Neuroprotective Effect of Solid Lipid Nanoparticles Loaded with Lepidium sativum (L.) Seed Bioactive Components Enhance Bioavailability and Wnt/β-Catenin/Camk-II Signaling Cascade in SH-SY5Y Neuroblastoma Cells

Abstract

The primary pathological hallmark of Alzheimer’s disease (AD) is the formation and accumulation of neurofibrillary tangles and plaques, which result from the aggregation of amyloid-β (Aβ) induced by oxidative stress. The effectiveness of Alzheimer’s disease (AD) therapeutics significantly hinges on the drug’s bioavailability and its ability to penetrate neuronal cells. The current investigation was designed as a first attempt to examine bio-fabricated Lepidium sativum (LS) seed-extract-loaded solid lipid nanoparticles (SLNps) to increase bioavailability and bioefficacy for the prevention of undifferentiated SH-SY5Y neuronal cells from oxidative stress induced by H2O2 and amyloid-β peptide (Aβ,1-42). The SLNps were fabricated using LS extract as a water phase and hyaluronic acid and chia seed fatty acids as a lipid phase, then confirmed and characterized using UV, Zeta size, and SEM methods. The biological safety of synthesized LS-SLNps has been determined using MTT assay and PI staining (nuclear damage) in hMSCs. LS-SLNp-pretreated neuronal cells were induced with oxidative stress and 2 µM of beta-amyloid (Aβ,1-42) fibrils; furthermore, the neuroprotective potential of LS-SLNps was determined through the quenching of oxidative stress, enhancing mitochondrial oxidative capacity, and immunoregulatory potential. Observations found that cells treated with both H2O2 and beta-amyloid (Aβ,1-42) fibrils showed decreased neuronal cell growth, nuclear damage, and mitochondrial membrane potential due to oxidative stress. However, SH-SY5Y cells pretreated with LS-SLNps for 24 h showed an increase in cell proliferation with uniform morphology and increased mitochondrial membrane potential compared to cells pretreated with LS alone. Gene expression analysis found that LS-SLNps increased the expression of Wnt 3a and 5a, which stimulated the canonical, β-catenin, and non-canonical Camk-II expressions of nerve cell growth factors, confirming the molecular-level reversal of neurodegenerative diseases.

Full text

Citation: Al-Saran, N.;
Subash-Babu, P.; Al-Harbi, L.N.;
Alrfaei, B.M.; Alshatwi, A.A.
Neuroprotective Effect of Solid Lipid
Nanoparticles Loaded with Lepidium
sativum (L.) Seed Bioactive
Components Enhance Bioavailability
and Wnt/β-Catenin/Camk-II
Signaling Cascade in SH-SY5Y
Neuroblastoma Cells. Nanomaterials
2024,14, 199. https://doi.org/
10.3390/nano14020199
Academic Editors: Carnevale
Gianluca and Michele Bianchi
Received: 3 December 2023
Revised: 24 December 2023
Accepted: 29 December 2023
Published: 16 January 2024
Copyright: © 2024 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
nanomaterials
Article
Neuroprotective Effect of Solid Lipid Nanoparticles Loaded
with Lepidium sativum (L.) Seed Bioactive Components
Enhance Bioavailability and Wnt/β-Catenin/Camk-II Signaling
Cascade in SH-SY5Y Neuroblastoma Cells
Nada Al-Saran 1, Pandurangan Subash-Babu 1, Laila Naif Al-Harbi 1, Bahauddeen M. Alrfaei 2,3
and Ali A. Alshatwi 1, *
1
Department of Food Science and Nutrition, College of Food and Agricultural Sciences, King Saud University,
P.O. Box 2460, Riyadh 11451, Saudi Arabia; subash@ksu.edu.sa (P.S.-B.)
2College of Medicine, King Saud Bin Abdulaziz University for Health Sciences (KSAU-HS),
Minister of National Guard-Health Affairs (MNGHA), P.O. Box 22490, Riyadh 11426, Saudi Arabia
3
King Abdullah International Medical Research Center, Minister of National Guard-Health Affairs (MNGHA),
P.O. Box 22490, Riyadh 11426, Saudi Arabia
*Correspondence: alshatwi@ksu.edu.sa
Abstract:
The primary pathological hallmark of Alzheimer’s disease (AD) is the formation and
accumulation of neurofibrillary tangles and plaques, which result from the aggregation of amyloid-
β
(A
β
) induced by oxidative stress. The effectiveness of Alzheimer ’s disease (AD) therapeutics
significantly hinges on the drug’s bioavailability and its ability to penetrate neuronal cells. The
current investigation was designed as a first attempt to examine bio-fabricated Lepidium sativum (LS)
seed-extract-loaded solid lipid nanoparticles (SLNps) to increase bioavailability and bioefficacy for
the prevention of undifferentiated SH-SY5Y neuronal cells from oxidative stress induced by H
2
O
2
and amyloid-
β
peptide (A
β
,1-42). The SLNps were fabricated using LS extract as a water phase and
hyaluronic acid and chia seed fatty acids as a lipid phase, then confirmed and characterized using UV,
Zeta size, and SEM methods. The biological safety of synthesized LS-SLNps has been determined
using MTT assay and PI staining (nuclear damage) in hMSCs. LS-SLNp-pretreated neuronal cells
were induced with oxidative stress and 2
µ
M of beta-amyloid (A
β
,1-42) fibrils; furthermore, the
neuroprotective potential of LS-SLNps was determined through the quenching of oxidative stress,
enhancing mitochondrial oxidative capacity, and immunoregulatory potential. Observations found
that cells treated with both H
2
O
2
and beta-amyloid (A
β
,1-42) fibrils showed decreased neuronal cell
growth, nuclear damage, and mitochondrial membrane potential due to oxidative stress. However,
SH-SY5Y cells pretreated with LS-SLNps for 24 h showed an increase in cell proliferation with
uniform morphology and increased mitochondrial membrane potential compared to cells pretreated
with LS alone. Gene expression analysis found that LS-SLNps increased the expression of Wnt 3a
and 5a, which stimulated the canonical,
β
-catenin, and non-canonical Camk-II expressions of nerve
cell growth factors, confirming the molecular-level reversal of neurodegenerative diseases.
Keywords: SLNP; Aβ(1-42) fibrils; oxidative stress; Aβ-neurotoxicity; Wnt/Camk-II; post synapse
1. Introduction
Neuronal cell death mainly occurs after oxidative stress, involving apoptosis induced
by alterations in the brain cell’s internal microenvironment. This process is implicated
in the onset of neurodegenerative conditions like Alzheimer’s disease (AD) or cerebral
ischemia [
1
]. Molecular mechanisms related to pathological neurodegenerative disease
share some standard features, such as the accumulation of misfolded proteins, oxidative
damage to DNA, neuro-excitotoxicity, and neuroinflammatory responses [
2
]. Amyloid-
β
(A
β
,1-42) is the aggregated misfolded protein considered to be the principal hallmark
Nanomaterials 2024,14, 199. https://doi.org/10.3390/nano14020199 https://www.mdpi.com/journal/nanomaterials

Nanomaterials 2024,14, 199 2 of 20
in many neurodegenerative diseases. AD patients have been observed to have a high
deposition of A
β
(1-42) fibrils in their brain, a depressed Wnt signaling cascade, and
intracellular hyperphosphorylated Tau (p-Tau) [3].
During cellular respiration, the release of free electrons from the electron transport
chain (ETC) is unavoidable. These free electrons bind to oxygen to generate superoxide
anions (O
2−
), collectively referred to as reactive oxygen species (ROS) [
4
]. In particular,
the energy uptake and survival of nerve cells majorly depend on aerobic oxidative respi-
ration [
5
]. Consequently, the rich lipid content, high energy demand, and availability of
low-molecular-weight antioxidants in the brain are associated with excessive oxidative
insults [
6
]. In the brain, oxidative stress (OS)-induced damage is more pronounced in
comparison to other organs. This high susceptibility is attributed to the brain’s exces-
sive oxygen demand, the presence of abundant redox-active iron and copper metals, and
the abundant oxidation of mitochondrial aerobic polyunsaturated fatty acids [
7
,
8
]. Pro-
longed oxidative insult is implicated in neuronal cell apoptosis, contributing to the onset of
neurodegenerative diseases such as AD, Parkinson’s disease, and cerebral ischemia [5].
Naturally occurring dietary polyphenols can exert antioxidant and anti-inflammatory
benefits. Red wine, grape seeds, and pomegranate-derived polyphenols, such as resveratrol
and ellagitannins, have been identified for their neuroprotection in both
in vitro
and
in vivo
studies [
9
,
10
]. However, the direct impact of these polyphenols on neuronal cells is a subject
of debate due to their limited bioavailability. Polyphenols face challenges in terms of poor
bioavailability, hindering their ability to reach systemic tissues [
11
,
12
]. Since the majority
of phenolics undergo metabolism and do not reach the nervous system or brain in the
same form as they occur in dietary sources, their direct impact is limited. Alternatively,
gold nanoparticles (AuNPs) have been reported as providing benefits for human neural
stem cells (hMSCs) treated with
β
-amyloid (A
β
). However, the specific neuroprotective
mechanisms remain unclear. In this approach, Shivananjegowda et al. [
13
] found that
SLNps formulated using memantine hydrochloride (MeHCl) and tramiprosate (TMPS)
confirmed the metabolic degradation of Aβon SH-SY5Y cells.
Lepidium sativum L. is a commonly used medicinal plant consumed as a health im-
prover, and it is used as an antioxidant to recover from illness [
14
]. Previously, alkaloids
present in the seeds and aerial parts of Lepidium sativum L. (LS) have been identified as
having antioxidant, hepatoprotective, and anti-inflammatory potential [
15
,
16
]. The present
study is a first attempt to fabricate polyphenol- and alkaloid-rich LS seed-extract-loaded
SLNps (LS-SLNps) to increase bioavailability and analyze the bioefficacy in the prevention
of SH-SY5Y neuronal cells from amyloid-
β
peptide (A
β
,1-42) and H
2
O
2
-induced oxidative
stress. The influence of SLNps on quenching of oxidative stress, enhancing mitochon-
drial oxidative capacity, clearance of A
β
(1-42) fibril deposition, and stimulation of the
molecular-level Wnt signaling pathway for neuronal cell growth have been analyzed.
2. Materials and Methods
2.1. Chemicals
MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide), phosphatidyl-
choline, hyaluronic acid, sialic acid, trypan blue, dimethyl sulfoxide (DMSO), amyloid-
β
peptide (A
β
,1-42), and hydrogen peroxide (H
2
O
2
) were obtained from Sigma-Aldrich (St.
Louis, MO, USA). Propidium iodide, phosphate-buffered saline (PBS), jc-1 (MMP assay),
acridine orange, ethidium bromide, and molecular biology-related chemicals were acquired
from Sigma-Aldrich (St. Louis, MO, USA).
2.2. Plant Material Collection, Extraction of Lepidium sativum L. (Cress Seed) and
Salvia hispanica. L. (Chia Seed)
Lepidium sativum L. (cress seed) and Salvia hispanica L. (chia seed) were purchased from
iHerb (Moreno Valley, CA, USA). In accordance with national and international regulations,
the plant species employed in the present study were identified and authenticated by a
taxonomist. After the identification process, the voucher specimens for Lepidium sativum L.

Nanomaterials 2024,14, 199 3 of 20
(KSU-LS-15) and Salvia hispanica L. (KSU-SH-07) were preserved in the Public Herbarium,
College of Science, King Saud University, Riyadh-11451.
Lepidium sativum L. (cress seed) and Salvia hispanica L. (chia seed) were ground for
30 s, respectively. In a glass container, 400 gm of Lepidium sativum L. (LS) powder was
weighed, 1.2 L of methanol was added to the container, and kept for 72 h in a mechanical
shaker at 30 rpm. After 72 h, the solute was separated using Whatman No. 1 filter paper
and the solvent was separated using a rotary evaporator under reduced pressure at 50
◦
C.
Condensed LS extract was collected and preserved in a brown container at
−
20
◦
C until
further use. Separately, 200 gm of coarsely powdered Salvia hispanica L. seed (SH) was
immersed in 600 mL of ethyl acetate for 72 h allowed for shaking using a fixed shaker. The
extraction progress of Salvia hispanica L. seeds has been carried out in the same way as the
LS seed progress.
2.3. Phytochemical Identification
GC-MS (Agilent 7890A; Agilent Technologies, Santa Clara, CA, USA) was used to
analyze the extract(s) and identify their chemical compounds. The concentration of each
compound was expressed as a peak area percentage. A DB-5MS (30 m
\
0.250 mm
\
0.25
µ
m)
column was used. The flow rate was fixed at 1 mL/min, the pressure was set at 10.42 psi,
splitless mode, and the injection volume was 3
µ
L. The oven temperature was initiated
with 60
◦
C for 3 min, 100
◦
C for 1 min (a rate of 3
◦
C/min), 200
◦
C for 1 min (a rate of
3
◦
C/min), and 300
◦
C for 1 min (a rate of 5
◦
C/min). NIST libraries were used to interpret
GC-MS data. The chromatogram threshold was set at 17 throughout all experiments.
2.4. Preparation of L. sativum Seed Extract Containing Solid Lipid Nanoparticle (LS-SLNp)
SLNp were prepared according to the emulsification evaporation principle, LS-loaded
with hyaluronic acid (HA), Salvia hispanica seed phospholipid (SHE, having omega 3: omega
6 as a 3:1 ratios), phosphatidylethanolamine, palmitic acid, and stearic acid, as described
by Xue et al. [
17
], with a minor modification. Briefly, the lipid phase containing 10 mg
of palmitic acid and 10 mg of stearic acid was dissolved in 20 mL of acetone, hyaluronic
acid, phosphatidylethanolamine (10
µ
L), and solvent-free SHE-phospholipids (15
µ
L),
LS (25 mg) were dissolved entirely using a magnetic stirrer at 70
◦
C. The preheated aqueous
phase containing Tween 20 has emulsified with the warm organic lipid phase (30 mg
dissolved in 15 mL of water). The whole procedure was carried out at 70
◦
C (melting
temperature for lipid) using a hot plate magnetic stirrer with continuous stirring for
60 min. The oil-in-water dispersion was sonicated using a probe-type Ultrasonicator
(Sonics, Newtown, CT, USA) in an ice bath at a frequency of 0.5 cycles with 60% amplitude.
The formulation contains 20 mL of 30 mg lipid phase, 15 mL of the aqueous phase, and
0.05% of the LS extract. The obtained dispersion was collected and stored in a brown glass
container (2–4 ◦C).
2.5. Characterization of Prepared LS-SLNp
The concentration of loaded drug in LS-SLNp was determined by disrupting 1 mL of
freshly prepared LS-SLNp and absorbance were measured at 420 nm using a spectropho-
tometer. Chemical interactions, functional groups with a carbon–oxygen double bonds,
and appearance of chemical (aldehyde and ketone) groups with other excipients were doc-
umented through Fourier-transform infrared spectroscopy (FT-IR) equipment from Agilent,
Santa Clara, CA, USA. The z-average diameter for particle size was determined using the
dynamic light scattering (DLS) technique with a Zetasizer (NANO-Zs90). Morphological
analysis involved placing 5
µ
L of LS-SLNp on a 300-mesh carbon-coated copper grid,
with negative staining achieved using 2% uranyl acetate (w/v). High-resolution scanning
electron microscopy (SEM) from JEOL, Japan, was utilized to examine the morphology
(shape and size) from the stained grids.

Nanomaterials 2024,14, 199 4 of 20
2.6. Cell lines and Cell Culture
Human neuroblastoma (SH-SY5Y) cell and human mesenchymal stem cell (hMSCs)
lines were obtained from the American type culture collections (ATCC, Manassas, VA, USA).
SH-SY5Y cells were cultured using growth media (Thermo Fisher Scientific, Waltham, MA,
USA) containing, 10% FBS (fetal bovine serum), DMEM (Dulbecco’s Modified Eagle’s
Medium), 2 mM
L
-glutamate and antibiotic (1% penicillin/streptomycin) combination in
5% CO
2
at 37
◦
C conditions. Once 80% confluence was visually confirmed, the media
was gently removed, and the cells were washed with Dulbecco’s phosphate-buffered
saline (DPBS) solution. Subsequently, cells were harvested after trypsinization using 0.25%
trypsin/EDTA solution. Further, the cell’s pellet was collected after 5 min centrifugation
at 3500 rpm at room temperature and counted using a hemocytometer. The respective
number of cells were seeded to 96 well (1
×
10
4
cells/well) plate for MTT assay; or 24 well
(5
×
10
4
cells/well) plate for cellular staining, and cDNA synthesis for gene expression analysis.
2.7. Preparation of Beta-Amyloid (Aβ,1-42) Peptides
Beta-amyloid (A
β
,1-42) peptides were dissolved in 1 mM of hexafluoro isopropanol
and the aliquots stored in a sterile brown glass container. Then, hexafluoro isopropanol
was removed under vacuum pressure; furthermore, the pure A
β
(1-42) peptide fibrils
were collected and stored at
−
20
◦
C. The peptides were first suspended in dry DMSO to a
concentration of 5 mM. Working concentration of A
β
(1-42) was prepared using 10 mM
HCL to obtain 100 µM of peptide fibrils and incubated for 24 h at 37 ◦C.
2.8. Biocompatibility Assessment of LS and LS-SLNp in hMSCs and SH-SY5Y Cells
To assess the biosafety of LS and LS-SLNp, the hMSCs and SH-SY5Y cells were
exposed with 0, 5, 10, 20, 40, and 80
µ
g/100 mL concentrations of LS and LS-SLNp for
48 h, respectively. Following incubation, 20
µ
L/well of MTT (5 mg/mL) was added and
maintained for 4 h at 37
◦
C in a CO
2
incubator. After incubation, the purple formazan
crystals were confirmed and dissolved using 100
µ
L of DMSO (100%). The quantity of
formazan compound was measured using a microplate reader (Thermo Scientific, Waltham,
MA, USA) with the absorbance at 570 nm. The quantity of viable cells were evaluated in
percentage according to the average value of absorbance of the sample/absorbance of the
control ×100.
2.9. Assessing the Toxic Dose for H2O2and Aβ(1-42) Using MTT Assay
SH-SY5Y cells (1
×
10
4
cells/well) were allowed to grown in 96 well plates. To
determine the inhibitory dose of H
2
O
2
and A
β
(1-42), increasing concentrations of H
2
O
2
(0, 0.6, 1.2, 2.5, 5, 10, 20, and 40 mM) and A
β
,1-42 (0, 0.25, 0.5, 1, 2, 4, 8, and 16
µ
M) were
treated to the cells (after 80% confluence) for 24 h, respectively. After incubation, according
to the MTT principle and methodology, the percentage of viable cells was calculated.
2.10. Neuroprotective Effect of LS-SLNp in H2O2and Aβ(1-42) Induced SH-SY5Y Cells
Further, SH-SY5Y cells were pretreated with increasing concentrations (0, 0.5, 1, 2,
4, 8, and 16
µ
g/100 mL) of LS and LS-SLNp for 24 h, respectively. The pretreated cells
were exposed with the toxic doses of H
2
O
2
(10 mM) and A
β
,1-42 (2
µ
M) in all wells
and incubated for next 24 h to identify the neuroprotective effect; untreated cells were
considered as negative controls; and SLNp-alone-treated cells were considered as positive
control. After incubation, according to the MTT principle and methodology, the percentage
of viable cells was calculated.
3. Experimental Design
The experiment was intended to analyze the protective effect of 4
µ
g/100 mL of LS
or LS-SLNp against SH-SY5Y cells exposed to neurotoxic agents (using H
2
O
2
oxidative
stress and A
β
,1-42 fibrils) through analyzing the cellular and nuclear characteristics, pro-
inflammation, and apoptosis-related gene expression (Figure 1).

Nanomaterials 2024,14, 199 5 of 20
Nanomaterials 2024, 14, x FOR PEER REVIEW 5 of 21
After incubation, according to the MTT principle and methodology, the percentage of vi-
able cells was calculated.
3. Experimental Design
The experiment was intended to analyze the protective effect of 4 µg/100 mL of LS or
LS-SLNp against SH-SY5Y cells exposed to neurotoxic agents (using H2O2 oxidative stress
and Aβ,1-42 fibrils) through analyzing the cellular and nuclear characteristics, pro-inflam-
mation, and apoptosis-related gene expression (Figure 1).
Figure 1. Experimental design of the present study.
To determine the neuroprotective potential, SH-SY5Y cells were pretreated with 4
µg/100 mL of LS and LS-SLNp for 24 h, respectively. Further, pretreated cells were incu-
bated with 2 µM of beta-amyloid (Aβ,1-42) fibrils and 10 mM of H2O2 for the following 24
h. Negative control (SH-SY5Y cells cultured in growth media alone added with 0.01%
DMSO as solvent control) and positive control (SH-SY5Y cells exposed to oxidative stress
and beta-amyloid toxicity with SLNp alone) have been maintained separately. After 48 h,
the negative control, positive control and experimental cells were examined using an in-
verted microscope for nuclear damage using a light or fluorescence microscope. Another
set of positive control and experimental cells have been used for protein quantification
and gene expression analysis.
3.1. Cell and Nuclear Morphology
SH-SY5Y cells were cultured at a density of 5 × 104 cells/well in a 24 well plate for this
experiment. According to the experimental protocol, positive control, LS, or LS-SLNp (4
µg/100 mL) pretreated SH-SY5Y cells were exposed to neurotoxic agents (10 mM of H2O2
and 2 µM of beta-amyloid (Aβ,1-42) fibrils). Following 48 h incubation, the treated cells
underwent processing to assess apoptotic and necrotic morphological changes. This anal-
ysis was conducted using either light microscopy or florescent microscopy (with propid-
ium iodide (PI), acridine orange (AO) and ethidium bromide (EO)), following the methods
outlined by Leite et al. [18]. Briefly, the culture media were gently removed without dis-
turbing the adherent cells, followed by a gentle wash with 1% PBS. For nuclear morphol-
ogy, 1 mg/mL of propidium iodide (PI; Sigma, St. Louis, MO, USA) solution was applied,
then kept in the dark for 20 min at 37 °C. After the incubation period, unbound dye was
gently washed away with PBS, and the stained cells were promptly examined under an
inverted fluorescent microscope (Carl Zeiss, Jena, Germany) equipped with a green filter.
Images were captured at a magnification of 200x.
In addition, to determine the apoptosis and necrosis the dual fluorescent staining
solution (1:1 ratio) containing AO (100 µg/mL) and EB (100 µg/mL) (AO/EB; Sigma, St.
Figure 1. Experimental design of the present study.
To determine the neuroprotective potential, SH-SY5Y cells were pretreated with
4
µ
g/100 mL of LS and LS-SLNp for 24 h, respectively. Further, pretreated cells were
incubated with 2
µ
M of beta-amyloid (A
β
,1-42) fibrils and 10 mM of H
2
O
2
for the following
24 h. Negative control (SH-SY5Y cells cultured in growth media alone added with 0.01%
DMSO as solvent control) and positive control (SH-SY5Y cells exposed to oxidative stress
and beta-amyloid toxicity with SLNp alone) have been maintained separately. After 48 h,
the negative control, positive control and experimental cells were examined using an in-
verted microscope for nuclear damage using a light or fluorescence microscope. Another
set of positive control and experimental cells have been used for protein quantification and
gene expression analysis.
3.1. Cell and Nuclear Morphology
SH-SY5Y cells were cultured at a density of 5
×
10
4
cells/well in a 24 well plate
for this experiment. According to the experimental protocol, positive control, LS, or
LS-SLNp (4
µ
g/100 mL) pretreated SH-SY5Y cells were exposed to neurotoxic agents
(10 mM of H
2
O
2
and 2
µ
M of beta-amyloid (A
β
,1-42) fibrils). Following 48 h incubation, the
treated cells underwent processing to assess apoptotic and necrotic morphological changes.
This analysis was conducted using either light microscopy or florescent microscopy (with
propidium iodide (PI), acridine orange (AO) and ethidium bromide (EO)), following the
methods outlined by Leite et al. [
18
]. Briefly, the culture media were gently removed
without disturbing the adherent cells, followed by a gentle wash with 1% PBS. For nuclear
morphology, 1 mg/mL of propidium iodide (PI; Sigma, St. Louis, MO, USA) solution was
applied, then kept in the dark for 20 min at 37
◦
C. After the incubation period, unbound
dye was gently washed away with PBS, and the stained cells were promptly examined
under an inverted fluorescent microscope (Carl Zeiss, Jena, Germany) equipped with a
green filter. Images were captured at a magnification of 200×.
In addition, to determine the apoptosis and necrosis the dual fluorescent staining
solution (1:1 ratio) containing AO (100
µ
g/mL) and EB (100
µ
g/mL) (AO/EB; Sigma,
St. Louis, MO, USA) solution was applied until the cells were completely immersed and
then covered with a coverslip. Within 20 min, the morphology of early apoptotic, pre-
apoptotic, late apoptotic, and necrotic cells were examined using a fluorescent microscope
(Carl Zeiss, Jena, Germany). Subsequently, after the 20 min incubation period, the cells
were gently rinsed with PBS to remove the dye, and the stained cells were promptly
examined using fluorescent microscope. Images were captured at a magnification of 200
×
.
The staining procedure was repeated a minimum of three times. The percentages of cells
exhibiting apoptotic and necrotic morphology were manually calculated based on a random
selection of 500 stained cells.

Nanomaterials 2024,14, 199 6 of 20
3.2. JC-1 Staining assay
The assessment of mitochondrial membrane potential (
∆ψm
) was conducted using
the JC-1 staining assay. SH-SY5Y cells, cultured at a density of 5
×
10
4
cells/well in
24 well plate, were subjected to pretreatments with a positive control, LS or LS-SLNp
(
4µg/100 mL
). In brief, JC-1 staining solution, mixed with an equal quantity of culture
medium, was added to experimental cells. Further, the cells were incubated for 20 min in
the dark at 37
◦
C. Following incubation, the unbound JC-1 dye was removed using
200 µL
of wash buffer (specific for JC-1 staining) at 4
◦
C, and this process was repeated twice,
then the JC-1 monomers (green, low MMP) and J-aggregate (red, high MMP) conversions
were observed under fluorescence microscopy (200
×
). Randomly, 500 stained cells were
characterized and ∆ψmwas determined manually and images were captured.
3.3. Measurement of Pro-Oxidant and Antioxidant Levels in LS and LS-SLNp-Pretreated hMSCs
and SH-SY5Y Cells Undergo Oxidative Stress
Pretreated hMSCs and SH-SY5Y cells with 4
µ
g/100 mL of LS or LS-SLNp present in
24 well plate, respective cells were exposed to oxidative stress using H
2
O
2
for hMSCs, and
10 mM of H
2
O
2
& 2
µ
M of A
β
,1-42 for SH-SY5Y for 24 h. The cells that underwent different
treatment conditions were labelled accordingly; then, the cells were lysed in ice-cold lysis
buffer (pH 7.4, 0.1 M Tris/HCL added with 0.5% Triton X-100, 5 mM
β
-mercaptoethanol,
0.1 mg/ mL serine protease inhibitor phenylmethylsulfonylfluoride). The cell lysate was
collected in labelled microcentrifuge tubes and centrifuged at 14,000
×
gfor 5 min at 4
◦
C.
The supernatant was used to analyzed the levels of LPO, activities of glutathione reductase
(GR), catalase (CAT), superoxide dismutase (SOD), and glutathione peroxidase (GPX)
using an enzymatic commercial analytical kit (Sigma-Aldrich, St. Louis, MO, USA) and
a multiwell plate reader. The assay protocol was followed according to the kit manual
provided by the company (detailed methodology presented in the Supplementary Materials:
Methodology—pro- and antioxidant assay).
3.4. Gene Expression Analysis
Total RNA and complementary DNA (Cdna) were synthesized from positive control,
LS (4
µ
g/100 mL), or LS-SLNp (4
µ
g/100 mL) pretreated cells using Fastlane
®
cell cDNA
kit. Quantitative-PCR was performed using Applied Biosystems 7500 Fast Real-Time
PCR System (Foster City, CA, USA). The mRNA expression levels of antioxidant, pro-
inflammatory, and tumor suppressor in hMSCs, as well as neuronal inflammation and
neuroprotective factors (Table 1) in SH-SY5Y cells, were quantified. The analysis including
the reference gene,
β
-actin, was conducted following the method of Yuan et al. [
19
]. All the
primers were purchased from Qiagen and their sequences were verified in primer-BLAST,
National Library of Medicine, online software, and OriGene Global, Rockville, MD 20850,
USA. Two negative controls were included for each gene by removing template cDNA. The
relative expression levels were calculated by the formula:
∆∆
Ct (comparative threshold)
= amplification values of LS-SLNp-treated (
∆
Ct)
−∆
Ct (positive control). Amplification
of the target gene was normalized to its corresponding
β
-actin using the 2
−∆∆Ct
method
using Applied Biosystems with 21 CFR Part 11 software (version 2.0.4).
3.5. Quantification of Protein Using ELISA
The assessment of nerve cell inflammation and neuroprotective factors in SH-SY5Y
cells, such as SFRP-1, T-tau, P-tau, TGF-
β
,
β
-catenin, and growth-associated protein (GAP-
43), was conducted in positive control and LS-SLNp (4
µ
g/100 mL)-pretreated cells. This
analysis was performed using high-sensitivity ELISA kits from Quantikine (R&D Systems,
MN, USA). It is important to note that the assay does not differentiate between soluble and
receptor-bound proteins, measuring the total concentration of proteins. The quantification
of these proteins was expressed as pg/mg protein, providing a standardized measure
across all the analyzed proteins.

Nanomaterials 2024,14, 199 7 of 20
Table 1. Primer sequences used in quantitative real-time polymerase chain reaction (RT-PCR).
Primer Forward Sequence (50to 30) Reverse Sequence (50to 30)
Oxidative stress
LPO CTGCCCTATGACAGCAAGAAGC CGGTTATGCTCGCGGAGAAAGA
NOS GCTCTACACCTCCAATGTGACC CTGCCGAGATTTGAGCCTCATG
HO TCACCTTCCCGAGCATCGAC TCACCCTGTGCTTGACCTCG
NOX-2 GGAGTTTCAAGATGCGTGGAAACTA GCCAGACTCAGAGTTGGAGATGCT
GSH CTGCCGAGATTTGAGCCTCATG CGGAGTCGAGACAGGTACATGT
GPX GTGCTCGGCTTCCCGTGCAAC CTCGAAGAGCATGAAGTTGGGC
GSK-3βGGAACTCCAACAAGGGAGCA TTCGGGGTCGGAAGACCTT
CYP1A GCTGACTTCATCCCTATTCTTCG TTTTGTAGTGCTCCTTGACCATCT
Pro-inflammatory genes
IL1βCCACAGACCTTCCAGGAGAATG GTGCAGTTCAGTGATCGTACAGG
IL4 CCGTAACAGACATCTTTGCTGCC GAGTGTCCTTCTCATGGTGGCT
NF-Kb GCGCTTCTCTGCCTTCCTTA TCTTCAGGTTTGATGCCCCC
TNF-αCTCTTCTGCCTGCTGCACTTTG ATGGGCTACAGGCTTGTCACTC
p53 CCTCAGCATCTTATCCGAGTGG TGGATGGTGGTACAGTCAGAGC
PRb2CTCGTGCTGATGCTACTGAGGA GGTCGGCGCAGTTGGGCTCC
Cdkn-2A CCTTCCAATGACTCCCTCC TCAGAAACCCTAGTTCAAAGGA
Nerve cell proliferation-related gene
GAP-43 AGGGAGAAGGCACCACTACT GGAGGACGGCGAGTTATCAG
Wnt-3a TCTACGACGTGCACACCTG CCTGCCTTCAGGTAGGAGTT
Wnt-5a AGCAGACGTTTCGGCTACAG TGCCCCCAGTTCATTCACAC
Wnt-7a GCGTCTCGCACACTTGCAC CCGCGCTTTCCGGTTCATAG
Camk-IIa CATGGTTTGGGTTTGCAGGG CCGGCTTTGATGCTGGTA
Camk-IIb GAGGACGGAGCAGTGTCTAA GACGCACGATGTTGGAATGC
TUBB3 CCGAAGCCAGCAGTGTCTAA AGGCCTGGAGCTGCAATAAG
FZD2 TCCATCTGGTGGGTGATTCTG CTCGTGGCCCCACTTCATT
FZD3 GCCTATAGCGAGTGTTCAAAACTCA TGGAAACCTACTGCACTCCATATCT
Housekeeping gene
βActin GATCTTGATCTTCATGGTGCTAGG TTGTAACCAACTGGGACCATATGG
3.6. Statistical Analysis
The experiments were carried out with 3 independent repetitions of each parameter.
The data were acquired and presented a mean of 3 data points with SD (wherein each
of the 3 data points was a mean of the 6 (n = 6) technical replicates). All data from
the experimental groups underwent statistical evaluation using the SPSS/28.5 software
package (IBM,
New York
, NY, USA). The analysis involved one-way analysis of variance
(ANOVA) for the experimental groups. Subsequently, post-hoc analysis was performed
using Tukey’s range test to compare and analyze the data within and between the groups.
Statistical significance for all comparisons was set at p
≤
0.05 and p
≤
0.001, as indicated by
the chosen level of significance [20].

Nanomaterials 2024,14, 199 8 of 20
4. Results
4.1. Characterization of LS-SLNp
The liquid phase containing L. sativum extract’s active principles was efficiently encapsu-
lated in the lipid phase containing hyaluronic acid, phosphatidylcholine, and chia seed fatty
acid combinations. The presence of L. sativum extract’s active principles was confirmed by
GC-MS analysis (Figure S1). The identified major phytochemicals, such as 3-Isoquinolinamine,
5-(hydroxymethyl)-2-Furancarboxaldehyde, 2,3,5,6-Tetrafluoroanisole, 9,12,15-Octadecatrien-
1-ol, and (Z)-9-Octadecenamide are presented in Table S1. In Figure 2, the SEM analysis
confirmed the particle dispersion size of free LS extract in Figure 2a, and LS extract-loaded
solid lipid nanoparticles (LS-SLNp) were confirmed with individual particle morphology
with a uniform range between 40 and 80 nm (Figure 2b). Figure 2c shows the availability of a
scattered range of particle distribution in Zetasizer for LS extract alone, found between the
ranges of 50 to 100 nm, 101 to 1000 nm, and 1001 to 4000 nm. Most interestingly, Figure 2d
shows the narrow particle distribution between 9 nm and 230 nm; the average particle size
was found in Zetasizer as 72.5 nm for LS-SLNp. In addition, the size distribution of freshly
prepared LS-SLNp particles ranges between 9 nm and 230 nm, with the average particle size of
72.5 nm (r.nm) (Figure S2a). The size distribution of freshly prepared LS-SLNp combined with
growth medium (0 h), the particle sizes range between 110 nm and 800 nm, with an average
particle size of 72.6 nm (r.nm) in Zetasizer (Figure S2b). No changes in the average particle
size of fresh and growth media-added LS-SLNp confirmed that there was no aggregation of
particles during the time of exposure to cell(s).
Nanomaterials 2024, 14, x FOR PEER REVIEW 8 of 21
4. Results
4.1. Characterization of LS-SLNp
The liquid phase containing L. sativum extract’s active principles was efficiently en-
capsulated in the lipid phase containing hyaluronic acid, phosphatidylcholine, and chia
seed fay acid combinations. The presence of L. sativum extract’s active principles was
confirmed by GC-MS analysis (Figure S1). The identified major phytochemicals, such as
3-Isoquinolinamine, 5-(hydroxymethyl)-2-Furancarboxaldehyde, 2,3,5,6-Tetrafluoroan-
isole, 9,12,15-Octadecatrien-1-ol, and (Z)-9-Octadecenamide are presented in Table S1. In
Figure 2, the SEM analysis confirmed the particle dispersion size of free LS extract in Fig-
ure 2a, and LS extract-loaded solid lipid nanoparticles (LS-SLNp) were confirmed with
individual particle morphology with a uniform range between 40 and 80 nm (Figure 2b).
Figure 2c shows the availability of a scaered range of particle distribution in Zetasizer
for LS extract alone, found between the ranges of 50 to100 nm, 101 to 1000 nm, and 1001
to 4000 nm. Most interestingly, Figure 2d shows the narrow particle distribution between
9 nm and 230 nm; the average particle size was found in Zetasizer as 72.5 nm for LS-SLNp.
In addition, the size distribution of freshly prepared LS-SLNp particles ranges between 9
nm and 230 nm, with the average particle size of 72.5 nm (r.nm) (Figure S2a). The size
distribution of freshly prepared LS-SLNp combined with growth medium (0 h), the par-
ticle sizes range between 110 nm and 800 nm, with an average particle size of 72.6 nm
(r.nm) in Zetasizer (Figure S2b). No changes in the average particle size of fresh and
growth media-added LS-SLNp confirmed that there was no aggregation of particles dur-
ing the time of exposure to cell(s).
Figure 2.
Characterization of L. sativum extract alone (
a
,
c
,
e
) and L. sativum extract-loaded solid lipid
nanoparticle (LS-SLNp) (
b
,
d
,
f
) using scanning electron microscopy (SEM) (
a
,
b
), particle size (
c
,
d
),
and FT-IR (e,f) analysis.

Nanomaterials 2024,14, 199 9 of 20
The comparison of FT-IR data between LS extract (Figure 2e) and LS-SLNp (Figure 2f)
confirmed that there were no significant losses or missing peaks, which confirmed that
all the LS extract containing phytochemicals were encapsulated into the LS-SLNp. The
functional group’s internalization and variations were confirmed in FT-IR data, with
the occurrence of a peak corresponding to the aliphatic primary amine group, such as
3321.2 cm−1
(stretching of N-H), 2923.8 cm
−1
(C-H stretching), 2832.9 (stretching C-H or
N-H of amine group), mild shifting of peaks from 2214 to 1999.2 (C=C=O, ketene; N=C=N,
carbodiimide; N=C=S, isothiocyanate groups), new peaks from 1602.4, 1541.4, and 1453.6
(C=C stretching of conjugated alkene group, N-H bending of an amine group, C-H bending
in alkane of methyl group), and from 1229.6 to 603.9 (C=O stretching of aromatic ester or
aldehyde or amine group) in LS-SLNp, confirmed the addition of LS phytochemicals with
SLNp as a functional group.
4.2. Effect LS and LS-SLNp on hMSCs and SH-SY5Y Cell Proliferation
Freshly prepared LS and LS-SLNp have been used to analyze the biosafety and
cytotoxic effect in hMSCs and SH-SY5Y cells. In Figure 3a, the cytotoxicity assay confirmed
that even at the highest tested concentration of 160
µ
g/100 mL of LS alone found a non-
significant growth decline in hMSCs. Figure 3b shows the results of cytotoxic effect in
SH-SY5Y cells, the LS extract alone with the highest concentration at 160
µ
g/100 mL was
found causing a 14% decline in total cell population. Most notably, LS-SLNp did not
demonstrate a significant decline in growth decline until 48 h.
Nanomaterials 2024, 14, x FOR PEER REVIEW 10 of 21
Figure 3. Effect of L. sativum extract (LS) and L. sativum extract-loaded solid lipid nanoparticles (LS-
SLNps) on hMSCs (a) and SH-SY5Y cell (b) proliferation. The cytotoxic effect of H2O2 (c), beta amy-
loid [Aβ,1-42] (d) after 24 h on SH-SY5Y neuroblastoma cells. The neuroprotective effect of LS and
LS-SLNp on H2O2 and beta amyloid-induced SH-SY5Y neuroblastoma cells (e) after 24 h. The values
are presented as mean ± SD (n = 6). (c,d) ** p ≤ 0.01, * p ≤ 0.05 by compared with negative control. (e)
** p ≤ 0.01, * p ≤ 0.05 by compared with positive control.
4.5. Determination of Neuroprotective Potential via Cell and Nuclear Staining
SH-SY5Y cells exposed to H2O2 and Aβ (1-42) (positive control), found with an irreg-
ular shape of the plasma membrane, uplifted and aggregated cells’ morphology in light
Figure 3. Cont.

Nanomaterials 2024,14, 199 10 of 20
Nanomaterials 2024, 14, x FOR PEER REVIEW 10 of 21
Figure 3. Effect of L. sativum extract (LS) and L. sativum extract-loaded solid lipid nanoparticles (LS-
SLNps) on hMSCs (a) and SH-SY5Y cell (b) proliferation. The cytotoxic effect of H2O2 (c), beta amy-
loid [Aβ,1-42] (d) after 24 h on SH-SY5Y neuroblastoma cells. The neuroprotective effect of LS and
LS-SLNp on H2O2 and beta amyloid-induced SH-SY5Y neuroblastoma cells (e) after 24 h. The values
are presented as mean ± SD (n = 6). (c,d) ** p ≤ 0.01, * p ≤ 0.05 by compared with negative control. (e)
** p ≤ 0.01, * p ≤ 0.05 by compared with positive control.
4.5. Determination of Neuroprotective Potential via Cell and Nuclear Staining
SH-SY5Y cells exposed to H2O2 and Aβ (1-42) (positive control), found with an irreg-
ular shape of the plasma membrane, uplifted and aggregated cells’ morphology in light
Figure 3.
Effect of L. sativum extract (LS) and L. sativum extract-loaded solid lipid nanoparticles
(LS-SLNps) on hMSCs (
a
) and SH-SY5Y cell (
b
) proliferation. The cytotoxic effect of H
2
O
2
(
c
), beta
amyloid [A
β
,1-42] (
d
) after 24 h on SH-SY5Y neuroblastoma cells. The neuroprotective effect of LS
and LS-SLNp on H
2
O
2
and beta amyloid-induced SH-SY5Y neuroblastoma cells (
e
) after 24 h. The
values are presented as mean
±
SD (n = 6). (
c
,
d
) ** p
≤
0.01, by compared with negative control.
(e) ** p≤0.01, * p≤0.05 by compared with positive control.
4.3. Cytotoxic Effect of H2O2and β-Amyloid on SH-SY5Y Neuroblastoma Cells
H
2
O
2
alone or H
2
O
2
(10 mM)-induced oxidative-stressed SH-SY5Y cells were incu-
bated with
β
-amyloid [A
β
,1-42] fibrils for 24 h and significantly decreased the cell popu-
lation, showed changes in the cell morphology, and a gradual decline in mitochondrial
oxidative capacity. We found that 40 mM of H
2
O
2
significantly decreased the SH-SY5Y
cell proliferation up to 62% (Figure 3c). Also, 16
µ
M of A
β
,1-42 significantly reduced the
neuronal cell population up to 66% (Figure 3d), confirming the neurotoxic effect. We found
the IC50 ranges for H2O2at 10 mM and Aβ,1-42 at 2 µM concentrations.
4.4. Preventative Effect of LS-SLNp against H2O2and Aβ,1-42 Induced Toxicity in SH-SY5Y Cells
In SH-SY5Y, the LS-SLNp treatment found with significantly increased cell proliferation
with all the tested doses (0.5, 1, 2, 4, 8, and 16
µ
g/100 mL) was confirmed by the high content of
purple formazan crystal (Figure 3e). LS-SLNp pretreatment for 24 h to SH-SY5Y cells exposed
to neurotoxic agents such as 10 mM of H
2
O
2
and 2
µ
M of
β
-amyloid [A
β
,1-42] fibrils for
24 h effectively prevented the neurotoxicity and found an increased cell proliferation with an
increased drug concentration (Figure 3e). The results confirmed that within a 2
µ
g/100 mL
dose of LS-SLNp increased the cell viability to 100%; however, in LS treatment, we found 98%
viability in the tested higher dose of 16
µ
g/100 mL only. The neuronal cell protection potential
of LS-SLNp was significantly higher (85%) than LS-alone-(63%)-treated SH-SY5Y cells. We
chose 4
µ
g/100 mL doses for further molecular level studies, which are safe as a human starting
dose. The starting dose or human equivalent dose (HED) of nanoparticles (drugs) to humans
are calculated based on the maximum recommended starting dose (MRSD), which is given in
milligrams per kilogram body weight (mg/kg). This calculation is consistently applied and can
be individually determined for each person [21–23].
4.5. Determination of Neuroprotective Potential via Cell and Nuclear Staining
SH-SY5Y cells exposed to H
2
O
2
and A
β
(1-42) (positive control), found with an
irregular shape of the plasma membrane, uplifted and aggregated cells’ morphology
in light microscopic observation are presented with the white arrow head in Figure 4a.
However, pretreatment with 4
µ
g/100 mL doses of LS or LS-SLNp found with both normal
and 95% of cells appeared to possess good adherence and a uniform morphology of cell
size compared to positive control cells.

Nanomaterials 2024,14, 199 11 of 20
Nanomaterials 2024, 14, x FOR PEER REVIEW 11 of 21
microscopic observation are presented with the white arrow head in Figure 4a. However,
pretreatment with 4 µg/100 mL doses of LS or LS-SLNp found with both normal and 95%
of cells appeared to possess good adherence and a uniform morphology of cell size com-
pared to positive control cells.
Figure 4. The light microscopic (a), florescence microscopic image (200×) analysis of propidium io-
dide (b), AO/EB (c), and JC-1 staining (d) for negative control, SLNp with H2O2 and Aβ,1-42-treated
positive control, LS extract, or LS-SLNp pretreated (24 h) SH-SY5Y neuroblastoma cells exposed to
H2O2 and Aβ,1-42 for 24 h. PI staining found that the nucleus appeared with signs of pyknosis mor-
phology (signs of apoptosis) in positive control cells (white arrow head) compared to negative con-
trol (vehicle-treated). However, cells pretreated with LS-SLNp showed normal morphology with no
signs of apoptotic nucleus compared to LS alone. AO/EB staining: positive control cells showing late
apoptotic (red), early apoptotic (orange), and pro-apoptotic (bright green) cells (white arrow head);
but LS-SLNP-pretreated cells found with dark green (normal cells) color alone. In the JC-1 fluores-
cence images, merged representations of the red and green signals of the dye indicate the presence
of J-aggregates and monomeric forms of JC-1, respectively. Notably, in positive control cells, fewer
J-aggregates (indicated by the white arrowhead) were observed compared to the vehicle control
group. However, in LS-SLNP-pretreated SH-SY5Y cells, a higher abundance of J-aggregates was
Figure 4.
The light microscopic (
a
), florescence microscopic image (200
×
) analysis of propidium
iodide (
b
), AO/EB (
c
), and JC-1 staining (
d
) for negative control, SLNp with H
2
O
2
and A
β
,1-42-treated
positive control, LS extract, or LS-SLNp pretreated (24 h) SH-SY5Y neuroblastoma cells exposed
to H
2
O
2
and A
β
,1-42 for 24 h. PI staining found that the nucleus appeared with signs of pyknosis
morphology (signs of apoptosis) in positive control cells (white arrow head) compared to negative
control (vehicle-treated). However, cells pretreated with LS-SLNp showed normal morphology with
no signs of apoptotic nucleus compared to LS alone. AO/EB staining: positive control cells showing
late apoptotic (red), early apoptotic (orange), and pro-apoptotic (bright green) cells (white arrow
head); but LS-SLNP-pretreated cells found with dark green (normal cells) color alone. In the JC-1
fluorescence images, merged representations of the red and green signals of the dye indicate the
presence of J-aggregates and monomeric forms of JC-1, respectively. Notably, in positive control
cells, fewer J-aggregates (indicated by the white arrowhead) were observed compared to the vehicle
control group. However, in LS-SLNP-pretreated SH-SY5Y cells, a higher abundance of J-aggregates
was evident, directly signifying an elevated mitochondrial membrane potential (high MMP,
∆ψ
m)
and indicating active mitochondria when compared to cells treated with LS alone.

Nanomaterials 2024,14, 199 12 of 20
Propidium iodide staining found that 85% of oxidatively stressed SH-SY5Y cells treated
with A
β
(1-42) were in the irregular shape of the nuclear membrane, and the irregular shape
of nuclear content (Figure 4b, white arrow head) confirmed the apoptotic features. The
nuclear damage was reversed or normalized in LS or LS-SLNp pretreatment; the percentage
of apoptotic cells in LS-SLNp-treated cells was 3% compared to the untreated control (70%).
AO/EB staining of untreated SH-SY5Y cells identified 85% late apoptotic and 10%
necrotic cells (Figure 4c, white arrow head). Nevertheless, a 4
µ
g/100 mL dose of LS-
SLNp-pretreated cells was found with 80% normal, 10% early apoptotic, and 5% late
apoptotic cells. This 15% of apoptotic cells (early and late) may be due to the H
2
O
2
and A
β
(1-42)-induced neurotoxicity, which might not reverse the severity completely. LS-SLNp
(
4µg/100 mL
) produced a significant reversal of apoptosis morphology. The morphology
of SH-SY5Y cells pretreated with LS or LS-SLNp was found to be similar to the vehicle-
alone-treated negative control cells. The neuroprotective effect of LS-SLNp was significantly
higher when compared to LS alone.
4.6. Mitochondrial Membrane Potential (∆ψm, JC-1)
Typically, healthy cells exhibit a high MMP (
∆ψ
m), and this parameter is directly
correlated with their oxidative capacity and energy metabolism level. The results obtained
with JC-1 dye serve as an indicator of MMP. This is affirmed by the uptake of the cationic,
natural green florescent JC-1 dye by the electronegative mitochondria. Subsequently, the
dye undergoes internal conversion into irreversible red florescent j-aggregates, further
confirming the status of the mitochondrial membrane potential. In the present study, oxida-
tively stressed SH-SY5Y cells treated with A
β
(1-42) were identified with low mitochondrial
membrane polarization, which was confirmed by the lower irreversible J-aggregates or
high bright green fluorescence accumulation evidenced by the loss of intra- and extra-
mitochondrial ion exchange. LS-SLNp-pretreated SH-SY5Y cells were found with high
red fluorescence compared to the untreated control (Figure 4d). The appearance of the red
color corresponds to a high accumulation of J-aggregates (white arrow head), evidenced by
the high mitochondrial membrane polarity transport of the red-colored JC-1 dye from the
outer mitochondrial to inner intramitochondrial J-aggregates.
4.7. Changes in Pro-Oxidant and Antioxidant Activity
Table 2shows the changes in oxidant levels in LS or LS-SLNp-pretreated hMSCs and
SH-SY5Y. The results show a significantly (p
≤
0.001) high level of LPO and lower levels of
GR, CAT, SOD, and GPX activity in oxidative stress-induced hMSCs and SH-SY5Y (positive
control). Pretreated hMSCs and SH-SY5Y cells significantly (p
≤
0.001) reduced the level of
LPO, increased the activities of GR, CAT, SOD, and GPX intracellularly. The antioxidant
level was found to be higher in LS-SLNp when compared to LS-alone-treated both hMSCs
or SH-SY5Y cells.
4.8. Alterations in Gene Expression Levels in hMSCs Pretreated with LS-SLNp
Alterations in mRNA expression of oxidative stress, immunomodulatory, and tumor
suppression-related genes were detected in both normal and oxidative-stressed hMSCs
following treatment with LS-SLNp. The upregulation in antioxidant and anti-inflammatory
gene expressions in LS-SLNp treatment was observed with a significant (p
≤
0.001) down-
regulation in oxidative stress markers, including LPO, NOS, HO, and NOX-2, in comparison
to untreated or H
2
O
2
-alone-treated hMSCs (Figure 5a). Additionally, the expression of
CYP1A significantly (p
≤
0.001) increased with LS-SLNp treatment. The stimulation of
antioxidant effectiveness of LS-SLNp was further confirmed by elevated expressions of
GSH, GSK-3
β
, and GPx compared to the vehicle control or hMSCs induced with oxidative
stress (Figure 5b).

Nanomaterials 2024,14, 199 13 of 20
Table 2.
Changes in the cellular LPO level and antioxidant enzyme (GR activity, SOD activity,
CAT activity, and GPx activity) in positive control, LS, or LS-SLNp-pretreated hMSCs or SH-SY5Y
neuroblastoma cells exposed to oxidative stress. The values are presented as mean
±
SD (n = 6).
*p
≤
0.05 and ** p
≤
0.001 in comparison with positive control.
#
p
≤
0.05 comparison of LS-SLNp
pretreated cells with LS-pretreated cells exposed to H
2
O
2
and A
β
,1-42. [Units: LPO—expressed as
µ
moles of MDA formed/gram; GR activity—one unit defined as the reduction of 1
µ
mol/min GSSG.
SOD activity—one unit corresponds to the quantity of the enzyme in 20
µ
L of the sample solution that
inhibits the reduction reaction of WST-8 with superoxide anion by 50%. CAT activity—the amount of
the enzyme that can catalyze 1
µ
M H
2
O
2
within 1 min under the condition of pH-7. GPx activity—the
activity was expressed as the conversion of 1 mM/min NADPH to NADP+.
hMSCs SH-SY5Y Cells
Positive Control LS LS-SLNp Positive Control LS LS-SLNp
LPO 0.9 ±0.02 0.6 ±0.01 * 0.4 ±0.02 *, #0.5 ±0.01 0.3 ±0.01 * 0.06 ±0.01 **, #
GR 2.1 ±0.01 3.2 ±0.2 ** 3.9 ±0.01 * 0.06 ±0.03 1.3 ±0.012 * 2.05 ±0.02 **, #
SOD 1.5 ±0.01 2.9 ±0.15 * 4.2 ±0.03 **, #0.03 ±0.01 0.9 ±0.01 * 1.5 ±0.01 **, #
CAT 1.7 ±0.02 2.3 ±0.09 * 2.9 ±0.01 *, #0.05 ±0.01 1.3 ±0.02 * 2.6 ±0.03 **, #
GPX 1.6 ±0.01 2.04 ±0.11 * 3.1 ±0.012 **, #1.1 ±0.02 2.3 ±0.013 * 2.9 ±0.025 *, #
Nanomaterials 2024, 14, x FOR PEER REVIEW 13 of 21
hMSCs SH-SY5Y Cells
Positive Control LS LS-SLNp Positive Control LS LS-SLNp
LPO 0.9 ± 0.02 0.6 ± 0.01 * 0.4 ± 0.02 *, # 0.5 ± 0.01 0.3 ± 0.01 * 0.06 ± 0.01 **, #
GR 2.1 ± 0.01 3.2 ± 0.2 ** 3.9 ± 0.01 * 0.06 ± 0.03 1.3 ± 0.012 * 2.05 ± 0.02 **, #
SOD 1.5 ± 0.01 2.9 ± 0.15 * 4.2 ± 0.03 **, # 0.03 ± 0.01 0.9 ± 0.01 * 1.5 ± 0.01 **, #
CAT 1.7 ± 0.02 2.3 ± 0.09 * 2.9 ± 0.01 *, # 0.05 ± 0.01 1.3 ± 0.02 * 2.6 ± 0.03 **, #
GPX 1.6 ± 0.01 2.04 ± 0.11 * 3.1 ± 0.012 **, # 1.1 ± 0.02 2.3 ± 0.013 * 2.9 ± 0.025 *, #
4.8. Alterations in Gene Expression Levels in hMSCs Pretreated with LS-SLNp
Alterations in mRNA expression of oxidative stress, immunomodulatory, and tumor
suppression-related genes were detected in both normal and oxidative-stressed hMSCs
following treatment with LS-SLNp. The upregulation in antioxidant and anti-inflamma-
tory gene expressions in LS-SLNp treatment was observed with a significant (p ≤ 0.001)
downregulation in oxidative stress markers, including LPO, NOS, HO, and NOX-2, in
comparison to untreated or H2O2-alone-treated hMSCs (Figure 5a). Additionally, the ex-
pression of CYP1A significantly (p ≤ 0.001) increased with LS-SLNp treatment. The stim-
ulation of antioxidant effectiveness of LS-SLNp was further confirmed by elevated expres-
sions of GSH, GSK-3β, and GPx compared to the vehicle control or hMSCs induced with
oxidative stress (Figure 5b).
Figure 5. Results show that the alterations in the expression of pro-oxidant (a), antioxidant (b), pro-
inflammatory, and anti-oncogene-associated genes (c) in positive control, LS, and LS-SLNp-
Figure 5.
Results show that the alterations in the expression of pro-oxidant (
a
), antioxidant (
b
), pro-
inflammatory, and anti-oncogene-associated genes (
c
) in positive control, LS, and LS-SLNp-pretreated
(24 h) human mesenchymal stem cells (hMSCs) exposed to H2O2for 24 h. The values are presented
as mean
±
SD (n = 6). * p
≤
0.05 and ** p
≤
0.001 by comparison with positive control.
#
p
≤
0.05,
comparison of LS-SLNp-pretreated cells with LS-pretreated cells exposed to H2O2and Aβ,1-42.

Nanomaterials 2024,14, 199 14 of 20
A notable increase in the expression levels of TNF-
α
and NF-
κ
b was significant in hM-
SCs subjected to oxidative stress. Furthermore, the expression of IL-1
β
was significantly
increased in both untreated and oxidatively stressed cells, and attained a considerable fold
change (
Figure 5c
). In addition, a two-fold decrease in cdkn2a and p53 expressions associated
with tumor suppressor genes compared to oxidatively stressed hMSCs. Notably, the expres-
sion levels of pro-inflammatory genes, cellular metabolic inflammatory markers, and tumor
suppressor-related genes were restored significantly (p
≤
0.001) in LS-SLNp-pretreated hMSCs.
4.9. Neuroprotection-Related Gene Expression Levels in SH-SY5Y Cells Pretreated with LS-SLNp
Aging and A
β
(1-42)-induced neuronal synapse vulnerability-related mRNA expres-
sion levels were quantified in oxidative stress-induced and LS-SLNp-pretreated SH-SY5Y
neuroblastoma cells. Neuroblastoma cells (SH-SY5Y) subjected to oxidative stress and
treated with A
β
(1-42) for 24 h exhibited a significant reduction in both cell proliferation
and population, which was evidenced with the decreased growth associated protein-43
(GAP-43), canonical (Gsk-3
β
)/non-canonical (CAMK-IIa) wingless-related integration site
(Wnt) signaling pathway. In addition, we observed an increased expression level of tubulin-
associated protein (T-tau) and beta-tubulin protein-3 (TUBB3) receptor genes (Figure 6).
It is noteworthy that LS-NPs pretreated SH-SY5Y cells induced with oxidative stress and
A
β
(1-42) exposure significantly upregulated the levels of GAP-43, Wnt3a, Wnt5a, Wnt7a,
calcium/calmodulin-dependent protein kinase II-a (CAMK-IIa and CAMK-IIb), and Frizzle
receptor (FZD2, FZD3) expression (Figure 6a,b). Most notably, LS-SLNp-pretreated SH-
SY5Y cells had significantly decreased levels of beta-tubulin protein-3 (TUBB3) (Figure 6c).
Nanomaterials 2024, 14, x FOR PEER REVIEW 15 of 21
Figure 6. Results showing the alterations in neuronal cell growth-associated (a–c) gene expression
levels in H2O2 and Aβ,1-42 treated positive control, LS or LS-SLNp-pretreated (24 h) SH-SY5Y neu-
roblastoma cells exposed to H2O2 and Aβ,1-42 for 24 h. The values are presented as mean ± SD (n =
6). * p ≤ 0.05 and ** p ≤ 0.001 in comparison with positive control. # p ≤ 0.05, comparison of LS-SLNp-
pretreated cells with LS-pretreated cells exposed to H2O2 and Aβ,1-42.
4.10. Protein Levels
The intracellular protein extraction and analysis in LS-SLNPs pretreated SH-SY5Y
neuroblastoma cells undergo oxidative stress and Aβ (1-42) exposure. Aβ (1-42) induced
Figure 6. Cont.

Nanomaterials 2024,14, 199 15 of 20
Nanomaterials 2024, 14, x FOR PEER REVIEW 15 of 21
Figure 6. Results showing the alterations in neuronal cell growth-associated (a–c) gene expression
levels in H2O2 and Aβ,1-42 treated positive control, LS or LS-SLNp-pretreated (24 h) SH-SY5Y neu-
roblastoma cells exposed to H2O2 and Aβ,1-42 for 24 h. The values are presented as mean ± SD (n =
6). * p ≤ 0.05 and ** p ≤ 0.001 in comparison with positive control. # p ≤ 0.05, comparison of LS-SLNp-
pretreated cells with LS-pretreated cells exposed to H2O2 and Aβ,1-42.
4.10. Protein Levels
The intracellular protein extraction and analysis in LS-SLNPs pretreated SH-SY5Y
neuroblastoma cells undergo oxidative stress and Aβ (1-42) exposure. Aβ (1-42) induced
Figure 6.
Results showing the alterations in neuronal cell growth-associated (
a
–
c
) gene expression
levels in H
2
O
2
and A
β
,1-42 treated positive control, LS or LS-SLNp-pretreated (24 h) SH-SY5Y
neuroblastoma cells exposed to H
2
O
2
and A
β
,1-42 for 24 h. The values are presented as mean
±
SD
(n = 6). * p
≤
0.05 and ** p
≤
0.001 in comparison with positive control.
#
p
≤
0.05, comparison of
LS-SLNp-pretreated cells with LS-pretreated cells exposed to H2O2and Aβ,1-42.
Nanomaterials 2024, 14, x FOR PEER REVIEW 16 of 21
synaptic vulnerable neuronal cell’s protein such as secreted frizzled-related protein-1
(SFRP-1), T-tau, P-tau, β-catenin, TGF-β were increased two-fold in untreated SH-SY5Y
neuroblastoma cells (Figure 7a,b). However, 24 h of LS-SLNp-pretreated SH-SY5Y cells
were found to significantly decrease synaptic vulnerable neuronal cell protein levels and
pro-inflammatory TGF-β protein.
Figure 7. Results showing the alterations in neuronal cell growth-associated (a,b) protein levels in
H2O2 and Aβ,1-42-treated positive control, LS, or LS-SLNp-pretreated (24 h) SH-SY5Y neuroblas-
toma cells exposed to H2O2 and Aβ,1-42 for 24 h. The values are presented as mean ± SD (n = 6). * p
≤ 0.05 and ** p ≤ 0.001 in comparison with positive control. # p ≤ 0.05, comparison of LS-SLNp pre-
treated cells with LS pretreated cells exposed to H2O2 and Aβ,1-42.
5. Discussion
Under physiological conditions, neural stem cells (NSCs) differentiate into neuro-
blasts, then neurons, oligodendrocytes, and astrocytes [24]. Neuroblasts play a significant
role during embryonic development. However, they persist into adulthood, contributing
to the generation of fresh brain cells and assisting in the recovery process following brain
injury and neuronal death [25]. The neuronal cell death is accompanied by an increased
unesterified cholesterol release and conversion of cholesterol into the polar metabolite; the
present analysis concentrated on evaluating the defenses against oxidative stress, oxyster-
ols, and unesterified cholesterol during the early stages of neuroblast proliferation [26,27].
In this study, our focus was on examining the protective impact of nanoparticles on
Figure 7.
Results showing the alterations in neuronal cell growth-associated (
a
,
b
) protein levels in
H
2
O
2
and A
β
,1-42-treated positive control, LS, or LS-SLNp-pretreated (24 h) SH-SY5Y neuroblastoma
cells exposed to H
2
O
2
and A
β
,1-42 for 24 h. The values are presented as mean
±
SD (n = 6). * p
≤
0.05
and ** p≤0.001 in comparison with positive control. #p≤0.05, comparison of LS-SLNp pretreated
cells with LS pretreated cells exposed to H2O2and Aβ,1-42.

Nanomaterials 2024,14, 199 16 of 20
4.10. Protein Levels
The intracellular protein extraction and analysis in LS-SLNPs pretreated SH-SY5Y
neuroblastoma cells undergo oxidative stress and A
β
(1-42) exposure. A
β
(1-42) induced
synaptic vulnerable neuronal cell’s protein such as secreted frizzled-related protein-1
(SFRP-1), T-tau, P-tau,
β
-catenin, TGF-
β
were increased two-fold in untreated SH-SY5Y
neuroblastoma cells (Figure 7a,b). However, 24 h of LS-SLNp-pretreated SH-SY5Y cells
were found to significantly decrease synaptic vulnerable neuronal cell protein levels and
pro-inflammatory TGF-βprotein.
5. Discussion
Under physiological conditions, neural stem cells (NSCs) differentiate into neuroblasts,
then neurons, oligodendrocytes, and astrocytes [
24
]. Neuroblasts play a significant role
during embryonic development. However, they persist into adulthood, contributing to the
generation of fresh brain cells and assisting in the recovery process following brain injury
and neuronal death [
25
]. The neuronal cell death is accompanied by an increased unesteri-
fied cholesterol release and conversion of cholesterol into the polar metabolite; the present
analysis concentrated on evaluating the defenses against oxidative stress, oxysterols, and
unesterified cholesterol during the early stages of neuroblast proliferation [
26
,
27
]. In this
study, our focus was on examining the protective impact of nanoparticles on undifferenti-
ated SH-SY5Y neuroblast cells, specifically before the onset of neuronal cell differentiation.
In addition, understanding the selective neuronal vulnerability (SNV) to oxidative
stress is crucial for developing future interventional strategies aimed to protect such suscep-
tible neurons from the challenges associated with the aging process and the pathological
conditions leading to neuronal cell degeneration [
28
]. Currently, many drugs are developed
or in progress of development for controlling neurodegenerative diseases; some have failed
in clinical trials. The bioavailability of drugs and their ability to traverse the blood–brain
barrier (BBB) are pivotal factors in the therapeutic management of AD [
29
]. In the present
study, the edible LS plant metabolites (3-Isoquinolinamine) were fabricated as a solid lipid
nanoparticle with hyaluronic acid; the hypothesis has been tested to determine whether
they possess bioaccessibility and bioavailability. Hyaluronic acid (HA) is a hydrophilic and
biodegradable polymer utilized in LS-SLNPs fabrication. The distinctive characteristics
of high molecular weight HA are marked by elevated specificity and biocompatibility,
a drug delivery system designed and optimized using HA-SLNs, and the hydrophilic
nature of HA meaning it is easily digested by cells which reduces immune rejection
or inflammation [30,31].
The preliminary bioefficacy assay confirmed that the fabricated LS-SLNPs support
hMSCs cell proliferation and increases in SH-SY5Y neuronal cell growth compared to
free LS extract treatment. The dietary polyphenols with fewer side effects pose potential
neuroprotective and beneficial effects both in cell and animal models of neurological
disorders [
11
]. In the present study, the identified bioactive metabolites from LS extract,
such as 3-Isoquinolinamine [
32
], triterpene esters, and polyphenols have been identified
with neuronal cell protection from
β
-amyloid-induced apoptosis [
33
]. The components
like 2,3,5,6-tetrafluoroanisole and 9-octadecenamide have been found to be beneficial in
hippocampal progenitor cell proliferation [34].
In regenerative medicine, the multipotent differentiation potential of hMSCs has been
explored as a novel treatment for AD. This is attributed to their ability to target multiple
pathological mechanisms associated with AD. In hMSCs, the fabricated LS-SLNPs increased
cell proliferation via reduced oxidative stress. The H
2
O
2
-induced oxidative stress was
effectively quenched by LS-SLNp and have been confirmed by an increased antioxidant
enzyme (SOD, GPX, CAT and GR) activity. The aforementioned findings are substantiated
by the elevated expression of antioxidant and pro-apoptotic genes, indicating a mitigation
of oxidative stress and restoration of the multilineage capacity of hMSCs at the graft site.
The current results affirm a decrease in lipid peroxidative levels (HO, LPO, and NOS) and
an increase in antioxidant gene expression (GSH, GSK-3
β
, and GPX) when compared to the

Nanomaterials 2024,14, 199 17 of 20
LS extract. This observation confirmed that the fabricated LS-SLNPs possess the highest
bioavailability and intracellular uptake mediated by the encapsulated surface lipid. The
phytocomponents, 3-isoquinolinamine from LS extract, can be dispersed homogeneously
in a HA-containing aqueous phase and encapsulated with phosphatidylcholine and chia
seed phospholipids. In this context, HA-SLNPs play a crucial role via enhancing cellular
uptake and notably facilitating targeted delivery to specific tumor cancer cells, particularly
in expressing CD44
+
[
35
]. Hydroxyapatite nanoparticles (HAp-NPs) were fabricated for an
effective treatment for Alzheimer’s disease. In silico methods were employed to confirm
the biological targets associated with the bioavailability and bioactivity ligands (five),
specifically in acetylcholinesterase and butyrylcholinesterase activities [36].
The increase in SH-SY5Y neuronal cell proliferation has been evidenced by the typical
morphology of nuclear chromatin content in propidium iodide staining; reduced numbers
of pro- and late apoptotic cells in AO/EB fluorescent staining. In addition, the JC-1 assay
confirmed the increased mitochondrial membrane potential (
∆ψ
m) in LS-SLNP-pretreated
SH-SY5Y cells exposed to oxidative stress and A
β
,1-42 amyloid fibrils compared to LS-alone
treatment. In this context, Zhang et al. [
37
] confirmed the protective efficacy of aspirin
eugenol ester against paraquat-induced toxicity in SH-SY5Y cells. Zhang et al. [
32
] have
confirmed that 3-Isoquinoline and its derivatives protect neuronal cells from beta-amyloid-
induced apoptosis.
The Wnt signaling pathway plays a comprehensive role in neuronal connectivity and
synapse formation through the central nervous system (CNS) development, spanning from
early stages to adulthood. Wnt is consistently released in the brain to uphold neural activity;
and any deregulation in Wnt signaling leads to the onset of neurological disorders [
38
].
Wnt signaling encompasses a multiplex cascade, classified into canonical or non-canonical
pathways [
39
]. The beta-catenin-dependent canonical pathway, which stimulates long-term
synaptic plasticity and cell survival, is regulated by Wnt3a, Wnt7a; and the non-canonical
β
-catenin independent or calmodulin-dependent protein kinase II (Camk-II) to stimulate
postsynaptic compartment is regulated by Wnt4a and Wnt5a [
40
]. The present study
observed that LS-SLNP treatment upregulated the levels of Wnt3a, Wnt7a, and Wnt5a
expression, confirming that suppressing A
β
(1-42) fibrils induced neuronal toxicity by
canonical or non-canonical pathways. Further, the non-canonical/Wnt signaling cascade
Camk-II has been expressed higher, followed by the increased expression of frizzled
receptors (FZD2 and FZD3). Previously, Folke et al. [
41
] observed that the expression
of Wnt ligands, specifically Wnt3a, 5a, 7a, and frizzled receptors FZD2 and FZD3, was
decreased in the brain of elderly people.
Furthermore, Wnt signaling is implicated in promoting the expression of repressor
element-silencing transcription factor-1 (REST) during aging process. In this context, REST
represses pro-apoptotic genes, playing a protective role against oxidative stress and the
neurotoxic agent, A
β
[
42
]. Consequently, a downregulated Wnt signaling may contribute
to the observed reduction in REST levels in AD [
42
], and potentially to an increased
susceptibility to neurotoxic agent, A
β
. In the human brain with AD, the synaptogenesis role
of abnormal aggregation of soluble
β
-amyloid, p-Tau, glia-mediated neuroinflammation,
and decreased GAP-43 is well evidenced [
43
]. Presynaptic dysfunction is characterized by
elevated CSF GAP-43 levels in asymptomatic and symptomatic AD patients [44].
Cell proliferation and differentiation have been prominently stimulated by the up-
regulation of the Wnt/
β
-catenin pathway [
45
]. In the present study, we found a higher
amount of secreted frizzle-related protein 1 (SFRP-1), p-Tau, t-Tau,
β
-catenin, and increased
GAP-43 in A
β
,1-42 treated oxidative-stressed SH-SY5Y cells. However, LS-SLNP-treated
SH-SY5Y cells stimulated with oxidative stress followed by amyloid fibril treatment found
decreased SFRP-1, p-Tau, t-Tau,
β
-catenin levels, and increased GAP-43 protein expression
levels. In addition, LS-SLNp effectively quenched the pro-oxidants and increased the
antioxidant enzymatic activity in SH-SY5Y cells exposed to oxidative stress. Nalci et al. [
46
]
found that green synthesized magnesium nanoparticles MgS-NPs upregulated antioxidant
activity in SH-SY5Y neuroblastoma cells. Overall, the expression of canonical or non-

Nanomaterials 2024,14, 199 18 of 20
canonical pathway-associated protein and gene expressions were significantly increased by
the treatment of LS-SLNp in SH-SY5Y neuroblastoma cells undergoing oxidative stress and
followed by the exposure of Aβ,1-42 amyloid fibrils.
6. Conclusions
The present study attempted to provide evidence of a substance to protect the neuronal
cell from oxidative insult and physiological relevance related to the use of Lepidium sativum
L., a commonly used medicinal plant. The fabrication of solid lipid nanoparticles improved
the absorption, stability, and bioavailability. The findings supported the proliferation of
both hMSCs and SH-SY5Y cells. This is accompanied by indications of biosafety, providing
a promising avenue for the translation of bioactive components from experimental research
in laboratories to potential clinical applications. Our findings suggest that pretreatment
with LS-SLNPs to SH-SY5Y cells stimulates Wnt signaling pathway activation and prevents
neuronal cell toxicity upon oxidative stress and A
β
,1-42 amyloid fibril exposure. The
observed LS-SLNPs effect was more significant than the free LS extract. Lepidium sativum L.
can be used as a preventive measure for controlling neuronal cell oxidative insults via the
Wnt/β-catenin/Camk-II signaling mechanism.
Supplementary Materials:
The following supporting information can be downloaded at: https://www.
mdpi.com/article/10.3390/nano14020199/s1. Figure S1: gas chromatography–mass spectrum (GC-
MS) chromatogram for
L. sativum
L. extract; Table S1: GC-MS phytochemical profiling of
L. sativum
methanol extract (LSE) show 99–95% similarity in the NIST-11 database; Figure S2: analysis of
particle size using size distribution by intensity for
L. sativum
extract-loaded solid lipid nanoparticle
(LS-SLNp) with free (Figure S2a) and growth media added (0 h) (Figure S2b) conditions.
Author Contributions:
Conceptualization, P.S.-B., N.A.-S. and A.A.A.; methodology, N.A.-S.,
P.S.-B.
and A.A.A.; formal analysis, N.A.-S., P.S.-B. and L.N.A.-H.; investigation, N.A.-S. and P.S.-B.; re-
sources, A.A.A., L.N.A.-H. and B.M.A.; validation, N.A.-S., P.S.-B. and A.A.A.; writing—original draft
preparation, N.A.-S., P.S.-B. and A.A.A.; writing—review and editing, N.A.-S., P.S.-B. and A.A.A.;
supervision, A.A.A.; project administration, P.S.-B. and A.A.A.; funding acquisition, P.S.-B. and A.A.A.
All authors have read and agreed to the published version of the manuscript.
Funding:
This research was funded by ‘Researchers Supporting Project’ grant number ‘RSP2024R178’,
King Saud University, Riyadh, Saudi Arabia.
Data Availability Statement:
The data presented in this study are available in the Supplementary
Materials.
Acknowledgments:
The authors are grateful for the funding by the ‘Researchers Supporting Project’
number (RSP2024R178), King Saud University, Riyadh, Saudi Arabia.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
Plascencia-Villa, G.; Perry, G. Roles of Oxidative Stress in Synaptic Dysfunction and Neuronal Cell Death in Alzheimer’s Disease.
Antioxidants 2023,12, 1628. [CrossRef] [PubMed]
2.
Mansor, N.I.; Ntimi, C.M.; Abdul-Aziz, N.M.; Ling, K.H.; Adam, A.; Rosli, R.; Hassan, Z.; Nordin, N. Asymptomatic neurotoxicity
of amyloid
β
-peptides (A
β
1-42 and A
β
25-35) on mouse embryonic stem cell-derived neural cells. Bosn. J. Basic Med. Sci.
2021
,
21, 98–110. [CrossRef]
3.
Wells, C.; Brennan, S.E.; Keon, M.; Saksena, N.K. Prionoid Proteins in the Pathogenesis of Neurodegenerative Diseases. Front.
Mol. Neurosci. 2019,12, 271. [CrossRef] [PubMed]
4.
Chen, R.; Lai, U.H.; Zhu, L.; Singh, A.; Ahmed, M.; Forsyth, N.R. Reactive oxygen species formation in the brain at different
oxygen levels: The role of hypoxia-inducible factors. Front. Cell Dev. Biol. 2018,6, 132. [CrossRef] [PubMed]
5.
Wang, W.; Zhao, F.; Ma, X.; Perry, G.; Zhu, X. Mitochondria dysfunction in the pathogenesis of Alzheimer’s disease: Recent
advances. Mol. Neurodegener. 2020,15, 30. [CrossRef] [PubMed]
6. Salim, S. Oxidative stress and the central nervous system. J. Pharmacol. Exp. Ther. 2017,360, 201–205. [CrossRef]
7.
Tanokashira, D.; Mamada, N.; Yamamoto, F.; Taniguchi, K.; Tamaoka, A.; Lakshmana, M.K.; Araki, W. The neurotoxicity of
amyloid β-protein oligomers is reversible in a primary neuron model. Mol. Brain 2017,10, 4. [CrossRef]

Nanomaterials 2024,14, 199 19 of 20
8.
Zhaliazka, K.; Matveyenka, M.; Kurouski, D. Lipids uniquely alter the secondary structure and toxicity of amyloid beta 1–42
aggregates. FEBS J. 2023,290, 3203–3220. [CrossRef]
9.
Ahmed, A.; Subaiea, M.; Eid, A.; Li, L.; Seeram, P.; Zawia, H. Pomegranate extract modulates procesh of amyloid-
β
precursor
protein in an aged Alzheimer’s Disease animal model. Curr. Alzheimer Res. 2014,11, 834–843. [CrossRef]
10.
Singh, N.; Agrawal, M.; Doré, S. Neuroprotective properties and mechanisms of resveratrol in
in vitro
and
in vivo
experimental
cerebral stroke models. ACS Chem. Neurosci. 2013,4, 1151–1162. [CrossRef]
11.
Singh, M.; Arseneault, M.; Sanderson, T.; Murthy, V.; Ramaswamy, C. Challenges for research on polyphenols from foods in
Alzheimer’s disease: Bioavailability, metabolism, and cellular and molecular mechanisms. J. Agric. Food Chem.
2008
,56, 4875–4883.
[CrossRef] [PubMed]
12.
Yan, L.; Guo, M.S.; Zhang, Y.; Yu, L.; Wu, J.M.; Tang, Y.; Ai, W.; Zhu, F.D.; Law, B.Y.K.; Chen, Q.; et al. Dietary plant polyphenols
as the potential drugs in neurodegenerative diseases: Current evidence, advances, and opportunities. Oxidative Med. Cell. Longev.
2022,2022, 5288698. [CrossRef] [PubMed]
13.
Shivananjegowda, M.G.; Hani, U.; Osmani, R.A.M.; Alamri, A.H.; Ghazwani, M.; Alhamhoom, Y.; Rahamathulla, M.;
Paranthaman, S.; Gowda, D.V.; Siddiqui, A. Development and evaluation of solid lipid nanoparticles for the clearance of A
β
in
Alzheimer’s disease. Pharmaceutics 2023,15, 221. [CrossRef] [PubMed]
14.
Al-Yahya, M.A.; Mossa, J.S.; Ageel, A.M.; Rafatullah, S. Pharmacological and safety evaluation studies on Lepidium sativum L.,
Seeds. Phytomedicine 1994,1, 137–144. [CrossRef] [PubMed]
15.
Al-Suwaydani, A.; Alam, M.A.; Raish, M.; ABin Jardan, Y.; Ahad, A.; IAl-Jenoobi, F. Effect of C. cyminum and L. sativum on
Pharmacokinetics and Pharmacodynamics of Antidiabetic Drug Gliclazide. Curr. Drug Metab.
2022
,23, 953–960. [CrossRef]
[PubMed]
16.
Vazifeh, S.; Kananpour, P.; Khalilpour, M.; Eisalou, S.V.; Hamblin, M.R. Anti-inflammatory and immunomodulatory properties of
Lepidium sativum. BioMed Res. Int. 2022,2022, 3645038. [CrossRef]
17.
Xue, M.; Zhang, L.; Yang, M.X.; Zhang, W.; Li, X.M.; Ou, Z.M.; Li, Z.P.; Liu, S.H.; Li, X.J.; Yang, S.Y. Berberine-loaded solid lipid
nanoparticles are concentrated in the liver and ameliorate hepatosteatosis in db/db mice. Int. J. Nanomed.
2015
,10, 5049–5057.
[CrossRef] [PubMed]
18.
Leite, M.; Quinta-Costa, M.; Leite, P.S.; Guimarães, J.E. Critical evaluation of techniques to detect and measure cell death—Study
in a model of UV radiation of the leukemic cell line HL60. Anal. Cell. Pathol. 1999,19, 139–146. [CrossRef]
19. Yuan, J.S.; Reed, A.; Chen, F.; Stewart, C.N. Statistical analysis of real-time PCR data. BMC Bioinform. 2006,7, 85. [CrossRef]
20.
Kim, H.-Y. Analysis of variance (ANOVA) comparing means of more than two groups. Restor. Dent. Endod.
2014
,39, 74–77.
[CrossRef]
21.
FDA. Guidance for Industry on Estimating the Maximum Safe Starting Dose in Initial Clinical Trials for Therapeutics in Adult
Healthy Volunteers. July 2005. Available online: www.fda.gov (accessed on 25 October 2023).
22.
Siegrist, S.; Cörek, E.; Detampel, P.; Sandström, J.; Wick, P.; Huwyler, J. Preclinical hazard evaluation strategy for nanomedicines.
Nanotoxicolog 2019,13, 73–99. [CrossRef] [PubMed]
23.
Reigner, B.G.; Blesch, K.S. Estimating the starting dose for entry into humans: Principles and practice. Eur. J. Clin. Pharmacol.
2002,57, 835–845. [CrossRef]
24.
Li, S.; Dong, L.; Pan, Z.; Yang, G. Targeting the neural stem cells in subventricular zone for the treatment of glioblastoma:
An update from preclinical evidence to clinical interventions. Stem Cell Res. Ther. 2023,14, 125. [CrossRef] [PubMed]
25. Vaz, A.; Ribeiro, I.; Pinto, L. Frontiers in Neurogenesis. Cells 2022,11, 3567. [CrossRef] [PubMed]
26.
Ay, H.F.; Yesilkir-Baydar, S.; Cakir-Koc, R. Synthesis characterisation and neuroprotectivity of Silybum marianum extract loaded
chitosan nanoparticles. J. Microencapsul. 2023,40, 29–36. [CrossRef]
27.
Testa, G.; Staurenghi, E.; Zerbinati, C.; Gargiulo, S.; Iuliano, L.; Giaccone, G.; Fantò, F.; Poli, G.; Leonarduzzi, G.; Gamba, P.
Changes in brain oxysterols at different stages of Alzheimer’s disease: Their involvement in neuroinflammation. Redox Biol.
2016
,
10, 24–33. [CrossRef]
28.
Sweeney, M.D.; Sagare, A.P.; Zlokovic, B.V. Blood-brain barrier breakdown in Alzheimer’s disease and other neurodegenerative
disorders. Nat. Rev. Neurol. 2018,14, 133–150. [CrossRef]
29.
Lee, R.-L.; Funk, K.E. Imaging blood-brain barrier disruption in neuroinflammation and Alzheimer’s disease. Front. Aging
Neurosci. 2023,15, 1144036. [CrossRef]
30.
Pereira, I.; Lopez-Martinez, M.J.; Villasante, A.; Introna, C.; Tornero, D.; Canals, J.M.; Samitier, J. Hyaluronic acid-based bioink
improves the differentiation and network formation of neural progenitor cells. Front. Bioeng. Biotechnol.
2023
,11, 1110547.
[CrossRef]
31.
Alhasan, M.A.; Tomokiyo, A.; Hamano, S.; Sugii, H.; Ono, T.; Ipposhi, K.; Yamashita, K.; Mardini, B.; Minowa, F.; Maeda, H.
Hyaluronic Acid Induction Promotes the Differentiation of Human Neural Crest-like Cells into Periodontal Ligament Stem-like
Cells. Cells 2023,12, 2743. [CrossRef]
32.
Zhang, Y.-H.; Zhang, H.-J.; Wu, F.; Chen, Y.-H.; Ma, X.-Q.; Du, J.-Q.; Zhou, Z.-L.; Li, J.-Y.; Nan, F.-J.; Li, J. Isoquinoline-1,3,4-trione
and its derivatives attenuate
β
-amyloid-induced apoptosis of neuronal cells. FEBS J.
2006
,273, 4842–4852. [CrossRef] [PubMed]
33.
Huang, C.N.; Wang, C.J.; Lin, C.L.; Yen, A.T.; Li, H.H.; Peng, C.H. Abelmoschus esculentus subfractions attenuate beta amyloid-
induced neuron apoptosis by regulating DPP-4 with improving insulin resistance signals. PLoS ONE
2018
,14, e0217400. [CrossRef]
[PubMed]

Nanomaterials 2024,14, 199 20 of 20
34.
Roy, A.; Kundu, M.; Chakrabarti, S.; Patel, D.R.; Pahan, K. Oleamide, a sleep-inducing supplement, upregulates doublecortin in
hippocampal progenitor cells via PPARα.J. Alzheimer’s Dis. 2021,84, 1539–1554. [CrossRef]
35.
Choi, Y.; Lee, S.G.; Jeong, J.H.; Lee, K.M.; Jeong, K.H.; Yang, H.; Kim, M.; Jung, H.; Lee, S. Nanostructured lipid carrier-loaded
hyaluronic acid microneedles for controlled dermal delivery of a lipophilic molecule. Int. J. Nanomed.
2013
,8, 289–299. [CrossRef]
[PubMed]
36.
Pradeep, S.; Prabhuswaminath, S.C.; Reddy, P.; Srinivasa, S.M.; Shati, A.A.; Alfaifi, M.Y.; Eldin, I.; Elbehairi, S.; Achar, R.R.; Silina,
E.; et al. Anticholinesterase activity of Areca Catechu:
In vitro
and in silico green synthesis approach in search for therapeutic
agents against Alzheimer’s disease. Front. Pharmacol. 2022,13, 1044248. [CrossRef]
37.
Zhang, Z.D.; Yang, Y.J.; Qin, Z.; Liu, X.W.; Li, S.H.; Bai, L.X.; Li, J.Y. Protective activity of aspirin eugenol ester on paraquat-induced
cell damage in SH-SY5Y cells. Oxidative Med. Cell. Longev. 2021,2021, 6697872. [CrossRef] [PubMed]
38.
Arredondo, S.B.; Valenzuela-Bezanilla, D.; Santibanez, S.H.; Varela-Nallar, L. Wnt signaling in the adult hippocampal neurogenic
niche. Stem Cells 2022,40, E198–E206. [CrossRef] [PubMed]
39.
Teo, S.; Salinas, P.C. Wnt-Frizzled Signaling Regulates Activity-Mediated Synapse Formation. Front. Mol. Neurosci.
2021
,
14, 683035. [CrossRef]
40.
Oliva, C.A.; Vargas, J.Y.; Inestrosa, N.C. Wnts in adult brain: From synaptic plasticity to cognitive deficiencies. Front. Cell.
Neurosci. 2013,7, 224. [CrossRef]
41.
Folke, J.; Pakkenberg, B.; Brudek, T. Impaired Wnt signaling in the prefrontal cortex of Alzheimer’s disease. Mol. Neurobiol.
2019
,
56, 956–965. [CrossRef]
42.
Lu, T.; Aron, L.; Zullo, J.; Pan, Y.; Kim, H.; Chen, Y.; Yang, T.H.; Kim, H.M.; Drake, D.; Liu, X.S.; et al. REST and stress resistance in
aging and Alzheimer’s disease. Nature 2014,507, 448–454. [CrossRef] [PubMed]
43.
Lan, G.; Li, A.; Liu, Z.; Ma, S.; Guo, T. Presynaptic membrane protein dysfunction occurs prior to neurodegeneration and predicts
faster cognitive decline. Alzheimer’s Dement. 2023,19, 2408–2419. [CrossRef] [PubMed]
44.
Sandelius, A.; Portelius, E.; Källén, A.; Zetterberg, H.; Rot, U.; Olsson, B.; Toledo, J.B.; Shaw, L.M.; Lee, V.M.Y.; Irwin, D.J.; et al.
Elevated CSF GAP-43 is Alzheimer’s disease-specific and associated with tau and amyloid pathology. Alzheimer’s Dement.
2019
,
15, 55–64. [CrossRef] [PubMed]
45. Wray, J.; Hartmann, C. WNTing embryonic stem cells. Trends Cell Biol. 2012,22, 159–168. [CrossRef]
46.
Nalci, O.B.; Nadaroglu, H.; Genc, S.; Hacimuftuoglu, A.; Alayli, A. The effects of MgS nanoparticles-Cisplatin-bio-conjugate on
SH-SY5Y neuroblastoma cell line. Mol. Biol. Rep. 2020,47, 9933–9940. [CrossRef]
Disclaimer/Publisher’s Note:
The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.