Available via license: CC BY 4.0
Content may be subject to copyright.
| Open Peer Review | Virology | Research Article
Identication and characterization of novel alphacoronaviruses
in Tadarida brasiliensis (Chiroptera, Molossidae) from Argentina:
insights into recombination as a mechanism favoring bat
coronavirus cross-species transmission
Agustina Cerri,1 Elisa M. Bolatti,1,2,3 Tomaz M. Zorec,4 Maria E. Montani,3,5,6 Agustina Rimondi,7,8 Lea Hosnjak,4 Pablo E. Casal,9
Violeta Di Domenica,1,3 Ruben M. Barquez,3,6 Mario Poljak,4 Adriana A. Giri1,2
AUTHOR AFFILIATIONS See aliation list on p. 16.
ABSTRACT Bats are reservoirs of various coronaviruses that can jump between bat
species or other mammalian hosts, including humans. This article explores coronavirus
infection in three bat species (Tadarida brasiliensis, Eumops bonariensis, and Molossus
molossus) of the family Molossidae from Argentina using whole viral metagenome
analysis. Fecal samples of 47 bats from three semiurban or highly urbanized areas
of the province of Santa Fe were investigated. After viral particle enrichment, total
RNA was sequenced using the Illumina NextSeq 550 instrument; the reads were
assembled into contigs and taxonomically and phylogenetically analyzed. Three novel
complete Alphacoronavirus (AlphaCoV) genomes (Tb1–3) and two partial sequences
were identied in T. brasiliensis (Tb4–5), and an additional four partial sequences
were identied in M. molossus (Mm1–4). Phylogenomic analysis showed that the novel
AlphaCoV clustered in two dierent lineages distinct from the 15 ocially recognized
AlphaCoV subgenera. Tb2 and Tb3 isolates appeared to be variants of the same virus,
probably involved in a persistent infectious cycle within the T. brasiliensis colony. Using
recombination analysis, we detected a statistically signicant event in Spike gene, which
was reinforced by phylogenetic tree incongruence analysis, involving novel Tb1 and
AlphaCoVs identied in Eptesicus fuscus (family Vespertilionidae) from the U.S. The
putative recombinant region is in the S1 subdomain of the Spike gene, encompass
ing the potential receptor-binding domain of AlphaCoVs. This study reports the rst
AlphaCoV genomes in molossids from the Americas and provides new insights into
recombination as an important mode of evolution of coronaviruses involved in cross-
species transmission.
IMPORTANCE This study generated three novel complete AlphaCoV genomes (Tb1,
Tb2, and Tb3 isolates) identied in individuals of Tadarida brasiliensis from Argentina,
which showed two dierent evolutionary patterns and are the rst to be reported in the
family Molossidae in the Americas. The novel Tb1 isolate was found to be involved in
a putative recombination event with alphacoronaviruses identied in bats of the genus
Eptesicus from the U.S., whereas isolates Tb2 and Tb3 were found in dierent collection
seasons and might be involved in persistent viral infections in the bat colony. These
ndings contribute to our knowledge of the global diversity of bat coronaviruses in
poorly studied species and highlight the dierent evolutionary aspects of AlphaCoVs
circulating in bat populations in Argentina.
KEYWORDS bats, genus alphacoronavirus, novel genomes, recombination, Molossidae,
cross-species transmission, Americas
Month XXXX Volume 0 Issue 0 10.1128/spectrum.02047-23 1
Editor Biao He, Changchun Veterinary Research
Institute, Changchun, China
Address correspondence to Elisa M.
Bolatti, bolatti@ibr-conicet.gov.ar, Mario Poljak,
mario.poljak@mf.uni-lj.si, or Adriana A. Giri, giri@ibr-
conicet.gov.ar.
The authors declare no conict of interest.
See the funding table on p. 16.
Received 16 May 2023
Accepted 14 July 2023
Published 11 September 2023
Copyright © 2023 Cerri et al. This is an open-access
article distributed under the terms of the Creative
Commons Attribution 4.0 International license.
Downloaded from https://journals.asm.org/journal/spectrum on 12 September 2023 by 204.217.148.198.
Coronaviruses (order: Nidovirales; family: Coronaviridae) are single-stranded positive-
sense RNA viruses with the largest non-segmented RNA viral genomes among
human viruses, ranging between 16 and 31 kb. Due to their large genome size, high
recombination rates, and genomic plasticity, coronaviruses are able to jump cross-spe
cies barriers and rapidly adapt to new hosts (1). Based on their phylogenetic relation
ships and genomic structures, members of the subfamily Orthocoronavirinae have been
divided into four genera: Alphacoronavirus (AlphaCoV) and Betacoronavirus (BetaCoV),
which have been associated with infections in mammals, and Gammacoronavirus
(GammaCoV) and Deltacoronavirus (DeltaCoV), which appear to mainly infect birds (2,
3).
Some AlphaCoVs have been recognized as causative agents of mild respiratory
syndromes in immunocompetent humans (HCoV-NL63 and HCoV-229E) and of serious
respiratory diseases and bowel disorders in livestock, such as transmissible gastroenter
itis coronavirus, porcine epidemic diarrhea virus, and swine acute diarrhea syndrome,
which are responsible for pandemics in pigs and cause signicant economic losses (2,
4). On the other hand, BetaCoVs cause serious diseases in humans, such as severe acute
respiratory syndrome (caused by SARS-CoV), Middle East respiratory syndrome (caused
by MERS-CoV), and coronavirus disease 2019 (COVID-19) (caused by SARS-CoV-2) (4).
A cumulative body of research on coronaviruses has shown that most AlphaCoVs and
BetaCoVs infecting humans jumped and naturalized from animal hosts (2, 5). Bats (order
Chiroptera) have often been reported as the source of zoonotic spillovers due to their
characteristics, such as a relatively long lifespan, capacity of ight, high metabolic rates,
and gregarious social behavior, which make them suitable for hosting and spreading a
wide variety of viruses (6).
According to the database of zoonotic and vector-borne viruses, coronaviruses
represent about 41% (n = 7,446) of all viral sequences globally reported in bats (n
= 18,152), with AlphaCoVs (n = 3,104) appearing to be the most widespread viruses
in these mammals (ZOVER, http://www.mgc.ac.cn/cgi-bin/ZOVER/mainTable.cgi?db=bat,
accessed on 27 March 2023) (7, 8). Due to the geographic origin of the most prominent
zoonotic coronaviruses, the main information comes from studies performed on Old
World bat species. In contrast, so far, less research has been conducted in the Americas
because only a total of 340 coronaviral sequences, mostly of the genus AlphaCoV,
from 39 species of bats from this geographical region belonging to four families
(Molossidae, Mormoopidae, Phyllostomidae, and Vespertilionidae), have been identi
ed (ZOVER, http://www.mgc.ac.cn/cgi-bin/ZOVER/mainTable.cgi?db=bat, accessed on
27 March 2023). Among these, only seven AlphaCoV complete genomes have been
characterized in species of bats of the family Vespertilionidae in North America (the
U.S.) (9, 10) and in vampire bats (family Phyllostomidae) in South America (Peru) (11).
On the other hand, Molossidae (P. Gervais, 1856) is a cosmopolitan family of bats,
widely distributed throughout the world, and often found in tropical and subtropical
regions. Currently, it includes two subfamilies: Tomopeatinae, monotypic and endemic
to Peru, and Molossinae, which is cosmopolitan (12, 13), with seven genera and 20
species recorded in Argentina (12, 14). Therefore, to understand virus ecology within
bat reservoirs, anticipate zoonotic risk, and accelerate the identication of reservoir
hosts following the emergence of the disease, greater eorts are needed for intensive
surveillance of coronaviruses in geographical areas that are understudied.
In line with this, in a previous study, we identied traces of coronavirus RNA in oral/
anal samples of Tadarida brasiliensis (I. Georoy Saint-Hilaire, 1824), an arthropodopha
gous species of bats of the family Molossidae (15). To fully characterize the coronaviruses
identied and to explore other potential transmission routes, here we analyze a total
of 47 fecal samples from three species of bats of the family Molossidae that inhabit
three semiurban or highly urbanized areas of the province of Santa Fe (Argentina). Using
whole viral metagenome analysis, we characterized three novel complete genomes
and six partial sequences of AlphaCoVs in T. brasiliensis and Molossus molossus (Pallas,
1766), which, to our knowledge, represent their rst description in Molossidae bats
Research Article Microbiology Spectrum
Month XXXX Volume 0 Issue 0 10.1128/spectrum.02047-23 2
Downloaded from https://journals.asm.org/journal/spectrum on 12 September 2023 by 204.217.148.198.
from the Americas. In addition, we detected a recombination event in the Spike gene,
which may be involved in past cross-species transmission infections between molossid
and vespertilionid bats. Our ndings increase the knowledge of coronavirus infection
dynamics among bats living in close contact with humans in the Americas and highlight
the need for systematic active surveillance of AlphaCoVs as potential human pathogens
in Argentina.
MATERIALS AND METHODS
Study area, sample collection, and ethics statement
Fecal samples were collected from three bat species of the family Molossidae—T.
brasiliensis, Eumops bonariensis (Peters, 1874), and M. molossus—at three dierent
geographical sites in the province of Santa Fe (Argentina): downtown Rosario (T.
brasiliensis maternal colony), Villarino Park in Zavalla [both sites described previously by
Bolatti et al. (16)], and the Ecological Reserve of the National University of the Littoral in
Santa Fe (31°38′10″S 60°40′31″W). Samples of T. brasiliensis were collected in 2016/2017
and 2017/2018, whereas samples of E. bonariensis and M. molossus were obtained in 2017
(Table 1).
Sample collection was performed as previously described (15, 16). Briey, bats were
manually captured from the walls or using mist nets and placed in individual cotton
bags for the determination of their species based on external and cranial morphometric
characteristics, reproductive condition, sex, and relative age. Fecal drops were collected
from the individual bags using sterile cotton-tipped swabs, suspended in 1 mL of viral
transport media, and stored at 4°C or on dry ice until further processing. Subsequently,
the animals were rehydrated and released.
During this study, every eort was made to minimize animal disturbance and
suering; no breeding or pregnant female bats were captured, and no animals were
harmed or required euthanasia. Sampling was carried out by trained professionals
as approved by the Ministry of Environment of the Argentinian Province of Santa
Fe (content numbers 519/17, 358, and 356) and the Animal Ethics Committee of the
Faculty of Biochemical and Pharmaceutical Sciences of the National University of Rosario
(consent number 6060/243).
Sample processing and viral enrichment
Selected fecal samples from 47 adult individual bats were vortexed to completely
resuspend the material into solution. Subsequently, Hank’s balanced salt solution (HBSS)
was added to each sample to reach 1 mL and further vortexed to create a less viscous
solution. The suspensions were then centrifuged at 10,000 × g for 2 min, and the
supernatants were transferred to fresh tubes and pooled by bat species, collection date,
and site (Table 1). Each pool was ltered through a 0.45-µm pore-size syringe lter (Fisher
Scientic, Pittsburgh, PA) and then centrifuged at 50,000 × g for 3 h at 10°C. Each pellet
was then resuspended in 100 µL of HBSS and frozen at −80°C until further processing
could be performed. Next, to reduce the amount of contaminating host RNA and DNA,
each sample was treated with 14 U of DNase I [New England Biolabs (NEB), Ipswich, MA]
and 20 U of RNase H (NEB), made up to a nal volume of 140 µL in 10× DNase buer
(NEB) and nuclease-free water, and incubated at 37°C for 2 h. Later, total nucleic acids
from viral particles were extracted using the Viral DNA/RNA Kit (Macherey-Nagel, Düren,
Germany), and viral RNA and DNA were eluted to a nal volume of 30 µL and stored at
−80°C until further use.
Library preparation and viral metagenome shotgun sequencing
First-strand cDNA synthesis was performed with SuperScript IV Reverse Transcriptase
(Thermo Scientic, Waltham, MA) and random hexamers (NEB), following the manufac
turer’s recommendations. The synthesis of the second strand of cDNA was performed
Research Article Microbiology Spectrum
Month XXXX Volume 0 Issue 0 10.1128/spectrum.02047-23 3
Downloaded from https://journals.asm.org/journal/spectrum on 12 September 2023 by 204.217.148.198.
using the Second Strand cDNA Synthesis Kit (Thermo Scientic), followed by cDNA
purication with the GeneJET PCR Purication Kit (Thermo Scientic). DNA concentration
was determined using a Qubit uorometer (Thermo Scientic), using the dsDNA High
Sensitivity Qubit Assay Kit (Thermo Scientic), as recommended by the manufacturer.
TABLE 1 Bat samples included in the present study by species, collection site, and date
Source Location Collection date Pool ID Sample ID Bat species Gender
Bat colony Rosario city 11/28/17 1M119 Tadarida
brasiliensis
Female
11/28/17 M120 Female
11/28/17 M122 Female
11/28/17 M123 Female
11/28/17 M124 Female
11/28/17 M125 Female
11/28/17 M127 Female
11/28/17 M128 Female
11/28/17 M132 Female
11/28/17 M133 Female
12/13/16 2M02 Tadarida
brasiliensis
Female
12/13/16 M04 Female
12/13/16 M05 Female
12/13/16 M07 Female
12/13/16 M08 Female
12/13/16 M09 Female
12/13/16 M12 Female
12/13/16 M13 Female
12/13/16 M15 Female
12/13/16 M19 Female
Individual
bats
Villarino Park
Zavalla city
02/03/17 3M69 Eumops
bonariensis
Male
02/03/17 M70 Female
02/03/17 M71 Female
02/03/17 M72 Male
04/13/17 M102 Female
04/13/17 M106 Female
04/12/17 M92 Male
04/12/17 M87 Female
04/13/17 M97 Female
04/13/17 M99 Male
Individual
bats
Ecological
Reserve,
National
University of
the Littoral
Santa Fe city
03/17/17 4M80 Eumops
bonariensis
Female
03/17/17 M81 Female
03/17/17 M82 Female
03/17/17 M83 Female
03/17/17 5M76 Molossus
molossus
Female
03/17/17 M77 Female
03/18/17 M78 Female
03/18/17 M79 Male
Individual
bats
Villarino Park
Zavalla city
04/13/17 6M94 Molossus
molossus
Female
04/13/17 M108 Female
04/12/17 M85 Female
04/12/17 M89 Male
04/12/17 M90 Male
04/13/17 M93 Female
04/13/17 M95 Male
04/13/17 M96 Female
04/13/17 M103 Female
Research Article Microbiology Spectrum
Month XXXX Volume 0 Issue 0 10.1128/spectrum.02047-23 4
Downloaded from https://journals.asm.org/journal/spectrum on 12 September 2023 by 204.217.148.198.
RNA libraries were constructed using the Nextera XT Kit (Illumina, San Diego, CA), and
shotgun libraries were prepared using standard Illumina protocols using 1 ng of cDNA.
Each pool was indexed according to its provenance using Illumina adaptor-specic
indexes, and libraries’ fragment size distribution was analyzed using the 2100 Bioanalyzer
Instrument (Agilent, Santa Clara, CA). Subsequently, the samples were sequenced on the
NextSeq 550 instrument (Illumina) in 150-base paired-end reads.
Metagenomic analysis
Reads were subjected to quality trimming and ltering using the bbduk program
(BBTools v38.42), as described previously (15, 16). Next, de novo nucleotide sequence
assembly was performed with SPAdes v3.15.3 using the metaSPAdes, metaviralSPAdes,
and rnaviralSPAdes parameter options, and MEGAHIT v1.2.9 setting default parameters
(17). Assembled contigs longer than 500 nt were clustered using Gclust v1.0 (18), ltered
using CheckV v0.8.1 (19), and further analyzed. Viral taxonomic classication of the de
novo-assembled contigs was performed using Diamond v0.9.14.115 (20) against the NCBI
nr protein database and BLASTn. The results of viral taxonomic classication were further
summarized to the level of taxonomic families using MEGAN V6.24.0 (21). Contigs related
to the family Coronaviridae were extracted and compared with coronavirus sequences
included in the NCBI database (https://www.ncbi.nlm.nih.gov/) using the Blastn and
BlastX algorithms.
Complete viral genome assembly/scaolding
Contigs that were related to a unique lowest common ancestor (LCA) according to
MEGAN software were aligned and scaolded. Gaps in the Tb1 genome were lled by
sequencing PCR amplicons: ve primer pairs were designed using the contig sequence
as a template and the Primer3 Plus online tool (https://www.primer3plus.com/amplica-
tion; Table S1).
PCRs were performed using a reaction mixture containing 1× PCR buer, 2.5 mM
MgCl2, 0.2 mM dNTPs, 0.8 mM of each primer, and 2.5 U FirePol Taq DNA Polymerase
(Solis Biodyne, Tartu, Estonia), with a cycling program of 5 minutes at 95°C, followed by
40 cycles of 30 seconds at 95°C, 30 seconds at 55°C, and 30 seconds at 72°C, with a
nal extension at 72°C for 5 minutes. PCR amplicons were checked by size determination
under UV light after electrophoresis in a 2% agarose gel and ethidium bromide staining.
Subsequently, PCR amplicons were puried with spin columns (Nucleospin Gel and
PCR Clean-up, Macherey-Nagel) and sequenced using Sanger at a sequencing facility
(Joint Laboratory of Aquatic Biotechnology, Faculty of Biochemical and Pharmaceutical
Sciences, Argentina).
Coverage statistics of the novel genomes were estimated by remapping the trimmed
read data sets to the sequences using Bowtie2 v2.2.6 (22) and by visual inspection with
Ugene (v40.0, Unipro) (23).
Functional annotation
Complete genome sequences of the novel AlphaCoVs were functionally annotated using
the online tool Z-curve 2.1 (http://tubic.tju.edu.cn/sars/) (24) and curated manually with
the aid of NCBI ORFnder, SnapGene Viewer 5.0.6 software (Insightful Science, San Diego,
CA), and Blastp and Blastn algorithms. Genes and transcription regulatory sequences
(TRSs) were located using the CORSID algorithm (25). For each AlphaCoV, the solution
with the highest genome coverage was considered optimal.
Putative structural proteins were analyzed and compared against protein databases
(nr protein sequences) included in the NCBI using the Blastp algorithm. Sizes, genomic
localization, and the 15 expected cleavage sites of the non-structural proteins encoded
by ORF1ab were predicted by Z-curve 2.1 (24). Functional domains of putative non-struc
tural proteins were predicted with InterProScan using the integrated protein databases
TIGRFAMs, SFLD, PANTHER, HAMAP, PRINTS, Pfam, CATH-Gene3D, ProSiteProles, CDD,
SUPERFAMILY, and SMART.
Research Article Microbiology Spectrum
Month XXXX Volume 0 Issue 0 10.1128/spectrum.02047-23 5
Downloaded from https://journals.asm.org/journal/spectrum on 12 September 2023 by 204.217.148.198.
Phylogenetic analysis
The novel genomes and protein-encoding genes (Spike and RdRp) were aligned with
selected context sequences of representative species belonging to the family Coro
naviridae (see Table S2 for accession numbers) using MAFFT v7.453 (26) and Clus
talW algorithm v2.1. The RdRp gene data set was constructed with AlphaCoV partial
sequences from Argentina (n = 38) (27, 28), the U.S. (n = 143), and other countries (n =
21). Sequences from Beta-, Gamma-, and DeltaCoV genera were included as outgroups
(n = 37). Phylogenetic analyses were performed using IQtree v1.6.12 (29), and model
selection was carried out using the built-in ModelFinder function (26). Branch support
was estimated as ultrafast bootstrap support values (30). Pairwise nucleotide similarity
plots of complete viral genomes were generated with Simplot v3.5.1 (31), using a
window and step size of 1,000 bp and 100 bp, respectively.
Recombination analysis
Detection of recombinant segments and localization of recombination breakpoints were
performed using Recombination Detection Program (RDP) v.4 (32), considering the
following methods: RDP (33), GENECONV (34), Bootscan (35), Maxchi (36), Chimaera (37),
SiScan (38), and 3Seq (39). Sequences were treated as linear, and the window size for the
RDP metric was set at 150 bp; all other parameters were left as default. Recombination
events detected by using ve or more methods (P < 0.05) (40), and those encompassing
sequence regions larger than 1,500 bp were considered for further analysis (inclusion
criteria). The data set for recombination analysis was compiled, including full-length
genomic sequences of the AlphaCoV genus retrieved from GenBank, which were aligned
with ClustalW using default parameters. Subsequently, all but one sequence in groups
sharing more than 99% nucleotide identity were discarded, yielding a total of 118
sequences in the nal data set (Table S3).
Nucleotide sequence accession numbers
The novel viral genomes and partial sequences reported in this study are available in
the GenBank/EMBL/DDBJ database with the following accession numbers: OP715781
(Tadarida brasiliensis bat alphacoronavirus 1 isolate Tb1), OP715780 (Tadarida brasilien
sis bat alphacoronavirus 2 isolate Tb2), OP700657 (Tadarida brasiliensis bat alphacor
onavirus 2 isolate Tb3), OP729193 (Tadarida brasiliensis bat alphacoronavirus isolate
Tb4), OP729194 (Tadarida brasiliensis bat alphacoronavirus isolate Tb5), OP839276
(bat alphacoronavirus isolate Mm1), OP839278 (bat alphacoronavirus isolate Mm2),
OP839277 (bat alphacoronavirus isolate Mm3), and OP839279 (bat alphacoronavirus
isolate Mm4). The relevant raw high-throughput sequencing data obtained in this
study were deposited at the NCBI Sequence Read Archives (SRA) under BioProject ID
PRJNA892907.
RESULTS
Three novel full-length and partial AlphaCoV genomes were identied in bats
of the family Molossidae from Argentina
A total of 47 fecal samples, collected from three species of bats (T. brasiliensis, n =
20; E. bonariensis, n = 14; M. molossus, n = 13) belonging to the family Molossidae,
were grouped into six sample pools (Table 1) and included in metagenomic analysis as
described previously (15, 16). Fourteen contigs (483 to 28,790 bp long) related to the
family Coronaviridae were detected in T. brasiliensis and M. molossus samples (pools 1,
2, and 6), whereas no Coronaviridae reads or contigs were identied in samples of E.
bonariensis (pools 3 and 4; Table 2).
Three novel full-length AlphaCoV genomes were identied in T. brasiliensis samples,
with two contigs being assigned to the same AlphaCoV LCAs (MZ081383, KY799179, and
NC022103), which corresponded to complete novel genomes of two viruses, Tadarida
brasiliensis bat alphacoronavirus 2 isolate Tb2 (28,719 bp) and Tb3 (28,790 bp), identied
Research Article Microbiology Spectrum
Month XXXX Volume 0 Issue 0 10.1128/spectrum.02047-23 6
Downloaded from https://journals.asm.org/journal/spectrum on 12 September 2023 by 204.217.148.198.
TABLE 2 Contig characteristics mapped to the family Coronaviridae in each sample poola
Pool Bat host Coronavirus contig ID Length (bp) Average coverage
depth
Genome regions Virus name Collection
year
Isolate
name
Genbank accession
number
1Tadarida brasiliensis k149_1310_3 ag = 1 multi = 11.0000 len = 11528 11,528 10.26 ORF1ab, partial; S, partial Tadarida brasiliensis bat
alphacoronavirus 1
2017 Tb1 OP715781
k149_1373 ag = 1 multi = 14.0000 len = 5133 5,133 11.93 ORF1a, partial
k149_656 ag = 1 multi = 23.0000 len = 3686 3,686 18.27 S, partial; ORF3, par tial
k149_1151 ag = 1 multi = 29.0000 len = 3026 3,026 23.39 E, M, N, ORF7
k149_1155 ag = 1 multi = 11.0000 len = 3009 3,009 9.41 ORF1a, partial
NODE_73_length_2349_cov_2.540000 2,349 8.50 ORF1a, par tial
k149_1770_3 ag = 1 multi = 491.6667 len = 28719 28,719 371.53 Complete genome Tadarida brasiliensis bat
alphacoronavirus 2
2017 Tb3 OP700657
NODE_11_length_6460_cov_13.837290 646 132.35 ORF1ab (Nsp16), partial; S, ORF3, E
and M complete genes
Tadarida brasiliensis bat
alphacoronavirus
2017 Tb4 OP729193
k149_1346_ag_0_multi_129.0000_len_5703 5,703 176.01 ORF1ab (Nsp16), partial; S and ORF3
complete genes
Tadarida brasiliensis bat
alphacoronavirus
2017 Tb5 OP729194
2Tadarida brasiliensis k149 2895 two ag = 1 multi = 892.0000 len = 28811 28,790 676.85 Complete genome Tadarida brasiliensis bat
alphacoronavirus 2
2016 Tb2 OP715780
3Eumops bonariensis Not detected
4Eumops bonariensis Not detected
5Molossus molossus Not detected
6Molossus molossus NODE 148 length 1094 cov 1.167839 1,094 3.68 ORF1ab, partial Bat alphacoronavirus 2017 Mm1 OP839276
k149 1587 ag = 1 multi = 2.0000 len = 599 597 2.74 ORF1ab, partial Bat alphacoronavirus 2017 Mm2 OP839278
k149 101 ag = 1 multi = 3.0000 len = 532 532 4.20 S gene, partial Bat alphacoronavirus 2017 Mm3 OP839277
k149 1871 ag = 1 multi = 3.0000 len = 483 483 3.22 ORF1ab, partial Bat alphacoronavirus 2017 Mm4 OP839279
aNovel AlphaCoV sequences identied in this work are given in italics.
Research Article Microbiology Spectrum
Month XXXX Volume 0 Issue 0 10.1128/spectrum.02047-23 7
Downloaded from https://journals.asm.org/journal/spectrum on 12 September 2023 by 204.217.148.198.
in Pools 1 and 2, respectively (Table 2). In addition, Pool 1 contained several additional
contigs, which were assigned to another unique AlphaCoV LCA (MW924112; strain
HCQD2020). These contigs were scaolded by alignment to the LCA, and the gap regions
were completed with Sanger sequences of PCR amplicons (ve amplicons; sizes ranging
from 501 to 600 bp). Finally, the complete genome sequence Tb1 (28,844 bp) of a novel
AlphaCoV was obtained (Tadarida brasiliensis bat alphacoronavirus 1 isolate Tb1). The
novel AlphaCoVs exhibited G + C contents of 40.8%, 43.2%, and 43.3% for Tb1, Tb2, and
Tb3, respectively.
Finally, an additional six partial sequences that corresponded to structural and
non-structural genes of AlphaCoV (Table 2; Fig. 1) were found, with two contigs
approximately 6,000 bp long related to LCA MK472070 identied in T. brasiliensis (Pool 1)
and four contigs ranging from 483 to 1,094 bp related to LCAs NC022103 and MW924112
detected in M. molossus (Pool 6).
The novel AlphaCoVs Tb1, Tb2, and Tb3 encode all ve characteristic
coronavirus open reading frames (ORFs)
Sequence annotation and BLASTP analysis showed that all novel viruses encoded the ve
characteristic ORFs found in Coronaviridae family, including replicase polyprotein Orf1ab,
Spike glycoprotein (S), envelope (E), membrane (M), and nucleocapsid (N) proteins (Fig.
1). TRS locations were predicted to conrm gene locations (Table 3). The “TTTAAAC”
FIG 1 Genome organization of novel Alphacoronavirus genomes and sequences identied in T. brasiliensis. S, Spike; E, envelope; M, membrane; N, nucleocapsid.
Research Article Microbiology Spectrum
Month XXXX Volume 0 Issue 0 10.1128/spectrum.02047-23 8
Downloaded from https://journals.asm.org/journal/spectrum on 12 September 2023 by 204.217.148.198.
conservative heptameric sequence between Orf1a and Orf1b, required for −1 ribosomal
frameshift Orf1b expression (41), was present in all three novel AlphaCoVs. Two putative
accessory genes (ORF3 located between S and E, and ORF7 located downstream from
N gene) were also identied in all novel AlphaCoVs (Table 3). Blastn and BlastX searches
showed low similarities of the ORF7 sequences of Tb2 and Tb3 to the most closely
related database proteins (34% identity with NS7 protein Megaderma bat coronavirus;
URD31312.1), and an additional putative ORF8 was recognized in Tb2 and Tb3, which
also did not retrieve homological sequences in the databases. Furthermore, analysis of
the replicase polyprotein (Orf1ab) showed the typical 16 putative non-structural proteins
(Nsp1–Nsp16) with their corresponding cleavage sites (Table 4).
Phylogenetic analysis shows two AlphaCoV lineages simultaneously
circulating in the colony of T. brasiliensis
All three novel AlphaCoVs phylogenetically positioned outside the 15 subgenera
currently recognized by the International Committee on Taxonomy of Viruses (ICTV; Fig.
2A). In addition, none of them were positioned alongside the AlphaCoV identied in a
Chaerephon plicatus (Buchannan, 1800) bat, and so far, the only AlphaCoV that has been
reported in molossids. In fact, Tb1 gravitated more toward viruses identied in bats of
the genus Eptesicus from the U.S. and South Korea. This group appeared to be related to
the AlphaCoV subgenus Myotacovirus and viruses identied in bats of the genus Myotis
from China and Denmark (Fig. 2A). On the other hand, Tb2 and Tb3 appeared to be
variants of the same virus, forming a novel monophyletic clade, close to the subgenus
Colacovirus, sharing between 98% and 100% amino acid (aa) and 97% nt similarity along
the genome, with the exception of the Spike gene (specically, along the S1 domain),
with an aa similarity of 91.3% (85.8% in nt; Fig. S1). Interestingly, Tb2 and Tb3 were found
in the same bat colony, in pools from dierent collection seasons: Pool 1 in 2016 and Pool
2 in 2017 (Table 2).
Pairwise aa comparisons of the replicase polyprotein pp1ab conserved domains
(Table S4) showed 95.8% aa identity of Tb1 with a bat coronavirus (OL415262) identi
ed in Eptesicus fuscus (Beauvois, 1796) from the U.S. and 84.2% aa identity for both
Tb2 and Tb3 with the prototype of the subgenus Decacovirus identied in Rhinolophus
ferrumequinum (Schreber, 1774) in China (NC028814). Considering the current criterion
established by the ICTV for species demarcation (42) (sequences with <92.5% aa identity
in this region with respect to other known AlphaCoV isolates, https://ictv.global/report/
chapter/coronaviridae/coronaviridae, accessed on 14 March 2023), it is possible that Tb1
is a member of the same species of Eptesicus coronaviruses, whereas Tb2 and Tb3 could
be considered prototypes of a novel species within the genus AlphaCoV.
To explore phylogenetic associations in the Spike protein, Tb4 and Tb5 partial
sequences were also included in the data set (Fig. 2; Fig. S2). Although T. brasiliensis
genomes clustered with the same viruses as the full-length genome tree (Fig. 2A), their
TABLE 3 Putative ORFs and TRS positions of the novel AlphaCoVsa
Putative
ORFs
Tb1 Tb2 Tb3
Length
(nt/aa)
TRS
location
TRS sequence(s)
(Distance to ATG)
Length
(nt/aa)
TRS
location
TRS sequence(s)
(Distance to ATG)
Length
(nt/aa)
TRS
location
TRS sequence(s)
(Distance to ATG)
ORF1ab 20,595/6,864 83 TCAACTAAACGA(218)ATG 20,447/6,815 76 TCTCAACTAAAC(217)ATG 20,447/6,815 78 TCTCAACTAAAC(217)ATG
S 4,044/1,347 20.895 TCAACCAAATG 4,305/1,434 20.738 ATTCAACTAAATAAAACTATG 4,344/1,447 2.074 ATTCAACTAAATAAAATG
ORF3 675/224 24.896 TCAACTAAACT (36)ATG 684/227 25.016 CATCAACTAAAC (37)ATG 684/227 25.054 CATCAACTAAAAC (37)ATG
E 228/75 25.593 AAAACTTTACGAAGATG 228/75 25.714 GTTCAACTTGACGAATATG 228/75 25.752 GTTCAACTTGACGAATATG
M 678/225 25.831 CTAACTAAATCAAAATG 771/256 25.953 TCTAAACGAAAATG 768/255 25.991 TCTAAACGAAATG
N 1,125/374 26.523 TCAATTAAACA (6)ATG 1,308/435 26.729 TCTAAACTAAACAAAATG 1,308/435 26.764 TCTAAACTAAACAAAATG
ORF7 828/275 27.657 CCAACTAAACATG 381/126 28.050 AATCAACTAAAACATG 381/126 28.085 AATCAACTAAAACATG
ORF8 - - - 144/47 28.335 TCCACAACCACCT(98)ATG 144/47 28.370 TCCACAACCACCT(98)ATG
aTRS: transcription regulatory sequences. TRS: core sequences are underlined.
Research Article Microbiology Spectrum
Month XXXX Volume 0 Issue 0 10.1128/spectrum.02047-23 9
Downloaded from https://journals.asm.org/journal/spectrum on 12 September 2023 by 204.217.148.198.
TABLE 4 Putative non-structural proteins (NSPs) and cleavage sites of polyproteins 1a and 1ab of the novel AlphaCoVsa
Putative
Nsp
Tb1 Tb2 Tb3
Putative protein function and functional
domains (InterPro entry accession)
First–last amino
acid residues
Protein
size Cleavage sequence
First–last amino
acid residues
Protein
size Cleavage sequence
First–last amino acid
residues
Protein
size Cleavage sequence
Nsp 1 311–641 110 FGHCGG|TPCVNT 303–632 110 FGRRGG|NVVYVD 305–634 110 FGRRGG|NVVYVD Host gene expression supression. IPR046443
Nsp 2 642–2974 778 FTFKRG|GGV TFG 633–2,975 781 YRKKGG|GGVAFA 635–2,977 781 YRKKGG|GGVAFA Unknown function. IPR044385
Nsp 3
2,975–8,089 1,705 IVQKSG|SGPPFP 2,976–7,964 1663 ANKKGA|GELREC 2,978–7,966 1,663 ANKKGA|GELREC Papain-like protease. IPR013016 (papain-like
protease), IPR044357 (ubiquitin-like domain
1), IPR002589 (Macro domain), IPR044353
(ubiquitin-like domain 2), IPR043611
(C-terminal domain)
Nsp 4
8,090–9,523 478 STLQ|AGLR 7,965–9,398 478 STLQ|SGLR 7,967–9,400 478 STLQ|SGLR Replication-transcription complex formation.
IPR043612 (N-terminal domain), IPR032505
(C-terminal domain)
Nsp 5 9,524–10,429 302 V TLQ|SGRK 9,399–10,304 302 V TLQ|SGKT 9,401–10,306 302 VTLQ|SGKT 3C-like proteinase. IPR008740
Nsp 6
10,430–11,266 279 SSVQ|SKLT 10,305–11,135 277 ST VQ|SKLT 10,307–11,137 277 STVQ|SKLT Double-membrane vesicles induction.
IPR044369
Nsp 7 11,267–11,515 83 AMLQ|SIAS 11,136–11,384 83 TILQ|SVAA 11,138–11,386 83 TILQ|SVAA Viral RNA replication complex. IPR014828
Nsp 8 11,516–12,100 195 VKLQ|NNEI 11,385–11,969 195 VKLQ|NNEI 11,387–11,971 195 VKLQ|NNEI Viral RNA replication complex. IPR014829
Nsp 9
12,101–12,427 109 IRLQ|AGKQ 11,970–12,293 108 VRLQ|AGKQ 11,972–12,295 108 VRLQ|AGKQ Single-stranded RNA-binding viral protein.
IPR014822
Nsp 10 12,428–12,832 135 ANVQ|SFDQ 12,294–12,698 135 TVMQ|SLDT 12,296–12,700 135 TVMQ|SLDT Involved in RNA synthesis. IPR018995
Nsp 11 12,833–12,886 18 - 12,699–12,752 18 - 12,701–12,754 18 - Short peptide at the end of Orf1a
Nsp 12 12,833–15,612 927 TVLQ|ASGM 12,699–15,478 927 T VLQ|AAGL 12,701–15,480 927 TVLQ|AAGL RNA-dependent RNA polymerase. IPR044356
Nsp 13
15,613–17,403 597 ADLQ|ATDG 15,479–17,269 597 SDLQ|SNGD 15,481–17,271 597 SDLQ|SNGD Helicase. IPR044343 (1B domain), IPR027351
(helicase core domain), IPR027352 (ZBD
domain)
Nsp 14
17,404–18,960 519 TRMQ|GLEN 17,270–18,826 519 VNLQ|GLEN 17,272–18,828 519 VNLQ|GLEN Exoribonuclease and Guanine-N7 methyl
transferase. IPR009466
Nsp 15
18,961–20,001 347 PQLQ|SAEW 18,827–19,843 339 PQLQ|SSEW 18,829–19,845 339 PQLQ|SSEW Endoribonuclease. IPR043606 (N-terminal
oligomerization domain), IPR044322
(non-catalytic middle domain), IPR043609
(C-terminal NendoU catalytic domain)
Nsp 16 20,002–20,901 300 - 19,844–20,746 301 - 19,846–20,748 301 - O-methyltransferase. IPR009461
aRepresentative functional domains identied by InterProScan are shown by InterPro accession numbers with its reported function in the databases.
Research Article Microbiology Spectrum
Month XXXX Volume 0 Issue 0 10.1128/spectrum.02047-23 10
Downloaded from https://journals.asm.org/journal/spectrum on 12 September 2023 by 204.217.148.198.
associations with the AlphaCoV subgenera changed, suggesting dierent evolutionary
forces shaping the Spike gene phylogeny. In particular, Tb1 was related to members of
the subgenera Tegacovirus and Minacovirus, which include AlphaCoVs identied in
animals dierent from bats (Fig. 2B). On the other hand, Tb4 and Tb5 grouped together
with Tb2 and Tb3 into a monophyletic clade, close to the genus Nyctacovirus. The
changes observed in the Spike gene phylogenetic tree topology (Fig. 2B; Fig. S2) suggest
that the novel viruses could be involved in recombination events and deserve further
analysis.
Finally, the phylogenetic relationships of partial RdRp genes were investigated in
order to explore the associations of the novel viruses with the recently described
AlphaCoV lineages circulating in bats from the Americas (43). As shown in Fig. 3,
Tb1 clustered into clade A, together with other AlphaCoV sequences identied in T.
brasiliensis individuals from Argentina, whereas Tb2 and Tb3 variants grouped into clade
B, closely related to strains previously reported in T. brasiliensis, Myotis spp., and Molossus
spp. individuals from Argentina.
Altogether, these ndings indicate that two AlphaCoV lineages are circulating in the T.
brasiliensis colony, with the Tb2/Tb3 lineage possibly involved in persistent infections.
Local sequence context convergence in the Spike gene suggests proxied
recombinant transfer between Tb1 and an Eptesicus bat AlphaCoV
To investigate whether the novel viral genomes identied herein belong to recombinant
AlphaCoV lineages, they were analyzed with selected AlphaCoV context sequences using
RDP software. Overall, 97 statistically signicant events were detected using ve or more
methods, of which 38 met the inclusion criteria (recombinant region length >1,500 bp;
Table S5). A single recombination event that involved the Spike gene in one of the
novel genomes (Tb1) was found with six out of seven methods (P-values ranging
from 1.31 × 10−51 to 2.54 × 10−3; Fig. 4, upper panel; Table S5). There was a local
sequence convergence around the Spike gene between the Eptesicus bat coronavirus
strain 16964 (OL410609; recognized as the putative recombinant) detected in South
Dakota in 2020, globally most closely related to the Eptesicus bat coronavirus strain
15712 (OL410607; recognized as the putative major parent), and the novel isolate
FIG 2 Phylogenetic analysis of novel AlphaCoVs identied in this work and representative viruses from dierent subgenera. Phylogenetic trees of (A) the
full-length virus genomes (nt) and (B) the spike protein of AlphaCoVs (aa). For the phylogenetic tree of the Spike gene (nt), see Fig. S2. The phylogenetic
trees were constructed using IQtree v1.6.12 (29) with 1,000 UFBootstrap (30) and SH-aLRT branch test replicates. The phylogenetic model GTR was chosen as
the best-tting model. All trees were rooted using BetaCoVs as outgroups. Tree visualization was facilitated using Figtree v1.4.4 (https:/github.com/rambaut/g-
tree.git, accessed on 25 September 2022). AlphaCoV subgenera (orange) and BetaCoVs (green) are shown. Newly identied AlphaCoVs are given in bold. Node
bootstrap support values <60 are not shown. Branch lengths are scaled according to the number of substitutions per site.
Research Article Microbiology Spectrum
Month XXXX Volume 0 Issue 0 10.1128/spectrum.02047-23 11
Downloaded from https://journals.asm.org/journal/spectrum on 12 September 2023 by 204.217.148.198.
Tb1 (OP715781; recognized as the putative minor parent; Fig. 4, bottom panel). The
recombination hypothesis was further reinforced with local tree incongruence analysis
(Fig. 5).
The recombinant segment extended between 21,796 and 23,414 bp in the recombi
nant sequence and represented a 1,618-nt fragment within the Spike coding region,
encompassing part of the C-terminal S1 and the N-terminal S2 subdomains. Nucleotide
sequence similarities between the genomes involved in the recombination event ranged
from 79.8% to 93.9% at the full-genome level (data not shown). Of note, the relatively
FIG 3 Phylogenetic tree by maximum likelihood based on partial RdRp gene sequences from the Americas and worldwide. Sequences identied in this work
are given in blue. The data set included sequences from the Americas (black), sequences from other reports from Argentina (orange), and reference AlphaCoVs
(red). GammaCoV and DeltaCoV genera were used as outgroups and are shown collapsed. Clades A–G previously dened by others are shown (43). Nodes with
bootstrap support values > 99 are represented with black dots. Branch lengths are scaled according to the number of substitutions per site.
Research Article Microbiology Spectrum
Month XXXX Volume 0 Issue 0 10.1128/spectrum.02047-23 12
Downloaded from https://journals.asm.org/journal/spectrum on 12 September 2023 by 204.217.148.198.
low mid-range pairwise nt similarity between Tb1 and OL410609 at the recombinant
segment (79%, data not shown) could be consistent with a proxied recombinant transfer
scenario.
DISCUSSION
To date, coronavirus studies carried out on bats from Argentina have corresponded to
surveillance campaigns based on the detection and sequencing of a conserved RdRp
region (27, 28). This strategy has been useful in exploring the presence, diversity, and
phylogenetic relationships of coronaviruses circulating in some species of bats. However,
these approaches do not reect the full evolutionary history and diversity of these
viruses and do not allow the study of recombination as a mechanism shaping the
phylogeny of the family Coronaviridae. In addition, highly divergent coronaviruses might
remain undetected because the majority of bat-CoV sequences that are available in
public databases have been generated with directed primers (44).
Even though AlphaCoV and BetaCoV genera have been detected in bats worldwide,
AlphaCoVs might be more diverse, common, and widespread (3). In fact, more than 80%
of coronavirus sequences identied in American bats belong to the genus AlphaCoV
(45). In this study, using a viral particle enrichment strategy and viral (meta)genome
shotgun sequencing, we found evidence of AlphaCoV infection in the feces of two out
of the three species of bats of the family Molossidae investigated: T. brasiliensis and
M. molossus. We identied and characterized three novel AlphaCoVs from the colony
of T. brasiliensis at Rosario, which, to our knowledge, are the rst full-length genomes
FIG 4 Characterization of a recombination event involving the novel AlphaCoV Tb1. The recombination methods that provided statistically signicant P-values
are indicated (upper panel). Relative pairwise identities between the recombinant and minor parent (purple), the recombinant and major parent (blue), and both
parents (yellow) are shown (bottom panel). The region between the recombination breakpoints is shaded and limited by dashed lines in the Tb1 genomic map.
Limits of the Spike gene and S1/S2 subdomains are also shown.
Research Article Microbiology Spectrum
Month XXXX Volume 0 Issue 0 10.1128/spectrum.02047-23 13
Downloaded from https://journals.asm.org/journal/spectrum on 12 September 2023 by 204.217.148.198.
reported in this family of bats in the Americas. We also provided the rst evidence of
AlphaCoV infection in M. molossus individuals inhabiting the province of Santa Fe, but
the sequences recovered were too short to accurately and comprehensively evaluate
their phylogenetic relationships. Therefore, wider sampling eorts are required to obtain
full genomes of viruses infecting this species of bats and to increase knowledge of the
coronavirus diversity of the family Molossidae in the Americas.
Isolates Tb1, Tb2, and Tb3 exhibited the typical genome organization found in the
genus AlphaCoV, with ve common ORFs, 16 typical putative non-structural proteins of
the Orf1ab polyprotein (42, 46, 47), and accessory proteins. The phylogenomic analysis
showed that all novel AlphaCoVs fell outside the current recognized subgenera, with
isolates Tb2 and Tb3 most probably constituting novel putative species according to the
ICTV demarcation criteria (42). In addition, the novel AlphaCoVs were positioned into two
dierent lineages: the Tb1 lineage, which was closely related to viruses identied in bats
of the genus Eptesicus from the U.S. and South Korea, and the Tb2/Tb3 lineage, which
grouped together with Myotis AlphaCoVs from the U.S. This observation was conrmed
by the RdRp phylogenetic tree because the Tb1 isolate grouped into the previously
proposed clade A, whereas Tb2 and Tb3 isolates clustered together in clade B with
sequences identied in molossid bats from Argentina (43). In contrast, none of the novel
viruses were closely related to the AlphaCoV identied in a molossid bat from China
(5), suggesting that coronavirus circulation might probably be related to geographical
distribution and virus-host co-divergence, as reported previously (27, 48). Indeed, it has
been proposed that E. fuscus (U.S.) and E. serotinus (South Korea) may be conspecic
(49), implying a single Eptesicus AlphaCoV species (10). Interestingly, isolate Tb1 is also
highly similar to Eptesicus AlphaCoV sequences, suggesting a possible host jump event
between both bat species. In line with this, previous studies proposed that AlphaCoV
cross-species transmission might have occurred between Molossidae and Vespertilioni
dae bat families in the past (43).
Cross-species transmission has been considered a common evolutionary force during
coronavirus evolution, with the events mentioned more likely occurring between
sympatric bat hosts (48). In fact, roost sharing among individuals of T. brasiliensis and
E. fuscus has been reported at the Desert Museum of Tucson, Arizona, in Ensenada
(Baja California, Mexico) (50) and in caves of Jalisco (Mexico) (51). Moreover, habitat
FIG 5 Phylogenetic tree incongruence analysis. Maximum likelihood trees from REGION 1 (nt positions 1–21,795), REGION 2 (nt positions 21,796–23,414), and
REGION 3 (nt positions 23,415–28,340). The recombinant strain is indicated in bold; the major and minor parents are indicated in blue and purple, respectively.
For clarity, AlphaCoV subgenera and related sequences have been collapsed. Nodes with bootstrap support values >90 are represented with black dots.
Research Article Microbiology Spectrum
Month XXXX Volume 0 Issue 0 10.1128/spectrum.02047-23 14
Downloaded from https://journals.asm.org/journal/spectrum on 12 September 2023 by 204.217.148.198.
sharing has been proposed as a key factor that increases the likelihood of viral sharing
among species of bats (52) and is a prerequisite for recombination(s) to occur. In line
with this observation, a putative recombination event has been detected in the Spike
gene, involving the novel Tb1 and two E. fuscus AlphaCoVs (OL410609 and OL410607),
identied in South Dakota in 2020.
The levels of global (along the complete genome) and local (at the recombi
nant segment) pairwise sequence similarities suggested a scenario involving proxied
recombinant transfer in which the transferred sequence context is part of a larger gene
pool that could span viruses infecting co-roosting bats. On the other hand, although
no recombination events involving Tb2 and Tb3 isolates were detected in this data set
analysis, the dissimilarity of their Spike genes suggested a past recombination event
of unknown origin. Nevertheless, it is possible that the parental viruses have not been
identied yet, and the possibility of cumulative nucleotide substitutions in the Spike
gene, due to their likely involvement in persistent infections, cannot be excluded, as
observed in previous studies of AlphaCoV persistence in natural (53, 54) and articial
populations of Myotis (9, 55).
Interestingly, the putative recombinant regions—one involving Tb1 detected by
RDP and hypothetical Tb2/Tb3—spanned the S1 subdomain of the Spike gene, which
encompassed the potential receptor-binding domain (RBD) of AlphaCoVs. The transfer
of small sections of Spike protein during recombination in a coinfection, particularly
involving the RBD domain, may be benecial for the virus to broaden its host range
and in intra-host immune suppression (56). Moreover, phylogenetic analysis of the Spike
protein showed changes in the topology with respect to the full-length genome tree,
in agreement with previous observations (5, 57). In fact, this split in the phylogenetic
history of the Spike proteins is characteristic of the family Coronaviridae (42), suggesting
that the Spike gene and the rest of the genome have distinct evolutionary patterns. This
semi-independent evolution of structural and non-structural genes might be a common
strategy of RNA viruses (58, 59).
Because susceptible newborn bats would amplify the virus due to their immature
immune system, infecting adult females, it has been proposed that maternal colonies
play an important role in maintaining coronavirus infection at the population level (16,
60, 61). In contrast, non-gregarious bats would experience mostly self-limited infections
(54, 61). Of note, the novel AlphaCoVs identied in the maternal colony of T. brasiliensis
had high sequence depth, suggesting that the animals may be shedding the virus, as was
observed previously with a circovirus infection (16). In light of these observations, further
eorts are needed to elucidate the transmission dynamics of bat-borne viruses in South
America, underscoring longitudinal studies to understand their maintenance patterns
and zoonotic potential.
Conclusions
This study generated three novel complete AlphaCoV genomes identied in individuals
of T. brasiliensis, which showed two dierent evolutionary patterns and are the rst
to be reported in the family Molossidae in the Americas. In addition, the Tb1 isolate
was involved in a putative recombination event with AlphaCoVs identied in bats
of the genus Eptesicus from the U.S., whereas Tb2 and Tb3 isolates were found in
dierent collection seasons and might be involved in persistent viral infections in the
bat colony. These ndings contribute to the knowledge of the global diversity of bat
coronaviruses in poorly studied species and highlight the dierent evolutionary aspects
of AlphaCoVs circulating in bat populations in Argentina. Greater eorts are needed for
long-term surveillance and full-genome characterization to better understand corona
virus evolution in bat populations in the Americas and to elucidate the mechanisms
involved in facilitating cross-species transmission.
Research Article Microbiology Spectrum
Month XXXX Volume 0 Issue 0 10.1128/spectrum.02047-23 15
Downloaded from https://journals.asm.org/journal/spectrum on 12 September 2023 by 204.217.148.198.
ACKNOWLEDGMENTS
The authors thank Irene Villa, German Saigo, Mauricio Taborda, and Valeria Olivera for
collecting and processing the bat samples.
This research was funded by (i) the National Agency for the Promotion of Science and
Technology (PICT-2019–01790; PICT-2020–00571); (ii) the European Society of Clinical
Microbiology and Infectious Diseases (ESCMID) Observership Program, granted to
Agustina Cerri (ESCMID Observership no. 1971); and (iii) the Slovenian Research Agency,
grant no. P3-00083. Agustina Cerri was supported by doctoral fellowships from CONICET.
A.C.: conceptualization, investigation, methodology, and writing—original draft
preparation; E.M.B.: conceptualization, formal analysis, resources, methodology,
writing—original draft preparation, and review and editing; T.M.Z.: conceptualization,
methodology, formal analysis, visualization, and writing—original draft preparation;
A.R.: conceptualization, resources, and writing—review and editing; M.E.M.: resources
and writing—review and editing; L.H.: writing—review and editing; P.E.C.: conceptualiza
tion, visualization, and writing—review and editing; V.D.D.: resources; R.M.B.: resources
and writing—review and editing; M.P.: conceptualization, supervision, resources, and
writing—review and editing; and A.A.G.: conceptualization, supervision, resources, and
writing—review and editing. All authors have read and agreed to the published version
of the manuscript.
The authors declare no conict of interest. The funders had no role in the design of
the study; collection, analyses, or interpretation of data; writing of the manuscript; or the
decision to publish the results.
AUTHOR AFFILIATIONS
1Human Virology Group, Rosario Institute of Molecular and Cellular Biology (IBR-CONI
CET), Rosario, Argentina
2Virology Area, Faculty of Biochemical and Pharmaceutical Sciences, National University
of Rosario, Rosario, Argentina
3Bat Conservation Program of Argentina, San Miguel de Tucumán, Argentina
4Institute of Microbiology and Immunology, Faculty of Medicine, University of Ljubljana,
Ljubljana, Slovenia
5Dr. Ángel Gallardo Provincial Museum of Natural Sciences, Rosario, Argentina
6Argentine Biodiversity Research Institute (PIDBA), Faculty of Natural Sciences, National
University of Tucumán, San Miguel de Tucumán, Argentina
7Institute of Virology and Technological Innovations (INTA/CONICET), Castelar, Argentina
8Robert Koch Institute, Berlin, Germany
9DETx MOL S.A. La Segunda Núcleo Corporate Building, Alvear, Argentina
AUTHOR ORCIDs
Elisa M. Bolatti http://orcid.org/0000-0001-6467-0650
Adriana A. Giri http://orcid.org/0000-0003-4925-9075
FUNDING
Funder Grant(s) Author(s)
Agencia Nacional de Promoción de la
Investigación, el Desarrollo Tecnológico y la
Innovación (Agencia I+D+i)
PICT-2019-01790 Elisa M. Bolatti
Agencia Nacional de Promoción de la
Investigación, el Desarrollo Tecnológico y la
Innovación (Agencia I+D+i)
PICT-2020-00571 Adriana A. Giri
European Society of Clinical Microbiology
and Infectious Diseases (ESCMID)
Observership no. 1971 Agustina Cerri
Research Article Microbiology Spectrum
Month XXXX Volume 0 Issue 0 10.1128/spectrum.02047-23 16
Downloaded from https://journals.asm.org/journal/spectrum on 12 September 2023 by 204.217.148.198.
Funder Grant(s) Author(s)
Slovenska Akademija Znanosti in Umetnosti
(SAZU)
P3-00083 Mario Poljak
Consejo Nacional de Investigaciones
Cientícas y Técnicas (CONICET)
Ph.D fellow Agustina Cerri
Consejo Nacional de Investigaciones
Cientícas y Técnicas (CONICET)
Ph.D fellow Violeta Di
Domenica
AUTHOR CONTRIBUTIONS
Agustina Cerri, Conceptualization, Investigation, Methodology, Writing – original draft
| Elisa M. Bolatti, Conceptualization, Formal analysis, Methodology, Resources, Writing
– original draft, Writing – review and editing | Tomaz M. Zorec, Conceptualization,
Formal analysis, Methodology, Visualization, Writing – original draft | Maria E. Mon
tani, Resources, Writing – review and editing | Agustina Rimondi, Conceptualization,
Resources, Writing – review and editing | Lea Hosnjak, Writing – review and editing |
Pablo E. Casal, Conceptualization, Visualization, Writing – review and editing | Violeta Di
Domenica, Resources | Ruben M. Barquez, Resources, Writing – review and editing | Mario
Poljak, Conceptualization, Resources, Supervision, Writing – review and editing | Adriana
A. Giri, Conceptualization, Resources, Supervision, Writing – review and editing
DATA AVAILABILITY
The sequences of novel viruses reported in this article are openly available in
the GenBank/EMBL/DDBJ database with the following accession numbers: OP715780–
OP715781, OP700657, OP729193–OP729194, and OP839276–OP839279. The relevant
raw high-throughput sequencing data obtained in this study were deposited at the NCBI
Sequence Read Archives (SRA) under BioProject ID PRJNA892907.
ETHICS APPROVAL
The animal study protocol was approved by the Ministry of Environment of the
Argentinian Province of Santa Fe (Files 519/17 and 356) and the Animal Ethics Commit
tee of the Faculty of Pharmaceutical and Biochemical Sciences (National University of
Rosario, Rosario, Argentina, File 6060/243).
ADDITIONAL FILES
The following material is available online.
Supplemental Material
Fig. S1 (Spectrum02047-23-S0001.tif). Sequence nucleotide similarity between Tb2 and
Tb3.
Fig. S2 (Spectrum02047-23-S0002.tif). Phylogenetic tree of the Spike gene (nt).
Table S1 (Spectrum02047-23-S0003.docx). Sequences of primers designed using
Primer3 Plus tool.
Table S2 (Spectrum02047-23-S0004.docx). CoV sequences used for phylogenetic
analysis.
Table S3 (Spectrum02047-23-S0005.docx). AlphaCoVs sequences used in the recombi
nation analysis.
Table S4 (Spectrum02047-23-S0006.docx). Pairwise amino acid comparisons of the
replicase polyprotein pp1ab conserved domains of the AlphaCoVs sequences.
Table S5 (Spectrum02047-23-S0007.docx). Recombination events meeting the
inclusion criterion.
Research Article Microbiology Spectrum
Month XXXX Volume 0 Issue 0 10.1128/spectrum.02047-23 17
Downloaded from https://journals.asm.org/journal/spectrum on 12 September 2023 by 204.217.148.198.
Open Peer Review
PEER REVIEW HISTORY (review-history.pdf). An accounting of the reviewer comments
and feedback.
REFERENCES
1. Graham RL, Baric RS. 2010. Recombination, reservoirs, and the modular
spike: mechanisms of coronavirus cross-species transmission. J Virol
84:3134–3146. https://doi.org/10.1128/JVI.01394-09
2. Cui J, Li F, Shi Z-L. 2019. Origin and evolution of pathogenic coronavi
ruses. Nat Rev Microbiol 17:181–192. https://doi.org/10.1038/s41579-
018-0118-9
3. Wong ACP, Li X, Lau SKP, Woo PCY. 2019. Global epidemiology of bat
coronaviruses. Viruses 11:174. https://doi.org/10.3390/v11020174
4. Ghai RR, Carpenter A, Liew AY, Martin KB, Herring MK, Gerber SI, Hall AJ,
Sleeman JM, VonDobschuetz S, Behravesh CB. 2021. Animal reservoirs
and hosts for emerging alphacoronaviruses and betacoronaviruses.
Emerg Infect Dis 27:1015–1022. https://doi.org/10.3201/eid2704.203945
5. Zhou H, Ji J, Chen X, Bi Y, Li J, Wang Q, Hu T, Song H, Zhao R, Chen Y, Cui
M, Zhang Y, Hughes AC, Holmes EC, Shi W. 2021. Identication of novel
bat coronaviruses sheds light on the evolutionary origins of SARS-CoV-2
and related viruses. Cell 184:4380–4391. https://doi.org/10.1016/j.cell.
2021.06.008
6. Luis AD, Hayman DTS, O’Shea TJ, Cryan PM, Gilbert AT, Pulliam JRC, Mills
JN, Timonin ME, Willis CKR, Cunningham AA, Fooks AR, Rupprecht CE,
Wood JLN, Webb CT. 2013. A comparison of bats and rodents as
reservoirs of zoonotic viruses: are bats special?. Proc Biol Sci
280:20122753. https://doi.org/10.1098/rspb.2012.2753
7. Chen L, Liu B, Yang J, Jin Q. 2014. DBatVir: the database of bat-associated
viruses. Database (Oxford) 2014:bau021. https://doi.org/10.1093/
database/bau021
8. Zhou S, Liu B, Han Y, Wang Y, Chen L, Wu Z, Yang J. 2022. ZOVER: the
database of zoonotic and vector-borne viruses. Nucleic Acids Res
50:D943–D949. https://doi.org/10.1093/nar/gkab862
9. Subudhi S, Rapin N, Bollinger TK, Hill JE, Donaldson ME, Davy CM,
Warnecke L, Turner JM, Kyle CJ, Willis CKR, Misra V. 2017. A persistently
infecting coronavirus in hibernating Myotis lucifugus, the North
American little brown bat. J Gen Virol 98:2297–2309. https://doi.org/10.
1099/jgv.0.000898
10. Schaeer R, Temeeyasen G, Hause BM. 2022. Alphacoronaviruses are
common in bats in the upper midwestern United States. Viruses 14:184.
https://doi.org/10.3390/v14020184
11. Bergner LM, Mollentze N, Orton RJ, Tello C, Broos A, Biek R, Streicker DG.
2021. Characterizing and evaluating the zoonotic potential of novel
viruses discovered in vampire bats. Viruses 13:252. https://doi.org/10.
3390/v13020252
12. Barquez R, Díaz M, Pérez J, Montani ME. 2020. Nueva guía de los
murciélagos de Argentina. PCMA.
13. Eger JL. 2007. Family Molossidae, p 399–440. In Gardner AL (ed),
Mammals of South America. Shrews, and Bats, Univ Chicago Press,
Chicago, U.S.
14. Montani ME, Tomasco IH, Barberis IM, Romano MC, Barquez RM, Díaz
MM, Baird A. 2021. A new species of Molossus (Chiroptera: Molossidae)
from Argentina. J Mammal 102:1426–1442. https://doi.org/10.1093/
jmammal/gyab078
15. Bolatti EM, Zorec TM, Montani ME, Hošnjak L, Chouhy D, Viarengo G,
Casal PE, Barquez RM, Poljak M, Giri AA. 2020. A preliminary study of the
virome of the South American free-tailed bats (Tadarida brasiliensis) and
identication of two novel mammalian viruses. Viruses 12:422. https://
doi.org/10.3390/v12040422
16. Bolatti EM, Viarengo G, Zorec TM, Cerri A, Montani ME, Hosnjak L, Casal
PE, Bortolotto E, Di Domenica V, Chouhy D, Allasia MB, Barquez RM,
Poljak M, Giri AA. 2022. Viral metagenomic data analyses of ve new
world bat species from Argentina: identication of 35 novel DNA viruses.
Microorganisms 10:266. https://doi.org/10.3390/microorgan
isms10020266
17. Li D, Liu C-M, Luo R, Sadakane K, Lam T-W. 2015. MEGAHIT: an ultra-fast
single-node solution for large and complex metagenomics assembly via
succinct de Bruijn graph. Bioinformatics 31:1674–1676. https://doi.org/
10.1093/bioinformatics/btv033
18. Li R, He X, Dai C, Zhu H, Lang X, Chen W, Li X, Zhao D, Zhang Y, Han X, Niu
T, Zhao Y, Cao R, He R, Lu Z, Chi X, Li W, Niu B. 2019. Gclust: a parallel
clustering tool for microbial genomic data. Genomics Proteomics
Bioinformatics 17:496–502. https://doi.org/10.1016/j.gpb.2018.10.008
19. Nayfach S, Camargo AP, Schulz F, Eloe-Fadrosh E, Roux S, Kyrpides NC.
2021. CheckV assesses the quality and completeness of metagenome-
assembled viral genomes. Nat Biotechnol 39:578–585. https://doi.org/
10.1038/s41587-020-00774-7
20. Buchnk B, Xie C, Huson DH. 2015. Fast and sensitive protein alignment
using DIAMOND. Nat Methods 12:59–60. https://doi.org/10.1038/nmeth.
3176
21. Huson DH, Auch AF, Qi J, Schuster SC. 2007. MEGAN analysis of
metagenomic data. Genome Res 17:377–386. https://doi.org/10.1101/gr.
5969107
22. Langmead B, Salzberg SL. 2012. Fast gapped-read alignment with
Bowtie 2. Nat Methods 9:357–359. https://doi.org/10.1038/nmeth.1923
23. Okonechnikov K, Golosova O, Fursov M, UGENE team. 2012. Unipro
UGENE: a unied bioinformatics toolkit. Bioinformatics 28:1166–1167.
https://doi.org/10.1093/bioinformatics/bts091
24. Chen L-L, Ou H-Y, Zhang R, Zhang C-T. 2003. ZCURVE_CoV: a new system
to recognize protein coding genes in coronavirus genomes, and its
applications in analyzing SARS-CoV genomes. Biochem Biophys Res
Commun 307:382–388. https://doi.org/10.1016/s0006-291x(03)01192-6
25. Zhang C, Sashittal P, Xiang M, Zhang Y, Kazi A, El-Kebir M. 2022. Accurate
identication of transcription regulatory sequences and genes in
coronaviruses. Mol Biol Evol 39:msac133. https://doi.org/10.1093/
molbev/msac133
26. Katoh K, Standley DM. 2016. A simple method to control over-alignment
in the MAFFT multiple sequence alignment program. Bioinformatics
32:1933–1942. https://doi.org/10.1093/bioinformatics/btw108
27. Caraballo DA, Sabio MS, Colombo VC, Piccirilli MG, Vico L, Hirmas Riade
SM, Campos J, Martínez G, Beltrán F, Baumeister E, Cisterna DM. 2022.
The role of Molossidae and Vespertilionidae in shaping the diversity of
alphacoronaviruses in the Americas. Microbiol Spectr 10:e0314322.
https://doi.org/10.1128/spectrum.03143-22
28. Lucero Arteaga F, Miragaya M, Molina N, Mondino M, Bracamonte C,
Capitelli G, Mundo S, Torres C, Bratanich A. 2023. Identication of
coronaviruses in bats and rodents in northern and central Argentina.
Arch Virol 168:78. https://doi.org/10.1007/s00705-023-05703-y
29. Nguyen L-T, Schmidt HA, von Haeseler A, Minh BQ. 2015. IQ-TREE: a fast
and eective stochastic algorithm for estimating maximum-likelihood
phylogenies. Mol Biol Evol 32:268–274. https://doi.org/10.1093/molbev/
msu300
30. Hoang DT, Chernomor O, von Haeseler A, Minh BQ, Vinh LS. 2018.
UFBoot2: improving the ultrafast bootstrap approximation. Mol Biol Evol
35:518–522. https://doi.org/10.1093/molbev/msx281
31. Lole KS, Bollinger RC, Paranjape RS, Gadkari D, Kulkarni SS, Novak NG,
Ingersoll R, Sheppard HW, Ray SC. 1999. Full-length human immunode-
ciency virus type 1 genomes from subtype C-infected seroconverters in
India, with evidence of intersubtype recombination. J Virol 73:152–160.
https://doi.org/10.1128/JVI.73.1.152-160.1999
32. Martin DP, Murrell B, Golden M, Khoosal A, Muhire B. 2015. RDP4:
detection and analysis of recombination patterns in virus genomes.
Virus Evol 1:vev003. https://doi.org/10.1093/ve/vev003
33. Martin D, Rybicki E. 2000. RDP: detection of recombination amongst
aligned sequences. Bioinformatics 16:562–563. https://doi.org/10.1093/
bioinformatics/16.6.562
34. Padidam M, Sawyer S, Fauquet CM. 1999. Possible emergence of new
geminiviruses by frequent recombination. Virology 265:218–225. https:/
/doi.org/10.1006/viro.1999.0056
Research Article Microbiology Spectrum
Month XXXX Volume 0 Issue 0 10.1128/spectrum.02047-23 18
Downloaded from https://journals.asm.org/journal/spectrum on 12 September 2023 by 204.217.148.198.
35. Martin DP, Posada D, Crandall KA, Williamson C. 2005. A modied
bootscan algorithm for automated identication of recombinant
sequences and recombination breakpoints. AIDS Res Hum Retroviruses
21:98–102. https://doi.org/10.1089/aid.2005.21.98
36. Smith JM. 1992. Analyzing the mosaic structure of genes. J Mol Evol
34:126–129. https://doi.org/10.1007/BF00182389
37. Posada D, Crandall KA. 2001. Evaluation of methods for detecting
recombination from DNA sequences: computer simulations. Proc Natl
Acad Sci U S A 98:13757–13762. https://doi.org/10.1073/pnas.
241370698
38. Gibbs MJ, Armstrong JS, Gibbs AJ. 2000. Sister-scanning: a Monte Carlo
procedure for assessing signals in recombinant sequences. Bioinformat
ics 16:573–582. https://doi.org/10.1093/bioinformatics/16.7.573
39. Boni MF, Posada D, Feldman MW. 2007. An exact nonparametric method
for inferring mosaic structure in sequence triplets. Genetics 176:1035–
1047. https://doi.org/10.1534/genetics.106.068874
40. Bolatti EM, Chouhy D, Casal PE, Pérez GR, Stella EJ, Sanchez A, Gorosito
M, Bussy RF, Giri AA. 2016. Characterization of novel human papillomavi
rus types 157, 158 and 205 from healthy skin and recombination analysis
in genus γ-papillomavirus. Infect Genet Evol 42:20–29. https://doi.org/
10.1016/j.meegid.2016.04.018
41. Kelly JA, Woodside MT, Dinman JD. 2021. Programmed -1 ribosomal
frameshifting in coronaviruses: a therapeutic target. Virology 554:75–82.
https://doi.org/10.1016/j.virol.2020.12.010
42. Woo PCY, de Groot RJ, Haagmans B, Lau SKP, Neuman BW, Perlman S,
Sola I, van der Hoek L, Wong ACP, Yeh S-H. 2023. ICTV virus taxonomy
prole: coronaviridae 2023. J Gen Virol 104. https://doi.org/10.1099/jgv.
0.001843
43. Caraballo DA. 2022. Cross-species transmission of bat coronaviruses in
the Americas: contrasting patterns between alphacoronavirus and
betacoronavirus. Microbiol Spectr 10:e0141122. https://doi.org/10.1128/
spectrum.01411-22
44. Watanabe S, Masangkay JS, Nagata N, Morikawa S, Mizutani T, Fukushi S,
Alviola P, Omatsu T, Ueda N, Iha K, Taniguchi S, Fujii H, Tsuda S, Endoh M,
Kato K, Tohya Y, Kyuwa S, Yoshikawa Y, Akashi H. 2010. Bat coronaviruses
and experimental infection of bats, the Philippines. Emerg Infect Dis
16:1217–1223. https://doi.org/10.3201/eid1608.100208
45. Hernández-Aguilar I, Lorenzo C, Santos-Moreno A, Naranjo EJ, Navarrete-
Gutiérrez D. 2021. Coronaviruses in bats: a review for the Americas.
Viruses 13:1226. https://doi.org/10.3390/v13071226
46. Wang L-F, Anderson DE. 2019. Viruses in bats and potential spillover to
animals and humans. Curr Opin Virol 34:79–89. https://doi.org/10.1016/j.
coviro.2018.12.007
47. Do H-Q, Nguyen V-G, Chung C-U, Jeon Y-S, Shin S, Jang K-C, Pham LBH,
Kong A, Kim C-U, Park Y-H, Park B-K, Chung H-C. 2021. Genomic
characterization of a novel alphacoronavirus isolated from bats, Korea,
2020. Viruses 13:2041. https://doi.org/10.3390/v13102041
48. Leopardi S, Holmes EC, Gastaldelli M, Tassoni L, Priori P, Scaravelli D,
Zamperin G, De Benedictis P. 2018. Interplay between co-divergence
and cross-species transmission in the evolutionary history of bat
coronaviruses. Infect Genet Evol 58:279–289. https://doi.org/10.1016/j.
meegid.2018.01.012
49. Simmons NB. 2005. Order Chiroptera, In Wilson DE, DM Reeder (ed),
Mammal species of the world: a taxonomic and geographic reference,
3rd ed. Johns Hopkins University Press, Baltimore, U.S.
50. Western BWG. 2006. WBWG news Western bat working group
newsletter. WBWG News 3. Available from: https://digitalcommons.usf.
edu/wbwg_news/3
51. Ayala Téllez HL, Iñiguez-Davalos LI, Olvera-Vargas M, Vargas-Contreras
JA, Herrera-Lizaola OA. 2018. Bats associated to caves in Jalisco, Mexico.
THERYA 9:29–40. https://doi.org/10.12933/therya-18-548
52. Willoughby A, Phelps K, Olival K, PREDICT Consortium. 2017. A
comparative analysis of viral richness and viral sharing in cave-roosting
bats. Diversity 9:35. https://doi.org/10.3390/d9030035
53. Jeong J, Smith CS, Peel AJ, Plowright RK, Kerlin DH, McBroom J,
McCallum H. 2017. Persistent infections support maintenance of a
coronavirus in a population of Australian bats (Myotis macropus).
Epidemiol Infect 145:2053–2061. https://doi.org/10.1017/-
S0950268817000991
54. Osborne C, Cryan PM, O’Shea TJ, Oko LM, Ndaluka C, Calisher CH,
Berglund AD, Klavetter ML, Bowen RA, Holmes KV, Dominguez SR. 2011.
Alphacoronaviruses in New World bats: prevalence, persistence,
phylogeny, and potential for interaction with humans. PLoS One
6:e19156. https://doi.org/10.1371/journal.pone.0019156
55. Davy CM, Donaldson ME, Subudhi S, Rapin N, Warnecke L, Turner JM,
Bollinger TK, Kyle CJ, Dorville N-Y, Kunkel EL, Norquay KJO, Dzal YA, Willis
CKR, Misra V. 2018. White-nose syndrome is associated with increased
replication of a naturally persisting coronaviruses in bats. Sci Rep
8:15508. https://doi.org/10.1038/s41598-018-33975-x
56. de Klerk A, Swanepoel P, Lourens R, Zondo M, Abodunran I, Lytras S,
MacLean OA, Robertson D, Kosakovsky Pond SL, Zehr JD, Kumar V,
Stanhope MJ, Harkins G, Murrell B, Martin DP. 2022. Conserved
recombination patterns across coronavirus subgenera. Virus Evol
8:veac054. https://doi.org/10.1093/ve/veac054
57. Zmasek CM, Lefkowitz EJ, Niewiadomska A, Scheuermann RH. 2022.
Genomic evolution of the coronaviridae family. Virology 570:123–133.
https://doi.org/10.1016/j.virol.2022.03.005
58. Casal PE, Chouhy D, Bolatti EM, Perez GR, Stella EJ, Giri AA. 2015.
Evidence for homologous recombination in Chikungunya Virus. Mol
Phylogenet Evol 85:68–75. https://doi.org/10.1016/j.ympev.2015.01.016
59. Vakulenko Y, Deviatkin A, Drexler JF, Lukashev A. 2021. Modular
evolution of coronavirus genomes. Viruses 13:1270. https://doi.org/10.
3390/v13071270
60. Drexler JF, Corman VM, Wegner T, Tateno AF, Zerbinati RM, Gloza-Rausch
F, Seebens A, Müller MA, Drosten C. 2011. Amplication of emerging
viruses in a bat colony. Emerg Infect Dis 17:449–456. https://doi.org/10.
3201/eid1703.100526
61. Gloza-Rausch F, Ipsen A, Seebens A, Göttsche M, Panning M, Drexler JF,
Petersen N, Annan A, Grywna K, Müller M, Pfeerle S, Drosten C. 2008.
Detection and prevalence patterns of group I coronaviruses in bats,
northern Germany. Emerg Infect Dis 14:626–631. https://doi.org/10.
3201/eid1404.071439
Research Article Microbiology Spectrum
Month XXXX Volume 0 Issue 0 10.1128/spectrum.02047-23 19
Downloaded from https://journals.asm.org/journal/spectrum on 12 September 2023 by 204.217.148.198.
