ArticlePDF Available

Checklist of newly-vouchered annelid taxa from the Clarion-Clipperton Zone, central Pacific Ocean, based on morphology and genetic delimitation

Biodiversity Data Journal

September 2023
11(4-5)

DOI:10.3897/BDJ.11.e86921

License
CC BY 4.0

Authors:

Muriel Rabone

Natural History Museum, London

Guadalupe Bribiesca-Contreras

National Oceanography Centre, Southampton

Show all 12 authorsHide

We present a checklist of annelids from recent United Kingdom Seabed Resources (UKSR) expeditions (Abyssal Baseline - ABYSSLINE project) to the eastern abyssal Pacific Clarion-Clipperton Zone (CCZ) polymetallic nodule fields, based on DNA species delimitation, including imagery of voucher specimens, Darwin Core (DwC) data and links to vouchered specimen material and new GenBank sequence records. This paper includes genetic and imagery data for 129 species of annelids from 339 records and is restricted to material that is, in general, in too poor a condition to describe formally at this time, but likely contains many species new to science. We make these data available both to aid future taxonomic studies in the CCZ that will be able to link back to these genetic data and specimens and to better underpin ongoing ecological studies of potential deep-sea mining impacts using the principles of FAIR (Findable, Accessible, Interoperable, Reusuable) data and specimens that will be available for all. We include genetic, imagery and all associated metadata in Darwin Core format for 129 species of annelids from the Clarion-Clipperton Zone, eastern abyssal Pacific, with 339 records.

Map of ABYSSLINE sampling locations used in this study. a) The Clarion-Clipperton Zone, central Pacific Ocean, with contract areas and Areas of Particular Environmental Interest highlighted; b) UK-1 and OMS-1 sampling locations used in this study; c-e) Bathymetric data for sites in UK-1 and OMS-1 claim areas, with yellow circles showing sampling locations.

…

Ampharetidae sp. (NHM_062), specimen NHM_062 in lateral view. Scale bar 500 µm.

…

Ampharetidae sp. (NHM_1338), live specimen NHM_1338.

…

Ampharetidae sp. (NHM_1161), live specimen NHM_1661 in dorsal view.

…

+108

Ampharetidae sp. (NHM_789), live specimen NHM_870 in lateral view. Scale bar: 1 mm.

…

Figures - available from: Biodiversity Data Journal

This content is subject to copyright. Terms and conditions apply.

Access to this full-text is provided by Pensoft Publishers.

Content available from Biodiversity Data Journal

This content is subject to copyright. Terms and conditions apply.

Biodiversity Data Journal 11: e86921

doi: 10.3897/BDJ.11.e86921

Taxonomy & Inventories

Checklist of newly-vouchered annelid taxa from

the Clarion-Clipperton Zone, central Pacific

Ocean, based on morphology and genetic

delimitation

Helena Wiklund , Muriel Rabone , Adrian G Glover , Guadalupe Bribiesca-Contreras , Regan

Drennan , Eva C D Stewart , Corie M Boolukos , Lucas D King , Emma Sherlock , Craig R Smith ,

Thomas G Dahlgren , Lenka Neal

‡ Natural History Museum, London, United Kingdom

§ University of Gothenburg, Gothenburg, Sweden

| Gothenburg Global Biodiversity Centre, Gothenburg, Sweden

¶ University of Southampton, Southampton, United Kingdom

# University of Hawaii, Honolulu, United States of America

¤ NORCE Norwegian Research Centre, Bergen, Norway

Corresponding author: Helena Wiklund (helena.wiklund@marine.gu.se), Adrian G Glover (a.glover@nhm.ac.uk),

Lenka Neal (l.nealova@nhm.ac.uk)

Academic editor: Wagner Magalhães

Received: 24 May 2022 | Accepted: 02 Jun 2023 | Published: 15 Sep 2023

Citation: Wiklund H, Rabone M, Glover AG, Bribiesca-Contreras G, Drennan R, Stewart ECD, Boolukos CM,

King LD, Sherlock E, Smith CR, Dahlgren TG, Neal L (2023) Checklist of newly-vouchered annelid taxa from the

Clarion-Clipperton Zone, central Pacific Ocean, based on morphology and genetic delimitation. Biodiversity Data

Journal 11: e86921. https://doi.org/10.3897/BDJ.11.e86921

Abstract

Background

We present a checklist of annelids from recent United Kingdom Seabed Resources

(UKSR) expeditions (Abyssal Baseline - ABYSSLINE project) to the eastern abyssal Pacific

Clarion-Clipperton Zone (CCZ) polymetallic nodule fields, based on DNA species

delimitation, including imagery of voucher specimens, Darwin Core (DwC) data and links to

vouchered specimen material and new GenBank sequence records. This paper includes

genetic and imagery data for 129 species of annelids from 339 records and is restricted to

‡,§,| ‡ ‡ ‡

‡,¶ ‡,¶ ‡ ‡ ‡ #

¤,§,| ‡

4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are

credited.

material that is, in general, in too poor a condition to describe formally at this time,

but

likely contains many species new to science. We make these data available both to aid

future taxonomic studies in the CCZ that will be able to link back to these genetic data and

specimens and to better underpin ongoing ecological studies of potential deep-sea mining

impacts using the principles of FAIR (Findable, Accessible, Interoperable, Reusuable) data

and specimens that will be available for all.

New information

We include genetic, imagery and all associated metadata in Darwin Core format for 129

species of annelids from the Clarion-Clipperton Zone, eastern abyssal Pacific, with 339

records.

Keywords

taxonomy, DNA barcoding, biodiversity, conservation, deep-sea mining, abyssal Pacific,

environmental impact

Introduction

We present a checklist of annelid fauna from recent UKSR expeditions (ABYSSLINE

project) to the CCZ the equatorial abyssal Pacific, based on DNA species delimitation,

including imagery of voucher specimens, Darwin Core data (DwC) and links to vouchered

specimen material and new GenBank sequence records. This is a region undergoing

significant exploration for mineral resources in the form of polymetallic nodules at the

seafloor (Hein et al. 2013) and, as such, future environmental monitoring of these areas

will require access to information on the biodiversity of animals at the seafloor, in particular

based on sound taxonomic sources (Glover et al. 2018, Rabone et al. 2023a, Rabone et al.

2023b).

Surveying of this region over the the past 20 years resulted in a large collection of often

very small, morphologically sub-optimally preserved and difficult to identify annelids,

despite the best efforts at collecting animals directly from samples at sea using cold-chain

protocols (Glover et al. 2015). Typically, the specimens can be identifed to family or genus

at best. Although good quality DNA sequences were obtained in most cases, there are few

genetic matches to sequences available on public databases (Suppl. material 1), most

being from other studies in the CCZ (Janssen et al. 2015, Janssen et al. 2019, Bonifácio

and Menot 2019, Bonifacio et al. 2020, Bonifácio et al. 2021) or abyssal Atlantic

(Boggemann 2009,Boggemann 2016). Based on detailed taxonomic studies that also

incorporated molecular data (e.g. Wiklund et al. 2019, Bonifácio and Menot 2019, Neal et

al. 2022a, Neal et al. 2022b, Bonifácio et al. 2021), over 80% of the CCZ-collected

annelids are likely new to science (Rabone et al. 2023b). To date, publications from the

areas targeted in this study have yielded 60 annelid species from 327 specimen records, of

2Wiklund H et al

which only 18 species have been formalised as new (Wiklund et al. 2019, Drennan et al.

2021, Neal et al. 2022a, Neal et al. 2022b). However, we are left with a problem in that

many specimens are in sub-optimal morphological condition and unable, therefore, to be

formally described. Therefore, in order to ensure that this material is accessible and useful

as more comparative material is recovered in future surveys and that the DNA sequences

obtained are linked transparently to openly-available molecular tissue/DNA and specimen

vouchers, we are making these data and materials available in the form of this checklist

paper. This has two major advantages: firstly, it enables future taxonomic work with better

materials to use and to link to these data and potentially describe more of these

specimens; secondly, it provides openly available data on the actual species hypotheses

used to support ecological papers describing the biodiversity of the CCZ (Rabone et al.

2023b), which clearly suffer from a lack of quality control in the specimen identifications

available, as has been recently acknowledged (Bianchi and Gonçalves 2021, Washburn et

al. 2021). This checklist also provides supporting data to Stewart et al. (2023) describing

the biodiversity and connectivity of annelids across the entire eastern CCZ region.

This paper includes a checklist of 129 annelid species, with 339 records from 18

polychaete families and four species of Sipuncula. Excluded from this study are several

annelid families which are common in the CCZ, but are either ones that have already been

studied (Wiklund et al. 2019, Drennan et al. 2021, Neal et al. 2022a, Neal et al. 2022b) or

are currently in preparation in separate detailed taxonomic papers (e.g. order Phyllodocida

and families Acrocirridae and Serpulidae).

Materials and methods

Sampling

The first UKSR ABYSSLINE cruise (AB01), sampling the UK-1 exploration contract area,

took place in October 2013 aboard the RV Melville and the second cruise (AB02), sampling

the UK-1 and OMS-1 (Ocean Minerals Singapore) exploration contract areas and one Area

of Particular Environmental Interest (APEI), APEI-6, took place in February-March 2015

onboard RV Thomas G. Thompson. Sampling locations are as indicated in Fig. 1.

A comprehensive description of our methods is provided in Glover et al. (2015). In

summary, deep-sea benthic specimens from the targeted CCZ areas were collected using

a range of oceanographic sampling gear including box core, epibenthic sledge (EBS), ROV

and multiple core. Geographic data from sampling activities were recorded on a central

GIS database. Live-sorting of specimen samples was carried out aboard both vessels in a

‘cold-chain’ pipeline, in which material was constantly maintained in chilled, filtered

seawater held at 2–4°C. Specimens were preliminarily identified at sea and imaged live

using stereomicroscopes with attached digital cameras. Only annelid specimens with a

visible head end were counted and included in taxonomic and biodiversity analyses. The

specimens were then stored in individual microtube vials containing an aqueous solution of

80% non-denatured ethanol, numbered and barcoded into a database and kept chilled until

return to the Natural History Museum (NHM), London, UK.

Checklist of newly-vouchered annelid taxa from the Clarion-Clipperton Zone, ... 3

Laboratory Work

In the laboratory, specimens were re-examined using stereomicroscopes, identified to the

best possible taxonomic level and a small tissue sample was taken for DNA extraction.

most of the specimens in this study, the material was too poor or degraded to make

species-level identifications.

Extraction of DNA was done with DNeasy Blood and Tissue Kit (Qiagen) using a Hamilton

Microlab STAR Robotic Workstation. About 450 bp of 16S and 650 bp of cytochrome c

oxidase subunit I (COI) were amplified using primers listed in Table 2. PCR mixtures

contained 1 μl of each primer (10 μM), 2 μl template DNA and 21 μl of Red Taq DNA

Polymerase 1.1X MasterMix (VWR) in a mixture of total 25 μl. The PCR amplification

profile consisted of initial denaturation at 95°C for 5 min, 35 cycles of denaturation at 94°C

for 45 s, annealing at 55°C for 45 s, extension at 72°C for 2 min and a final extension at

72°C for 10 min. PCR products were purified using Millipore Multiscreen 96-well PCR

Purification System and sequencing was performed on an ABI 3730XL DNA Analyser

(Applied Biosystems) at NHM Sequencing Facility, using the same primers as in the PCR

reactions (Table 2). Overlapping sequence fragments were merged into consensus

sequences using Geneious (Kearse et al. 2012) and aligned using MAFFT (Katoh 2002)

for 16S and MUSCLE (Edgar 2004) for COI.

Figure 1.

Map of ABYSSLINE sampling locations used in this study. a) The Clarion-Clipperton Zone,

central Pacific Ocean, with contract areas and Areas of Particular Environmental Interest

highlighted; b) UK-1 and OMS-1 sampling locations used in this study; c-e) Bathymetric data

for sites in UK-1 and OMS-1 claim areas, with yellow circles showing sampling locations.

4Wiklund H et al

Family/Order Species # Records

Ampharetidae Ampharetidae sp. (NHM_015) 2

Ampharetidae sp. (NHM_044) 3

Ampharetidae sp. (NHM_062) 2

Ampharetidae sp. (NHM_1082) 1

Ampharetidae sp. (NHM_1161) 1

Ampharetidae sp. (NHM_1338) 3

Ampharetidae sp. (NHM_1578) 2

Ampharetidae sp. (NHM_1599) 2

Ampharetidae sp. (NHM_163) 3

Ampharetidae sp. (NHM_265) 1

Ampharetidae sp. (NHM_292) 4

Ampharetidae sp. (NHM_774) 1

Ampharetidae sp. (NHM_789) 4

Chaetopteridae Chaetopteridae sp. (NHM_331) 3

Chrysopetalidae Chrysopetalidae sp. NHM (1303) 2

Chrysopetalidae sp. (NHM_1550) 1

Chrysopetalidae sp. (NHM_2026) 1

Chrysopetalidae sp. (NHM_410) 1

Chrysopetalidae sp. (NHM_748A) 1

Cirratulidae Cirratulidae sp. (NHM_172) 4

Cirratulidae sp. (NHM_1001) 1

Cirratulidae sp. (NHM_1235) 3

Cirratulidae sp. (NHM_1429) 1

Cirratulidae sp. (NHM_1518) 1

Cirratulidae sp. (NHM_165) 1

Cirratulidae sp. (NHM_2093) 1

Cirratulidae sp. (NHM_2163) 4

Cirratulidae sp. (NHM_269) 4

Table 1.

List of species included in this study, including the number of records per species.

Checklist of newly-vouchered annelid taxa from the Clarion-Clipperton Zone, ... 5

Family/Order Species # Records

Cirratulidae sp. (NHM_340) 5

Cirratulidae sp. (NHM_530) 3

Cirratulidae sp. (NHM_734) 1

Cirratulidae sp. (NHM_904) 2

Cirratulidae sp. (NHM_915G) 4

Cirratulidae sp. (NHM_945C) 1

Flabelligeridae Flabelligeridae sp. (NHM_045) 3

Flabelligeridae sp. (NHM_1274) 2

Flabelligeridae sp. (NHM_1313) 3

Flabelligeridae sp. (NHM_1638) 2

Flabelligeridae sp. (NHM_2124) 1

Flabelligeridae sp. (NHM_555) 1

Flabelligeridae sp. (NHM_630A) 1

Flabelligeridae sp. (NHM_738) 3

Flabelligeridae sp. (NHM_955) 7

Glyceridae Glyceridae sp. (NHM_1242) 3

Glyceridae sp. (NHM_207) 13

Glyceridae sp. (NHM_2089) 2

Goniadidae Goniadidae sp. (NHM_1512) 2

Lacydoniidae Lacydoniidae sp. (NHM_1355C) 1

Lacydoniidae sp. (NHM_1797D) 1

Lacydoniidae sp. (NHM_898) 1

Magelonidae Magelonidae sp. (NHM_1340) 2

Maldanidae Maldanidae sp. (NHM_026) 5

Maldanidae sp. (NHM_1170) 1

Maldanidae sp. (NHM_1178) 2

Maldanidae sp. (NHM_836) 5

Maldanidae sp. (NHM_900) 1

Onuphidae Onuphidae sp. (NHM_1010) 2

Onuphidae sp. (NHM_2430) 1

6Wiklund H et al

Family/Order Species # Records

Orbiniidae Orbiniidae sp. (NHM_050) 4

Orbiniidae sp. (NHM_102) 4

Orbiniidae sp. (NHM_1947G) 1

Orbiniidae sp. (NHM_264) 2

Orbiniidae sp. (NHM_458) 2

Orbiniidae sp. (NHM_754) 6

Orbiniidae sp. (NHM_791) 2

Orbiniidae sp. (NHM_824) 7

Paraonidae Paraonidae sp. (NHM_059) 7

Paraonidae sp. (NHM_1139) 1

Paraonidae sp. (NHM_177) 2

Paraonidae sp. (NHM_2118) 1

Paraonidae sp. (NHM_332) 6

Paraonidae sp. (NHM_363) 5

Paraonidae sp. (NHM_412) 3

Paraonidae sp. (NHM_434) 3

Paraonidae sp. (NHM_584) 2

Paraonidae sp. (NHM_902) 4

Pilargidae Ancistrosyllis sp. (NHM_765) 9

Polynoidae Bathyeliasona mariaae 2

Bathyfauvelia glacigena 9

Bathyfauvelia ignigena 1

Polaruschakov lamellae 1

Polynoidae sp. (NGM_1074) 1

Polynoidae sp. (NHM_034) 1

Polynoidae sp. (NHM_1000) 1

Polynoidae sp. (NHM_128) 8

Polynoidae sp. (NHM_1655) 2

Polynoidae sp. (NHM_1763) 1

Polynoidae sp. (NHM_2097) 1

Checklist of newly-vouchered annelid taxa from the Clarion-Clipperton Zone, ... 7

Family/Order Species # Records

Polynoidae sp. (NHM_2099) 1

Polynoidae sp. (NHM_2101) 2

Polynoidae sp. (NHM_2122) 1

Polynoidae sp. (NHM_2195) 2

Polynoidae sp. (NHM_583) 2

Polynoidae sp. (NHM_588) 2

Polynoidae sp. (NHM_589) 1

Polynoidae sp. (NHM_595) 8

Polynoidae sp. (NHM_679) 8

Polynoidae sp. (NHM_690) 1

Polynoidae sp. (NHM_747A) 1

Polynoidae sp. (NHM_747D) 5

Polynoidae sp. (NHM_756) 2

Polynoidae sp. (NHM_773B) 7

Polynoidae sp. (NHM_834) 1

Sabellariidae Sabellariidae sp. (NHM_1167B) 4

Sabellidae Sabellidae sp. (NHM_1613) 1

Sabellidae sp. (NHM_1859A) 1

Sabellidae sp. (NHM_1879) 1

Sabellidae sp. (NHM_189) 1

Sabellidae sp. (NHM_1991) 1

Sabellidae sp. (NHM_351) 1

Sabellidae sp. (NHM_370) 1

Sabellidae sp. (NHM_472) 1

Sabellidae sp. (NHM_535) 1

Sabellidae sp. (NHM_647) 1

Sabellidae sp. (NHM_915D) 2

Sigalionidae Pholoinae sp. (NHM_366) 4

Sigalionidae sp. (NHM_1093) 1

Sigalionidae sp. (NHM_342) 9

8Wiklund H et al

Family/Order Species # Records

Sigalionidae sp. (NHM_881) 2

Sphaerodoridae Sphaerodoridae sp. (NHM_1003) 1

Sphaerodoridae sp. (NHM_2177) 1

Sphaerodoridae sp. (NHM_2532) 1

Terebellidae Terebellidae sp. (NHM_018) 1

Trichobranchidae Terebellides sp. (NHM_167) 1

Terebellides sp. (NHM_406) 1

Sipuncula Sipuncula sp. (NHM_126) 6

Sipuncula sp. (NHM_1298) 2

Sipuncula sp. (NHM_148) 1

Sipuncula sp. (NHM_715) 10

Primer Sequence 5'-3' Reference

COI

LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994)

HCO2198 TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994)

COI-E TATACTTCTGGGTGTCCGAAGAATCA Bely and Wray (2004)

polyLCO GAYTATWTTCAACAAATCATAAAGATATTGG Carr et al. (2011)

polyHCO TAMACTTCWGGGTGACCAAARAATCA Carr et al. 2011

16S

ann16SF GCGGTATCCTGACCGTRCWAAGGTA Sjölin et al. (2005)

16SbrH CCGGTCTGAACTCAGATCACGT Palumbi (1996)

Species delimitation and taxonomic assignments

Future studies of biogeographic and bathymetric ranges, gene-flow, extinction risks, natural

history, reproductive ecology, functional ecology and geochemical interactions of CCZ

species are dependent on accurate taxonomic identifications. Our more recent taxonomic

studies (e.g. Glover et al. (2016), Dahlgren et al. (2016), Wiklund et al. (2017), Wiklund et

al. (2019), Drennan et al. (2021), Neal et al. (2022a), Neal et al. (2022b)), applied an

integrative DNA taxonomy approach, with species delimitation principally based on a

Table 2.

Primers used for PCR and sequencing of COI and 16S.

Checklist of newly-vouchered annelid taxa from the Clarion-Clipperton Zone, ... 9

phylogenetic species concept, sensu Donoghue (1985) coupled with morphological

interpretations. However, in this broader study of all of the annelids, including many poorly-

preserved or fragmented individuals, we have relied more heavily on genetic data.

Taxonomic assignments and nomenclature

Almost all species discriminated by the analyses could be identified to family level from

morphology and this was cross-checked with the genetic data through a BLAST search.

Given the poor preservation of morphology and the goals of this paper to make specimen

and genetic data rapidly available for any future studies, we did not attempt to force

species into genera in most instances and used an open nomenclature whereby the

species are named with the best taxonomic level and a species epithet that refers to the

best voucher specimen of that species. For example, Pilargidae sp. (NHM_015) is the

informal species name for the species that is represented by two specimens, specimen

NHM_015 being the better representative (an informal type specimen). This avoids

confusion with the use of sp. A, B, C etc. where informal and confusing synonyms can

easily arise.

Species were delimited, based on well-supported clades recovered from phylogenetic trees

estimated separately for 16S and COI sequences. Best nucleotide substitution models for

each alignment (i.e. 16S and COI) and best-fit partitions were inferred using PartitionFinder

2.0 (Lanfear et al. 2017), utilising a greedy clustering algorithm (Lanfear et al. 2012) and

PhyML v.3 (Guindon et al. 2010). Phylogenetic trees were estimated using Bayesian

Inference in BEAST v.2.6.2 (Bouckaert et al. 2019) under a Yule speciation model,

uncorrelated relaxed clock, GTR+I+G substitution model for each partition of COI (codon

positions 1, 2 and 3) and for 16S and a chain length of 100 M, sampling every 10,000. The

MCMC runs were inspected convergence in Tracer v.1.7.1. The first 50 M states were

discarded as burn-in and a consensus median heights tree was generated from the

remaining posterior trees. Trees were visualised using FigTree v.1.4.4 and species clusters

were mostly defined from very similar sequences recovered in monophyletic clades with a

posterior probability of 1.

Data Handling

The field and laboratory work created a series of databases and sample sets that are

integrated into a data-management pipeline. This includes the transfer and management of

data and samples between a central collections database, a molecular collections

database and external repositories (GenBank, WoRMS, OBIS, GBIF, GGBN, ZooBank)

through DwC archives. This provides a robust data framework to support DNA taxonomy, in

which openly available data and voucher material is key to quality data standards. All DwC

data present in the taxon treatments of the checklist herein are also provided as a

supplementary data file to allow for ease of usage (Suppl. material 2). A further elaboration

of the data pipeline is published in Glover et al. (2015).

10 Wiklund H et al

List of Species

A list of the species in this checklist and number of records is provided here in Table 1.

Ampharetidae Malmgren, 1866

Ampharetidae sp. (NHM_015)

Materials

a. scientificName: Ampharetidae; taxonConceptID: Ampharetidae sp. (NHM_015); kingdom:

Animalia; phylum: Annelida; class: Polychaeta; order: Terebellida; family: Ampharetidae;

taxonRank: family; scientificNameAuthorship: Malmgren, 1866; waterBody: Pacific;

stateProvince: Clarion Clipperton Zone; locality: Ocean Mineral Singapore exploration

claim Stratum A; verbatimLocality: OMS Stratum A; maximumDepthInMeters: 4094;

locationRemarks: Deployment EB11; at Station S10; from R/V Thomas G. Thompson

Cruise no. TN319; verbatimLatitude: 12°02.49’; verbatimLongitude: 117°13.03’;

decimalLatitude: 12.0415; decimalLongitude: -117.21717; geodeticDatum: WGS84;

eventID: OMS1_AB02_EB11; samplingProtocol: Brenke Epibenthic Sledge; eventDate:

2015-03-13; habitat: Abyssal plain; fieldNotes: Collected from nodule (on the epibenthic

sledge); individualCount: 1; preparations: specimen stored in 80% non-denatured ethanol

aqueous solution | DNA voucher stored in buffer; catalogNumber: NHMUK ANEA

2023.309; recordNumber: NHM_1893; recordedBy: Adrian Glover | Helena Wiklund |

Thomas Dahlgren | Madeleine Brasier; otherCatalogNumbers: 0174126196;

associatedSequences: OQ746731 (16S); identifiedBy: Helena Wiklund | Lenka Neal |

Thomas Dahlgren | Adrian Glover | Madeleine Brasier | Regan Drennan | Eva Stewart;

dateIdentified: 2021-04-20; identificationRemarks: identified by DNA and morphology;

language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName:

ABYSSLINE; basisOfRecord: PreservedSpecimen; occurrenceID:

0A7FA264-84FE-574B-BF4C-026E6BE55820

b. scientificName: Ampharetidae; taxonConceptID: Ampharetidae sp. (NHM_015); kingdom:

Animalia; phylum: Annelida; class: Polychaeta; order: Terebellida; family: Ampharetidae;

taxonRank: family; scientificNameAuthorship: Malmgren, 1866; waterBody: Pacific;

stateProvince: Clarion Clipperton Zone; locality: UK Seabed Resources Ltd exploration

area UK-1 Stratum A; verbatimLocality: UK1 Stratum A; maximumDepthInMeters: 4336;

locationRemarks: Deployment EB01; at Station B-K-E; from R/V Melville Cruise no.

MV1313; verbatimLatitude: 13°50.232; verbatimLongitude: 116°33.506; decimalLatitude:

13.8372; decimalLongitude: -116.55843; geodeticDatum: WGS84; eventID:

UK1_AB01_EB01; samplingProtocol: Brenke Epibenthic Sledge; eventDate: 2013-10-09;

eventTime: 10:26; habitat: Abyssal plain; fieldNotes: Collected from epi net (on the

epibenthic sledge); individualCount: 1; preparations: specimen stored in 80% non-

denatured ethanol aqueous solution | DNA voucher stored in buffer; catalogNumber:

NHMUK ANEA 2023.308; recordNumber: NHM_0015; recordedBy: Adrian Glover |

Helena Wiklund | Thomas Dahlgren | Magdalena Georgieva; otherCatalogNumbers:

0174127342; associatedSequences: OQ746466 (16S) | OQ746789 (18S) | OQ738494

(COI); identifiedBy: Helena Wiklund | Lenka Neal | Thomas Dahlgren | Adrian Glover |

Madeleine Brasier | Regan Drennan | Eva Stewart; dateIdentified: 2021-04-20;

identificationRemarks: identified by DNA and morphology; language: en; institutionCode:

Checklist of newly-vouchered annelid taxa from the Clarion-Clipperton Zone, ... 11

NHMUK; collectionCode: ZOO; datasetName: ABYSSLINE; basisOfRecord:

PreservedSpecimen; occurrenceID: 667791B3-AD99-567E-A080-F41C3123770A

Diagnosis: Damaged specimens (Fig. 2) consistent with placement within

family

Ampharetidae, based on morphology and DNA.

Distribution: Eastern Clarion-Clipperton Zone, central Pacific ocean.

Ampharetidae sp. (NHM_044)

Materials

a. scientificName: Ampharetidae; taxonConceptID: Ampharetidae sp. (NHM_044); kingdom:

Animalia; phylum: Annelida; class: Polychaeta; order: Terebellida; family: Ampharetidae;

taxonRank: family; scientificNameAuthorship: Malmgren, 1866; waterBody: Pacific;

stateProvince: Clarion Clipperton Zone; locality: Ocean Mineral Singapore exploration

claim Stratum A; verbatimLocality: OMS Stratum A; maximumDepthInMeters: 4094;

locationRemarks: Deployment EB11; at Station S10; from R/V Thomas G. Thompson

Figure 2.

Ampharetidae sp. (NHM_015).

a: Anterior fragment of live specimen NHM_1893;

b: Dorsal view of prostomium with branchiae, preserved specimen NHM_015;

c: Thoracic uncini, specimen NHM_015;

d: Live specimen NHM_015 in ventral view, partly inside the tube.

12 Wiklund H et al

Cruise no. TN319; verbatimLatitude: 12°02.49’; verbatimLongitude: 117°13.03’;

decimalLatitude: 12.0415; decimalLongitude: -117.21717; geodeticDatum: WGS84;

eventID: OMS1_AB02_EB11; samplingProtocol: Brenke Epibenthic Sledge; eventDate:

2015-03-13; habitat: Abyssal plain; fieldNotes: Collected from epi net (on the epibenthic

sledge); individualCount: 1; preparations: specimen stored in 80% non-denatured ethanol

aqueous solution | DNA voucher stored in buffer; catalogNumber: NHMUK ANEA

2023.311; recordNumber: NHM_1947I; recordedBy: Adrian Glover | Helena Wiklund |

Thomas Dahlgren | Madeleine Brasier; otherCatalogNumbers: 0174126173;

associatedSequences: OQ746738 (16S); identifiedBy: Helena Wiklund | Lenka Neal |

Thomas Dahlgren | Adrian Glover | Madeleine Brasier | Regan Drennan | Eva Stewart;

dateIdentified: 2021-04-20; identificationRemarks: identified by DNA and morphology;

language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName:

ABYSSLINE; basisOfRecord: PreservedSpecimen; occurrenceID:

65B5ECB4-3223-5FDE-A716-44F1E8C3A680

b. scientificName: Ampharetidae; taxonConceptID: Ampharetidae sp. (NHM_044); kingdom:

Animalia; phylum: Annelida; class: Polychaeta; order: Terebellida; family: Ampharetidae;

taxonRank: family; scientificNameAuthorship: Malmgren, 1866; waterBody: Pacific;

stateProvince: Clarion Clipperton Zone; locality: Ocean Mineral Singapore exploration

claim Stratum A; verbatimLocality: OMS Stratum A; maximumDepthInMeters: 4100;

locationRemarks: Deployment EB05; at Station S2; from R/V Thomas G. Thompson

Cruise no. TN319; verbatimLatitude: 12'06.93; verbatimLongitude: 117'09.87;

decimalLatitude: 12.1155; decimalLongitude: -117.1645; geodeticDatum: WGS84;

eventID: OMS1_AB02_EB05; samplingProtocol: Brenke Epibenthic Sledge; eventDate:

2015-02-26; eventTime: 21:29; habitat: Abyssal plain; fieldNotes: Collected from supra

net (on the epibenthic sledge); individualCount: 1; preparations: specimen stored in 80%

non-denatured ethanol aqueous solution | DNA voucher stored in buffer; catalogNumber:

NHMUK ANEA 2023.312; recordNumber: NHM_2769; recordedBy: Adrian Glover |

Helena Wiklund | Thomas Dahlgren | Madeleine Brasier; otherCatalogNumbers:

0174126158; associatedSequences: OQ746783 (16S); identifiedBy: Helena Wiklund |

Eva Stewart; dateIdentified: 2021-04-20; identificationRemarks: identified by DNA and

morphology; language: en; institutionCode: NHMUK; collectionCode: ZOO; datasetName:

ABYSSLINE; basisOfRecord: PreservedSpecimen; occurrenceID: 8DEE847A-

E775-5B20-B2F7-52219A9BCE98

c. scientificName: Ampharetidae; taxonConceptID: Ampharetidae sp. (NHM_044); kingdom: