ArticlePDF Available

New Report on Fusarium equiseti Causing Yellow Leaf Disease of Brassica juncea (L.) Czern from Karandighi, Uttar Dinajpur, West Bengal, India

Authors:
Shambhu Swarnakar at Raiganj University
Shambhu Swarnakar
Papan Chowhan at Raiganj University
Papan Chowhan
Zerald Tiru at Raiganj University
Zerald Tiru
Parimal Mandal at Raiganj University
Parimal Mandal
Show all 5 authorsHide
Download full-text PDF
Read full-text
Download citation

Abstract

Yellow leaf disease in B-9 variety of yellow mustard [Brassica juncea (L.) Czern] was noticed in the area of Khowaspur, Karandighi, Uttar Dinajpur District, West Bengal. Irregularly shaped dull yellow regions along the leaf margin and even in the midrib of leaf were observed. Fusarium equiseti (Corda) Sacc. (ON783721.1) was isolated and identified as causal potent fungal isolate causing yellows in leaves of Brassica juncea.
Content uploaded by Papan Chowhan
Author content
All content in this area was uploaded by Papan Chowhan on Sep 23, 2023
Content may be subject to copyright.
NBUJPS ISSN No. 0974-6927
NBU Journal of Plant Sciences Vol. 14 (2022), pp. 21-24
Copyright © 2022, University of North Bengal. All Rights Reserved
21
New Report on
Fusarium equiseti
Causing Yellow Leaf Disease of
Brassica juncea
(L.) Czern from Karandighi, Uttar Dinajpur, West Bengal, India
Shambhu Swarnakar, Papan Chowhan, Zerald Tiru, Parimal Mandal, Arka Pratim Chakraborty*
Department of Botany, Raiganj University, Raiganj, Uttar Dinajpur- 733134, West Bengal, India.
Abstract
Yellow leaf disease in B-9 variety of yellow mustard [Brassica juncea (L.) Czern]
was noticed in the area of Khowaspur, Karandighi, Uttar Dinajpur District, West
Bengal. Irregularly shaped dull yellow regions along the leaf margin and even in the
midrib of leaf were observed. Fusarium equiseti (Corda) Sacc. (ON783721.1) was
isolated and identified as causal potent fungal isolate causing yellows in leaves of
Brassica juncea.
Keywords: Fusarium equiseti, yellow leaf disease, Brassica juncea
Introduction
Yellows symptoms in leaves of Brassica juncea was
noticed during January and February 2022 form the
area of Khowaspur (Lat 25.7726710; Long
88.0328480), Karandighi, Uttar Dinajpur District,
West Bengal (Figs. 1 & 2). In January, the
temperature varied between 13.3-24.7 °C and 16.0-
28.7 °C in February. In January, the average
humidity was 53%, while in February humidity was
recorded as 45%. The initial signs of the disease
were irregularly shaped dull yellow regions along
the leaf margins. These areas then spread to the leaf
midrib and turned tan to brown (Fig. 1C). Lesions
could be sparse and dispersed throughout the leaves
and densely packed over vast areas of leaves. After
surface sterilizing the diseased leaf sample with
0.1% HgCl2 for 2 min, followed by ethanol for 2
min, the leaf sample (1–1.5 cm) was chopped into
small pieces and placed on PDA (Potato Dextrose
Agar) medium. An antibiotic Monocef-O 100 (each
5 ml of the reconstituted suspension contains
cefpodoxime proxetil IP equivalent to cefpodoxime-
100 mg) was added in PDA medium to prevent any
bacterial interference. On potato dextrose agar, a
cefpodoxime proxetil IP equivalent to cefpodoxime-
100 mg) was added in PDA medium to prevent any
bacterial interference. On potato dextrose agar, a
fungus was isolated from the diseased leaf. On the
basis of morphology of the fungal mycelia, various
shapes and sizes of conidia by compound and
scanning electron microscopy, the fungus was
supposed to be species of Fusarium (Fig. 3). For
molecular identification, first step was DNA
isolation followed by fragment of 18S rRNA gene
that was amplified by ITS1 and ITS4 primers- ITS1-
TCC GTA GGT GAA CCT GC GG and ITS4- TCC
TCC GCT TAT TGA TAT GC. A single discrete
PCR amplicon band of 1500 bp was observed when
carried out with ITS1 and ITS4 primers using BDT
v3.1 Cycle sequencing kit on ABI 3730xl Genetic
Analyzer. Consensus sequence of 18S rRNA gene
was generated from forward and reverse sequence
data using aligner software and finally the 18S rRNA
gene sequence was used to carry out BLAST with
the “nr” database of NCBI GenBank database.
Fusarium equiseti (ON783721) was identified and
submitted to NCBI GenBank (Fig. 4).
DOI: https://doi.org/10.55734/nbujps.2022.v14i01.003
* Correspondence -arka.botanyrgu@gmail.com
Short Communication
Article info
Received 12 October 2022
Revised 08 April 2023
Accepted 03 May 2023
S. Swarnakar et al., 2022 Vol. 14(2022)
Copyright © 2022, University of North Bengal. All Rights Reserved
22
Fig. 1: Sample collection site (A &B); Disease symptoms (C) in leaf of B9 variety of yellow mustard (Brassica juncea)
Fig. 4: Molecular identification of the isolate with
GenBank accession number- ON783721
Fig. 2: Earth map and GPS location of the sample collection site from where diseased leaves of Brassica juncea were
collected (A-C)
Fig. 3: Isolation on PDA medium (A); 7 days old
growing isolate (B); Microscopic view of mycelia of
the isolate under x40X resolution (C-D); Scanning
Electron Microscopic view of mycelia and spore of the
isolate (E-F)
S. Swarnakar et al., 2022 Vol. 14(2022)
Copyright © 2022, University of North Bengal. All Rights Reserved
23
resolved on agarose gel and forward and reverse
DNA sequencing reaction of PCR amplicon was
The Neighbour Joining (NJ) method [Saitou and Nei
(1987), Tamura et al. (2004, 2021)] was used to do
phylogenetic analysis of Fusarium equiseti
(ON783721.1) with other ex types of Fusarium.
Fusarium equiseti (ON783721.1) was found to be
closely related with Fusarium equiseti isolate
MLS029 (OM203485.1) (Figs. 5 & 6). Healthy
mustard plant [B. juncea (L.) Czern] was re-
inoculated with foliar spray of spore suspension of
F. equiseti (ON783721.1) and similar leaf symptoms
were appeared. To confirm the attachment of fungal
mycelia to the leaf surface, scanning electron
microscopy of the leaf surface was performed and
the existence of fungal mycelia was confirmed. After
Koch’s Postulate, the isolated fungal morphology
Fig. 6: Phylogenetic analysis of Fusarium
equiseti (ON783721) was performed with other ex
types of Fusarium by Neighbour Joining (NJ) method
Fig. 5: Chromatogram of sequence of the fungus
S. Swarnakar et al., 2022 Vol. 14(2022)
Copyright © 2022, University of North Bengal. All Rights Reserved
24
was rechecked through scanning electron
microscopy. F. equiseti (ON783721.1) was able to
cause wilt of the plant when the plant was dipped
into the spore suspension of the fungus in vitro
condition (Fig. 7). This case report is regarded as
new one on Fusarium equiseti (ON783721) causing
yellow leaf disease of Brassica juncea from
Karandighi, Uttar Dinajpur, West Bengal. Similar
findings were found on first report of Fusarium
equiseti causing wilt and seedling death in other crop
plants in support of our new finding (Mishra et al.
2021; Khan et al. 2021; Astudillo-Calderón et al.
2019; Rajput et al. 2020; Aldakil et al. 2019).
Conflict of Interests
The authors declare no conflict of interests among
them.
Acknowledgements
Authors take this opportunity to express earnest
gratefulness to M/s Edison Life Science, Kolkata for
molecular identification of the isolate and the
Director of USIC-Scanning Electron Microscopy
Unit, University of North Bengal for taking the
scanning electron microscopic photographs.
References
Aldakil H, Jaradat ZW, Tadros M, Alboom MH
(2019) First Report of Fusarium equiseti causing
crown rot on cucumber in Jordan valley. Plant
Dis https://doi.org/10.1094/PDIS-11-18-2073-
PDN
Astudillo-Calderón S, Tello ML, Alonso de
Robador JM, Pintos B (2019) First Report of
Fusarium equiseti causing vascular wilt disease
on Vitis vinifera in Spain. Plant Dis
https://doi.org/10.1094/PDIS-01-19-0067-PDN
Khan MF, Liu Y, Bhuyian MZR, Lashman D, Liu Z,
Zhong S (2021) First Report of Fusarium
equiseti causing seedling death on sugar beet in
Minnesota, USA. Plant Dis doi: 10.1094/PDIS-
10-20-2102-PDN
Mishra RK, Mishra M, Bohra A, Naik S, Pr S.
Kumar K, Patil P, Srivastava DK, Singh NP
(2021) First report of Fusarium equiseti (Corda)
Sacc. causing wilt of Cajanus scarabaeoides, a
wild relative of pigeon pea in India. Plant Dis
doi: 10.1094/PDIS-12-20-2723-PDN
Rajput N, Zaman B, Huo C, JiFen C, Muhammad A,
Abdul ML, Rehana NS, Babar K, Owais I,
Zhijian Z (2020) First report of Fusarium
equiseti causing stem rot disease of grape (Vitis
vinifera L.) in Afghanistan. J Plant Pathol 102:
1277. https://doi.org/10.1007/s42161-020-
00557-8
Saitou N, Nei M (1987) The neighbor-joining
method: A new method for reconstructing
phylogenetic trees. Mol Biol Evol 4:406-425.
Tamura K, Nei M, Kumar S (2004) Prospects for
inferring very large phylogenies by using the
neighbor-joining method. Proceedings of the
National Academy of Sciences (USA)
101:11030-11035.
Tamura K, Stecher G, Kumar S (2021) MEGA 11:
Molecular Evolutionary Genetics Analysis
Version 11. Mol Biol Evol
https://doi.org/10.1093/molbev/msab120
ResearchGate has not been able to resolve any citations for this publication.
MEGA11: Molecular Evolutionary Genetics Analysis Version 11
Article
Full-text available
  • Apr 2021
  • MOL BIOL EVOL
The Molecular Evolutionary Genetics Analysis (MEGA) software has matured to contain a large collection of methods and tools of computational molecular evolution. Here, we describe new additions that make MEGA a more comprehensive tool for building timetrees of species, pathogens, and gene families using rapid relaxed-clock methods. Methods for estimating divergence times and confidence intervals are implemented to use probability densities for calibration constraints for node-dating and sequence sampling dates for tip-dating analyses, which will be supported by new options for tagging sequences with spatiotemporal sampling information, an expanded interactive Node Calibrations Editor, and an extended Tree Explorer to display timetrees. We have now added a Bayesian method for estimating neutral evolutionary probabilities of alleles in a species using multispecies sequence alignments and a machine learning method to test for the autocorrelation of evolutionary rates in phylogenies. The computer memory requirements for the maximum likelihood analysis are reduced significantly through reprogramming, and the graphical user interface (GUI) has been made more responsive and interactive for very big datasets. These enhancements will improve the user experience, quality of results, and the pace of biological discovery. Natively compiled GUI and command-line versions of MEGA11 are available for Microsoft Windows, Linux, and macOS from www.megasoftware.net.
View
First report of Fusarium equiseti causing stem rot disease of grape (Vitis vinifera L.) in Afghanistan
Article
Full-text available
  • May 2020
During 2017, grapevines were observed with an unknown disease in Nari, Kunar province of Afghanistan. The disease was characterized by the appearance of small to large circular brown color spots on vine stem. These spots gradually increased in size and turned purplish brown to dark brown. Affected stems were collected from different fields and surface disinfected, PDA plates were incubated at 25°C for 3-4 days. The results revealed the consistent association of Fusarium equiseti. On PDA, the fungus produced colonies with white dense aerial mycelium which later turned deep olive in colour in center. Macroconidia were 5-6 septate, (1.6-2.4 × 27-38 μm), well developed, with prominent dorsiventral, curvature, falcate, thick-walled, moderately curved, short and elongated apical cell, and well-known foot shaped basal cell. Microconidia were not found. Conidiophores were branched or unbranched, bearing monophialides. Chlamydospores were produced abundantly on the aerial mycelium, formed in clumps, with flat or roughened walls. In pathogenicity test, 20 young shoots of three-year-old grape plant were inoculated with 1 cm mycelial plug and maintained in a greenhouse at 28°C with 70% RH. Typical rot symptoms on the grape stems were clearly detected after 14 dpi on all the inoculated plants. No symptoms were found on 20 control stems inoculated with only PDA plugs. Re-isolation of F. equiseti from the inoculated plants fulfilled the Koch's postulates. Internal transcribed spacer and nuclear large subunit ribosomal DNA of both pathogenic isolates NAR08 and NAR16 were amplified and sequenced with the primers ITS-1/ITS-4 and D1D2-NL1/D1D2-NL4, respectively (Hesham et al. 2014). Sequences were deposited in GenBank (ITS, MF039884, MF039885 and LSU, MF039882, MF039883) and shared 99% similarity with the published ITS (KX588103, KY426430) and LSU (KY411824, KJ126466) sequences of F. equiseti. To our knowledge, this is the first report of F. equiseti causing stem rot on grapes in Afghanistan. Reference Hesham AEL, Wambui V, Jo HO, Maina JM (2014) Phylogenetic analysis of isolated biofuel yeasts based on 5.8 SITS rDNA and D1/D2 26S rDNA sequences. J Genet Eng Biotechnol 12:37-43 Publisher's note Springer Nature remains neutral with regard to jurisdic-tional claims in published maps and institutional affiliations.
View
Genetic variability, heritability, correlation and path analyses of yield components in traditional rice
Article
Full-text available
  • Mar 2019
The presence of sufficient genetic variability, the knowledge of nature of association among different characters and relative contribution of different characters to yield is a prerequisite to any breeding programme. The aim of the present study was to estimate genetic parameters of thirteen yield and yield attributing traits in 40 landraces of rice with a view to select better yield attributes in rice. The higher value of phenotypic coefficient of variation (PCV) compared to the corresponding genotypic coefficient of variation (GCV) for all the studied traits indicated that there was an influence of the environment. Number of unfilled grains per panicle exhibited high estimates of PCV and GCV followed by number of filled grains per panicle, number of grains per panicle, flag leaf area. High heritability coupled with high genetic advance was observed in flag leaf area, pollen fertility, number of grains per panicle and number of filled grains per panicle which reflected that the direct selection of these characters based on phenotypic expression by simple selection method for yield improvement would be more reliable. Grain yield per plant showed significant and positive association with days to 50% flowering, days to maturity, flag leaf area, number of total tillers per hill, number of effective tillers per hill, pollen fertility, number of grains per panicle, number of filled grains per panicle indicating selection of these characters for yield improvement may be rewarding. Both at phenotypic and genotypic level, days to 50% flowering, flag leaf area, number of effective tillers per hill, pollen fertility, panicle length, number of grains per panicle and 100 seed weight had direct positive effect on yield per plant indicating their importance during selection in yield improvement program. Moreover, the information generated from this study, can be exploited in future rice breeding program.
View
View
Genetic Divergence in Landraces of Bangladesh Rice (Oryza sativa L.)
Article
Full-text available
  • Mar 2011
Twenty rice landraces collected from different ecological regions of Bangladesh were studied to assess the nature and magnitude of genetic divergence among them. Based on twelve characters, the genotypes were grouped into five clusters. No parallel relationship between genetic and geographical divergence was observed. Inter-cluster distances were higher than the intra-cluster distances reflecting wider genetic diversity among the genotypes of different groups. The genotypes under cluster IV showed highest divergence among them as it exhibited highest intra-cluster distance. High level of inter-cluster distance was found between cluster II and V and between cluster I and III. Number of filled grains number /panicle, number of panicles/plant, biomass index and grain yield contributed considerably towards total divergence. Germplasm having these characters in the genetically distant cluster could, therefore, offer a significant scope for the development of high yielder through judicious selection.
View
View
First report of Fusarium equiseti (Corda) Sacc. causing wilt of Cajanus scarabaeoides, a wild relative of pigeonpea in India
Article
  • Mar 2021
  • PLANT DIS
Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 μm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using ‘root dip inoculation’ and ‘soil inoculation’ technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.
View
First Report of Fusarium equiseti Causing Seedling Death on Sugar Beet in Minnesota, USA
Article
  • Feb 2021
  • PLANT DIS
In May 2019, sugar beet (Beta vulgaris L.) seedlings with symptoms of wilting and root tip discoloration and necrosis were found in Moorhead (46.5507° N, 96.4208° W), Minnesota, USA. Roots of infected seedlings were surface sterilized with 10% bleach for 15 seconds, rinsed with sterile distilled water and cultured on water agar (MA Mooragar®, Inc, CA) for 3 days at 23 ± 2°C. Isolates were transferred to carnation leaf agar (CLA) and incubated at room temperature (22°C) under fluorescent light for 14 days. Abundant macroconidia were produced in sporodochia. Macroconidia were 5- to 7-septate, slightly curved at the apex, and ranged from 35 to 110 ×1.2 to 3.8 μm. No microconidia were produced. Chlamydospores with thick, roughened walls were observed in chains or in clumps, and were ellipsoidal or subglobose. Single spore was transferred from CLA to potato dextrose agar (HIMEDIA Laboratories, India) produced abundant white mycelium and was pale brown where the colony was in contact with the media. The morphological features of the isolates were consistent with Fusarium equiseti (Corda) Sacc. (Leslie and Summerell 2006, Li et al. 2015). Genomic DNAs (NORGEN BIOTEK CORP, Fungi DNA Isolation Kit #26200) of two representative isolates were used for polymerase chain reaction (PCR). The second largest subunit of RNA polymerase (RPB2) was amplified by PCR with primers 5f2/7cr (O’Donnell et al. 2010). The amplified PCR product was sequenced and deposited in GenBank (accession number MW048778). A BLAST search in Genbank and the Fusarium MLST database showed 100% sequence alignment to F. equiseti with accession MK077037.1 and NRRL 25795, respectively. Pathogenicity testing was done using three sugar beet seedlings (Hilleshög proprietary material, Hilleshög Seed, LLC, Halsey, OR 97348) at cotyledonary stage grown in a pot (4˝×4˝×6˝) with six replicates. Seedlings were inoculated with F. equiseti conidial suspension (104 conidia ml-1 for 8 minutes) by the root dip method (Hanson, 2006). Mock inoculated plants were dipped in sterile water. Inoculated and control plants were placed in the greenhouse at 25 ± 2°C, and 75 to 85% relative humidity. One week later, inoculated seedlings showed root tip tissue discoloration similar to those observed in the field and non-inoculated seedlings were symptomless. This study was repeated. The fungus was re-isolated from diseased roots and confirmed to be F. equiseti based on morphological characters. Fusarium equiseti was reported on freshly harvested and stored beet in Europe but was not found to be pathogenic (Christ et al. 2011). Strausbaugh and Gillen (2009) reported the association of F. equiseti and root rot of sugar beet but did not report pathogenicity. This pathogen is reported in several crops including edible beans that is grown in rotation with sugar beet in several production areas (Jacobs et al. 2018). The most important Fusarium species reported to cause significant economic damage to sugar beet include F. oxysporum and F. secorum (Secor et al. 2014, Webb et. al. 2012). The presence of another pathogenic Fusarium species in sugar beet will require monitoring to determine how widespread it is and whether current commercial cultivars are resistant. To our knowledge, this is the first report of F. equiseti causing disease on sugar beet seedlings in Minnesota, USA.
View
Genetic variability and correlation of some morphometric traits with grain yield in bold grained rice (Oryza sativa L.) gene pool of Barak valley
Article
  • Jan 2010
Physically hard working people prefer bold grained rice with good taste and qualities. But most of the modern high yielding varieties are medium and fine grained. The present experiment was conducted on 47 bold grained rice genotypes with two locally recommended high yielding check varieties namely Ranjit and Monohar Sali of Barak Valley, Assam to assess the genetic variability, correlation and coheritability for eight morphophysiological characters. The characters were days to 50% flowering, plant height, flag leaf length, flag leaf breadth, effective branch tillers per hill, panicle length, sterility percentage and grain yield per hill. Very small difference between GCV and PCV was observed for the characters like days to 50% flowering and flag leaf breadth. Wide difference between GCV and PCV was observed for the characters like plant height, flag leaf length, effective branch tillers per hill, panicle length, sterility percentage and yield per plant. In the present investigation, high heritability associated with high genetic advance was found in the characters grain yield per hill and sterility percentage. These characters were predominantly governed by additive gene action. High heritability along with moderate genetic advance was observed in the character plant height. Moderate heritability associated with moderate genetic advance was recorded for the characters effective branch tillers per hill, flag leaf length and flag leaf breadth. Lastly, high heritability with low genetic advance was recorded for the character days to 50% flowering. This indicated that these characters were mostly governed by nonadditive gene action (dominance and epistasis). The genotypic correlation coefficient was found to be higher than the corresponding phenotypic correlation coefficient. This indicates a strong inherent association among grain yield per plant and other morpho-physiological characters. The characters sterility percentage, effective branch tiller per hill and panicle length showed significant positive genotypic correlation with grain yield per hill. Sterility percentage, effective branch tiller per hill and panicle length had high coheritability with grain yield suggesting that selection for these characters would improve grain yield.
View
The Neighbor-Joining Method: A New Method for Reconstructing Phylogenetic Trees
Article
  • Jul 1987
  • MOL BIOL EVOL
A new method called the neighbor-joining method is proposed for reconstructing phylogenetic trees from evolutionary distance data. The principle of this method is to find pairs of operational taxonomic units (OTUs [= neighbors]) that minimize the total branch length at each stage of clustering of OTUs starting with a starlike tree. The branch lengths as well as the topology of a parsimonious tree can quickly be obtained by using this method. Using computer simulation, we studied the efficiency of this method in obtaining the correct unrooted tree in comparison with that of five other tree-making methods: the unweighted pair group method of analysis, Farris's method, Sattath and Tversky's method, Li's method, and Tateno et al.'s modified Farris method. The new, neighbor-joining method and Sattath and Tversky's method are shown to be generally better than the other methods.
View