Available via license: CC BY 4.0
Content may be subject to copyright.
Al-Kufa University Journal for Biology / VOL.11 / NO.1 / Year: 2019
Print ISSN: 2073-8854 Online ISSN: 2311-6544
1
Phylogenetic and Palynological Study of the Genus Potentilla L.
(Rosaceae) in Kurdistan Region-Iraq
Hiwa H. Hasan¹ and Abdullah Sh. Sardar²
Department of Biology, College of Education, University of Salahaddin-Erbil, Erbil, Iraq
¹drhewa.husen@gmail.com ²abdullah.sardar@su.edu.krd
Abstract The phylogeny of the species of Potentilla in Kurdistan Region-Iraq was
investigated by using six in-group species and one out-group related genus Sibbaldia
parviflora, based on trnL-F intergenic region of chloroplast DNA and internal
transcribed spacer of nuclear ribosomal DNA. In addition, the pollen morphology of
the six species of Potentilla was examined by using Light Microscope (LM) and
Scanning Electron Microscope (SEM). Individual and combined analysis of trnL-F
and ITS sequence data indicated monophyly of the genus Potentilla, the results of
bayesian and maximum parsimony displayed three clades of Potentilla with high
supports (bs=100%, pp=1.00). The pollen grains appeared tricolporate and prolate-
spheroidal, oblate-spheroidal, or oblate; their sizes were small to medium; the outlines
varied from circular to ellipsoid; the exine sculpturing type was striate and consists of
shallow, fingerprint-like ridges and predominately parallel arranged.
Keywords: Phylogenetic, Palynological, trnL-F, ITS, Potentilla, Kurdistan, Iraq
1. Introduction
Rosaceae family involves 3200 species throughout the world which distributed
on 115 genera (Core, 1955); 2800 species on 95 genera (Sipson, 2006) and in Iraq,
involves 53 species distributed on 19 genera (Al-Rawi, 1964). In Iraq, the genus
Potentilla L. has not been dealt with extensive studies as the other Iraqi plant genera
which they also in need to phylogenetic and palynological studies, where the Flora of
Iraq is still in need to this type of study. However, all of its species grow in Kurdistan
of Iraq (except P. supina). The species of the genus potentilla which grow naturally
and mainly in Kurdistan are: P. speciosa Willd., P. hirta L., P. kurdica Boiss. et Hoh.
ex Boiss., P. pannosa Boiss. et Hausskn ex Boiss., P. reptans L. and P. lignosa Willd.
The first practical use of molecular data in Rosaceae was done by Takhtajan
(1997). Integrating some of the possible results of the first molecular phylogenetic
study of proper relationships across Rosaceae, traditionally recognized twelve
subfamilies (Morgan et al., 1994). However, several reliable sources of molecular
data adequately support the monophyly of Rosaceae (Morgan et al., 1994, Evans et
al., 2000, Potter et al., 2002, Faghir et al., 2014).
Potter et al. (2002), shows the phylogenetic relationships within 37 genera of
Rosaceae, which are traditionally divided into 4 subfamilies and 3 related genera
based on two specific regions of chloroplast DNA, the matK and the trnL-F genes. In
addition, Potter et al. (2007), accurately classified 88 distinct genera of Rosaceae
constructed on phylogenetic relationships based on nucleotide sequence data of six
nuclear (18S, gbssi1, gbssi2, ITS, pgip, and ppo) and four chloroplast (matK, ndhF,
rbcL, and trnL-F) regions.
-------------------------------------------------------------
A part of the First Author’s M. Sc. Thesis
Al-Kufa University Journal for Biology / VOL.11 / NO.1 / Year: 2019
Print ISSN: 2073-8854 Online ISSN: 2311-6544
2
Eriksson et al. (2003), made a good phylogenetic definition of Rosaceae based
on the sequences of internal transcribed spacer ITS of nuclear ribosomal DNA and
trnL-F region of chloroplast DNA. In the same way, Eriksson et al. (2015),
representing that Sibbaldia is a polyphyletic assemblage and it falls into five separate
clades of Potentilleae, three with Fragariinae and two with Potentilla.
Dobes and Paule (2010), reconstructed the phylogenetic relationships among 98
species of the genus Potentilla and 15 related genera based on three chloroplast DNA
markers trnS-ycf9, trnL-F, and trnC-ycf6. Moreover, several natural occurring hybrids
in Potentilla have been reported by Topel et al. (2011), based on two nuclear
ribosomal DNA the internal transcribed spacer ITS and external transcribed spacer
ETS and two regions of chloroplast DNA trnS-G and trnL-F.
The completed last accurately reconstructed complex relationships among the
tribe Potentilleae have been typically seen in the study of Feng et al. (2017), they
identified three major clades of the Potentilleae: the subtribe Fragariinae, the genera
Argentina, and Potentilla.
Pollen grains are important character for taxonomic purposes. In addition to the
taxonomic value of the pore structure the variations in the pollen grain sculptures are
important features for species classification (Reitsma, 1966). Comparative studies of
pollen morphology have provided useful characters for demarcating genera and
species and determining relationships in several ancestries of Rosaceae (Reitsma,
1966, Eide, 1981, Hebda et al., 1991, Hebda and Chinnappa, 1994, Oybak Dönmez,
2008, Wronska-Pilarek, 2011).
Based on the pollen grains, the genus Potentilla is tricolporate (Reitsma, 1966,
Eide, 1979a, Eide, 1981). Sánchez et al. (1998), used LM and SEM for 26 taxa of
Potentilla and clarified the taxonomic and phylogenetic relationships among the
species on the base of the pollen characters and they mentioned that Potentilla pollens
appear stenopalynous under light microscope. Similarly, Kołodziejek and Gabara
(2008), identified tricolporate sculpture type of 5 species of Potentilla. Faghir et al.
(2012), found that two main exin sculpture types of 28 species of the Potentilla and 6
related genera.
The aim of the present study is to investigate the relativeness between the species
of Potentilla based on the phylogenetic relationships and comparing with the nearest
genus. For this purpose, two regions were selected, the first region is chloroplast DNA
trnL-F and the second is nuclear ribosomal DNA ITS. Furthermore, to investigate the
morphology of the pollen grains of 6 species of the genus Potentilla in order to use
them in the separation of the species under study.
2. Material and Methods
2.1. Taxon Sampling
The plant taxa used in the present study were collected from the different
districts of Kurdistan region-Iraq that preserved in the Herbarium of College of
Education/ Salahaddin University (Table 1). Seven distinct taxa consist of six ingroup
taxa and one out group Sibbaldia parviflora were used in the analysis.
2.2. DNA Extraction
Total DNA was extracted from the collected specimens. The extraction
method was based on the CTAB protocol of Doyle and Doyle (1990) with some
Al-Kufa University Journal for Biology / VOL.11 / NO.1 / Year: 2019
Print ISSN: 2073-8854 Online ISSN: 2311-6544
3
modification (1X CTAB: 10 mL of 1.0 M Tris-HCl, PH 8; 4 mL of 0.5 M EDTA, PH
8; 28 mL of 5 M NaCl; 2% CTAB; 2 g PVP; and 158 ddH2O), the washing process of
the DNA pellet has been conducted twice with 0.5 mL of 80% ethanol, then DNA was
dissolved in 25 µl TE-buffer.
2.3. PCR and DNA Sequencing
The two noncoding regions of nrDNA and cpDNA were amplified by using
the primers trn-C and trn-F of Taberlet et al. (1991), and ITS-A and ITS-B of White et
al. (1990) for trnL-F intergenic spacer and ITS region respectively (Table 2). The
primers were ordered from (IDT) company-Skokie, Illinois-USA. The total volume of
amplification reactions was 25 µl and the Master Mix made up of 10.8 µl of ddH2O,
2.5 µl ThermoPol reaction buffer, 2.5 µl MgCl2, 5 µl dNTPs, 2 µl template, 1 µl from
each primers, 0.2 µl DNA polymerase (Taq polymerase). The PCR-Thermal cycler
started with 2 min for initial denaturation at 94 C° followed by 30 cycles: 30 sec. for
trnL-F and ITS for denaturation at 94 C°; 60 sec. for annealing at 54 C° for trnL-F
and 52 C° for ITS; 60 sec. for trnL-F and 90 sec. for ITS for extension at 72 C°; and
180 sec. for final extension at 72 C°. The resultant PCR products were checked on
1.5% agarose gel run in TAE buffer. The gel was stained with EtBr and photographed
under UV transilluminator.
Table 1: Specimen numbers of Potentilla species which their DNA and pollen grains
have been studied, and their preserved locations in the Herbarium of College of
Education/ Salahaddin University with collection date
Table 2: list of primers and their sequences that have been used in the study.
Primer
Direction
Sequence 5'---- 3'
Resources
ITS-A
Forward
GGAAGGAGAAGTCGTAACAAGG
(White et al., 1990)
ITS-B
Reverse
CTTTTCCTCCGCTTATTGATATG
(White et al., 1990)
trn-C
Forward
CGAAATCGGTAGACGCTACG
(Taberlet et al., 1991)
trn-F
Reverse
ATTTGAACTGGTGACACGAG
(Taberlet et al., 1991)
PCR products were purified by using Kits (Promega company-Madison-USA).
The purified PCR products were sent to the National Science and Technology
Development Agency (NSTDA) in Thailand for sequencing.
2.4. Sequence Alignment
All the DNA sequences were edited and aligned with ClastalW option
available in BioEdit, Version 7.0.4.1 (Hall, 2001) and manual adjustment, there are 7
accessions for each trnL-F and ITS regions, including the out group species.
Species
Specimen number &
Herbarium symbol
Specimen location
Date of
collection
P. hirta
7633
ESUH
Halgurd M.
2.7.2017
P. kurdica
7640
ESUH
Hasarost M.
26.6.2016
P. lignosa
7451
ESUH
Qandil M.
25.8.2016
P. pannosa
7617
ESUH
Sakran M.
7.6.2017
P. reptans
7624
ESUH
Tawela village
15.5.2016
P. speciosa
7635
ESUH
Gara M.
12.7.2017
Al-Kufa University Journal for Biology / VOL.11 / NO.1 / Year: 2019
Print ISSN: 2073-8854 Online ISSN: 2311-6544
4
2.5. Phylogenetic Analyses
a. Maximum Parsimony Analysis
The reconstruction of the phylogenetic relationships was based on Maximum
Parsimony (MP) methods. The analysis was carried out for separate and combined
regions. MP analysis was performed by using PAUP* version 4.0a164 (Swofford,
2000). Using heuristic search with 100 replicates of random taxon additions, Tree-
Bisection-Reconnection (TBR) branch swapping, MulTrees on, and steepest decent
off was performed. The maximum numbers of saved trees were 100 for each
replicate. The bootstrap values were calculated from 100 replicates, the consistency
index (CI), retention index (RI), rescaled consistency, and homoplasy index (HI) were
measured (Felsenstein, 1985).
b. Bayesian Analysis
Bayesian analysis was carried out by using MrBayes version. 3.2 (Ronquist
and Huelsenbeck, 2003). The parameters and evolutionary models were selected by
assistant of MrModeltest2 version 2.3 (Nylander et al., 2004), based on Akaike
Information Criterion (AIC), which selected GTR+G model for both combined and
ITS regions, while F81+G was selected for trnL-F. Two independent analyses were
run 1000000 generations with four chains (one cold and three heated) for each
generation and the temperature parameter set to 0.1. Trees were sampled every 100th
generations. After that (25% of initial tree sampled) were removed by burn-in period
samples, a tree with maximum 50% (majority rule consensus tree) was plotted. The
value of posterior probability (PP) was calculated and the final tree was plotted by
using FigTree software version 1.4.3 (Rambaut, 2016).
2.6. Palynological Study
a. Light Microscope (LM)
For light microscope, a mature anther has been taken from a fresh specimen
and has put in a clean hour glass, a drop of safranine-glycerine stain has added to it
(Al-Mayah, 1983). The anther has been opened by two dissected needles, then the
pollens have pull with the stain by using a special dropper for each species, and have
put on a clean slide, then covered by the cover slip slightly, at this stage the slide was
ready for examine.
In the present study, the data have been taken from (10-15) specimens for each
species. The slides have examined under Olympus-compound microscope, and
photographed by using Sony-digital camera in Education College/Salahaddin
University.
b. Scanning Electron Microscope (SEM)
For scanning electron microscope, the anthers were washed with sterilized
distil water in eppendorff tubes and then dehydrated with alcohol series 50%, 70%,
80%, 85%, 90%, 95% and three times 100%, followed by three times of 100% aceton
for 30 min each time, then left to dry in the room temperature to eliminate the large
amount of impurities that might hinder vision of the structural characteristic of the
wall. Finally, the grains were mounted on metal stup with double-side cellophane tape
and then coated with a film of gold palladium by the aid of sputtering chamber, after
that the coated samples were viewed under scanning electron microscope (INSPECT
Al-Kufa University Journal for Biology / VOL.11 / NO.1 / Year: 2019
Print ISSN: 2073-8854 Online ISSN: 2311-6544
5
The numbers inside bracts represent the minimum and maximum limit and that outside bracts represent the average.
S50) in (College of Science / Kufa University). The pollen terminology used in
accordance of Erdtman (1952) and Ueda and Tomita (1989).
3. Results
3.1. Data matrix, tree statistics and pollen morphological features The main pollen
morphological features of the studied species and the characteristics of each data
matrix and tree statistics of trnL-F and ITS regions are summarized in (Tables 3 and
4).
Aperture
Shapes & numbers
3 - Colporate
3- Colporate
3 - Colporate
3 - Colporate
3 - Colporate
3 - Colporate
Equatorial
view
oblate
oblate
oblate
oblate
Oblate
oblate
Polar view
circular
circular
triangular
circular
circular
circular
Pollen Shape
(PS)
Prolate
spheroidal
Prolate
spheroidal
Suboblate
Oblate
spheroidal
Prolate
spheroidal
spheroidal
P/E
1.10
1.05
0.87
0.98
1.02
1.07
Equatorial axis
(µm)
mean
(12-15-18)
15.00 ± 1.73
(18-20-22)
20 .00± 1.15
(12-13-15)
13.33 ± 0.88
(22-25-30)
25.66 ± 2.33
(11-12-13)
12.00 ± 0.57
(10-11-12)
11.14 ± 0.57
Polar axis (µm)
Mean
(15-17-18)
16.6 ± 0.88
(20-21-22)
21.00± 0.57
(10-12-13)
11.66 ± 0.88
(21-25-30)
25.33 ± 2.60
(10-12-15)
12.33 ± 1.45
(11-12-13)
12.00 ± 0.57
Taxon
P. hirta
P. kurdica
P. lignosa
P. pannosa
P. reptans
P. speciosa
Table 3: Pollen grain featurs
Al-Kufa University Journal for Biology / VOL.11 / NO.1 / Year: 2019
Print ISSN: 2073-8854 Online ISSN: 2311-6544
6
Table 4: A summary of alignment and tree statistics of trnL-F, ITS and combined
analyses.
3.2. Phylogenetic relationships within Potenetilla species
Three major clades were recovered within Potentilla in both nuclear ribosomal
(Reitsma) and plastid (trnL-F) tree, although the positions of these clades are varied
(fig. 1, 2 and 3). The analyses were carried out for separate and combined regions,
consisted of six ingroups and one outgroup taxa. The tree topology of the maximum
parsimony showed same results with bayesian analysis.
The clades of trnL-F region are as follow: Clade A consists of only P. lignosa
with bootstrap support (bs=100%, pp=0.93); the clade B consists of P. kurdica and P.
hirta and are highly supported (bs=100%, pp=1.00); while the clade C consists of P.
pannosa, P. reptans and P. speciosa and are highly supported (bs=100%, pp=0.98).
The clades of ITS region are as follow: Clade A consists of only P. lignosa with
bootstrap support (bs=72%, pp=0.75); Clade B consists of P. kurdica, P. Pannosa and
P. hirta (bs=92%, pp=1.00); and Clade C consists of P. reptans and P. speciosa
(bs=96%, pp=1.00).
The clades of combined regions are as follow: Clade A consists of only P. lignosa
with bootstrap support (bs=100%, pp=1.00); the clade B consists of P. kurdica and P.
hirta and are highly supported (bs=100%, pp=1.00); and clade C consists of P.
pannosa, P. reptans and P. speciosa and are highly supported (bs=100%, pp=1.00).
Parameters/Regions
trnL-F
ITS
Combined
Aligned length
374
467
841
Number of parsimony informative
characters
100
38
261
Number of variable parsimony
uninformative characters
51
67
118
Number of constant characters
51(%26)
362(%77)
426 (%54)
Tree length (steps)
425
145
578
CI (Consistency Index)
0.908
0.855
0.882
RI (Retention Index)
0.873
0.604
0.811
RC (Rescaled Index)
0.793
0.516
0.716
HI (Homoplasy index)
0.092
0.145
0.118
Model
F81+G
GTR+G
GTR+G
Al-Kufa University Journal for Biology / VOL.11 / NO.1 / Year: 2019
Print ISSN: 2073-8854 Online ISSN: 2311-6544
7
Figure 1: Strict consensus tree of most parsimonious tree resulting from phylogenetic
analysis of the cpDNA trnL-F sequences with heuristic search using maximum
parsimony analysis. (Tree length of 425 steps, CI = 0.908, RI = 0.873, RC = 0.793
and HI =0.092). Numbers on the branches indicate bootstrap support and numbers
below branches are Bayesian posterior probability values and clades are identified by
letters
3.3. Palynology
The Potentilla pollen grains are tricolporate, radially symmetrical monads.
The shape classes of pollen grains are based on P/E ratio are studied, various shapes
found in polar view from prolate-spheroidal (1.10, 1.05, and 1.02 µm) as in P. hirta,
P. kurdica and P. reptans (Plates 1A, C and 2C) respectively, oblate-spheroidal (0.98)
as in P. pannosa and spheroidal (1.07) as in P. speciosa (Plate 2A and 2E), and
suboblate (0.87) as in P. lignosa (Plate 1E). While, the outline of pollen grains is
ellipsoid in equatorial view (Plate 2 C and D) and circular (Plate 1 B, D, and E). The
aperture includes three ectocolpi and three endopores. The size of the pollen grains
ranged from small to medium. The exine sculpturing type includes striate pattern and
consists of shallow, fingerprint-like ridges and predominately parallel arranged.
(Plates 3-4).
Al-Kufa University Journal for Biology / VOL.11 / NO.1 / Year: 2019
Print ISSN: 2073-8854 Online ISSN: 2311-6544
8
Figure 2: Strict consensus tree of most parsimonious tree resulting from phylogenetic
analysis of the nrDNA ITS sequences with heuristic search using maximum
parsimony analysis. (Tree length of 145 steps, CI = 0.855, RI = 0.604, RC = 0.516
and HI =0.145). Numbers on the branches indicate bootstrap support and numbers
below branches are Bayesian posterior probability values and clades are identified by
letters.
Figure 3: Strict consensus tree of most parsimonious tree resulting from phylogenetic
analysis of the combined sequences with heuristic search using maximum parsimony
analysis. (Tree length of 578 steps, CI = 0.882, RI = 0.811, RC = 0.716 and HI
=0.118). Numbers on the branches indicate bootstrap support and numbers below
branches are Bayesian posterior probability values and clades are identified by letters.
Al-Kufa University Journal for Biology / VOL.11 / NO.1 / Year: 2019
Print ISSN: 2073-8854 Online ISSN: 2311-6544
9
A
B
C
E
D
F
Plate (1): Pollen grains of Potentilla species (LM): A&B. P. hirta; C&D.
P. kurdica; E&F. P. lignosa; A, C, and E = polar view; B, D, and F = equatorial
view
0.4 µm
Al-Kufa University Journal for Biology / VOL.11 / NO.1 / Year: 2019
Print ISSN: 2073-8854 Online ISSN: 2311-6544
10
E
D
C
F
B
A
Plate (2): Pollen grains of Potentilla species (LM): A&B. P. pannosa; C&D.
P. reptans; E&F. P. speciosa; A, C, and E = polar view; B, D, and F =
equatorial view
0.4 µm
Al-Kufa University Journal for Biology / VOL.11 / NO.1 / Year: 2019
Print ISSN: 2073-8854 Online ISSN: 2311-6544
11
Plate (3): Pollen grains of Potentilla (SEM): A&B. P. hirta; C&D. P. kurdica;
and E&F. P. pannosa; A, C, and E= polar view and B, D, and F= equatorial view
Al-Kufa University Journal for Biology / VOL.11 / NO.1 / Year: 2019
Print ISSN: 2073-8854 Online ISSN: 2311-6544
12
4. Disccusion
4.1. Phylogenetic Analysis
The tree depending on trnL-F gene sequences data in (Figure 2) showing three
clades with high supports (bs=100%, pp=1.00): The clade A consists of only P.
lignosa with supports (bs=100%, pp=0.93), due to the special occurrence and habit,
it's the only shrub species within the other Potentilla species; while the clade B
consists of sister species P. kurdica and P. hirta with high supports (bs=100%,
pp=1.00), because they are compound dichasium inflorescence and similar in there
pollen grain shapes; and clade C consists of P. pannosa and sister species P. reptans
and P. speciosa with supports (bs=100%, pp=0.98), because they have 30 stamens,
triseriate, and the flowers are bisexual, actinomorphic, pediculate and hypogenous.
Matthews (1972), identified 53 species of Potentilla and divided them into
four groups, he separated P. lignosa and P. fruticosa from the other species in a single
special group because both them are shrubs, and this is a support for the current study.
Plate (4): Pollen grains of Potentilla (SEM): A&B. P. reptans and C&D.
P. speciosa; A and C= polar view & B and D= equatorial view
Al-Kufa University Journal for Biology / VOL.11 / NO.1 / Year: 2019
Print ISSN: 2073-8854 Online ISSN: 2311-6544
13
On the other hand, the results of Eriksson et al. (2015), showed that P.
lignosa is strongly supported as a sister group with the rest of the sampled species.
Also, this finding was congruent with the results of Topel et al. (2011).
The tree based on ITS region sequences data in (Figure 2) showing three
clades with high supports (bs=96%, pp=1.00), and the results are slightly differ from
trnL-F in which P. pannosa become a sister species with P. kurdica, because they are
similar in the arrangement of vascular bundle in midrib, both are collateral and they
have villous hairs.
Faghir et al. (2011), identified two types of vascular bundles within 27 species
of Potentilla and four related genera. According to the author the P. pannosa and P.
kurdica have a collateral vascular bundle. Furthermore, Faghir et al. (2014), based on
ITS region found that P. kurdica and P. pannosa located in the same clade.
The tree based on combined regions in (Figure 3) represents the same result as
trnL-F tree with high supports (bs=100%, pp=1.00).
The phylogenetic analysis based on chloroplast noncoding trnL-F and nuclear
ribosomal ITS regions are showed to be monophyletic by Dobes and Paule (2010),
Faghir et al. (2014), and Feng et al. (2017).
4.2. Pollen grains study
It is obvious that the pollen grains of Potentilla are generally tricolporate and
prolate-spheroidal, oblate-spheroidal, or oblate. The size of the grains according to
Erdtman (1952), are small to medium. The largest pollen grains were seen in P.
pannosa. While, the smallest one is found in P. speciosa. The outlines of species are
varied from circular to ellipsoid.
Tricolporate pollen grains are founded in previous works of authors (Reitsma,
1966, Eide, 1979b, Eide, 1981, Sánchez et al., 1998, Hesse et al., 2009, Faghir et al.,
2012). With respect to quantitative data, the pollen morphological data of the present
study were dissimilar to that of previous authors (Faghir et al., 2012), especially in P,
E, and P/E mean values in P. kurdica, P. reptans, and P. pannosa where Faghir et al.
(2012), reported larger pollen sizes. However, P/E means value of P. hirta and P.
reptans are similar to previous authors (Sánchez et al., 1998).
The apertures are consisting of three ectocolpai and three endoporus. The
operculum is another feature which covers the pores, in some species the operculum is
located at the middle of aperture and partially covers it as in P. pannosa (Plate 3E).
The exine sculpturing type includes striate pattern and consists of shallow,
fingerprint-like ridges and predominately parallel arranged.
Exine sculpture types are important characters for identification between the
members of family Rosaceae (Ueda and Tomita, 1989). Striate exine sculpture in
Potentilla is found in previous investigations of authors like (Reitsma, 1966, Hebda
and Chinnappa, 1990, Faghir et al., 2012). Perveen and Qaiser (2014), identified
striate exine ornamentation in 17 species of Potentilla and also they found the
variation between exine ridge intervals and on the basis of this variation the species
are categorized into three categories: coaurse, medium, and fine striate.
Any pores on the surface of exine sculpture have not seen due to the low
resolution of the images of SEM. While, the microperforate-striate exine type is the
predominant feature in most species of Potentilla (Hebda and Chinnappa, 1990,
Chung et al., 2010, Hebda and Chinnappa, 1994). (Faghir et al. (2012)), found the
Al-Kufa University Journal for Biology / VOL.11 / NO.1 / Year: 2019
Print ISSN: 2073-8854 Online ISSN: 2311-6544
14
striate perforate with round pore in P. reptans and striate perforate with linear pore
in P. pannosa.
5. Conclusions
In the present study three major clades within the species of Potentilla were
identified. In the trnL-F tree the species P. hirta and P. kurdica placed in the same
clade, while in the ITS tree the species P. hirta replaced by the species P. pannosa.
The analysis of both trnL-F and combined regions are appeared similar in the
arrangement of the taxa.
The study of the pollen grains by using Light and Scanning Electron
Microscope showed that the palynological data of Potentilla species are not
representing more variation among the species. One reason may be that Potentilla
pollen grains appears stenopalynous under light microscope, and another reason due
to the limited numbers of Potentilla species in Kurdistan region – Iraq. However, the
present study revealing different pollen shapes among species.
6. Refferences
Al-Mayah, A. A. (1983). Taxonomy of Terminalia (Combertaceae). Ph.D. Thesis,
Univ. Of Leicester, U.K.
Al-Rawi, A. (1964). Wild plants of Iraq with their distribution, Baghdad, Ministry of
Agriculture & Irrigation, State board for agricultural & water resources
research, National Herbarium of Iraq: 81-84
Chung, K.-S., Elisens, W. J. & Skvarla, J. J. (2010). Pollen morphology and its
phylogenetic significance in tribe Sanguisorbeae (Rosaceae). Plant Syst Evol,
285, 139-148.
Core, E. L. (1955). Plant Taxonomy, Englewood Cliffs, NJ, Prentice-Hall, INC.: 327.
Dobes, C. & Paule, J. (2010). A comprehensive chloroplast DNA-based phylogeny of
the genus Potentilla (Rosaceae): implications for its geographic origin,
phylogeography and generic circumscription. Mol Phylogenet Evol, 56, 156-
75.
Doyle, J. J. & Doyle, J. L. (1990). Isolation of plant DNA from fresh tissue. Focus,
12, 13-15.
Eide, F. Y. (1979a). Species distinction in the “Potentilla pollen type” (Rosaceae) of
NW Europe. Grana, 18, 189-192.
Eide, F. Y. (1979b). Species distinction in the “Potentilla pollen type” (Rosaceae) of
NW Europe. Grana, 18, 189-192.
Eide, F. Y. (1981). Key for northwest european rosaceae pollen. Grana, 20, 101-118.
Al-Kufa University Journal for Biology / VOL.11 / NO.1 / Year: 2019
Print ISSN: 2073-8854 Online ISSN: 2311-6544
15
Erdtman, G. (1952). Pollen morphology and plant taxonomy. Angiosperm (An
introduction of
Palynology), Stockholm, Almqvist and Wiksells: 16-18.
Eriksson, T ,.Hibbs, M. S., Yoder, A. D., Delwiche, C. F. & Donoghue, M. J. (2003).
The Phylogeny of Rosoideae (Rosaceae) Based on Sequences of the Internal
Transcribed Spacers (ITS) of Nuclear Ribosomal DNA and the trnL/F Region
of Chloroplast DNA. International Journal of Plant Sciences, 164, 197-211.
Eriksson, T., Lundberg, M., Töpel, M., Östensson, P. & Smedmark, J. E. E. (2015).
Sibbaldia: a molecular phylogenetic study of a remarkably polyphyletic genus
in Rosaceae. Plant Systematics and Evolution, 301, 171-184.
Evans, R. C., Alice, L. A., Campbell, C. S., Kellogg, E. A. & Dickinson, T. A. (2000).
The granule-bound starch synthase (GBSSI) gene in the Rosaceae: multiple
loci and phylogenetic utility. Mol Phylogenet Evol, 17, 388-400.
Faghir, M. B., Attar, F. & Ertter, B. (2011). Foliar anatomy of the genus Potentilla L.
(Rosaceae) in Iran and its taxonomic implication.Iranian Journals for Science
& Technology, 35, 243-256.
Faghir, M. B., Attar, F., Ertter, B. & Eriksen, B. (2012). Pollen morphology of the
genus Potentilla (Rosaceae) in Iran. Acta Botanica Hungarica, 54, 1-16.
Faghir, M. B., Attar, F., Farazmand, A. & Kazempour Osaloo, S. (2014). Phylogeny
of the genus Potentilla (Rosaceae) in Iran based on nrDNA ITS and cpDNA
trnL-F sequences with a focus on leaf and style characters’ evolution. Turk J
Bot, 38,417-429.
Felsenstein, J. (1985). Confidence limits on phylogenies: An approach using the
bootstrap. Evolution, 39, 783-791.
Feng, T., Moore, M. J., Yan, M., Sun, Y., Zhang, H., Meng, A., Li, X., Jian, S ,.Li, J.
& Wang, H. (2017). Phylogenetic study of the tribe Potentilleae (Rosaceae),
with further insight into the disintegration of Sibbaldia. Journal of Systematics
and Evolution, 55, 177-191.
Hall, R. E. (2001). The Stock Market and Capital Accumulation. American Economic
Review, 91, 1185-1202.
Hebda, R. J. & Chinnappa, C. C. (1990). Studies on pollen morphology of Rosaceae
in Canada. Rev. Palaeobot. Palynol., 64, 103-108.
Hebda, R. J. & Chinnappa, C. C. (1994). Studies on pollen morphology of Rosaceae.
Acta Botanica Gallica, 141, 183-193.
Al-Kufa University Journal for Biology / VOL.11 / NO.1 / Year: 2019
Print ISSN: 2073-8854 Online ISSN: 2311-6544
16
Hebda, R. J., Chinnappa, C. C. & Smith, B. M. (1991). Pollen morphology of the
Rosaceae of western Canada. IV. Luetkea, Oemleria, Physocarpus, Prunus.
Canadian Journal of Botany, 69, 2583-2596.
Hesse, M., Halbritter, H., Zetter ,R., Weber, M., Buchner, R., Frosch-Radivo, A. &
Ulrich, S. (2009). Pollen Terminology, An illustrated hand book, Australia,
Springer Wien New York: 55-56.
Kołodziejek, J. & Gabara, B. (2008). Palynological study of Polish taxa of Potentilla
subsect. Collinae (Rosaceae). Acta Botanica Croatica, 67(2), 139-146.
Matthews, V. A. (1972). In: Flora of Turkey. Vol. 4., Edinburgh, Edinburgh at the
University press: 41-64.
Morgan, D. R., Soltis, D. E. & Robertson, K. R. (1994). Systematic and Evolutionary
Implications of rbcL Sequence Variation in Rosaceae. American Journal of
Botany , 81, 890-903.
Nylander, J. A., Ronquist, F., Huelsenbeck, J. P. & Nieves-Aldrey, J. L. (2004).
Bayesian phylogenetic analysis of combined data. Syst Biol, 53, 47-67.
Oybak Dönmez, E. (2008). Pollen morphology in Turkish Crataegus (Rosaceae).Turk
J Bot, 118, 59-70.
Palmer, J. D. (1985).Chloroplast DNA and molecular phylogeny. BioEssays, 2, 263-
267.
Perveen, A. & Qaiser, M. (2014). Pollen Flora of Pakistan–LXXI. Rosaceae. Pak. J.
Bot., 46, 1027-1037.
Potter, D., Eriksson, T., Evans, R. C., Oh, S., Smedmark, J. E. E., Morgan, D. R.,
Kerr ,M., Robertson, K. R., Arsenault, M., Dickinson, T. A. & Campbell, C. S.
(2007). Phylogeny and classification of Rosaceae. Plant Systematics and
Evolution, 266, 5-43.
Potter, D., Gao, F., Bortiri, P. E., Oh, S.-H. & Baggett, S. (2002). Phylogenetic
relationships in Rosaceae inferred from chloroplast matK and trnL-trnF
nucleotide sequence data. Plant Systematics and Evolution, 231, 77-89.
Rambaut, A. (2016). 〈http://tree.bio.ed.ac.uk/software/figtree /) Accessed 6 January
2016)
Reitsma, T. (1966). Pollen morphology of some European Rosaceae. Acta botanica
neerlandica, 15, 290-307.
Al-Kufa University Journal for Biology / VOL.11 / NO.1 / Year: 2019
Print ISSN: 2073-8854 Online ISSN: 2311-6544
17
Ronquist, F. & Huelsenbeck, J. P. (2003). MrBayes 3: Bayesian phylogenetic
inference under mixed models. Bioinformatics, 19, 1572-4.
Sánchez, J. A., Rico, E. & Sánchez, J. S. (1998). Palynological study of Potentilla
subg. Potentilla (Rosaceae) in the Western Mediterranean. Grana, 37, 276-
284.
Sipson, M. G. (2006). Plant Systematics, Canada, Elsevier Inc -250 : 252.
Swofford, D. L. (2000). PAUP*. Phylogenetic Analysis Using Parsimony, Version 4,
Sunderland, Massachusetts, Sinauer Associates: 6-10.
Taberlet, P., Gielly, L., Pautou, G. & Bouvet, J. (1991). Universal primers for
amplification of three non-coding regions of chloroplast DNA. Plant Mol Biol,
17, 1105-9.
Takhtajan, A. (1997). Diversity and classification
of flowering plants, New York,
Columbia University Press: 385-390.
Topel, M., Lundberg, M., Eriksson, T. & Eriksen, B. (2011). Molecular data and
ploidal levels indicate several putative allopolyploidization events in the genus
Potentilla (Rosaceae). PLoS Curr, 3 , Rrn1237.
Ueda, Y. & Tomita, H. (1989). Morphometric analysis of pollen exine patterns in
roses. J. Japan. Soc. Hort. Sci., 58, 211-220.
White, T. J., Bruns, T., Lee, S. J. & Taylor, W. (1990). Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetic. In: Innis, M. A.,
Gelfand, D. H., Sninsky, J. J. & White, T. J. (eds.) PCR Protocols: a Guide to
Methods and Applications. New York, NY, USA: Academic Press: 317-319.
Wronska-Pilarek, D. (2011). Pollen morphology of Polish native species of the Rosa
genus (Rosaceae) and its relation to systematics. Polish Botanical Society, 80,
221-232.
