Available via license: CC BY 4.0
Content may be subject to copyright.
Bradyrhizobium ottawaense eciently reduces
nitrous oxide through high nosZ gene expression
Sawa Wasai-Hara
National Agriculture and Food Research Organization (NARO)
Manabu Itakura
Tohoku University
Arthur Fernandes Siqueira
Tohoku University
Daisaku Takemoto
National Agriculture and Food Research Organization (NARO)
Masayuki Sugawara
Tohoku University
Hisayuki Mitsui
Tohoku University
Shusei Sato
Tohoku University
Noritoshi Inagaki
National Agriculture and Food Research Organization (NARO)
Toshimasa Yamazaki
National Agriculture and Food Research Organization (NARO)
Haruko Imaizumi-Anraku
National Agriculture and Food Research Organization (NARO)
Yoshikazu Shimoda ( yshimoda@affrc.go.jp )
National Agriculture and Food Research Organization (NARO)
Kiwamu Minamisawa
Tohoku University
Article
Keywords:
Posted Date: August 28th, 2023
DOI: https://doi.org/10.21203/rs.3.rs-3288261/v1
1
Bradyrhizobium ottawaense efficiently reduces nitrous oxide through high nosZ gene expression
Sawa Wasai-Hara1,2, Manabu Itakura2, Arthur Fernandes Siqueira2, Daisaku Takemoto1, Masayuki
Sugawara2, Hisayuki Mitsui2, Shusei Sato2, Noritoshi Inagaki1, Toshimasa Yamazaki1, Haruko
Imaizumi-Anraku1, Yoshikazu Shimoda1*, and Kiwamu Minamisawa2*
1National Agriculture and Food Research Organization (NARO), Tsukuba, Ibaraki 305-8604, Japan
2Graduate School of Life Sciences, Tohoku University, Katahira, Aoba-ku, Sendai 980-8577, Japan
*Corresponding authors: Y.S., yshimoda@affrc.go.jp; K.M., kiwamu.minamisawa.e6@tohoku.ac.jp
2
Abstract
N2O is the major greenhouse gases influencing global warming, and agricultural land is the
predominant (anthropogenic) source of N2O emissions. Here, we report the high N2O-reducing
activity of Bradyrhizobium ottawaense, suggesting the potential for efficiently mitigating N2O
emission from agricultural lands. Among the 15 B. ottawaense isolates examined, the N2O-reducing
activities of most (13) strains were approximately 5-fold higher than that of Bradyrhizobium
diazoefficiens USDA110T under anaerobic free-living conditions. This robust N2O-reducing activity
of B. ottawaense was confirmed by N2O reductase (NosZ) protein levels and in the soybean
rhizosphere after nodule decomposition. While the NosZ of B. ottawaense and B. diazoefficiens
showed high homology, nosZ gene expression in B. ottawaense was over 150-fold higher than that in
B. diazoefficiens USDA110T, suggesting the high N2O-reducing activity of B. ottawaense is
achieved by high nos expression. Furthermore, we examined the nos operon transcription start sites
and found that, unlike B. diazoefficiens, B. ottawaense has two transcription start sites under N2O-
respiring conditions, which may contribute to the high nosZ expression. Our study proposes the
potential of B. ottawaense for effective N2O reduction and unique regulation of nos gene expression
that contributes to the high performance of N2O mitigation in the soil.
3
Introduction
The expansion of human activities is triggering irreversible environmental damage, including
global warming and stratospheric ozone depletion. N2O is a long-lived greenhouse gas (GHG)
whose atmospheric lifetime is an estimated 116 ± 9 years [1]. Moreover, N2O has a stratospheric
ozone-depleting effect. Although N2O concentration in the atmosphere is still low compared with
other GHG such as CO2 and CH4, N2O is an alarming GHG due to its high global warming potential
per unit [2]. Agricultural land is the primary source of N2O, accounting for 52% of anthropogenic
origin emissions [3]. N2O is markedly emitted from nitrogen-rich environments, such as agricultural
fields in which excess N fertilizers are applied and crop residues, including nodulated legume roots
[4, 5]. Biochemically, microbial nitrification and denitrification are the two major processes of N2O
generation [6, 7]. During nitrification, N2O is produced as a byproduct when ammonia is oxidized to
nitrite via hydroxylamine. N2O is also generated from NO during incomplete denitrification, which
intricately involves diverse soil bacteria, fungi, and archaea [8]. However, to date, only one
microbial enzyme, N2O reductase (encoded by the nosZ gene), reportedly reduces N2O to N2 [7].
Since some rhizobial species possess the nosZ gene, strategies to reduce N2O emissions from
agricultural fields using rhizobia have been studied. In particular, soybeans are grown globally, and
the amount of N2O emitted from soybean fields is higher than that from corn or wheat. For example,
N2O emissions from soybean fields in Argentina are estimated to reach 5.1 kg N ha⁻1 yr⁻1 [9]. The
use of rhizobia is, therefore, an effective approach to reducing global GHG emissions.
Bradyrhizobium nodulates various legumes, including soybean, and has been studied as a model
denitrification microorganism. Soybean roots nodulated with Bradyrhizobium diazoefficiens
USDA110T scavenges exogenous N2O, even in ambient air containing a low concentration of N2O
(0.34 ppm) [10]. Moreover, N2O fluxes from soybean fields have been mitigated by inoculation with
B. diazoefficiens mutants with high N2O reductase activity (Nos++ mutants) [11]. The utility of B.
diazoefficiens in N2O mitigation has also been verified in soybean ecosystems in Japan [12], France
[13], and South America [14].
On the other hand, rhizobial strains carrying nos genes are uncommon; nos genes and N2O-
reducing activity have been observed only in B. diazoefficiens, soybean rhizobia [10], and Ensifer
meliloti, an alfalfa endosymbiont [15]. Several soybean rhizobia species, including B. diazoefficiens,
B. japonicum, B. elkanii, and Ensifer fredii, have been identified, but most soybean rhizobia in Japan
and the world are non-nos-possessing (nos⁻) species [16]. However, nos gene clusters have been
recently found in Bradyrhizobium ottawaense [17] and Rhizobium leguminosarum [13], suggesting
4
that the strategy for mitigating N2O emissions from the legume rhizosphere using rhizobia could be
expanded to various legume and rhizobial species.
The highest N2O emissions from the rhizosphere occur after soybean harvest during nodule
decomposition [11]. Nitrification is promoted when the accumulated N and rhizobia are released
from decomposed nodules into the soil: N2O is released by denitrification around nos⁻ or even nos+
strains due to the balance between the generation and reduction of N2O. Therefore, to effectively
prevent N2O release, using rhizobia with high N2O-reducing activity in the free-living state is
necessary.
Denitrification reactions involving N2O reduction occur under anaerobic conditions. In
bradyrhizobia, N2O reductase (nos) genes are regulated by three different two-component regulatory
systems [18]. The FixLJK2 cascade is the primary oxygen-sensing regulator for nos operons. Under
moderate low oxygen concentration conditions (<5%), FixLJK2 recognizes the FixK box
[TTG(A/C)-N6-(T/G)CAA] located upstream of nosR and promotes nos operon expression [19, 20].
It has also been shown that the NasST two-component regulatory system, which senses NO3-
concentrations and regulates the NO3- assimilation gene (nas) operon, is also responsible for
regulating the nos operon [21]. NasT act as activators of the nas/nos operons and NasS acts on NasT,
inhibiting its function: in the absence of NO3-/NO2-, NasS and NasT bind to each other, and
transcription is arrested by the terminator structure upstream of the nas/nos operon. On the other
hand, in the presence of NO3-/NO2-, NasT is released from NasS and binds to the mRNA upstream of
the nos operon, resulting in a conformational change in the hairpin termination structure of the
mRNA and read-through transcription of the nos genes [18]. In nasS deletion mutants, transcription
of the nos operon is activated independently of NO3-. Itakura et al. [11] developed nos++ strains from
naturally occurring nasS mutants and verified their utility in N2O reduction in laboratory and field
experiments. Additionally, the RegSR two-component regulatory system presumably controls nosR
expression via the NifA protein [22].
In this study, we characterized nos-possessing B. ottawaense strains isolated from sorghum
roots based on their genome sequence and activity. Most B. ottawaense strains showed significantly
higher N2O-reducing activity than that of B. diazoefficiens USDA110T. Gene expression and
promoter analyses showed that B. ottawaense strongly expressed the nosZ gene under both N2O- and
NO3--reducing conditions, and its high-level expression is thought to be achieved by different nos
operon transcription start sites and not by already known regulation systems. Our study proposes the
potential of B. ottawaense in N2O mitigation and the unique regulation of nos gene expression that
5
contributes to the high performance of N2O reduction.
Results
B. ottawaense N2O-reducing activity
The B. ottawaense strains used in this study are listed in Supplementary Table 1. Among
them, the phylogenetic relationships and gene conservation of the denitrification pathway of four
strains (SG09, TM102, TM233, and TM239) have been reported [17]. To confirm species
classification and gene organization, we determined the draft genome sequence of 10 strains,
including 3 strains reported by Wasai-Hara et al. [17] (see Supplementary Table 1). All isolates
showed more than 95.0% average nucleotide identity (ANI) values with the type strain B.
ottawaense OO99T [23], indicating that the isolates were classified into B. ottawaense (see
Supplementary Table 2). Furthermore, phylogenetic analysis based on multiple housekeeping genes
(AMPHORA [24]) supported this classification, as shown in Supplementary Fig. 1.
The N2O-reducing activity of the B. ottawaense strains was determined under free-living,
N2O-respiring conditions (Fig. 1a, see also Supplementary Fig. 2). Almost all isolates and the type
strain B. ottawaense OO99T showed activity in the range of 1,387–1,855 nmol h⁻1 OD⁻1, which was
5.5–7.4-fold higher than that of B. diazoefficiens USDA110T (252 nmol h⁻1 OD⁻1). Also, growth
under N2O-respiring conditions was better in B. ottawaense strains than in B. diazoefficiens
USDA110T (Supplementary Fig. 3). Conversely, two strains (SF12 and SF19) showed relatively low
activity, with values of 309 and 454 nmol h⁻1 OD⁻1, respectively, comparable to that of B.
diazoefficiens USDA110T(Fig. 1a). We also analyzed the N2O-reducing activity of TM102, TM233,
and TM239, which lacked nodulation and nitrogen-fixing ability [17], but no significant difference
was observed from the other nodulating strains of B. ottawaense (p<0.05, Tukey’s test). Monitoring
N2O concentrations over time showed a rapid decrease in B. ottawaense (SG09, OO99, TM102, and
TM233), while B. diazoefficiens USDA110T exhibited a slow decrease (Fig. 1b).
Next, we examined the effects of B. ottawaense inoculation on the N2O flux associated with
nodule degradation in a soybean rhizosphere in a laboratory system (Fig. 2). Under atmospheric
conditions (approximately 340 ppb of N2O in the gas phase), N2O flux from soybean rhizospheres
inoculated with the non-nos possessing strain B. japonicum USDA 6T and B. ottawaense SG09 was
29.2 and 2.3 nmol h⁻1 plant⁻1, respectively, indicating that N2O flux following SG09 inoculation
significantly decreased relative to that after B. diazoefficiens USDA 6T (nos⁻) and USDA110 T (nos+)
inoculation (Fig. 2a). In N2O-supplemented air (50 ppm N2O), B. ottawaense SG09 inoculation
6
exclusively showed negative N2O flux. However, such negative flux was not observed with B.
diazoefficiens USDA 110T and USDA 6T inoculation (Fig, 2b). These results demonstrate the
effectiveness of B. ottawaense inoculation in reducing N2O emissions from the soybean rhizosphere.
nosZ gene expression and protein activity of wild-type B. ottawaense strains
nosZ expression in B. ottawaense strains was evaluated by RT-qPCR under both N2O- and
NO3--respiring conditions based on B. diazoefficiens USDA110T (Table 1). Under N2O-respiring
conditions, wild-type (WT) B. ottawaense SG09 and OO99T strains showed 211.5- and 163.5-fold
higher expression levels than WT B. diazoefficiens USDA110T, respectively. Under NO3--respiring
conditions, the nosZ expression of WT strains was upregulated in both B. ottawaense and B.
diazoefficiens being 29.6-fold (USDA110T), 9.2-fold (SG09), and 15.1-fold (OO99T) higher than
that under N2O-respiring conditions. In the comparison among strains, B. ottawaense SG09 and
OO99T showed 66.3- and 83.9-fold higher nosZ expression than that of USDA110T respectively,
even under NO3--respiring conditions. On the other hand, the two strains with low N2O-reducing
activity (SF12 and SF19; Fig. 1a) showed low expression levels that were 31.2- and 40.6-fold higher
than those of USDA110T, respectively, and less than 1/5 those of SG09 under N2O-respiring
conditions.
We next analyzed NosZ protein activity in B. ottawaense and B. diazoefficiens by specific
activity staining with methyl viologen after sodium deoxycholate polyacrylamide gel electrophoresis
(DOC-PAGE). Equal amounts of B. ottawaense and B. diazoefficiens total protein were loaded and
confirmed by Coomassie brilliant blue (CBB) staining (Fig. 3a, see also Supplementary Fig. 4). On
the same gel, the intensity of activity staining was clearly higher for SG09 than that for USDA110T;
the intensity of the 8-fold diluted SG09 lane was comparable to that of the non-diluted USDA110T
lane, indicating that NosZ protein activity in B. ottawaense was approximately 8-fold higher than
that in B. diazoefficiens (Fig. 3b, c).
nosZ expression in nasS deletion mutants
To investigate the high nosZ expression in B. ottawaense, we compared the sequences of the
genes involved in the expression of the nos operon, nasST, fixLJK2, and regSR, in B. ottawaense
SG09 and B. diazoefficiens USDA110T. As shown in Supplementary Table 3, all genes showed
>90% identity in amino acid sequence. However, the upstream sequence of the nos operon, which is
recognized by NasT to suppress transcription, showed only 48% identity in the nucleotide sequence.
7
Therefore, we examined whether the NasST regulatory system is also functional in B. ottawaense,
similar to B. diazoefficiens USDA110T [21]. To this end, we analyzed nosZ gene expression in nasS
deletion mutants of B. ottawaense SG09 and OO99T. In B. diazoefficiens USDA110T, nosZ
expression was significantly increased (3.4-fold) in the ΔnasS mutant. Similarly, nosZ expression
was significantly increased in the B. ottawaense SG09 (2.03-fold) and OO99T (2.06-fold) ΔnasS
mutants under N2O-respiring conditions. This significant expression increase in nasS deletion
mutants was not observed in the presence of NO3- (Table 1). The effect of nasS deletion was also
observed in N2O-reducing activity, but there was no significant difference in the activity change in
B. ottawaense (See Supplementary Fig. 5).
nos operon transcription system in B. ottawaense
To investigate the effect of the transcriptional regulation of the nos operon on nosZ
expression, we determined the transcriptional start site of nosR, which is located upstream of the
operon (see Supplementary Fig. 6). The transcription start site was investigated under anaerobic
conditions with NO3- or N2O as the sole electron acceptor by 5′ rapid amplification of cDNA ends (5′
RACE).
Under N2O-respiring conditions, two start sites were detected in B. ottawaense SG09 at C and
G, 212 and 79 nucleotides (nt) upstream of the nosR start codon, respectively (Pd1 and Pd2,
respectively; Fig. 4, Supplementary Fig. 7). The -35/-10 consensus sequence was predicted upstream
of the two transcription start sites. In addition, the putative FixK box was predicted upstream of Pd1.
On the other hand, under NO3--respiring conditions, a single transcription start site, Pd1, was
observed in B. ottawaense SG09 (Fig. 4 and Supplementary Fig. 7). We also confirmed that B.
ottawaense OO99T has identical promoter sequences and two transcription start sites (Pd1 and Pd2;
Fig. 4 and Supplementary Fig. 7). In B. ottawaense OO99T, two transcription start points (Pd1 and
Pd2) were detected under NO3--respiring conditions, but comparing the band intensities, it was clear
that Pd1, which was also detected in SG09, was strongly transcribed. We additionally examined the
transcription start site in USDA110T under N2O-respiring conditions and detected a single site (G, 84
nucleotides upstream of nosR) that was identical to the previously reported site of USDA110T under
NO3--respiring conditions [20, 25](see Supplementary Fig. 7). Our results indicate that, unlike B.
diazoefficiens USDA110T, the nosR of B. ottawaense has two transcription start sites under N2O-
respiring conditions.
8
Two B. ottawaense strains with low N2O-reducing activity
Among the B. ottawaense analyzed in this study, two strains SF12 and SF19 showed low
N2O-reducing activity and nosZ expression (Fig. 1a, Table 1). When compared nos gene clusters (see
Supplementary Fig. 6a, b), we could not identify the differences responsible for the N2O-reducing
activity as their nos genes are identical in amino acid sequence. However, when compared the
genomic sequence of the upstream region of nosR, 56 bp deletion was commonly observed in the
low N2O-reducing activity strains SF12 and SF19; the deleted region includes the start codon (ATG)
of nosR (see Supplementary Fig. 6c). To confirm that 56 bp deletion is the cause of low activity, the
deletion mutants of SG09 and OO99T(SG09Δ56, OO99TΔ56) were generated. In the 56 bp deletion
mutants, both N2O-reducing activity and nosZ expression levels were decreased to levels comparable
to those of SF12 and SF19 (Table 2), confirming that 56 bp deletion is the cause of the low activity
of SF12 and SF19.
Discussion
In this study, we demonstrated that B. ottawaense has higher N2O-reducing activity than that
of B. diazoefficiens. In a previous study, B. diazoefficiens mutants with high N2O-reducing activity
(Nos++ mutants) were generated, and the mutants mitigated N2O emission at the laboratory and field
levels [11, 26]. One of the Nos++ mutants (5M09) was established as a non-genetically modified
organism; however, this strain has 66 mutations in the genome, raising concerns for actual
agricultural use. The B. ottawaense described in this study is a WT strain that exhibits high N2O
reduction activity comparable to that of the artificially generated USDA110T Nos++ mutant strains
[21]. Furthermore, we demonstrated that SG09 inoculation resulted in almost no N2O release in the
rhizosphere due to nodule decomposition. Notably, negative N2O flux was observed under a 50 ppm
N2O gas phase in the laboratory experiment, suggesting a system is in place to reduce high N2O
concentrations (Fig. 2). Given that GHG reduction is a current key issue, B. ottawaense is quite
beneficial as it can contribute to the mitigation of N2O in agricultural fields.
High N2O-reducing ability is considered adaptive in environments with high N2O
concentrations. B. ottawaense was first isolated from a soybean field in Canada in 2012 as a novel
species [27, 28]. Other isolates have been reported from soybean and peanut fields in China and
Japan and woody legumes in Ethiopia [29-32]. B. ottawaense can form nodules in soybeans, but it is
rarely detected in soybean fields in Japan [30], suggesting that it is adapted to different environments
than those of conventional soybean rhizobacteria such as B. diazoefficiens, B. japonicum, and B.
9
elkanii. N2O reduction occurs preferentially over NO3- reduction [33], and B. ottawaense can grow
better than B. diazoefficiens under N2O-respiring conditions (see Supplementary Fig. 3). Therefore,
it is possible that the ability to reduce N2O, as in B. ottawaense, may have been important to survive
in specific environments.
In the current study, we demonstrated that the N2O-reducing activity of bradyrhizobia
correlated with the expression of the nosZ gene. B. ottawaense strains with high N2O-reducing
activity (SG09 and OO99T) strongly express the nosZ gene under both N2O- and NO3--respiring
conditions (Figs. 1 and 3, Table. 1). In addition, Bradyrhizobium with low N2O-reducing activity
(USDA110T, SF12, SF19) showed relatively low nosZ expression compared to that of high N2O-
reducing strains (Fig. 1, Table 1). Given the relatively high homology of nosZ between B.
diazoefficiens and B. ottawaense (92%, see Supplementary Fig. 6a), our results suggest that the N2O-
reducing activity of Bradyrhizobium is determined by the expression of the nosZ gene rather than
NosZ protein activity.
To investigate the cause of high nosZ expression in B. ottawaense, we first focused on the
NasST regulatory system and examined whether it is functional in B. ottawaense. In the nasS
deletion mutants (OO99ΔnasS and SG09ΔnasS), nosZ expression levels increased under N2O-
respiring condition but not increased under NO3--respiring condition (Table 1), indicating that the
NasST regulatory system is functional in B. ottawaense as in B. diazoefficiens [21, 25]. In addition,
it seems that the NasST regulatory system is not a main factor for the high expression in B.
ottawaense because the nosZ expression of WT B. ottawaense (163 in OO99T, 211 in SG09) was
higher than that of USDA110ΔnasS (3.4) under N2O-respiring conditions (Table 1).
Analysis of ΔnasS mutants also showed little linearity between nosZ gene expression and
N2O-reducing activity. B. ottawaenseΔnasS mutants exhibited higher nosZ gene expression than
that of WT (Table 1), but N2O-reducing activity did not significantly differ between WT and ΔnasS
mutants (see Supplementary Fig. 5). In addition, when comparing nosZ expression in ΔnasS
mutants, B. ottawaense demonstrated a 100-fold higher expression than that of B. diazoefficiens
(Table 1), but N2O-reducing activity only slightly differed (see Supplementary Fig. 5). The lack of
linearity between gene expression and N2O-reducing activity may indicate upper limits for NosZ
protein activity. This may be due to translation efficiency or depletion of the components required
for NosZ activity, such as copper and electrons, during N2O reduction. Moreover, NosZ protein
activation requires highly complex pathways, such as sequential metal trafficking and assembly to
copper sites via NosDFY [34]. The exact cause is presently unknown, but the aforementioned factors
10
may define the upper limit of N2O reduction activity in bradyrhizobia.
In the current study, the single transcription start point was detected in B. diazoefficiens
USDA110T under anaerobic conditions regardless of different electron acceptors (N2O or NO3-),
whereas B. ottawaense has a variable transcription start point depending on the electron acceptors:
two transcription start points were detected under N2O respiration conditions in both SG09 and
OO99T. Changes in the transcription start site depending on two different electron acceptor have
been reported in studies on Geobactor [35]. Also, genome-wide analysis of transcription start sites in
Clostridium identified several metabolism-related genes with multiple transcription start sites that
change depending on the substrate [36]. Although the importance of having multiple transcription
start sites has not been fully elucidated, it is considered an important regulatory mechanism of gene
expression because it largely influences transcription efficiency, translation initiation, and protein
abundance [37]. Changes in the transcription start sites of B. ottawaense nosR depend on the type of
electron acceptor, which may be part of the nos genes expression regulatory mechanism in the
denitrification system.
Genome sequence comparisons of high and low N2O-reducing activity strains revealed a
novel determinant of activity. Incidentally, 56 bp deletion in the upstream region of nosR was
detected specifically in the low N2O-reducing activity strains, SF12 and SF19, as shown in
Supplementary Fig. 6, and introducing the deletion in the high N2O-reducing activity strains (SG09
and OO99T) reduced nosZ gene expression and N2O-reducing activity (Table 2). These results are
consistent with previous studies where decreased nosZ expression was observed in artificially
generated nosR-deleted Pseudomonas aeruginosa strains in which the nos genes were encoded in a
single operon similar to that of Bradyrhizobium [38]. Since partial gene deletion is among the
driving forces for environmental adaptation or functional evolution in bacteria [39-41], the strains
with natural deletion isolated in the present study may have evolved to adapt to environments with
limited denitrification substrates. Accordingly, examining the distribution and abundance of high and
low N2O-reducing activity strains in various environments may reveal the importance of N2O-
reducing activity in environmental adaptation.
In summary, we demonstrated that the N2O-reducing activity of B. ottawaense is significantly
higher than that of conventional strains, and this activity is achieved via high nosZ expression. Since
N2O is a GHG mainly generated in agricultural lands, developing strategies for reducing N2O
emissions from agricultural lands is an urgent task. The B. ottawaense we reported here has great
potential for GHG mitigation in the rhizosphere owing to its high N2O-reducing activity. In addition,
11
the regulatory mechanism of nos gene expression we elucidated in this study will be useful for
developing and identifying bacteria with higher GHG-reducing ability. Further studies on the
ecology of B. ottawaense including its compatibility with legume crops and competitiveness with
other indigenous rhizobacteria are needed to improve its utility on actual agricultural land.
Methods
Bacterial strains, isolation, and genome analysis
The type strain B. ottawaense OO99T was purchased from the Microbial Domain Biological
Resource Centre HAMBI (Helsinki, Finland). The type strain B. diazoefficiens USDA110T was
provided by Dr. Michael J. Sadowsky at University of Minnesota. We used the culture stock of the
nosZ deleted mutant B. diazoefficiens USDA110ΔnosZ generated by Hirayama et al. 2011[42]. The
B. ottawaense strains used in this study are listed in Supplementary Table 1. Eight strains (SG09,
SG10, SG20, SG23, TM102, TM233, and TM239) have been reported by Wasai-Hara et al. [17], and
the other strains were isolated by the same procedures. For whole genome sequencing, genomic
DNA was extracted using a Bacteria GenomicPrep Mini Spin Kit (Cytiva, Tokyo, Japan). DNA
libraries were prepared using a Nextera Sample Preparation Kit (Illumina, San Diego, CA, USA),
and the 300-bp paired-end libraries were sequenced using Illumina Miseq (Illumina). Subsequently,
20 bp of the 5′ and 3′ ends were trimmed, and the genomes were assembled using CLC Genomics
Workbench ver. 8.5.1(Illumina). Genome annotation was performed using DFAST [43].
N2O-reducing activity
N2O-reducing activity was determined by culturing the bacteria under anaerobic conditions
with 1% N2O supplemented as the sole electron acceptor. The N2O concentration was measured
using a gas chromatograph (GC2014; Shimadzu, Kyoto, Japan) equipped with a thermal
conductivity detector and Porapak Q column (GL Sciences, Tokyo, Japan). Bacterial strains were
aerobically cultured for over 6 h in a 75-mL test tube with an air-permeable plug containing 10 mL
HM liquid medium [44] supplemented with 0.1% (w/v) arabinose and 0.025% (w/v) yeast extract at
28 °C with shaking at 200 rpm. Thereafter, the appropriate volume of bacterial culture was added to
new tubes containing 10 mL HM medium to reach an optical density (OD) at 660 nm (OD660) of
0.05. The OD was measured using a φ = 25 mm test tube (TEST25NP; AGC Techno Glass Co., Ltd.,
Shizuoka, Japan). The test tube was closed with a butyl rubber cap, and the gas phase was replaced
with 4.98% N2O + 95.02% N2 gas following overnight (12–14 h) culture to induce N2O reduction
12
metabolism. Subsequently, the gas phase was again replaced with 100% N2 gas, after which 100%
N2O was supplemented to adjust to a final concentration of 1%. Finally, the test tube was incubated
at 28 ºC with shaking at 200 rpm, and 100 µL of gas phase was withdrawn every 1–3 h and
subjected to the gas chromatography.
N2O flux experiment
N2O flux in the soybean rhizosphere was measured using a previously described method with
modifications [11]. Briefly, bacterial strains were aerobically cultured in HM liquid medium at 30 °C
for 1 week, after which the prepared bacterial suspension was adjusted to 1 × 108 cells mL⁻1 using
sterilized water. Soybean seeds (Glycine max, cv. Enrei (GmJMC025) seeds acquired from
Genebank Project NARO, Japan) were sterilized using 0.5% sodium hypochlorite were sown in
Leonardo Jar pots—at three seeds per pot—containing sterilized vermiculite and were inoculated
with 1 mL of bacterial suspension. The seeds were cultivated in a growth chamber at 25 °C for 16 h
in light and 8 h in the dark. Thinning was performed on the third day after sowing, leaving an
individual plant that was in the best germination state, and cultivation continued for another 27 days.
A nitrogen-free hydroponic solution was periodically added to the pot during cultivation. After
cultivation, the root system from each plant was transferred to a 100-mL glass vial containing 30 mL
of soil obtained from the Kashimadai field (38°27′36.0″N 141°05′24.0″E, at the permission of
Tohoku University, Japan). Thereafter, the vials with the roots and soil were incubated at 25 °C for
20 days to induce nodule degradation. N2O flux was determined by measuring the concentration of
N2O in the gas phase in the vials with the roots and soil using a gas chromatograph (GC2014;
Shimadzu) equipped with a 63Ni electron capture detector and tandem Porapak Q columns (GL
Sciences; 80/100 mesh; 3.0 mm × 1.0 m and 3.0 mm × 2.0 m).
Expression analysis
nosZ gene expression levels were measured under N2O- and NO3--respiring conditions. For
N2O-respiring conditions, cells were prepared the same as described above. Three hours after
exposure to 1% N2O conditions, a 1 mL phenol solution (10% phenol in ethanol) was added to the 1-
mL culture to stop metabolism. After centrifugation, the pellets were stored at -80 °C until further
processing. For NO3- respiring conditions, cells were anaerobically grown in 20 mL HM medium
supplemented with 10 mM KNO3 in a 75-mL test tube. The OD660 was initially adjusted to 0.05 and
monitored to induce the exponential growth phase of cells. When OD660 reached 0.1, the cells were
13
collected as described above. Subsequently, total RNA was isolated using the hot-phenol method as
described previously [35], followed by DNase I treatment (RQ1; Promega, Madison, WI, USA) and
further purification using RNA Clean & Concentrator-5 (Zymo Research, Irvine, CA, USA). First-
strand cDNA was synthesized using 500 ng RNA as a template and SuperScript IV Reverse
Transcriptase (Invitrogen, Waltham, MA, USA) according to the manufacturer’s instructions. RT-
qPCR was performed using a LightCycler Nano Instrument (Roche, Basel, Switzerland),
LightCycler® FastStart DNA MasterPLUS SYBR® Green I (Roche), and specific primers for sigA
(sigAf/sigAr) and nosZ (nosZ_qPCR_F/ nosZ_qPCR_R) (see Supplementary Table 4) at an
annealing temperature of 60 ºC for 50 cycles. Relative expression calculated using the 2⁻ΔΔCt method
[45] was normalized to sigA expression.
nosZ activity staining
B. ottawaense SG09 and B. diazoefficiens USDA110T were cultured overnight under N2O-
respiring conditions. After centrifugation of the cultured cells, total protein was extracted using lysis
buffer (CelLytic B; Sigma-Aldrich, St. Louis, MO, USA) and sonication (BIORUPTOR; BM
Equipment Co., Ltd., Tokyo, Japan). Protein content in the supernatants was measured using a DC-
protein assay (Bio-Rad Laboratories, Hercules, CA, USA). For DOC-PAGE, approximately 9.6 µg
of total protein was used as the non-diluted sample (1×, Fig. 3). After electrophoresis, each gel was
immersed in the buffer containing 25 mM Tris, 192 mM glycine, and 1 mM methyl viologen (pH
8.3). Subsequently, Ti(III)-citrate was used to reduce methyl viologen, and N2O-saturated H2O was
added for the in-gel N2O-reducing enzymatic reaction. Band signal intensity was determined using
an ImageJ macro, Band/Peak Quantification [46]. All experiments except for protein quantification
were performed under an N2 atmosphere. CBB staining was performed after N2O-reducing activity
staining to confirm protein content.
nasS, nosZ, and 56-bp deletion mutants
nasS deletion mutants were generated using the in-frame markerless method. The deletion
region was determined as in the B. diazoefficiens USDA110T nasS mutant strain (5M09) reported by
Sánchez et al. [21]. Briefly, pK18mobsacB-Ω was created by replacing the kanamycin resistance
gene coding region of the suicide vector pK18mobsacB with a streptomycin-spectinomycin
resistance gene (aadA). pK18mobsacB was digested with NcoI and BglII to obtain 5.1 kb of linear
DNA with 0.6 kb of the kanamycin resistance gene partially deleted. The aadA fragment to be
14
introduced was amplified by PCR using primers aadA_F_IF and aadA_R_IF and Prime STAR® Max
DNA Polymerase (Takara Bio Inc., Shiga, Japan) (details on the primers are shown in
Supplementary Table 4) with pHP45Ω as a template. Thereafter, 1.1 kb of amplified DNA was
extracted using Wizard® SV Gel and a PCR Clean-Up System (Promega). The resulting linear
pK18mobsacB and aadA were combined using an In-fusion HD cloning kit (Takara Bio Inc.) and
transformed E. coli DH5α according to the manufacturer’s instructions.
The up- and downstream regions of the nasS gene were amplified by PCR using primers
Bo_nasSdel_F1/R1 and Bo_nasSdel_F2/R2 (see Supplementary Table 4 for details on primers) and
Prime STAR® Max DNA Polymerase (Takara Bio Inc.). Amplified fragments were combined by
overlap extension PCR and inserted into the SmaI site of pK18mobsacB-Ω using an In-fusion HD
Cloning Kit (Takara Bio Inc.). The sequence of the introduced fragment was confirmed by
sequencing, and the resultant plasmid was designated pMS187. Transmission of pMS187 to B.
ottawaense strains and homologous recombination of the nasS region were performed by triparental
mating with a mobilizing E. coli HB101 strain harboring the pRK2013 helper plasmid. Next, B.
ottawaense SG09 or OO99T, E. coli DH5αharboring pMS187, and E. coli HB101 harboring
pRK2013 were mixed and cultured for mating. Transconjugants were selected by resistance to
streptomycin (Sp, 100 µg/mL), spectinomycin (Sm, 100 µg/mL), and polymyxin (Px, 50 µg/mL) and
sensitivity to sucrose (10%). The single crossover strains were further cultured in HM medium
without antibiotics, and deletion mutants that showed Sp/Sm sensitivity and sucrose resistance—
SG09ΔnasS and OO99ΔnasS—were obtained.
ΔnosZ and 56 bp deletion mutants were generated using the same methods as for the nasS
mutants with the pK18mobsacB-Ω vector. Briefly, the up- and downstream regions of the nosZ gene
were amplified by PCR using primers SG09_nos-1F/1R and SG09_nos-2F/2R (see Supplementary
Table 4 for details on the primers) and Prime STAR® max DNA Polymerase (Takara Bio Inc.). The
amplified fragments were combined by overlap extension PCR using primers SG09_nos-1F/1R and
SG09_nos-2F/2R (see Supplementary Table 4) and Prime STAR® max DNA Polymerase (Takara
Bio Inc.). The PCR fragments and pK18mobsacB-Ω were digested with EcoRI and HindIII and then
ligated using a DNA Ligation Kit (<Mighty Mix>; Takara Bio Inc.). Thereafter, triparental mating
was performed using the sequence-introduced vector as described above.
For 56-bp deletion mutants, the up- and downstream regions of the 56-bp region were
amplified by PCR using primers 56del_F1/R1 and 56del_F2/R2 (see Supplementary Table 4) and
then combined and inserted into the SmaI site of pK18mobsacB-Ω using an In-fusion HD Cloning
15
Kit (Takara Bio Inc.). Thereafter, triparental mating was performed using the sequence-introduced
vector as described above. The generated 56 bp deletion mutants were designated SG09Δ56 and
OO99Δ56.
5
′
RACE
5′ RACE experiments were performed using a 5′/3′ RACE kit, 2nd Generation (Roche).
Briefly, the total RNA of B. ottawaense and B. diazoefficiens strains were isolated from cells grown
under N2O- and NO3-- respiring conditions using the hot-phenol method as described above. cDNA
synthesis and amplification of the 5′- region of nosR were conducted according to the manufacturer’s
instructions using the primers listed in Supplementary Table 4 (Bw_SP1, SP2, and SP3 for B.
ottawaense strains, R_SP1, SP2, and SP3 for B. diazoefficiens strains). The amplified fragments
were sequenced to determine the transcription start site.
Statistical analysis
Differences in N2O reducing activities between all strains tested were evaluated using Tukey’s
test after ANOVA analysis. Differences in N2O flux and nosZ gene expression between the two
strains were evaluated using Student’s t tests at a significance level of 0.05.
Data availability
Genome data are available in NCBI (https://www.ncbi.nlm.nih.gov/), and accession numbers are
detailed in the Supplementary Information files.
References
1 Prather M.J. et al. Measuring and modeling the lifetime of nitrous oxide including its
variability. J. Geophys Res. 120, 5693–5705 (2015).
2 IPCC 2021, A.R. "Climate change 2021: the physical science basis." Working Group I
Contribution to the IPCC Sixth Assessment Report (2021).
3 Tian H. et al. A comprehensive quantification of global nitrous oxide sources and sinks.
Nature 586, 248–256 (2020).
4 McKenney D.J., Wang S.W., Drury C.F. & Findlay W.I. Denitrification and
mineralization in soil amended with legume, grass and corn residues. Soil. Sci. Soc. Am. J. 57, 1013–
1020 (1993).
16
5 Uchida, Y. & Akiyama, H. Mitigation of postharvest nitrous oxide emissions from
soybean ecosystems: a review Soil Sci. Plant Nutr. 59, 477-487 (2013)
6 Thomson A.J., Giannopoulos G,. Pretty J., Baggs E.M. & Richardson D.J. Biological
sources and sinks of nitrous oxide and strategies to mitigate emissions. Philos. Trans. R. Soc. B:
Biol. Sci. 367, 1157-1168 (2012).
7 Kuypers, M. M. M., Marchant, H. K. & Kartal, B. The microbial nitrogen-cycling
network. Nat. Rev. Microbiol. 16, 263–276 (2018).
8 Hallin, S., Philippot, L., Loffler, F. E., Sanford, R. A. & Jones, C. M. Genomics and
ecology of novel N2O-reducing microorganisms. Trends Microbiol. 1485, 43–55 (2017).
9 Della Chiesa T. et al. Higher than expected N2O emissions from soybean crops in the
Pampas Region of Argentina: Estimates from DayCent simulations and field measurements. Sci.
Total Environ. 835:155408 (2022).
10 Sameshima-Saito, R. et al. Symbiotic Bradyrhizobium japonicum reduces N2O
surrounding the soybean root system via nitrous oxide reductase. Appl. Environ. Microbiol. 72,
2526–2532 (2006).
11 Itakura, M. et al. Mitigation of nitrous oxide emissions from soils by Bradyrhizobium
japonicum inoculation, Nature Clim. Change 3, 208–212 (2013).
12 Akiyama, H. et al. Mitigation of soil N2O emission by inoculation with a mixed culture
of indigenous Bradyrhizobium diazoefficiens. Sci. Rep. 6, 32869 (2016).
13 Hénault, C., Barbier, E., Hartmann, A. & Revellin, C. New Insights into the Use of
Rhizobia to Mitigate Soil N2O Emissions. Agriculture 12, 271 (2022).
14 Melissa, O. et al. Evaluation of nitrous oxide emission by soybean inoculated with
Bradyrhizobium strains commonly used as inoculants in South America. Plant Soil 472, 311–328
(2022).
15 Bueno, E. et al. Anoxic growth of Ensifer meliloti 1021 by N2O-reduction, a potential
mitigation strategy. Front. Microbiol. 6, 537 (2015).
16 Shiina, Y. et al. Relationship between soil type and N₂O reductase genotype (nosZ) of
indigenous soybean bradyrhizobia: nosZ-minus populations are dominant in Andosols. Microbes
Environ. 29, 420-6 (2014)
17 Wasai-Hara, S. et al. Diversity of Bradyrhizobium in non-leguminous sorghum plants: B.
ottawaense isolates unique in genes for N2O reductase and lack of the type VI secretion system.
Microbes Environ. 35, ME19102 (2020).
17
18 Sánchez. C. & Minamisawa, K. Nitrogen Cycling in Soybean Rhizosphere: Sources and
Sinks of Nitrous Oxide (N2O). Front Microbiol. 10,1943 (2019).
19 Bonnet, M.et al. The structure of Bradyrhizobium japonicum transcription factor FixK2
unveils sites of DNA binding and oxidation. J. Biol. Chem. 288, 14238–14246 (2013).
20 Torres, M.J. et al. FixK2 Is the main transcriptional activator of Bradyrhizobium
diazoefficiens nosRZDYFLX genes in response to low oxygen. Front. Microbiol. 8, 1621 (2017).
21 Sánchez, C. et al. The nitrate-sensing NasST system regulates nitrous oxide reductase
and periplasmic nitrate reductase in Bradyrhizobium japonicum. Environ. Microbiol. 16, 3263–3274
(2014).
22 Torres, M. J. et al. (2014). The global response regulator RegR controls expression of
denitrification genes in Bradyrhizobium japonicum. PLoS ONE 9, e99011 (2014).
23 Nguyen, H.D.T., Cloutier, S. & Bromfield, E.S.P. Complete Genome Sequence of
Bradyrhizobium ottawaense OO99T, an Efficient Nitrogen-Fixing Symbiont of Soybean. Microbiol.
Resour. Announc. 7, e01477-18 (2018).
24 Wu, M. & Eisen. J.A. A simple, fast, and accurate method of phylogenomic inference.
Genome Biol. 9, R151 (2008).
25 Sánchez, C., Mitsui, H. & Minamisawa, K. Regulation of nitrous oxide reductase genes
by NasT-mediated transcription antitermination in Bradyrhizobium diazoefficiens. Environ Microbiol
Rep. 9, 389-396 (2017).
26 Itakura, M. et al. Generation of Bradyrhizobium japonicum mutants with increased N2O
reductase activity by selection after introduction of a mutated dnaQ gene. Appl Environ Microbiol.
74, 7258-7264 (2008).
27 Tang, J., Bromfield, E.S., Rodrigue, N., Cloutier, S. & Tambong, J.T. Microevolution of
symbiotic Bradyrhizobium populations associated with soybeans in east North America. Ecol. Evol.
2, 2943-2961 (2012).
28 Yu, X., Cloutier, S., Tambong, J.T. & Bromfield, E.S.P. Bradyrhizobium ottawaense sp.
nov., a symbiotic nitrogen fixing bacterium from root nodules of soybeans in Canada. Int. J. Syst.
Evol. Microbiol. 64, 3202-3207 (2014).
29 Yan, J. et al. Genetic diversity of indigenous soybean-nodulating rhizobia in response to
locally-based long term fertilization in a Mollisol of Northeast China. World J. Microbiol.
Biotechnol. 33, 6 (2017).
18
30 Minakata, C., Wasai-Hara, S., Fujioka, S., Sano, S. & Matsumura, A. Unique Rhizobial
Communities Dominated by Bradyrhizobium liaoningense and Bradyrhizobium ottawaense were
Found in Vegetable Soybean Nodules in Osaka Prefecture, Japan. Microbes Environ. 38, ME22081
(2023).
31 Mania, D., Woliy, K., Degefu, T. & Frostegård, Å. A common mechanism for efficient
N2O reduction in diverse isolates of nodule-forming bradyrhizobia. Environ. Microbiol. 22, 17-31
(2020).
32 Shao, S., Chen, M., Liu, W., Hu, X., & Li, Y. Long-term monoculture reduces the
symbiotic rhizobial biodiversity of peanut. Syst. Appl. Microbiol. 43, 126101 (2020).
33 Gao, Y. et al. Competition for electrons favours N2O reduction in denitrifying
Bradyrhizobium isolates. Environ. Microbiol. 23, 2244-2259 (2021).
34 Müller, C. et al. Molecular interplay of an assembly machinery for nitrous oxide
reductase. Nature 608, 626-631 (2022).
35 González, G. et al. Global transcriptional start site mapping in Geobacter sulfurreducens
during growth with two different electron acceptors. FEMS Microbiol. Lett. 363, fnw175 (2016).
36 Boutard, M. et al. Global repositioning of transcription start sites in a plant-fermenting
bacterium. Nat. Commun. 7, 13783 (2016).
37 Arribere, J.A.& Gilbert, W.V. Roles for transcript leaders in translation and mRNA decay
revealed by transcript leader sequencing. Genome Res. 23, 977-87 (2013).
38 Arai, H., Mizutani, M. & Igarashi, Y. Transcriptional regulation of the nos genes for
nitrous oxide reductase in Pseudomonas aeruginosa. Microbiology 149, 29-36 (2003).
39 D'Souza, G. et al. Less is more: selective advantages can explain the prevalent loss of
biosynthetic genes in bacteria. Evolution 68, 2559-70 (2014).
40 Godfroid, M. et al. Insertion and deletion evolution reflects antibiotics selection pressure
in a Mycobacterium tuberculosis outbreak. PLoS Pathog. 30, e1008357 (2020).
41 Bottai, D. et al. TbD1 deletion as a driver of the evolutionary success of modern
epidemic Mycobacterium tuberculosis lineages. Nat. Commun. 11, 684 (2020).
42 Hirayama, J., Eda, S., Mitsui, H. & Minamisawa, K. Nitrate-dependent N2O emission
from intact soybean nodules via denitrification by Bradyrhizobium japonicum bacteroids. Appl.
Environ. Microbiol. 77, 8787-8790 (2011)
19
43 Tanizawa, Y., Fujisawa, T., Kaminuma, E., Nakamura & Y., Arita, M. DFAST and
DAGA: web-based integrated genome annotation tools and resources. Biosci. Microbiota Food
Health 35, 173-184 (2016).
44 Cole, M.A. & Elkan G. H. Transmissible resistance to penicillin G, neomycin, and
chloramphenicol in Rhizobium japonicum. Antimicrob. Agents Chemother. 4, 248–253 (1973).
45 Schmittgen, T.D. & Livak, K.J. Analyzing real-time PCR data by the comparative CT
method. Nat. Protoc. 3, 1101-1108 (2008).
46 Ohgane, K. & Yoshioka H. Quantification of Gel Bands by an Image J Macro, Band/Peak
Quantification Tool. protocols.io, (2019) https://dx.doi.org/10.17504/protocols.io.7vghn3w
Author contributions
S.W-H carried out experiments, data analysis, and genome analysis and drafted the original
manuscript. M.I., A.F.S., and D.T. designed and performed experiments and contributed to
manuscript writing. M.S. contributed to the generation of gene deletion mutants and interpretation of
data. N.I. and T.Y. supervised protein experiments and contributed to the interpretation of data.
H.M., S.S., H.I-A, Y.S., and K.M. supervised the conduct of this study. Y.S. and K.M. contributed to
manuscript finalization and revision. All authors reviewed the results and approved the final version
of the manuscript.
Additional information
Competing interests: The authors declare no competing interests.
Acknowledgments
This work was supported by a Grant-in-Aid for JSPS Fellows [Grant Numbers: 20J12228,
22J01397] and project JPNP18016, commissioned by the New Energy and Industrial Technology
Development Organization (NEDO). We would like to thank Cristina Sánchez Gomes for valuable
discussion, and Yukiko Fujisawa, Kaori Kakizaki, Kanako Tago, and Kouhei Ohtsubo for their
technical support.
20
Figures
Fig. 1 N2O-reducing activity of B. ottawaense. (a) N2O-reducing activity of B. ottawaense isolates,
type strain OO99T, B. diazoefficiens stain USDA110T, and the nosZ-deficient strain (ΔnosZ).
Different letters above the bars represent significant differences between inoculation treatments
analyzed using Tukey’s test after analysis of variance (ANOVA; p < 0.05). Parentheses after the
strain name indicate nodule-forming ability. R = nodule forming strain (rhizobia), N = non-
nodulation and non-diazotroph. (b) N2O-reducing activity in representative strains of B. ottawaense
and B. diazoefficiens. The graph shows the changes in N2O concentration over time in the gas phase
in the test tube.
21
Fig. 2 N2O flux in rhizosphere inoculated with either Bradyrhizobium ottawaense B.
diazoefficiens and B. japonicum. N2O flux from the rhizosphere of soybean plants inoculated with
B. ottawaense SG09 (nosZ+), B. diazoefficiens USDA110T (nosZ+), and B. japonicum USDA 6T
(nosZ-) under (a) an atmospheric concentration (approximately 340 ppb) of N2O and (b) N2O-
supplemented air (50 ppm). Asterisks represent significant differences at p < 0.05 by the t-test.
0
10
20
30
40
50
USDA6 USDA110 SG09
N2O flux (nmol/h/plant)
-15
-10
-5
0
5
10
15
20
25
30
USDA6 USDA110 SG09
N2O flux (nmol/h/plant)
*
*
*
*
a b
TT T T
22
Fig. 3 Activity of the NosZ protein of Bradyrhizobium ottawaense and B. diazoefficiens.
Coomassie brilliant blue staining(a) and NosZ-specific activity staining (DOC-PAGE, b) protein
extracted from B. ottawaense SG09 and B. diazoefficiens USDA110T. The numbers in each lane
indicate the concentration (x) rate of extracted protein samples. ‘M’ indicates the protein size marker
(60, 120, and 240 kDa were indicated). The gel images are cropped; full images are shown in
Supplemental Fig. 4. Panel c shows the signal intensity of the NosZ-specific activity staining.
23
Fig. 4 Transcriptional organization of nosR in Bradyrhizobium ottawaense SG09 and OO99T.
Pd1(c) is the transcription start site under N2O- and NO3--respiring conditions. Pd2(g) is the
transcription start site under N2O-respiring conditions. -35/-10 consensus sequences preceding each
transcription start site are indicated by underlining. Putative FixK box located upstream of Pd1 is
shown in the box. The translational start codon (ATG) of nosR is shown in bold case. The promoter
sequences of B. ottawaense SG09 and OO99T are completely identical. The dotted underlined region
indicates the 56 bp deleted in strains SF12 and SF19 (see Supplementary Fig. 6 for details).
TGCTCCATTGCATGCGCTAGCGCAAAGAGCTCGTCGAGAGACTCCAATACACCTGCGGGCTcAGCAC
TGAGCAATGATGTGCGTAGGAATGGCATACCAAGGACTCCACATGCAGATTTCTGAACCGGTTCCGC
GCACGCACAAATCTCAAGAGCGGGGTTGACAGAGTCAGTCGCGCGCGATGAGTGTTGCATgTCAGCG
GCGACAAATCATCGAAGAAGATATCAAGGCACGCGCGCCTCTGTCCGTCGCGCAAATCGCATTTGTA
TCGATATGTTGAAGCGACCGGA
FixK box -35d1 -10d1
-35d2 -10d2
nosR
Pd1
Pd2
56-bp deletion in SF12, SF19
24
Tables
Table 1. Relative expression of nosZ under N2O- and NO3--respiring conditions
N2O-respiring conditions
NO3--respiring conditions
Wild type
ΔnasS
nasS deletion
effects
Wild type
ΔnasS
nasS deletion
effects
B. diazoefficiens USDA110
T
1.0
±
0.48
3.4
±
1.7
3.4*
29.6
±
34
16.3
±
10.3
0.55
B. ottawaense SG09
211.5
±
58
430.2
±
164
2.03*
1962
±
740
1276
±
740
0.65
B. ottawaense OO99
T
163.5
±
81
337.4
±
132
2.06*
2482
±
1058
2445
±
912
0.99
B. ottawaense SF12
31.2
±
8.3
nm
nm
nm
B. ottawaense SF19
40.6
±
8.2
nm
nm
nm
Expression is shown relative to Bradyrhizobium diazoefficiens USDA110T, which is set to 1.0 and
normalized to sigA gene expression. Data are presented as the mean values ± standard error of three
independent experiments. *Significant difference, p < 0.05, n =4-6 , t-test, nm = not measured
25
Table 2. Relative expression of nosZ and N2O-reducing activity in the 56 bp deletion mutant of B.
ottawaense
Relative expression
N2O-reducing activity
(nmol/h/OD)
B. ottawaense SG09Δ56
24.0
±
7.9
303
±
17.2
B. ottawaense OO99Δ56
38.4
±
5.0
588
±
44.8
B. ottawaense SG09*
211.5
±
58
1645
±
202
B. ottawaense OO99
T
*
163.5
±
81
1418
±
106
B. diazoefficiens USDA110
T
*
1.0
±
0.48
252
±
47.1
*The wild-type data were obtained from Fig. 1a and Table 1.
