observed, the acetate concentration increased to 72.3,
78.1, and 75.0 mM for the control, AM, and CAM groups, respectively.
e result conformed to the changes of ADF and NDF apparent
digestibility, caused by the increase in microbial populations and
cellulolytic enzyme activity. Rumen carboxymethyl cellulase,
cellobiase, and pectinase are secreted by fungi, protozoa,
F. succinogenes, B. brisolvens, R. avefaciens, and R. albus, which are
used to hydrolyze ber to acetate (37). e elevated propionate molar
proportion, coupled with the reduced acetate-to-propionate ratio,
suggested that dietary AM or CAM addition altered the rumen
fermentation pattern for further propionate production. ese results
conformed to the changes in AM activity as well as amylolytic
bacterial populations, including B. brisolvens, P. ruminicola, and Rb.
amylophilus with AMor CAM addition. Moreover, the increase in
AMactivity was mainly caused by the positive responses of amylolytic
bacteria, showing a synergistic eect of exogenous AMand rumen
microbes, as reported by Noziere etal. (8). Similarly, other studies
indicated that AMsupplementation increased ruminal propionate
molar proportion and AMactivity in dairy cows (8) and stimulated
B. brisolvens D1 growth in vitro (7). However, according to Tricarico
et al. (6), AM addition increased the butyrate and acetate molar
proportions and the acetate-to-propionate ratio. e inconsistent
results may becaused due to the dierences in diet composition,
especially in starch content.
e decreased rumen ammonia N content did not conform to the
unaltered protease activity or the elevated protozoa and protein-
degrading bacterial populations (B. brisolvens, Rb. amylophilus, and
P. ruminicola). Given the positive responses of blood concentrations
of albumin and total protein and the limited response of blood urea
nitrogen, the reduction of rumen ammonia N content might becaused
by an elevation of microbial protein production. Moreover, the
elevation of the total VFA level increased the carbon skeleton and
energy supply to facilitate microbial protein generation. Furthermore,
as found by Gado etal. (38), supplementation of exogenous enzyme
mixture including AMincreased the duodenal microbial N ow in
Brown Swiss.
Bulls fed diets added with CAM had greater ADG and FE compared
with those receiving AMsupply, indicating that AMshould besupplied
TABLE7 Eects of α-amylase (AM) and coated α-amylase (CAM) on blood metabolites of Holstein bulls.
Treatmentsap-value
Item Control AM CAM SEM Control vs. AM+CAM AM vs. CAM
Glucose (mmol/L) 3.06 3.49 3.95 0.131 0.020 0.012
Insulin (mIU/L) 10.6 11.4 12.2 1.58 0.235 0.215
Total protein (g/L) 67.5 80.1 89.8 3.19 0.030 0.048
Albumin (g/L) 34.7 38.8 42.1 1.10 0.032 0.025
Urea nitrogen (mg/L) 172 148 159 8.52 0.439 0.486
Lactic acid (mg/L) 220 238 243 8.35 0.911 0.882
aControl = without AMor CAM addition; AM = AM 0.6 g AM/kg DM; CAM = CAM 0.6 g AM/kg DM.

Zhang et al. 10.3389/fvets.2023.1330616
Frontiers in Veterinary Science 08 frontiersin.org
in the form of CAM, as rumen total VFA concentration was similar for
both CAM and AMadditions. e greater ADG was correlated with the
greater total-tract starch and CP digestibility. In addition, it was caused
by the AM released from CAM in the intestine. Furthermore, the
increased total-tract starch and CP digestibility were related to greater
intestinal AMand trypsin activity with CAM addition. e results
further showed that increasing starch digestion had a stimulatory eect
on trypsin activity and CP digestion in the intestine, as reported in
broilers by Jiang etal. (15). e greater CP digestibility contributed to
an improvement in protein utilization eciency, as reected by the
observed greater blood albumin and total protein contents for CAM
addition, which can beused as indicators of protein utilization eciency
(39). Rumen propionate concentration for CAM and AMaddition was
21.8 and 23.6 mM, respectively; however, the blood glucose
concentration was greater for bulls receiving CAM supply. e results
showed that supplementation with CAM had a greater improvement in
intestinal digestion and energy supply of starch. When dietary starch
was digested in the small intestine and rumen, the energy utilization
eciency was 60% and 48%, respectively (40). Bulls receiving CAM
addition had lower ADF apparent digestibility, and this was consistent
with the results that rumen carboxymethyl cellulase and cellobiase
activity and F. succinogenes, R. albus, and R. avefaciens were lower aer
CAM supplementation than AMaddition. e results suggested that
the AMreleased from CAM in the rumen probably did not support the
optimum growth of cellulolytic bacteria. Furthermore, similarly
observed AMactivity for CAM and AMaddition further suggested that
the increased AM activity due to AM supply was caused by the
stimulatory eects of AMon ruminal microbial growth. Exogenous
AM degraded more starch into oligosaccharides, providing more
substrates for microbial growth and reproduction, thereby increasing
the number of microorganisms (7).
5 Conclusion
e supplementation of 0.6 g/kg DM AM (AM or CAM)
promoted ADG and nutrient digestibility of bulls. ese positive
impacts were mostly caused by the increment in ruminal microbial
population and intestinal digestive enzyme activity. e AMshould
be supplied in the form of CAM, reected as the greater ADG
observed for bulls receiving CAM compared with those consuming
AMaddition.
Data availability statement
e raw data supporting the conclusions of this article will
bemade available by the authors, without undue reservation.
Ethics statement
e animal study was approved by Animal Care and Use Committee
of Shanxi Agricultural University. e study was conducted in accordance
with the local legislation and institutional requirements.
Author contributions
XZ: Formal analysis, Resources, Writing – original dra. FX:
Resources, Writing – original dra. KX: Formal analysis, Resources,
Writing – original dra. QL: Funding acquisition, Writing – review &
editing. GG: Resources, Validation, Writing – original dra. WH: Data
curation, Writing – original dra. YZ: Visualization, Writing –
original dra. CW: Validation, Writing – review & editing.
Funding
e author(s) declare nancial support was received for the
research, authorship, and/or publication of this article. is study
received funding from the Modern Agricultural Industrial Technology
System of Shanxi Province (2023CYJSTX13).
Acknowledgments
e authors want to express their gratitude to the entire personnel
of the beef cattle unit at the Shanxi Agriculture University for their
assistance in animal care.
Conflict of interest
FX is employed by DSM Nutritional Products Animal Nutrition
& Health.
e remaining authors declare that the research was conducted in
the absence of any commercial or nancial relationships that could be
construed as a potential conict of interest.
Publisher’s note
All claims expressed in this article are solely those of the authors and
do not necessarily represent those of their aliated organizations, or those
of the publisher, the editors and the reviewers. Any product that may be
evaluated in this article, or claim that may be made by its manufacturer,
is not guaranteed or endorsed by the publisher.
References
1. Ryle M, Ørskov ER. Energy nutrition in ruminants. Dordrecht: Springer Netherlands
(1990).
2. Harmon DL, Mcleod KR. Glucose uptake and regulation by intestinal tissues:
implications and whole-body energetics. J Anim Sci. (2001) 79:59–72. doi: 10.2527/
jas2001.79E-SupplE59x
3. Tricarico JM, Abney MD, Galyean ML, Rivera JD, Hanson KC, McLeod KR, et al.
Eects of a dietary aspergillus oryzae extract containing alpha-amylase activity on
performance and carcass characteristics in nishing beef cattle. J Anim Sci. (2007)
85:802–11. doi: 10.2527/jas.2006-427
4. Mccarthy MM, Engstrom MA, Azem E, Gressley TF. The effect of an exogenous
amylase on performance and total-tract digestibility in lactating dairy cows fed a
high-byproduct diet. J Dairy Sci. (2013) 96:3075–84. doi: 10.3168/
jds.2012-6045
5. Klingerman CM, Hu W, McDonell EE, DerBedrosian MC, Kung L Jr. An evaluation
of exogenous enzymes with amylolytic activity for dairy cows. J Dairy Sci. (2009)
92:1050–9. doi: 10.3168/jds.2008-1339
6. Tricarico JM, Johnston JD, Dawson KA, Hanson KC, McLe od KR, Harmon DL. e
eects of an aspergillus oryzae extract containing alpha-amylase activity on ruminal

Zhang et al. 10.3389/fvets.2023.1330616
Frontiers in Veterinary Science 09 frontiersin.org
fermentation and milk production in lactating Holstein cows. Anim Sci. (2005)
81:365–74. doi: 10.1079/ASC50410365
7. Tricarico JM, Johnston JD, Dawson KA. Dietary supplementation of ruminant diets
with an aspergillus oryzae α-amylase. Anim Feed Sci Technol. (2008) 145:136–50. doi:
10.1016/j.anifeedsci.2007.04.017
8. Nozière P, Steinberg W, Silberberg M, Morgavi DP. Amylase addition increases
starch ruminal digestion in rst-lactation cows fed high and low starch diets. J Dairy Sci.
(2014) 97:2319–28. doi: 10.3168/jds.2013-7095
9. Gencoglu H, Shaver RD, Steinberg W, Ensink J, Ferraretto LF, Bertics SJ, et al. Eect
of feeding a reduced-starch diet with or without amylase addition on lactation
performance in dairy cows. J Dairy Sci. (2010) 93:723–32. doi: 10.3168/jds.2009-2673
10. Beauchemin KA, Morgavi DP, McAllister TA, Yang WZ, Rode LM, Garnsworthy
PC, et al. e use of enzymes in ruminant diets In: PC Garnsworthy and J Wiseman,
editors. Recent advances in animal nutrition. Loughborough, England: Nottingham
University Press (2001). 297–322.
11. Morgavi DP, Beauchemin KA, Nsereko VL, Rode LM, Iwaasa AD, Yang WZ, et al.
Synergy between the ruminal brolytic enzymes and enzymes from Trichoderma
longibrachiatum. J Dairy Sci. (2000) 83:1310–21. doi: 10.3168/jds.S0022-0302(00)74997-6
12. Huntington GB. Starch utilization by ruminants: from basics to the bunk. J Anim
Sci. (1997) 75:852–67. doi: 10.2527/1997.753852x
13. Harmon DL, Yamka RM, Elam NA. Factors aecting intestinal starch digestion in
ruminants: a review. Can J Anim Sci. (2004) 84:309–18. doi: 10.4141/A03-077
14. Wang X, He RG. e eect of extrusion processing and enzyme supplementation
of corn on blood parameters and amylase activity of weaning piglets. Chin J Vet Sci.
(2006) 26:329–32. doi: 10.16303/j.cnki.1005-4545.2006.03.033
15. Jiang ZY, Zhou YM, Wang T. Inuence of exogenous alpha-amylase
supplementation on development of digestive organs and intestinal enzyme activities of
21-day-old broilers. Acta Vet Zootechnica Sin. (2007) 38:672–7. doi: 10.3969/j.
issn.1006-6314-B.2007.01.007
16. Jung S., Vogel K. Determination of Ronozyme RumiStar alpha-amylase activity in
feed and per se samples. Regulatory Report No. 2500706. DSM Nutritional Products
Ltd., Basel, Switzerland (2008).
17. Wang C, Liu Q, Guo G, Huo WJ, Ma L, Zhang YL, et al. Eects of rumen-protected
folic acid on ruminal fermentation, microbial enzyme activity, cellulolytic bacteria and
urinary excretion of purine derivatives in growing beef steers. Anim Feed Sci Technol.
(2016) 221:185–94. doi: 10.1016/j.anifeedsci.2016.09.006
18. Bachmann M, Bochnia M, Mielenz N, Spilke J, Sourant WB, Azem E, etal.
Impact of ɑ-amylase supplementation on energy balance and performance of high-
yielding dairy cows on moderate starch feeding. Anim Sci J (2018), 89; 367–376. doi:
10.1111/asj.12939
19. Arturo SR, Marcos N, Ronaldo B, Renata AN, Nilson N, Tiago S, et al. Eect of
exogenous amylase on lactation performance of dairy cows fed a high-starch diet. J
Dairy Sci. (2018) 101:7199–207. doi: 10.3168/jds.2017-14331
20. NASEM. Nutrient requirements of beef cattle. 8th rev. ed. Washington, DC: National
Academies Press (2006).
21. AOAC. Ocial methods of analysis. 18th ed. Gaithersburg, MD: Association of
Ocial Analytical Chemists International (2006).
22. Van Soest PJ, Robertson JB, Lewis BA. Metho ds for dietary ber, neutral detergent
ber and non-starch polysaccharides in relation to animal nutrition. J Dairy Sci. (1991)
74:3583–97. doi: 10.3168/jds.S0022-0302(91)78551-2
23. Van-Keulen J, Young BA. Evaluation of acid-insoluble ash as a natural marker in
ruminant digestibility studies. J Anim Sci. (1977) 44:282–7. doi: 10.2527/jas1977.442282x
24. Hall MB. Analysis of starch, including maltooligosaccharides, in animal feeds: a
comparison of methods and a recommended method for AOAC collaborative study. J
AOAC Int. (2009) 92:42–9. doi: 10.1093/jaoac/92.1.42
25. Agarwal N, Kamra DN, Chaudhary LC, Agarwal I, Sahoo A, Pathak NN. Microbial
status and rumen enzyme prole of crossbred calves fed on dierent microbial feed
additives. Lett Appl Microbiol. (2002) 34:329–36. doi: 10.1046/j.1472-765X.2002.01092.x
26. Miller GL. Use of dinitrosalisylic acid reagent for determination of reducing sugar.
Anal Chem. (1959) 31:426–8. doi: 10.1021/ac60147a030
27. Yu Z, Morrison M. Improved extraction of PCR-quality community DNA from
digesta and fecal sample. Biotechniques. (2004) 36:808–12. doi: 10.2144/04365ST04
28. Kongmun P, Wanapat M, Pakdee P, Navanukraw C. Eect of coconut oil and garlic
powder on invitro fermentation using gas production technique. Livest Sci. (2010)
127:38–44. doi: 10.1016/j.livsci.2009.08.008
29. SAS Institute Inc. SAS/STAT®9.0 User’s Guide. Cary, NC, USA: SAS Institute Inc.
(2002).
30. DiLorenzo N, Smith DR, Quinn MJ, May ML, Ponce CH, Steinberg W, et al. Eects
of grain processing and supplementation with exogenous amylase on nutrient digestibility
in feedlot diets. Livest Sci. (2011) 137:178–84. doi: 10.1016/j.livsci.2010.11.003
31. Yao JH, Shen J. Rumen degradable starch regulate the gut health and nutrient
utilization in ruminants. Feed Industry. (2020) 8:1–7. doi: 10.13302/j.cnki..2020.08.001
32. Defrain JM, Hippen AR, Kalscheur KF, Tricarico JM. Eects of dietary alpha-
amylase on metabolism and performance of transition dairy cows. J Dairy Sci. (2005)
88:4405–13. doi: 10.3168/jds.S0022-0302(05)73127-1
33. Swanson KC, Matthews JC, Woods CA, Harmon DL. Postruminal administration
of partially hydrolyzed starch and casein inuences pancreatic α-amylase expression in
calves. J Nutr. (2022) 132:376–81. doi: 10.1093/jn/132.3.376
34. Kopecny J, Wallace RJ. Cellular location and some properties of proteolytic
enzymes of rumen bacteria. Appl Environ Microbiol. (1982) 43:1026–33. doi: 10.1128/
aem.43.5.1026-1033.1982
35. Wales WJ, Kolver ES, Thorne PL, Egan AR. Diurnal variation in ruminal pH
on the digestibility of highly digestible perennial ryegrass during continuous
culture fermentation. J Dairy Sci. (2004) 87:1864–71. doi: 10.3168/jds.
S0022-0302(04)73344-5
36. Dijkstra J, Ellis JL, Kebreab E, Strathe AB, Lopez S, France J, et al. Ruminal pH
regulation and nutritional consequences of low pH. Anim Feed Sci Technol. (2012)
172:22–33. doi: 10.1016/j.anifeedsci.2011.12.005
37. Wang Y, Mcallister TA. Rumen microbes, enzymes and feed digestion-a review.
Asian-Aust J Anim Sci. (2002) 15:1659–76. doi: 10.5713/ajas.2002.1659
38. Gado HM, Salem AZM, Robinson PH, Hassan M. Inuence of exogenous enzymes
on nutrient digestibility, extent of ruminal fermentation as well as milk production and
composition in dairy cows. Anim Feed Sci Technol. (2009) 154:36–46. doi: 10.1016/j.
anifeedsci.2009.07.006
39. Lohakare JD, Pattanaik AK, Khan SA. Eect of dietary protein levels on the
performance, nutrient balances, metabolic prole and thyroid hormones of crossbred
calves. Asian-Aust J Anim Sci. (2006) 19:1588–96. doi: 10.5713/ajas.2006.1588
40. Mcleod KR, Baldwin RL, Solomon MB, Baumann RG. Inuence of ruminal and
postruminal carbohydrate infusion on visceral organ mass and adipose tissue accretion
in growing beef steers 1. J Anim Sci. (2007) 85:2256–70. doi: 10.2527/jas.2006-359