No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Potential role of hesperidin in lifestyle disorders: A scoping review
Type 2 diabetes (T2D) and metabolic (dysfunction)-associated steatotic liver disease (MASLD) affect a growing number of individuals worldwide. T2D and MASLD often coexist and substantially elevate the risk of adverse hepatic and cardiovascular clinical outcomes. Several common pathogenetic mechanisms are responsible for T2D and MASLD onset and progression, including insulin resistance, oxidative stress, and low-grade inflammation, among others. The latter can also be induced by gut microbiota and its derived metabolites. Natural bioactive compounds (NBCs) have been reported for their therapeutic potential in both T2D and MASLD. A large amount of evidence obtained from clinical trials suggests that compounds like berberine, curcumin, soluble fibers, and omega-3 fatty acids exhibit significant hypoglycemic, hypolipidemic, and hepatoprotective activity in humans and may be employed as adjunct therapy in T2D and MASLD management. In this review, the role of the most studied NBCs in the management of T2D and MASLD is discussed, emphasizing recent clinical evidence supporting these compounds’ efficacy and safety. Also, prebiotics that act against metabolic dysfunction by modulating gut microbiota are evaluated.
The purpose of this review is to examine the effects of hesperidin and hesperetin on liver disorders. Metabolic dysfunction-associated steatotic liver disease is a complicated disorder influenced by many factors such as inflammation, diabetes, and obesity. Currently, the most prominent treatment method is lifestyle changes. If left untreated, it can progress to cirrhosis, liver fibrosis, and liver cancer. Hesperidin, which is a flavanone glycoside polyphenolic plant compound, belongs to the flavanone class and was first isolated from citrus peel. Hesperidin includes aglycone hesperetin and rutinoside sugar. It is the most dominant form of flavonoid in citrus fruits. In our review, we discussed the effects of these phytochemicals on liver diseases, focusing on their relationship with inflammation, blood sugar regulation, and blood lipids. Hesperidin and hesperetin are seen as promising agents for many diseases. Their antioxidant and anti-inflammatory properties support this view. Although their low water solubility limits their potential effects, many studies have demonstrated their benefits. They are thought to play an effective role in inflammatory processes, particularly in liver diseases ore studies are required to find the optimum dosage and to use them as a therapeutic agent for the liver.
Edible oils and fats are derived from plants and animals and have several health benefits. Edible oils and fats consist of many health-promoting bioactive compounds such as polyunsaturated fatty acids, monounsaturated fatty acids, polyphenols, flavonoids, phytosterols, vitamins, and inorganic compounds. The chemical compounds present in edible oils and fats are known for their possible health risks such as coronary heart disease and metabolic diseases, which is why there is a need to check the quality, purity, and safety of edible oils and fats. Bioactive Compounds of Edible Oils & Fats: Health Benefits, Risks, and Analysis provides an overview of different edible oils and fats, health benefits, associated risks, and analytical techniques for qualitative and quantitative guidelines for ensuring their quality and safety using modern analytical tools and techniques. This book will provide an important guideline for controlling quality, safety, and efficacy issues related to edible oils and fats.
Key Features:
Provides a detailed overview of different edible oils and fats of plant and animal origin, chemistry, and identification methods.
Describes their health benefits, risks, and the use of different analytical techniques in quality control.
Describes the applicability of sophisticated analytical techniques such as GC-FID, GC-MS, and HPLC for quality control of edible oils and fats.
Emphasizes the use of recent techniques such as LC-MS and FTIR-chemometrics in the analysis and quality control of edible oils and fats.
Bioactive natural compounds possess several health benefits in humans. Edible oils and fats are a major source of bioactive compounds, and these compounds are mainly categorized into triglycerides, saturated and unsaturated fatty acids, polyphenolics and phenolic acids, flavonoids, phytosterols, phospholipids, vitamins, minerals, etc. These bioactive compounds have several health benefits in humans; however, excess consumption of saturated and trans fatty acids poses a risk for cardiovascular diseases. Unsaturated fatty acids such as omega-3 fatty acids and omega-6 fatty acids specifically linoleic acid, eicosapentaenoic acid (EPA), and docosahexaenoic acid (DHA) are known for their cardioprotective, anticancer, anti-inflammatory, and immunomodulatory activities. Edible oils and fats are obtained from seeds of many plant species such as olive oils, peanut oils, canola oil, sunflower oil, soybean oil, flaxseed oil, corn oil, mustard oil, coconut oil, peanut oil, and linseed oil, and animal products such as fish oils, ghee, and butter also contain edible oils and fats. The current book chapter comprehensively compiles data on different plant and animal sources of edible oils and fats. The chapter also focuses on different classes of bioactive compounds present in these edible oils and fats.
Among the major neurodegenerative disorders (NDDs), Alzheimer’s disease (AD) and Parkinson’s disease (PD), are a huge socioeconomic burden. Over many centuries, people have sought a cure for NDDs from the natural herbals. Many medicinal plants and their secondary metabolites are reported with the ability to alleviate the symptoms of NDDs. The major mechanisms identified, through which phytochemicals exert their neuroprotective effects and potential maintenance of neurological health in ageing, include antioxidant, anti-inflammatory, antithrombotic, antiapoptotic, acetylcholinesterase and monoamine oxidase inhibition and neurotrophic activities. This article reviews the mechanisms of action of some of the major herbal products with potential in the treatment of NDDs according to their molecular targets, as well as their regional sources (Asia, America and Africa). A number of studies demonstrated the beneficial properties of plant extracts or their bioactive compounds against NDDs. Herbal products may potentially offer new treatment options for patients with NDDs, which is a cheaper and culturally suitable alternative to conventional therapies for millions of people in the world with age-related NDDs.
The genus Cinnamomum, the evergreen tree of tropical and subtropical Asia, Australia, the pacific region and South America, a member of family Lauraceae, has been used in day to day routine as a spice and condiment in India. This genus has many applications in perfumery, flavouring and pharmaceutical industries. Volatile oils from different parts of cinnamon such as leaves, fruits, root bark, flowers and buds have been isolated by several techniques and identification of these constituents have been done by GC and GC-MS. The present review describes the traditional and ethanobotanical uses and various chemical constituents, of various Indian species of Cinnamomum genus. This review will help those people who are interested in doing research work on this plant in future, which has got tremendous potential medicinally.
Nuclear magnetic resonance (NMR) spectroscopy is a robust method, which can rapidly analyze compounds or their mixtures in complex matrices without separating or purifying them. This makes the technique ideal for analysis of foods and related products. NMR continues to be an underutilized methodology in the area of food authentication and analysis, mainly due to the high cost, relatively low sensitivity, and the lack of NMR expertise among food analysts. The aim of this chapter is to explore the role of NMR methodologies in the field of food science with a special focus on analysis of food toxins. An introduction of the basic principles of NMR related to the study of foods and nutrients is given. This is followed by a detailed description of metabolomics studies. NMR with metabolomics studies together make a powerful methodology to address the challenges faced in food science. Furthermore, a comprehensive overview of their recent applications in the areas of compositional analysis, food authentication, quality control, and human nutrition is provided. In addition, use of NMR techniques in the analysis of potential food toxins is discussed. Finally, future perspective of the use NMR-based studies in the identification and characterization of food constituents and toxins is presented.
Abstract
Hesperidin and hesperetin are polyphenols that can be found predominantly in citrus fruits. They possess a variety of pharmacological properties such as neuroprotective and antidiabetic activity. However, the bioavailability of these compounds is limited due to low solubility and restricts their use as pro-healthy agents. This paper described the limitations resulting from the low bioavailability of the presented compounds and gathered the methods aiming at its improvement. Moreover, this work reviewed studies providing pieces of evidence for neuroprotective and antidiabetic properties of hesperidin and hesperetin as well as providing a detailed look into the significance of reported modes of action in chronic diseases. On account of a well-documented pro-healthy activity, it is important to look for ways to overcome the problem of poor bioavailability. View Full-Text
Keywords: hesperidin; hesperetin; bioavailability; neuroprotection; antidiabetic
New drugs or active leads with high efficiency and low toxicity are needed in the treatment of lung cancer. Natural products are an important source of anti-tumor drugs. At present, there are many molecular-targeted anti-tumor drugs derived from natural products or their derivatives for tumor treatment or in clinical trials. Hesperidin is a flavanone isolated from the Rutaceae plant lime Citrus aurantium L. or Citrus sinensis Osbeck. It has been considered to inhibit cancer cell viability in vitro. However, the effect of hesperidin on lung cancer and its underlying mechanism remain unclear. In this study, we found that the pinX1 expression level is closely related to overall survival and plays an important role in regulating lung cancer cell proliferation, migration, invasion, and senescence. More importantly, hesperidin significantly increased pinX1 protein expression, and knockdown pinX1 by its specific siRNA blocked the protective effects of hesperidin. Moreover, we also assessed that hesperidin at 100 mg/kg is safe in vivo. These findings showed that hesperidin is a potential therapeutic candidate for preventing the progression of lung cancer.
Wound healing is a complex biological phenomenon, having different but overlapping stages to obtained complete re-epithelization. The aim of the current study was to develop a dendrimer-based hydrogel bandage, to ameliorate full-thickness wounds. Hesperidin, a bioflavonoid found in vegetables and citrus fruits, is used for treatment of wounds; however, its therapeutic use is limited, due to poor water solubility and poor bioavailability. This issue was overcome by incorporating hesperidin in the inner core of a dendrimer. Hence, a dendrimer-based hydrogel bandage was prepared, and the wound healing activity was determined. A hemolysis study indicated that the hesperidin-loaded dendrimer was biocompatible and can be used for wound healing. The therapeutic efficacy of the prepared formulation was evaluated on a full-thickness wound, using an animal model. H&E staining of the control group showed degenerated neutrophils and eosinophils, while 10% of the formulation showed wound closure, formation of the epidermal layer, and remodeling. The MT staining of the 10% formulation showed better collagen synthesis compared to the control group. In vivo results showed that the preparation had better wound contraction activity compared to the control group; after 14 days, the control group had 79 ± 1.41, while the 10% of formulation had 98.9 ± 0.42. In a nutshell, Hsp-P-Hyd 10% showed the best overall performance in amelioration of full-thickness wounds.
Hesperidin is a bioflavonoid occurring in high concentrations in citrus fruits. Its use has been associated with a great number of health benefits, including antioxidant, antibacterial, antimicrobial, anti-inflammatory and anticarcinogenic properties. The food industry uses large quantities of citrus fruit, especially for the production of juice. It results in the accumulation of huge amounts of by-products such as peels, seeds, cell and membrane residues, which are also a good source of hesperidin. Thus, its extraction from these by-products has attracted considerable scientific interest with aim to use as natural antioxidants. In this review, the extraction and determination methods for quantification of hesperidin in fruits and by-products are presented and discussed as well as its stability and biological activities.
This dementia epidemiology fact sheet 2022 is aimed at providing an overview of the epidemiology of dementia in Korea using representative government-led data. This review summarizes the prevalence and incidence of this condition using various types of data. The prevalence and incidence of dementia have increased and are predicted to continue to do so. This information will be utilized by public health officials, healthcare professionals, and policymakers to develop strategies for dementia rehabilitation and prevention.
We developed a naringenin–hesperidin molar mixture (MIX–160) with proven antihyperglycemic and vasorelaxant activity in preclinical studies. A solid dosage form was manufactured to improve the bioavailability properties. In the current study, we sought to evaluate the oral preclinical toxicity of the MIX–160 dosage form, which showed no mortality or significant changes in the body weight, food consumption and tissue/organ mass in rats. Three daily oral doses (50, 300 and 2000 mg/kg of MIX–160) were assayed for 28 days. The results showed no structural abnormalities in the histological analysis and no significant changes (p > 0.05) in the liver biochemical markers (total bilirubin, AST and ALT) compared to the control group. The above findings showed that the MIX–160 dosage form did not exhibit relevant toxic effects, which suggests its potential safety as a drug candidate for clinical studies.
The simultaneous effects of three continuous factors: solvent concentration (50–100%), treated times (25–85 min), treated temperatures (25–55 °C), and two categorical factors: type of solvents (methanol or ethanol) and ultrasonic frequency (28 kHz or 40 kHz) on ultrasonic-assisted extraction yield from waste orange peels were evaluated and optimized by response surface methodology. Fourier Transform Infrared (FTIR) spectroscopy with a wavelength of 500 cm−1 to 4000 cm−1 was employed to rapidly identify the orange extracts. The significant polynomial regression models on crude extraction, sediments after evaporation, and precipitation yield were established (p < 0.05). Results revealed that solvent concentration affected crude extraction and precipitation yield linearly (p < 0.01). The optimal and practical ultrasound-assisted extraction conditions for increasing the precipitation yield were using 61.42% methanol with 85 min at 55 °C under 40 kHz ultrasonic frequency. The spectra of extracts showed a similar fingerprint of hesperidin.
Green tea, a widely consumed beverage in Asia, contains green tea catechins effective against obesity, especially epigallocatechin-3-O-gallate (EGCG), but must be consumed in an impractically huge amount daily to elicit its biological effect. Meanwhile, citrus polyphenols have various physiological effects that could enhance EGCG functionality. Here we investigated the antiobesity effect of a combination of EGCG and α-glucosyl hesperidin, a citrus polyphenol, at doses that have not been previously reported to exert antiobesity effects by themselves in any clinical trial. In a randomized, placebo-controlled, double-blinded, and parallel-group-designed clinical trial, 60 healthy Japanese males and females aged 30–75 years consumed green tea combined with α-glucosyl hesperidin (GT-gH), which contained 178 mg α-glucosyl hesperidin and 146 mg EGCG, for 12 weeks. Physical, hematological, blood biochemical, and urine examinations showed that GT-gH is safe to use. At week 12, GT-gH prevented weight gain and reduced body mass index (BMI) compared with the placebo. Especially in those aged < 50 years, triglyceride and body fat percentage decreased at week 6, visceral fat level and body fat percentage decreased at week 12; body weight, BMI, and blood LDL/HDL ratio also decreased. In conclusion, taking GT-gH prevents weight gain, and the antiobesity effect of GT-gH was more pronounced in people aged < 50 years.
Purpose:
Hesperidin, a plant-based molecule, has been shown to exhibit anticancer effects against the human prostate cancer cells. However, its mechanism of action is still unclear. This study was undertaken to investigate the mechanism underlying the anticancer effects of hesperidin against prostate cancer cells.
Methods:
The CCK-8 kit-based proliferation analysis was performed to find out the effect of hesperidin administration on prostate cancer cell growth, in vitro. Apoptosis of cancer cells was studied with dual Annexin V-FITC/propidium iodide (PI) staining combined with flow cytometry. The latter was also used for the analysis of cancer cell mitotic cell cycle. The intracellular levels of reactive oxygen species (ROS) were determined with ROS-detection kit. Fluorescent probing was used for determination of mitochondrial membrane potential (MMP) of prostate cancer cells. The migration and invasion of cancer cells was studied using transwell assay.
Results:
The in vitro treatment of prostate cancer cells led to significant decrease of cell growth and viability in a dose-dependent manner. The decline in the growth of cancer cells was shown to be resulting from initiation of cell cycle arrest and necrosis-like apoptotic cell death. The latter was shown to be triggered by intracellular accumulation of ROS molecules and reduction of MMP. Moreover, the hesperidin administration significantly reduced the cancer cell migration and invasion.
Conclusion:
Hesperidin was shown to selectively inhibit the growth of prostate cancer cells through apoptosis triggered by ROS generation. The results support its potential to act as lead molecule in anticancer drug design.
Objectives: A simple, sensitive, precise, robust and rapid high performance thin layer chromatography (HPTLC) method for analysis of luteolin in Eclipta alba extract as well as in the formulation was developed and validated. Method: The mobile phase system consisted of toluene-ethyl acetate-formic acid (5: 3.5: 0.1, v/v/v). Densitometry analysis was carried out in the absorbance/reflectance mode at the wavelength of 350 nm at room temperature (25 ± 2°C). Result: The system was found to give compact bands for luteolin (Rf value of 0.34±0.02). The linear regression analysis data for the calibration plots showed good linearity (r 2 = 0.99601 ± 0.002) in the concentration range 200-1200 ng spot-1. The method was validated according to the International Conference on Harmonization (ICH) guidelines. The limits of detection and quantitation were 20 and 60 ng spot-1 , respectively. Conclusion: The method has been successfully applied in the analysis of herbal extract and market formulations containing luteolin.
This study was designed to investigate the structure of synthesized hesperidin glycosides (HGs) and evaluate their antibacterial and α-glucosidase inhibitory activities. The preliminary structure of HGs was confirmed by glucoamylase treatment and analyzed on thin layer chromatography (TLC). The LC-MS/MS profiles of HGs showed the important fragments at m/z ratios of 345.21 (added glucose to glucose of rutinose in HG1) and 687.28 (added maltose to glucose of rutinose in HG2), confirming that the structures of HG1 and HG2 were α-glucosyl hesperidin and α-maltosyl hesperidin, respectively. In addition, 1H and 13C-NMR of hesperidin derivatives were performed to identify their α-1,4-glycosidic bonds. The MIC and MBC studies showed that transglycosylated HG1 and HG2 had better antibacterial and bactericidal activities than hesperidin and diosmin, and were more active against Staphylococcus aureus than Escherichia coli. Hesperidin, HG1, HG2, and diosmin inhibited α-glucosidase with IC50 values of 2.75 ± 1.57, 2.48 ± 1.61, 2.36 ± 1.48, and 2.99 ± 1.23 mg/mL, respectively. The inhibition kinetics of HG2 shown by a Lineweaver–Burk plot confirmed HG2 was an α-glucosidase competitive inhibitor with an inhibitor constant, Ki, of 2.20 ± 0.10 mM. Thus, HGs have the potential to be developed into antibacterial drugs and treatments for treating α-glucosidase-associated type 2 diabetes.
Scope
To evaluate the chemopreventive efficacy of hesperidin (Hsd) in 1,2-dimethylhydrazine (DMH)-induced colorectal cancer (CRC) and demonstrate its role in mothers against decapentaplegic homolog 4(Smad4) and activin A signaling pathways.
Methods and results
A CRC rat model was established by DMH exposure, and the animals were randomly divided into five groups: Control group, Hsd, DMH, DMH + Hsd, and DMH followed by Hsd. The resected colon was subjected to macroscopic, microscopic, molecular, histopathological, and immunohistochemical examination. Activin A, Smad4, malondialdehyde (MDA), nitric oxide (NO), reduced glutathione (GSH), and superoxide dismutase (SOD) levels in tissues were also measured. The DMH group exhibited a significant increase in the gene and protein expression of activin A as well as MDA and NO levels in tissues. There was a significant reduction in the gene and protein expression of Smad4 as well as GSH and SOD levels in tissues. Administration of Hsd significantly upregulated Smad4 and activin A gene expressions in both the DMH + Hsd and DMH followed by Hsd groups. Moreover, Hsd improved the antioxidant status of the former two groups.
Conclusion
This study demonstrated the chemopreventive effect of Hsd against CRC by modulating Smad4 and activin A signaling in vivo. Further studies are needed to demonstrate its clinical value and explore its possible role in advanced malignancy.
The Preferred Reporting Items for Systematic reviews and Meta-Analyses (PRISMA) statement, published in 2009, was designed to help systematic reviewers transparently report why the review was done, what the authors did, and what they found. Over the past decade, advances in systematic review methodology and terminology have necessitated an update to the guideline. The PRISMA 2020 statement replaces the 2009 statement and includes new reporting guidance that reflects advances in methods to identify, select, appraise, and synthesise studies. The structure and presentation of the items have been modified to facilitate implementation. In this article, we present the PRISMA 2020 27-item checklist, an expanded checklist that details reporting recommendations for each item, the PRISMA 2020 abstract checklist, and the revised flow diagrams for original and updated reviews.
This article provides an update on the global cancer burden using the GLOBOCAN 2020 estimates of cancer incidence and mortality produced by the International Agency for Research on Cancer. Worldwide, an estimated 19.3 million new cancer cases (18.1 million excluding nonmelanoma skin cancer) and almost 10.0 million cancer deaths (9.9 million excluding nonmelanoma skin cancer) occurred in 2020. Female breast cancer has surpassed lung cancer as the most commonly diagnosed cancer, with an estimated 2.3 million new cases (11.7%), followed by lung (11.4%), colorectal (10.0 %), prostate (7.3%), and stomach (5.6%) cancers. Lung cancer remained the leading cause of cancer death, with an estimated 1.8 million deaths (18%), followed by colorectal (9.4%), liver (8.3%), stomach (7.7%), and female breast (6.9%) cancers. Overall incidence was from 2‐fold to 3‐fold higher in transitioned versus transitioning countries for both sexes, whereas mortality varied <2‐fold for men and little for women. Death rates for female breast and cervical cancers, however, were considerably higher in transitioning versus transitioned countries (15.0 vs 12.8 per 100,000 and 12.4 vs 5.2 per 100,000, respectively). The global cancer burden is expected to be 28.4 million cases in 2040, a 47% rise from 2020, with a larger increase in transitioning (64% to 95%) versus transitioned (32% to 56%) countries due to demographic changes, although this may be further exacerbated by increasing risk factors associated with globalization and a growing economy. Efforts to build a sustainable infrastructure for the dissemination of cancer prevention measures and provision of cancer care in transitioning countries is critical for global cancer control.
Regarding the increasing prevalence of cardiometabolic abnormalities, and its association with non-communicable chronic diseases, providing preventive and therapeutic strategies is a priority. A randomized placebo-controlled study was conducted to assess the effects of combination therapy of milled brown flaxseed and hesperidin during lifestyle intervention on controlling cardiovascular risk in prediabetes. A total of forty-eight subjects were randomly assigned to receive lifestyle intervention plus combination therapy of brown flaxseed (30 g milled) and hesperidin (two 500 mg capsules) or lifestyle modification alone for 12 weeks. Changes from baseline in anthropometric measures, lipid profile and atherogenic indices, glucose homeostasis parameters, and inflammatory biomarkers was assessed as a primary end point. Anthropometric data comparison between the two groups showed a significant reduction in weight (p = 0.048). Waist circumference reduction was about twice that of the control group (− 6.75 cm vs − 3.57 cm), but this difference was not statistically significant. Comparison of blood pressure changes throughout the study indicated a greater reduction in blood pressure in the intervention group rather than control group (− 5.66 vs. − 1.56 mmHg, P = 0.049). Improvements of lipid profile and atherogenic indices, glucose homeostasis parameters, and inflammatory biomarkers in flaxseed-hesperidin group was significantly more than the control group after 12 weeks of intervention (p < 0.05). Our results indicate that co-administration of flaxseed and hesperidin as an adjunct to lifestyle modification program is more effective than lifestyle modification alone in the metabolic abnormalities remission of prediabetic patients. Trial registration: The trial was registered with ClinicalTrials.gov, number NCT03737422. Registered 11 November 2018. Retrospectively registered, https://clinicaltrials.gov/ct2/results?cond=&term=NCT03737422&cntry=&state=&city=&dist=.
Background:Osteoporosis (OP) is being increasingly recognized in inflammatory rheumatic diseases like rheumatoid arthritis (RA), characterized mainly by low bone mass, reduced bone strength, and an increased risk of fractures affecting bone metabolism influencing bone mineral density (BMD) and fracture risk.Results :Women in the RA with PRED group did not show lower BMD values than those in the RA without PRED group at baseline, in both lumbar spine L1-L4 (P=0.691), in femoral neck (P=0.332), in radius total (P=0.564) and radius UD (P=0.941). Women in the RA without PRED group had lower T score (Radius UD) (P=0.015) value than those in the RA with PRED group. However, during 12 months follow ups there was no statistically significant difference between the two groups in the change in BMD or projection area in the lumbar spine, femoral neck and radius UD.Conclusion: Premenopausal RA women with or without prednisolone treatment lost their bone mass statistically similar. Study assumes role of RA on axial bone mass development will be less important with better treatment of RA than our patients received.
Hesperidin, a secondary orange (Citrus sinensis) metabolite, was extracted from orange bagasse. No organic solvents or additional energy consumption were used in the clean and sustainable process. Hesperidin purity was approximately 98% and had a yield of 1%. Hesperidin is a known supplement due to antioxidant, chelating, and anti-ageing properties. Herein, hesperidin application to eliminate dark eye circles, which are sensitive and thin skin regions, was studied. In addition, the proposed method for its aqueous extraction was especially important for human consumption. Further, the most effective methods for hesperidin nanonization were explored, after which the nanoemulsions were incorporated into a cream formulation that was formulated for a tropical climate. Silky cream formulations (oil in water) were tested in vitro on artificial 3D skin from cultured cells extracted from skin residues after plastic surgery. The proposed in vitro assay avoided tests of the different formulations in human volunteers and animals. It was shown that one of the nanonized hesperidin formulations was the most skin-friendly and might be used in cosmetics.
Abstract Background The increasing aging population has been posing a significant challenge to disease burden in developing countries. In particular, the contribution of population aging to and long term changes of disease burden of malignant neoplasm of female genital organs (MNFGO) have not been quantitatively demonstrated. Methods Data were collected from the Shanghai Vital Statistics System of Pudong New Area (PNA). Crude mortality rate (CMR), age-standardized mortality rate by Segi’s world standard population (ASMRW), and years of life lost (YLL) of MNFGO as the underlying cause of death in age and pathology types from 1995 to 2018 were calculated. The joinpoint regression was used to estimate the trends of those rates by identifying the annual percent changes (APCs), and the decomposition method was used to calculate the increased rates and the contribution resulting from demographic and non-demographic factors. Results From 1995 to 2018, a total of 2869 MNFGO-specific deaths were reported in PNA, accounting for 0.64% of the total deaths. The CMR and ASMRW of MNFGO were 9.23/105 person-years and 4.80/105 person-years, respectively. Ovary cancer was the most common cause of MNFGO death, accounting for 43.9% (1260/2869) of all MNFGO death. Other common causes of MNFGO death included cervix uteri cancer, uterus unspecified cancer, and corpus uteri cancer. With the increase of age, the mortality rate of MNFGO in residents had shown an upward trend ([APC (95%CI) = 3.46 (2.74, 4.18), P
Objectives
Parkinson’s disease (PD) is a neurological condition with selective progressive degeneration of dopaminergic neurons. Routine therapies are symptomatic and palliative. Although, hesperidin (Hsd) is known for its neuroprotective effects, its exact cellular mechanism is still a mystery. Considering the important role of calcium (Ca ²⁺ ) in cellular mechanisms of neurodegenerative diseases, the present study aimed to investigate the possible effects of Hsd on Ca ²⁺ channels in cellular model of PD and the possible association between the selective vulnerability of neurons in cellular models of PD and expression of the physiological phenotype that changes Ca ²⁺ homeostasis.
Methods
SH-SY5Y cell line was used in this study; cell damage was induced by 150 µM 6-OHDA and the cells’ viability was examined using MTT assay. Intracellular calcium, reactive oxygen species (ROS) and mitochondrial membrane potential were determined by the fluorescence spectrophotometry method. The expressions of calcium channel receptors were determined by gel electrophoresis and immunoblotting.
Results
Loss of cell viability and mitochondrial membrane potential were confirmed in 6-OHDA treated cells. In addition, intracellular ROS and calcium levels, calcium channel receptors significantly increased in 6-OHDA-treated cells. Incubation of SH-SY5Y cells with hesperidin showed a protective effect, reduced the biochemical markers of cell damage/death, and balanced calcium hemostasis.
Conclusions
Based on our findings, it seems that hesperidin could suppress the progression of the cellular model of PD via acting on intracellular calcium homeostasis. Further studies are needed to confirm the potential benefits of preventive and therapeutic effects of stabilizing cellular calcium homeostasis in neurodegenerative disease.
PurposeTo assess the sustained and acute effects, as well as the influence of sustained consumption on the acute effects, of orange juice (OJ) with a natural hesperidin content and hesperidin-enriched OJ (EOJ) on blood (BP) and pulse (PP) pressures in pre- and stage-1 hypertensive individuals.Methods
In a randomized, parallel, double-blind, placebo-controlled trial, participants (n = 159) received 500 mL/day of control drink, OJ, or EOJ for 12 weeks. Two dose–response studies were performed at baseline and after 12 weeks.ResultsA single EOJ dose (500 mL) reduced systolic BP (SBP) and PP, with greater changes after sustained treatment where a decrease in diastolic BP (DBP) also occurred (P < 0.05). SBP and PP decreased in a dose-dependent manner relative to the hesperidin content of the beverages throughout the 12 weeks (P < 0.05). OJ and EOJ decreased homocysteine levels at 12 weeks versus the control drink (P < 0.05). After 12 weeks of EOJ consumption, four genes related to hypertension (PTX3, NLRP3, NPSR1 and NAMPT) were differentially expressed in peripheral blood mononuclear cells (P < 0.05).Conclusion
Hesperidin in OJ reduces SBP and PP after sustained consumption, and after a single dose, the chronic consumption of EOJ enhances its postprandial effect. Decreases in systemic and transcriptomic biomarkers were concomitant with BP and PP changes. EOJ could be a useful co-adjuvant tool for BP and PP management in pre- and stage-1 hypertensive individuals.
This study is aimed at assessing the antihyperglycemic, antihyperlipidemic, and antioxidant effects of Citrus reticulata (C. reticulata) fruit peel hydroethanolic extract and two flavonoids, hesperidin and quercetin, in nicotinamide (NA)/streptozotocin- (STZ-) induced type 2 diabetic rats. In addition, GC-MS and HPLC-MS analyses of the extract were performed and the results indicated the presence of multiple flavonoids including hesperidin, quercetin, naringin, and polymethoxylated flavones (nobiletin and tangeretin). To achieve the aim of the study, diabetic rats with NA/STZ-induced T2DM were orally treated with C. reticulata fruit peel hydroethanolic extract, hesperidin, and quercetin at a dose of 100 mg/kg b.w./day for four weeks. The treatments with C. reticulata fruit peel extract, hesperidin, and quercetin significantly ameliorated the impaired oral glucose tolerance; the elevated serum fructosamine level; the diminished serum insulin and C-peptide levels; the altered HOMA-IR, HOMA-IS, and HOMA-β cell function; the decreased liver glycogen content; the increased liver glucose-6-phosphatase and glycogen phosphorylase activities; the deleteriously affected serum lipid profile; the elevated serum AST and ALT activities; and the raised serum creatinine and urea levels in the diabetic rats. The treatments also produced remarkable improvement in the antioxidant defense system manifested by a decrease in the elevated liver lipid peroxidation and an increase in the lowered glutathione content and GPx, GST, and SOD activities. Furthermore, the three treatments enhanced the mRNA expression of GLUT-4 and the insulin receptor β-subunit, but only quercetin produced a significant increase in the expression of adiponectin in adipose tissue of diabetic rats. In conclusion, C. reticulata fruit peel hydroethanolic extract, hesperidin, and quercetin have potent antidiabetic effects which may be mediated through their insulinotropic effects and insulin-sensitizing actions. In addition, the alleviation of the antioxidant defense system by the extract, hesperidin, and naringin may have an important action to enhance the antidiabetic actions and to improve liver and kidney functions in NA/STZ-induced diabetic rats.
1. Introduction
Diabetes mellitus (DM), one of the most common diseases in the world, results from impairments in insulin secretion and/or insulin action leading to disturbances in the metabolism of carbohydrates, lipids, and proteins [1, 2]. The American Diabetes Association (ADA) has classified DM into type 1 DM (T1DM), type 2 DM (T2DM), gestational DM (GDM), and many other specific types of diabetes [3]. T2DM is much more prevalent in humans than T1DM and is responsible for 90% of DM incidence [4, 5]. The main reasons for T2DM are impaired tissue insulin sensitivity and insulin resistance which was coupled to pancreatic β-cell dysfunction [6–8]. Many experimental animal models of T2DM were applied by several publications to validate the use of new therapies and to elucidate the underlying molecular mechanism(s) of action of the tested drugs [9, 10].
Nicotinamide (NA)/streptozotocin- (STZ-) induced DM is the most commonly used animal model of T2DM in rats. STZ, an antibiotic drug formed by Streptomyces achromogenes, has damaging effects on the β-cells in the islets of Langerhans [11–13]. Many reports stated that the damaging effect of STZ on β-cells of pancreatic islets is caused by the stimulation of oxidative stress and suppression of antioxidant defense [14–16]. Furthermore, the intracellular biotransformation of STZ results in the production of nitric oxide (NO) which speeds up the formation of DNA strand breaks, leading to β-cells’ necrosis [17]. NA injection before STZ in this DM-induced model, on the other hand, partially counteracts the destructive effect of STZ on β-cells, and it leads to the loss of the early phase of glucose stimulation of insulin secretion which is a feature of T2DM [18–20]. It was also proven by many investigators that in NA/STZ-induced DM, there are both impairment in insulin secretion and insulin resistance, which is a characteristic feature of T2DM [21–23].
The search for suitable antihyperglycemic agents from natural sources has been focused on plants applied in traditional medicines partly because they have lower side effects than the currently used conventional drugs [24]. Recently, there is an increased interest in the medical benefits of flavonoids because their supplementation seems to be accompanied by reduced risks for certain severe maladies and increased survival as stated by previous publications [25–27]. Citrus fruit peels, i.e., the outer layers of many fruits including lemons, oranges, mandarins, and grapefruits, have been demonstrated to be rich in flavonoid content [27–30]. Flavonoids found in citrus fruits were mainly allocated to three classes: flavanones, flavones, and flavonols [31].
Citrus reticulata (C. reticulata) or tangerine fruit peels have been shown to contain high concentrations of three flavanones: hesperidin, naringin, and narirutin [32]. Citrus peel also contains good quantities of flavonol and quercetin [33]. Hesperidin, a glycosylated flavanone of hesperetin, has been reported by Constantin et al. [34] and Parhiz et al. [35] to decrease intestinal glucose absorption and inhibit the gluconeogenic pathways, thereby leading to antihyperglycemic actions in diabetic human beings. Quercetin, a principal flavonol found in citrus fruits especially in fruit peels, was found to have antidiabetic actions in diabetic animal models at doses of 10, 25, and 50 mg/kilogram body weight (kg b.w.) [36]. It is a glycone of rutin, and it is a parent compound of a number of various flavonoids [37, 38]. Although the antidiabetic effects of hesperidin and quercetin were reported by some publications, the mechanisms of their antidiabetic actions are not fully elucidated. In addition, further investigations are needed to assess their comparative effects with the crude extract of C. reticulata fruit peel.
Therefore, the present study was conducted to assess the comparative antihyperglycemic, antihyperlipidemic, and antioxidant effects of C. reticulata fruit peel hydroethanolic extract, hesperidin, and quercetin in NA/STZ-induced DM in Wistar rats and to suggest their mechanisms of action.
2. Materials and Methods
2.1. Experimental Animals
Adult male rats of Wistar strain weighing about 130-150 g and aged 10-12 weeks were used in the present experimental research work. The animals were supplied from the animal house of the National Research Center (NRC), El-Tahrir Street, Dokki, Giza, Egypt. They were maintained under strict care for about 10 days before the start of the experiment to exclude any intercurrent infection. The rats were housed in clean polypropylene cages (six rats/cage) with a well-aerated standard stainless steel frame and wood mulch at the bottom of cage. The rats were maintained under normal controlled atmospheric temperature (), humidity (), and daily normal 12-hour (hr) light/dark cycle. Moreover, they had free access to water and were provided daily with standard pelleted chow diet ad libitum. All animal procedures were in accordance with the guidelines and recommendations of the Experimental Animal Ethics Committee for Use and Care of Animals, Faculty of Science, Beni-Suef University, Egypt (ethical approval number is BSU/FS/2015/14). All instructions were followed, and all precautions were considered to minimize discomfort, distress, and pain of rats under investigations.
2.2. Drugs and Chemicals
STZ (2-deoxy-2-(3-methyl-3-nitrosoureido)-D-glycopyranoside), NA, hesperidin, and quercetin were obtained from Sigma-Aldrich Chemical Company, St. Louis, MO, USA. NA, hesperidin, and quercetin were kept at 2–4°C, while STZ was stored at -20°C. All other used chemicals were of analytical grade and were commercially obtained.
2.3. Extract Preparation of C. reticulata Fruit Peel
C. reticulata or tangerine fruits were purchased from the local market at Beni-Suef Governorate, Egypt. The purchased fruits were manually flaked and were cleaned by washing with running water till completely clean. The washed peels were then dried in a good aerated area. Then, the dried peels were ground to a powder by an electric mortar. The finely obtained powder (0.5 kg) was drenched in 70% ethanol for 3 days. The mixture was filtered by using a Whatman No. 2 filter paper for removal of peel particles. The water and ethanol were vaporized by a Rotavapor to obtain a semisolid viscous mass which was stored in dark bottles in a deep freezer at -30°C pending its use for the treatment.
2.4. Gas Chromatography-Mass Spectrometry (GC-MS) Analysis
Chemical analysis of C. reticulata peel hydroethanolic extract was performed in the Central Laboratory of the Faculty of Postgraduate Studies for Advanced Sciences, Beni-Suef University, Egypt, by using the Gas Chromatography (GC) System 7890A/5975C Inert Mass Spectrometry (MS) with a Triple Axis Detector, Agilent Technologies, Germany. The constituents were recognized by comparing their mass spectra with the spectra of derivatives in the Library Search Report (C:\Database\NIST11.L; C:\Database\demo.l) as well as in the NIST08s, WILEY8, and FAME libraries.
2.5. High-Performance Liquid Chromatography- (HPLC-) Mass Spectrometry (MS) Analysis
HPLC-MS analysis of C. reticulata fruit peel hydroethanolic extract was performed in the Central Laboratory of the Faculty of Postgraduate Studies for Advanced Sciences, Beni-Suef University, Egypt, by using the HPLC-MS system, 1260 Infinity, Agilent Technologies, Germany coupled with a Diode Array Detector (DAD). Standards including gallic acid, naringin, quercetin, hesperidin, nobiletin, and tangeretin were used to identify their peaks in the HPLC-MS chromatogram. The C. reticulata fruit peel hydroethanolic extract was dissolved in water : methanol (80 : 20 /) at a concentration of 10 mg/3 ml and filtered with a 0.45 μm filter, before injection of 20 μl into the HPLC system. Spectral UV data from all peaks were collected in the range of 240-400 nm, and chromatograms were recorded at 340 and 270 nm according to the method of Negri et al. [39].
2.6. Induction of T2DM
Experimental T2DM was induced in male Wistar rats, fasted for 16 hours (hrs), by a single intraperitoneal (i.p.) injection of STZ at a dose level of 50 mg STZ/kg b.w. (dissolved in citrate buffer of pH 4.5), 15 minutes after the i.p. injection of 120 mg NA/kg b.w. [40]. Ten days after NA/STZ injection, overnight-fasted rats were orally supplemented with glucose (3 g/kg b.w.) by oral gavage. After 2 hrs of oral glucose administration, blood samples taken from the lateral tail vein were left to coagulate and then centrifuged. Thereafter, serum glucose level was detected. After screening of serum glucose levels, the rats which have serum glucose levels of 180-300 mg/dl after 2 hrs of oral glucose loading were considered mildly diabetic and were included in the experiment. Rats with serum glucose levels outside this range were excluded.
2.7. Experimental Design
The rats included in the experiment were divided into five groups, each group comprising six rats as follows: (1)Group 1 was regarded as the normal control group and received the equivalent volume of the vehicle, 1% carboxymethyl cellulose (CMC), by oral gavage daily for four weeks(2)Group 2 was regarded as the diabetic control group and received the equivalent volume of 1% CMC by oral gavage daily for four weeks(3)Group 3 served as diabetic rats that were treated with C. reticulata fruit peel hydroethanolic extract at a dose level of 100 mg in 5 ml 1% CMC/kg b.w./day [41], by oral gavage, for four weeks(4)Group 4 served as diabetic rats that were treated with hesperidin (Sigma-Aldrich Chemical Company, MO, USA), at a dose level of 100 mg (dissolved in 5 ml 1% CMC)/kg b.w./day, by oral gavage, for four weeks [42].(5)Group 5 served as diabetic rats that were treated with quercetin (Sigma-Aldrich Chemical Company, MO, USA), at a dose level of 100 mg (dissolved in 5 ml 1% CMC)/kg b.w./day, by oral gavage, for four weeks [43].
Each week, the dose was adjusted according to the alterations in b.w. to stabilize the correct dose per kg b.w. of rats during the entire period of the experiment.
2.8. Blood and Tissue Sampling
At the day before decapitation, an oral glucose tolerance test (OGTT) was performed for all individual rats. Blood samples were withdrawn from the lateral tail veins of overnight-fasted rats at 30, 60, 90, and 120 minutes following the oral glucose loading (3 g/kg b.w.), left to clot, and centrifuged at 4000 rounds per minute (rpm) for 15 minutes. After that, sera were quickly collected for the detection of serum glucose levels.
A day following OGTT, the overnight-fasted animals were anaesthetized by diethyl ether inhalation anaesthesia and blood samples were obtained from the jugular vein. Then, after decapitation by cervical dislocation, rats were dissected and liver, visceral adipose tissue, and pancreas were excised and perfused in saline. The blood from each rat was collected in gel and clot activator tubes and centrifuged at 4000 rpm for 15 minutes. The obtained sera were stored in a deep freezer at -30°C until they were used for biochemical detection. The liver was kept in a deep freezer at -30°C pending its use for the determination of liver glycogen content and homogenization in saline (2% /). Pieces of visceral adipose tissue (3 mm³) were kept in a deep freezer at -70°C pending their use in RNA isolation and RT-PCR analysis. Pancreas from each rat was fixed in 10% neutral buffered formalin and transferred to the Pathology Department, National Cancer Institute (NCI), Cairo University, Cairo, Egypt, for processing, blocking in wax, sectioning, and staining with the trichrome PAS method.
2.9. Biochemical Assays
Serum glucose level was determined based on the method of Trinder [44] by a reagent kit obtained from Randox Laboratories, United Kingdom (UK). Serum fructosamine level was determined according to the method of Baker et al. [45]. Serum insulin and C-peptide levels were determined by an ELISA kit obtained from Linco Research Inc., USA, according to the manufacturer’s instruction. Homeostasis model assessment of insulin resistance (HOMA-IR), homeostasis model assessment of insulin sensitivity (HOMA-IS), and homeostasis model assessment of β-cell function (HOMA-β cell function) were calculated according to the equations described by Mishra et al. [46] and Aref et al. [47]. The measurement of serum total cholesterol (TC) and HDL-cholesterol (HDL-C) levels was performed based on the publication of Allain et al. [48], using a reagent kit obtained from Randox Laboratories (UK). Serum triglyceride (TG) level was determined based on the method of Finley and Tietz [49]. Serum LDL-cholesterol (LDL-C) level was determined based on Friedewald et al.’s [50] formula (). Serum vLDL-cholesterol (vLDL-C) was calculated based on Norbert’s [51] formula (). FFA level in serum was estimated based on the publication of Duncombe [52]. Aspartate transaminase (AST) and alanine transaminase (ALT) activities in serum were measured, respectively, based on the publication of Gella et al. [53], by reagent kits delivered from Randox Laboratories (UK). Serum creatinine and urea levels were determined by using kits obtained from Biosystems S.A. (Spain) according to the methods of Fabiny and Ertingshausen [54] and Tabacco et al. [55], respectively.
Liver glycogen content was estimated based on the procedure of Seifter et al. [56]. Glucose-6-phosphatase (G-6-Pase) and glycogen phosphorylase activities in liver homogenates were assayed based on the procedures of Kabir and Begum [57] and Stalmans and Hers [58], respectively.
Liver lipid peroxidation (LPO) was estimated by malondialdehyde (MDA) detection based on the publication of Preuss et al. [59]. Liver glutathione (GSH) content was detected based on the publication of Beutler et al. [60]. Liver glutathione peroxidase (GPx) and glutathione-S-transferase (GST) activities were detected based on the procedures of Matkovics et al. [61] and Mannervik and Gutenberg [62], respectively. The enzyme SOD activity in liver was measured based to the procedure of Marklund and Marklund [63].
2.10. Histological Investigation
Pancreatic tissues fixed in 10% neutral buffered formalin were transferred to the Pathology Department, National Cancer Institute, Cairo University, Cairo, Egypt, for processing, which included embedding in paraffin wax, sectioning at 5 μm thickness, and staining with a modified aldehyde fuchsin stain method according to Bancroft and Stevens [64].
2.11. RNA Isolation and RT-PCR Analysis
The total RNA was isolated from visceral adipose tissue by the GeneJET RNA Purification Kit obtained from Thermo Scientific Verso 1-Step RT-PCR ReddyMix Kit, Thermo Fisher Scientific Inc., USA according to the publications of Chomzynski and Sacchi [65] and Boom et al. [66]. The levels of isolated RNA were determined and quantified using an ultraviolet (UV) spectrophotometer and taking the absorbances at optical densities (OD) of 260 nm and 280 nm. RNA was quantified and qualified based on Finley and Tietz’s [49] formula ().
For each extracted RNA sample, the ratio was between OD at 260 nm and OD at 280 nm and the ratio ranged between 1.7 and 2.0 to ensure the high purity of extracted RNA. Thermo Scientific Verso 1-Step RT-PCR ReddyMix was applied for the synthesis of cloned DNA (cDNA) which, in turn, was amplified by using specific forward and reverse primers by 32 Techne thermal cyclers. The primer pair sequences are as follows: GLUT-4—forward: 5 GCTGTGCCATCTTGATGACGG 3 and reverse: 5 TGAAGAAGCCAAGCAGGAGGAC 3 [1]; insulin receptor β-subunit (IRβ)—forward: 5 CTGGAGAACTGCTCGGTCATT 3 and reverse: 5 GGCCATAGACACGGAAAAGAAG 3 [67]; adiponectin—forward: 5 AATCCTGCCCAGTCATGAAG 3 and reverse: 5 TCTCCAGGAGTGCCATCTCT 3 [68, 69]); and β-actin—forward: 5 TCACCCTGAAGTACCCCATGGAG 3 and reverse: 5 TTGGCCTTGGGGTTCAGGGGG 3 [70]).
2.12. Statistical Analysis
The obtained individual data were statistically analyzed by one-way analysis of variance (ANOVA) using the PC-STAT program, University of Georgia, followed by the Least Significance Difference (LSD) test to compare various groups with each other [71]. -probability for the detected parameter represents the general effects between groups. All data are represented as , and significant changes were calculated at and for LSD and at , , and for -probabilities.
3. Results
3.1. GC-MS Analysis of C. reticulata Peel Hydroethanolic Extract
The GC-MS analysis (Table 1 and Figure 1) indicated the presence multiple phytochemicals. The main constituents and groups which have a concentration of more than 1% of the total include 4H-pyran-4-one (a cyclic nucleus in the chemical structure of quercetin, naringin, hesperetin, nobiletin tangeretin, etc.), 2,3-dihydro-3,5-dihydroxy-6-methyl-; 5-hydroxymethylfurfural; 4-hexen-3-one, 4,5-dimethyl; phenol, 4-ethyl-; benzaldehyde, 4-hydroxy-; benzaldehyde, 2-hydroxy-; 3,3,4,5,5,7,8-heptamethoxyflavone; 4h-1-benzopyran-4-one, 2-(3,4-dimethoxyphenyl)-5,6,7-trimethoxy-; and β-D-glucopyranose, 4-O-β-D-galactopyranosyl-; n-hexadecanoic acid; tridecanoic acid; 9,12-octadecadienoic acid (Z,Z)-; (Z)6,(Z)9-pentadecadien-1-ol; 9,12,15-octadecatrien-1-ol, (Z,Z,Z)-; 9,12,15-octadecatrien-1-ol, (Z,Z,Z)-; 9-octadecenamide, (Z)-.
Number
Retention time
Compound (from the central Library Search Report)
Area % (higher than 1%)
1
15.282
(i) No matches in library
3.50%
2
16.556
(i) 4H-Pyran-4-one, 2,3-dihydro-3,5-dihydroxy-6-methyl-
3.55%
3
17.906
(i) No matches in library
1.13%
4
18.080
(i) No matches in library
2.14%
5
18.579
(i) 5-Hydroxymethylfurfural
(ii) 4-Hexen-3-one, 4,5-dimethyl-
17.74%
6
18.981
(i) No matches in library
1.57%
7
19.803
(i) No matches in library
2.65%
8
20.241
(i) No matches in library
1.84%
9
21.329
(i) Phenol, 4-ethyl-
(ii) Benzaldehyde, 4-hydroxy-
(iii) Benzaldehyde, 2-hydroxy-
1.00%
10
27.047
(i) 3,3,4,5,5,7,8-heptamethoxyflavone
1.78%
11
27.356
(i) 4h-1-benzopyran-4-one, 2-(3,4-dimethoxyphenyl)-5,6,7-trimethoxy-
(ii) β-D-Glucopyranose, 4-O-β-D-galactopyranosyl-
3.00
12
29.940
(i) Dodecane
1.29%
13
32.898
(i) n-Hexadecanoic acid
(ii) Tridecanoic acid
2.88%
14
34.964
(i) 9,12-Octadecadienoic acid (Z,Z)-
2.37%
15
35.033
(i) 9,12,15-Octadecatrienoic acid, (Z,Z,Z)-
(ii) (Z)6,(Z)9-Pentadecadien-1-ol
(iii) 9,12,15-Octadecatrien-1-ol, (Z,Z,Z)-
2.46%
16
37.253
(i) 9-Octadecenamide, (Z)-
1.34%
Hesperidin is a flavonoid glycoside with proven therapeutic activities for various diseases, including cancer. However, its poor solubility and bioavailability render it only slightly absorbed, requiring a delivery system to reach its therapeutic target. Hesperidin loaded on gold nanoparticles (Hsp-AuNPs) was prepared by a chemical synthesis method. Various characterization techniques such as UV-VIS spectroscopy, FTIR, XRD, FESEM, TEM and EDX, Zeta potential analysis, particle size analysis, were used to confirm the synthesis of Hsp-AuNPs. The cytotoxic effect of Hsp-AuNPs on human breast cancer cell line (MDA-MB-231) was assessed using MTT and crystal violet assays. The results revealed significant decrease in proliferation and inhibition of growth of the treated cells when compared with human normal breast epithelial cell line (HBL-100). Determination of apoptosis by fluorescence microscope was also performed using acridine orange-propidium iodide dual staining assay. The in vivo study was designed to evaluate the toxicity of Hsp-AuNPs in mice. The levels of hepatic and kidney functionality markers were assessed. No significant statistical differences were found for the tested indicators. Histological images of liver, spleen, lung and kidney showed no apparent damages and histopathological abnormalities after treatment with Hsp-AuNPs. Hsp-AuNPs ameliorated the functional activity of macrophages against Ehrlich ascites tumor cells-bearing mice. The production of the pro-inflammatory cytokines was also assessed in bone marrow–derived macrophage cells treated with Hsp-AuNPs. The results obviously demonstrated that Hsp-AuNPs treatment significantly inhibited the secretion of IL-1β, IL-6 and TNF.
Glaucoma is well-known clinical eye conditions that damage the optic nerve due to abnormal pressure conditions in eye. Hesperidin is well-known glycoside widely present in the citrus fruits, and its aglycone form is known as hesperetin. Hesperidin is major flavone found in orange fruits. Hypotensive effect of hesperidin in acute and chronic glaucoma rats, glutamate level in vitreous humour and glutathione (GSH) level in aqueous humour were determined following 25, 50 and 100 mg/kg of hesperidin treatment. Acetazolamide (5 mg/kg) was used as positive control. Hesperidin treatment significantly reduced the increased intraocular pressure (IOP) level in dextrose induced ocular hypertension than saline treated rats. The effect of hesperidin was comparable to the positive control acetazolamide. Similarly, hesperidin treatment significantly reduced the IOP level in prednisolone acetate induced ocular hypertension than saline treated rats. In the aqueous humour, hesperidin treatment increased the glutathione level 125%, 184.4% and 231.2% at 25, 50 and 100 mg/kg of hesperidin respectively. In the vitreous humour, hesperidin treatment reduced the glutamate level 9.9%, 13.2% and 25.3% at 25, 50 and 100 mg/kg of hesperidin respectively. Histopathological analysis of normal saline treated rats showed morphological alteration in ciliary bodies. However, rats treated with hesperidin showed the reduced level of morphological alteration in ciliary bodies. Taking all these data together, it is suggested that the hesperidin supplementation was effective against glaucoma in experimental rats.
PurposeThe aim of the present study was to compare the clinical effect of flaxseed and hesperidin alone and with combination in patients with metabolic syndrome. Number of participants with treated metabolic syndrome was assessed as a primary end point.Methods
In this 12-week randomized controlled trial, ninety-eight patients with metabolic syndrome randomly assigned to receive either whole flaxseed powder (30 g/day), or hesperidin (1 g/day), or combination of 30 g flaxseed and 1 g hesperidin or no supplement while adhering a lifestyle modification program.ResultsIn comparison to control group, systolic blood pressure (− 5.68 vs. − 2.91 mmHg, P = 0.041) and serum concentrations of triglyceride (− 50.06 vs. 3.87 mg/dL, P = 0.033) in hesperidin group showed a significant reduction over 12 weeks of intervention. Comparison of the results of flaxseed group with the control group showed a significant improvement in serum concentrations of triglyceride (− 66 vs. 3.87 mg/dL, P = 0.028), insulin (− 4.27 vs. − 2.51 mU/L, P = 0.003) and accordingly insulin resistance (− 1.19 vs. − 0.76, P = 0.005) and sensitivity (0.03 vs. 0.01, P = 0.022) indices in flaxseed group. Combination of flaxseed and hesperidin improved three of five metabolic syndrome components including serum concentrations of triglyceride, glucose and systolic blood pressure as compared to placebo. Interestingly, co-administration of flaxseed and hesperidin with 77.3% reduction in the prevalence of defined metabolic syndrome was revealed to be most effective in controlling the metabolic syndrome, after which the group of flaxseed with 76% reduction and hesperidin group with 54.5% reduction were ranked second and third, respectively.Conclusions
It can be concluded that co-administration of flaxseed and hesperidin appears to be superior to either supplementation alone on metabolic syndrome treatment, while the effects of flaxseed are stronger than hesperidin supplementation.
Hesperidin belongs to flavanones class of flavonoids and is known to possess broad-spectrum applicability to prevent dreadful diseases such as cardiovascular disease, neurodegeneration, and cancer. The reported anticancer effects of hesperidin have been found to be associated with its anti-oxidant and anti-inflammatory activities. Hesperidin interacts with numerous recognized cellular targets and inhibits cancer cell proliferation by inducing apoptosis and cell cycle arrest. In addition, evidence has suggested its promising role in inhibiting tumor cell metastasis, angiogenesis, and chemoresistance. The present mini-review highlights the ongoing development to identify hesperidin targets in cancer. Furthermore, the potential of nano technology-based hesperidin combinations and delivery systems will also be discussed. Overall, this review highlights all the possible molecular targets affected by hesperidin in tumor cells on a single platform.
Impact statement
Experimental findings from numerous studies have demonstrated the anticancer effects of hesperidin (Hesp) to be associated with anti-oxidant and anti-inflammatory activities along with its potential role in inhibiting the tumor cell metastasis and angiogenesis. Additionally, Hesp can also reverse drug resistance of cancer cells, which make it a promising candidate to be used in combination with existing anti-cancer drugs. This review will be helpful for upcoming researchers and scientific community to find out complete capsular package about cancer drug targets of Hesp and its role in modulating various important hallmarks of cancer.
Programmed death ligand 1 (PD-L1) is overexpressed in the most aggressive breast cancer subtype, triple-negative breast cancer (TNBC), assisting the eradication of antitumor immunity, and thereby enhancing the survival of the tumor. This study explored how hesperidin affects PD-L1 expression, and thereby cancer progression in breast cancer cells. We found that MDA-MB231, the triple-negative breast adenocarcinoma cancer cell line, (high aggressiveness) has higher expression, in both mRNA and protein, of PD-L1 than that of the other breast cancer cell line, MCF-7 (low aggressiveness). Hesperidin inhibited cell proliferation in MDA-MB231 cells. Additionally, high expression of PD-L1 (both mRNA and protein) in aggressive cancer cells was strongly inhibited by hesperidin through inhibition of Akt and NF-κB signaling. Moreover, hesperidin treatment, by inhibiting activation of matrix metalloproteinases such as MMP-9 and MMP-2, suppressed the metastatic phenotype and cell migration in the PD-L1 high-expressing MDA-MB231 cells. In summary, hesperidin inhibits breast cancer cell growth through the inhibition of the expression of PD-L1 via downregulation of Akt and NF-κB signaling in TNBC. Moreover, hesperidin significantly suppresses cell migration of MDA-MB231 cells. Our findings reveal fresh insights into the anticancer effects of hesperidin which might have potential clinical implications.
Citrus species contain significant amounts of flavonoids that possess antioxidant activities; furthermore, dietary citrus is not associated with adverse effects or cytotoxicity in healthy individuals. Hesperidin, which is an abundant flavanone glycoside in the peel of citrus fruits, possesses a variety of biological capabilities that include antioxidant and anti-inflammatory actions. Over the last few decades, many studies have been investigated the biological actions of hesperidin and its aglycone, hesperetin, as well as their underlying mechanisms. Due to the antioxidant effects of hesperidin and its derivatives, the cardioprotective and anti-cancer effects of these compounds have been widely reviewed. Although the biological activities of hesperidin in neurodegenerative diseases have been evaluated, its potential involvement in a variety of central nervous system (CNS) disorders, including autoimmune demyelinating disease, requires further investigation in terms of the underlying mechanisms. Thus, the present review will focus on the potential role of hesperidin in diverse models of CNS neuroinflammation, including experimental autoimmune encephalomyelitis, with special consideration given to its antioxidant and anti-inflammatory effects in neurodegenerative disease models. Additionally, current evidence provides information regarding the nutraceutical use of hesperidin to prevent various CNS disorders.
Purpose
Hesperidin as an antioxidant flavonoid exerts anti-adipogenic, anti-inflammatory, anti-oxidant and anti-hypercholesterolemic effects. Besides, the increasing prevalence of metabolic syndrome (MetS) and its allied complications, on the one hand, and the willingness of individuals to use natural products for curing their diseases, on the other hand, led to the design of this study to evaluate the efficacy of hesperidin in normalizing the metabolic abnormalities in patients with MetS.
Methods
In this clinical trial with a parallel-group design, 49 patients with MetS received either 500-mg hesperidin or placebo, twice daily, for 12 weeks. Number of participants with treated MetS was considered as a primary end point. Anthropometric parameters, dietary intake, physical activity, lipid profile, glucose homeostasis parameter, tumor necrosis factor alpha (TNF-α), high-sensitivity C-reactive protein (hs-CRP) were assessed at the beginning and at the end of the study. This trial is registered at clinicaltrials.gov as NCT03734874.
Results
Compared with the placebo group, hesperidin decreased fasting glucose level (− 6.07 vs. − 13.32 mg/dL, P = 0.043), triglyceride (− 8.83 vs. − 49.09 mg/dL, P = 0.049), systolic blood pressure (− 0.58 vs. − 2.68 mmHg, P = 0.048) and TNF-α (− 1.29 vs. − 4.44 pg/mL, P = 0.009). Based on the within-group analysis, hesperidin led to significant decrease in serum levels of glucose, insulin, triglyceride, total cholesterol, low density lipoprotein cholesterol, TNF-α and hs-CRP, while in control group only glucose and insulin significantly decreased.
Conclusions
The results indicate that hesperidin supplementation can improve metabolic abnormalities and inflammatory status in patients with MetS.
Obesity is a chronic metabolic disease caused by multiple factors and is considered to be a risk factor for type 2 diabetes, cardiovascular disease, hypertension, stroke and various cancers. Hesperidin, a flavanone glycoside, is a natural phenolic compound with a wide range of biological effects. Mounting evidence has demonstrated that hesperidin possesses inhibitory effect against obesity diseases. Our review discusses mechanisms of hesperidin in the treatment of obesity. Hesperidin regulates lipid metabolism and glucose metabolism by mediating AMPK and PPAR signaling pathways, directly regulates antioxidant index and anti-apoptosis, and indirectly mediates NF-κB signaling pathway to regulate inflammation to play a role in the treatment of obesity. In addition, hesperidin-enriched dietary supplements can significantly improve symptoms such as postprandial hyperglycemia and hyperlipidemia. Further clinical trials are also required for confirming lipid-lowering efficacy of this natural flavonoid and evaluating its safety profile.
Conventional chemotherapeutics exploration is hampered due to their nonspecific distribution leading to unintended serious toxicity. Toxicity is so severe that deciding to go for chemotherapy becomes a question of concern for many terminally ill cancer patients. However, with evolving times nanotechnology assisted in reducing the haywire distribution and channelizing the movement of drug-enclosing drug delivery systems to cancer cells to a greater extent, yet toxicity issues still could not be obliterated. Thus, active targeting appeared as a refuge, where ligands actively or specifically deliver linked chemotherapeutics and carriers to cancer cells. For a very long time, large molecule weight/macromolecular ligands (peptides and big polymers) were considered the first choice for ligand-directed active cancer targeting, due to their specificity towards overexpressed native cancer receptors. However, complex characterization, instability, and the expensive nature demanded to reconnoitre better alternatives for macromolecule ligands. The concept of small molecules as ligands emerged from the idea that few chemical molecules including chemotherapeutics have a higher affinity for cancer receptors, which are overexpressed on cell membranes, and may have the ability to assist in drug cellular uptake through endocytosis. But now the question is, can they assist the conjugated macro cargos to enter the cell or not? This present review will provide a holistic overview of the small molecule ligands explored till now.
Drug development is a time‐consuming, expensive and extremely risky procedure. Up to 90% of drug concepts are discarded due to challenges such as safety, efficacy and toxicity resulting in significant losses for the investor. The use of artificial intelligence (AI), namely machine learning and deep learning algorithms, to improve the drug discovery process is one technique that has arisen in recent years. AI has been effectively used in drug discovery and design. This chapter includes these machine learning approaches in depth, as well as their applications in medicinal chemistry. The current state‐of‐the‐art of AI supported pharmaceutical discovery is discussed, including applications in structure and ligand‐based virtual screening, de novo drug design, drug repurposing, and factors related, after introducing the basic principles, along with some application notes, of the various machine learning algorithms. Finally, obstacles and limits are outlined, with an eye towards possible future avenues for AI‐supported drug discovery and design.
Abstract
Neurological disorders are the foremost occurring diseases across the globe resulting in progressive dysfunction, loss of neuronal structure ultimately cell death. Therefore, attention has been drawn toward the natural resources for the search of neuroprotective agents. Plant-based food bioactives have emerged as potential neuroprotective agents for the treatment of neurodegenerative disorders. This comprehensive review primarily focuses on various plant food bioactive, mechanisms, therapeutic targets, in vitro and in vivo studies in the treatment of neurological disorders to explore whether they are boon or bane for neurological disorders. In addition, the clinical perspective of plant food bioactives in neurological disorders are also highlighted. Scientific evidences point toward the enormous therapeutic efficacy of plant food bioactives in the prevention or treatment of neurological disorders. Nevertheless, identification of food bioactive components accountable for the neuroprotective effects, mechanism, clinical trials, and consolidation of information flow are warranted. Plant food bioactives primarily act by mediating through various pathways including oxidative stress, neuroinflammation, apoptosis, excitotoxicity, specific proteins, mitochondrial dysfunction, and reversing neurodegeneration and can be used for the prevention and therapy of neurodegenerative disorders. In conclusion, the plant based food bioactives are boon for neurological disorders.
Keywords:
Bioactives
neurodegeneration
targets
mechanism
preclinical
Background
Emerging studies indicate that hypericin has diverse pharmacological actions and exhibits potential for treatment of various types of cancer.
Purpose
The current review evaluates the pharmacological activity, associated molecular mechanism, and therapeutic application of hypericin as an anticancer agent according to the most recent state of knowledge with special emphasis on clinical trials and safety profile.
Method
This review follows The Preferred Reporting Items for Systematic Reviews criteria. Various databases, including PubMed, Scopus and Science Direct, were used to search and collect relevant literature. The major keywords used included the following: cancer, distribution, property, signaling pathway, pharmacological effect, treatment, prevention, in vitro and in vivo studies, toxicity, bioavailability, and clinical trials.
Results
One hundred three articles met the established inclusion and exclusion criteria. Hypericin has shown anticancer activity against the expansion of several cell types including breast cancer, cervical cancer, colorectal cancer, colon cancer, hepatocellular carcinoma, stomach carcinoma, leukemia, lung cancer, melanoma, and glioblastoma cancer. Hypericin exerts its anticancer activity by inhibiting pro-inflammatory mediators, endothelial growth factor, fibroblast growth factor, cell adhesion, angiogenesis, and mitochondrial thioredoxin. It has also been shown to cause an increase in the levels of caspase-3 and caspase-4, arrest the cell cycle at metaphase leading to cancer cell apoptosis, and affect various protein and gene expression patterns.
Conclusion
Hypericin exhibits significant inhibitory activity against various types of in vitro and in vivo cancer models. However, well-designed, high quality, large-scale and multi-center randomized clinical studies are required to establish the safety and clinical utility of hypericin in cancer patients.
Background:
Curcumin, a natural polyphenol from Curcuma longa, is known to possess diversified pharmacological roles including anti-inflammatory, antioxidant, antiproliferative and antiangiogenic properties; however, its bioavailability is severely limited due to its poor solubility, poor absorption, rapid metabolism, and significant elimination. Hydrazinocurcumin (HZC), a novel analogue of curcumin has been reported to overcome the limitations of curcumin and also possesses multiple pharmacological activities. The present study aimed to evaluate the unexplored pharmacokinetic profile of this agent in experimental rats.
Methods:
Drug formulations were administered to the experimental animals via oral, intravenous and intraperitoneal routes. Blood samples were collected at different pre-determined time intervals to determine the pharmacokinetic parameters. To understand the biodistribution profile of HCZ, tissue samples were isolated from different groups of Sprague-Dawley rats at different time points. The pharmacokinetic parameters of HZC were evaluated after administration through oral (100 mg/kg), intraperitoneal (100 mg/kg) and intravenous (10 mg/kg) routes.
Results:
Significantly (p < 0.05) higher total AUC along with maximum concentration were evident with intraperitoneal administration when compared to the results of oral administration at a similar dose. In addition, shorter time to peak was observed with intraperitoneal administration. These results revealed a faster rate and longer duration of absorption with intraperitoneal administration, which further resulted in enhanced absolute bioavailability of HZC (29.17%) when compared to 5.1% upon oral dosing. The obtained data from the pharmacokinetic study indicated that HZC was instantaneously distributed and moderately eliminated from body fluids.
Conclusion:
Based on the findings, it could be concluded that absorption of HZC is much higher via intraperitoneal route of administration compared to the oral administration.
Hesperidin, a phytoactive compound, is an abundant and economical dietary bioflavonoid possessing numerous biological and medicinal benefits. Several studies have strongly proven the significant chemotherapeutic potential of hesperidin. Therefore this review is an effort to bring together the existing studies demonstrating hesperidin as a potential anticancer agent with its mode of action reported in the therapeutic strategies for numerous cancer types. Hesperidin acts via modulating multiple pathways involving cell cycle arrest, apoptosis, antiangiogenic, antimetastatic and DNA repair in various cancer cells. Hesperidin has been reported to alter several molecular targets related to carcinogenesis, such as reactive nitrogen species, cellular kinases, transcription factors, reactive oxygen species, drug transporters, cell cycle mediators and inflammatory cytokines. Altogether, this review provides significant insights for the potential of hesperidin to be a strong and promising candidate for pharmaceuticals, functional foods, dietary supplements, nutraceuticals and geared toward the better management of carcinoma.
High blood pressure is one of the most important risk factors for ischaemic heart disease, stroke, other cardiovascular diseases, chronic kidney disease and dementia. Mean blood pressure and the prevalence of raised blood pressure have declined substantially in high-income regions since at least the 1970s. By contrast, blood pressure has risen in East, South and Southeast Asia, Oceania and sub-Saharan Africa. Given these trends, the prevalence of hypertension is now higher in low-income and middle-income countries than in high-income countries. In 2015, an estimated 8.5 million deaths were attributable to systolic blood pressure >115 mmHg, 88% of which were in low-income and middle-income countries. Measures such as increasing the availability and affordability of fresh fruits and vegetables, lowering the sodium content of packaged and prepared food and staples such as bread, and improving the availability of dietary salt substitutes can help lower blood pressure in the entire population. The use and effectiveness of hypertension treatment vary substantially across countries. Factors influencing this variation include a country’s financial resources, the extent of health insurance and health facilities, how frequently people interact with physicians and non-physician health personnel, whether a clear and widely adopted clinical guideline exists and the availability of medicines. Scaling up treatment coverage and improving its community effectiveness can substantially reduce the health burden of hypertension.
Hyperlipidemia is one of the leading causes of, atherosclerosis, and cardiovascular disease. In this study, we evaluated the protective role of hesperidin (HES) against lipidemic stress in a hyperlipidemic model of rats. We developed a hyperlipidemic model of the rat through an i.p dose of poloxamer-407, 0.5 g/kg body weight for 3 alternative days in a week for 30 days and rats were supplemented with HES orally (100 mg/kg body weight) once daily. Bodyweight, fasting glucose, insulin, HOMA-IR index, triglyceride, cholesterol, ROS, FRAP, GSH, PMRS, AGE, MDA, PCO, AOPP, PON-1, TNF-α and IL-6, SGPT and SGOT were estimated in blood and plasma, and histopathology was done in liver tissue. Our data show that oxidative stress, inflammatory markers were increased in the P-407 treated group. Liver tissue histology also changes in the hyperlipidemic groups of rats.HES supplementation protects against P-407 induced alterations and maintains the redox homeostasis. Our results provide evidence that HES protects against lipidemic stress and redox imbalance induced by P-407 in rats.
Neutrophil infiltration, pro-inflammatory cytokines, and reactive oxygen species (ROS) production have been implicated in development and progression of ulcerative colitis (UC), an inflammatory bowel disease (IBD) characterized by ulcerating inflammation of the mucosal layer generally restricted to the colon. The side effects, safety and human intolerance are limitations of the currently approved treatments for UC. Hesperidin methyl chalcone (HMC) is a flavonoid used to treat chronic venous disease, which shows anti-inflammatory, analgesic, and antioxidant properties in pre-clinical studies, however, its effects on colitis have never been described. Therefore, we aimed to evaluate the protective effects of HMC in a mouse model of acetic acid-induced colitis. Treatment with HMC significantly reduced neutrophil infiltration, edema, colon shortening, macro and microscopic damages induced by intracolonic administration of acetic acid. The improvement of colitis after HMC treatment is related to the increase in colon antioxidant status, and the inhibition of pro-inflammatory cytokines TNF-α, IL-6, IL-1β, and IL-33 in the colon. We observed, moreover, that HMC inhibited NF-κB activation in the colon, which might explain the reduction of the cytokines we observed. Finally, these results demonstrate a novel applicability of HMC to increase antioxidant response and reduce inflammation during acetic acid-induced colitis suggesting it as a promising therapeutic approach for the treatment of ulcerative colitis.
An alternative and high-yield method to obtain hesperidin, a bitter flavored flavanone glucoside, from orange (Citrus sinensis L. osbeck) peels waste is described. The proposed process, which add high-value to this kind of residue from orange juice processing industry, was based on a successful modification applied to extraction of naringin from grapefruit. This method involves extraction with methanol and crystallization in water with addition of dichloromethane, requiring shorter times and reducing of volume of solvent employed. Changing to hot extraction with methanol of fresh orange albedo led to higher yields of extraction in half the time required due to the direct method, avoiding air-dried albedo step. Application of described method led to 2.8% yield (w/w dry albedo) of hesperidin extracted in 89.4% purity determined by HPLC analysis. To add high-value to the flavanone obtained, it was subject to chemical transformation (oxidation and hydrolysis, 83% and 88% yield, respectively) into the flavone diosmetin (73% yield for 2 steps), an expensive and naturally-occurring flavonoid in low yields which exhibits a wide range of pharmacological properties. This paper describes high-yield process for extraction of hesperidin from orange peels waste, and their use as feedstock in the production of diosmetin.
Importance
Parkinson disease is the most common form of parkinsonism, a group of neurological disorders with Parkinson disease–like movement problems such as rigidity, slowness, and tremor. More than 6 million individuals worldwide have Parkinson disease.
Observations
Diagnosis of Parkinson disease is based on history and examination. History can include prodromal features (eg, rapid eye movement sleep behavior disorder, hyposmia, constipation), characteristic movement difficulty (eg, tremor, stiffness, slowness), and psychological or cognitive problems (eg, cognitive decline, depression, anxiety). Examination typically demonstrates bradykinesia with tremor, rigidity, or both. Dopamine transporter single-photon emission computed tomography can improve the accuracy of diagnosis when the presence of parkinsonism is uncertain. Parkinson disease has multiple disease variants with different prognoses. Individuals with a diffuse malignant subtype (9%-16% of individuals with Parkinson disease) have prominent early motor and nonmotor symptoms, poor response to medication, and faster disease progression. Individuals with mild motor-predominant Parkinson disease (49%-53% of individuals with Parkinson disease) have mild symptoms, a good response to dopaminergic medications (eg, carbidopa-levodopa, dopamine agonists), and slower disease progression. Other individuals have an intermediate subtype. For all patients with Parkinson disease, treatment is symptomatic, focused on improvement in motor (eg, tremor, rigidity, bradykinesia) and nonmotor (eg, constipation, cognition, mood, sleep) signs and symptoms. No disease-modifying pharmacologic treatments are available. Dopamine-based therapies typically help initial motor symptoms. Nonmotor symptoms require nondopaminergic approaches (eg, selective serotonin reuptake inhibitors for psychiatric symptoms, cholinesterase inhibitors for cognition). Rehabilitative therapy and exercise complement pharmacologic treatments. Individuals experiencing complications, such as worsening symptoms and functional impairment when a medication dose wears off (“off periods”), medication-resistant tremor, and dyskinesias, benefit from advanced treatments such as therapy with levodopa-carbidopa enteral suspension or deep brain stimulation. Palliative care is part of Parkinson disease management.
Conclusions and Relevance
Parkinson disease is a heterogeneous disease with rapidly and slowly progressive forms. Treatment involves pharmacologic approaches (typically with levodopa preparations prescribed with or without other medications) and nonpharmacologic approaches (such as exercise and physical, occupational, and speech therapies). Approaches such as deep brain stimulation and treatment with levodopa-carbidopa enteral suspension can help individuals with medication-resistant tremor, worsening symptoms when the medication wears off, and dyskinesias.
The present study investigates the in vitro antidiabetic and antioxidant potential of hesperidin and hesperetin under oxidative stress induced in L6 myotubes. Also, the study attempts to reveal the effect of glycosylation (hesperetin) on the biological activities of hesperidin. Oxidative stress is the leading cause of complications associated with diabetes. Both hesperidin and hesperetin reduce oxidative stress directly by scavenging intracellular reactive oxygen species (ROS) and by up‐regulating natural antioxidant defence system like glutathione. Hesperidin and hesperetin at 10μM inhibited the non‐enzymatic glycation of proteins (65.57% and 35.6%, respectively), the critical reaction involved in the formation of advanced glycation end products (AGEs) which has a significant role in the pathogenesis of diabetes. Additionally, these compounds induced glucose uptake in L6 myotubes following acute and chronic treatment. The percentage 2‐NBDG uptake shown by both the compounds was comparable with that of the antidiabetic drug, rosiglitazone (30.4%). Both the compounds downregulated PI3 kinase activity whereas GLUT4, IRS, and AKT were upregulated in L6 myotubes pointing to the possible overlapping with the insulin signalling pathway.
Significance of the study
Evidence suggest that oxidative stress occurs in diabetes and could have a role in the development of insulin resistance. Oral hypoglycaemic agents which target on increasing insulin levels and improving insulin sensitivity or that reduce the rate of carbohydrate absorption from the gastrointestinal tract are used to manage type 2 diabetes. But these therapies rarely target the real cause of type 2 diabetes and have severe adverse effects. The observations from the present study provide significant evidence for hesperidin and hesperetin, to be considered as a dietary supplement to manage type 2 diabetes and to suppress oxidative stress mediated diabetic pathophysiology.
Hesperidin is a flavonoid with many nutritional benefits including antioxidant activity in food formulations; however, hesperidin is practically insoluble in water. A commercial enzymatic process has been developed in which a glucose molecule is attached to hesperidin increasing the solubility by approximately 100,000 times. The substance is called glucosyl hesperidin (GH) with the main component being monoglucosyl hesperidin (MGH; 75 to 85%). This paper presents results of OECD-compliant toxicity studies with GH, including 4-week and 13-week sub-chronic toxicity, and teratogenicity studies in rats, and chromosomal aberration and mouse micronucleus formation tests. There were no deaths and no treatment-related adverse effects in the 4-week (highest dose 15,000 ppm) or the 13-week sub-chronic (highest dose 50,000 ppm) studies. There were no statistically significant treatment-related adverse effects on any parameter evaluated. The NOEL in the 4-week study was calculated as 1,280 mg/kg/day in females and 1,206 mg/kg/day for males, and in the 13-week study, the NOEL was 3,428 and 3,084 mg/kg/day, for females and males, respectively. In the teratogenicity study, the NOAEL was 1,000 mg/kg/day of treatment for both dams and fetuses. No genotoxicity was observed in the chromosomal study at 5,000 μg/mL and no micronuclei at 2,000 mg/kg, respectively. The results of these OECD-compliant studies support the safe use of GH as a food and beverage ingredient.