Access to this full-text is provided by PLOS.
Content available from PLOS Pathogens
This content is subject to copyright.
RESEARCH ARTICLE
Single-cell mutation rate of turnip crinkle virus
(-)-strand replication intermediates
Camila Perdoncini Carvalho
1,2
, Junping Han
1
, Khwannarin Khemsom
1
, Ruifan Ren
1,3
, Luis
Eduardo Aranha Camargo
2
, Shuhei Miyashita
4
, Feng QuID
1
*
1Department of Plant Pathology, The Ohio State University, Wooster, Ohio, United States of America,
2Department of Plant Pathology and Nematology, Luiz de Queiroz College of Agriculture, University of Sao
Paolo, Piracicaba, Brazil, 3Longping Branch, College of Biology, Hunan University, Changsha, China,
4Graduate School of Agricultural Science, Tohoku University, Tohoku, Japan
*qu.28@osu.edu
Abstract
Viruses with single-stranded, positive-sense (+) RNA genomes incur high numbers of errors
during replication, thereby creating diversified genome populations from which new, better
adapted viral variants can emerge. However, a definitive error rate is known for a relatively
few (+) RNA plant viruses, due to challenges to account for perturbations caused by natural
selection and/or experimental set-ups. To address these challenges, we developed a new
approach that exclusively profiled errors in the (-)-strand replication intermediates of turnip
crinkle virus (TCV), in singly infected cells. A series of controls and safeguards were devised
to ensure errors inherent to the experimental process were accounted for. This approach
permitted the estimation of a TCV error rate of 8.47 X 10
−5
substitution per nucleotide site
per cell infection. Importantly, the characteristic error distribution pattern among the 50 cop-
ies of 2,363-base-pair cDNA fragments predicted that nearly all TCV (-) strands were prod-
ucts of one replication cycle per cell. Furthermore, some of the errors probably elevated
error frequencies by lowering the fidelity of TCV RNA-dependent RNA polymerase, and/or
permitting occasional re-replication of progeny genomes. In summary, by profiling errors in
TCV (-)-strand intermediates incurred during replication in single cells, this study provided
strong support for a stamping machine mode of replication employed by a (+) RNA virus.
Author summary
Most (+) RNA viruses introduce replication errors at relatively high frequencies. As a
result, it is of vital importance for these viruses to purge lethal errors in a timely manner.
TCV, a plant-infecting small (+) RNA virus, was proposed to encode a Bottleneck, Isolate,
Amplify, Select (BIAS) mechanism that compel swift clearance of lethal errors by bottle-
necking the number of replicating genome copies to one per cell. A crucial prediction of
this BIAS model is that such bottlenecking also acts on progeny genome copies, prevent-
ing them from repeating replication in the cells of their own genesis. The current study
tested this prediction by developing a carefully controlled, readily reproducible approach
to profile errors and error distributions in (-)-stranded replication intermediates of TCV.
PLOS PATHOGENS
PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011395 August 14, 2023 1 / 17
a1111111111
a1111111111
a1111111111
a1111111111
a1111111111
OPEN ACCESS
Citation: Carvalho CP, Han J, Khemsom K, Ren R,
Camargo LEA, Miyashita S, et al. (2023) Single-cell
mutation rate of turnip crinkle virus (-)-strand
replication intermediates. PLoS Pathog 19(8):
e1011395. https://doi.org/10.1371/journal.
ppat.1011395
Editor: Israel Paga
´n, Universidad Politecnica de
Madrid, SPAIN
Received: May 2, 2023
Accepted: July 25, 2023
Published: August 14, 2023
Copyright: ©2023 Carvalho et al. This is an open
access article distributed under the terms of the
Creative Commons Attribution License, which
permits unrestricted use, distribution, and
reproduction in any medium, provided the original
author and source are credited.
Data Availability Statement: The authors confirm
that all data underlying the findings are fully
available without restriction. All relevant data are
within the paper and its Supporting Information
files.
Funding: This study is supported in part by the
NSF grant 1758912 to FQ. CPC is supported in part
by a scholarship from the Coordenac¸ão de
Aperfeic¸oamento de Pessoal de Nı
´vel Superior -
Brasil (CAPES) – Finance Code 001. SM is
supported in part by Japan Society for the
We found that most of replication-generated (-) strands descended from the primary (+)
strands through a single replication cycle. This finding adds fresh support to the BIAS
model.
Introduction
Viruses with single-stranded, positive sense (+) RNA genomes are a major class of human, ani-
mal, and plant pathogens that include poliovirus, Dengue virus, Zika virus, and more recently
SARS-CoV-2 causing the global COVID-19 pandemic. These viruses are known to incur high
numbers of errors during the process of genome replication, as the virus-encoded RNA-
dependent RNA polymerases (RdRps) mostly lack proofreading activities [1–4]. While many
of the replication errors threaten viral competitiveness or even viability, they also create reser-
voirs of diversity through which new variants can emerge. Some of the new variants may
enable a virus to spread and flourish in a species different from its original host, causing devas-
tating diseases in the new host species. Therefore, knowledge about the mutation rates of (+)
RNA viruses is critical for assessing the potential risks of emerging viruses, especially those
that transcended the host barriers in the recent past.
However, mutation rates are known for a surprisingly few (+) RNA viruses, primarily due
to difficulties to account for biases caused by natural selection, and/or the measurement pro-
cess itself. Several frequently used methods have been critically reviewed by Peck and Lauring
[2]. The most common ones are Sa¨nger sequencing of randomly selected cDNA clones of viral
genomes produced during infections of culture cells or host individuals [5–8], and more
recently, high-throughput sequencing of viral cDNA libraries [9,10]. Despite various precau-
tions taken to minimize selection biases or mutations introduced by the measurement proce-
dures such as reverse transcription-polymerase chain reaction (RT-PCR), mutations identified
by these two methods likely still favor more competitive ones, while undercounting deleterious
ones. A third approach known as mutation accumulation assay uses serial dilutions to separate
genome variants from each other, subsequent parallel propagation of these variants permits
the capture of variants less capable of competing in a mixed infection environment. The least
biased method is the fluctuation assay, which relies on a scorable, selection-neutral phenotype
that can be abolished, and restored, with very few point mutations. Spontaneous reversions or
compensatory mutations occurring during virus replication that restore the abolished pheno-
type are then profiled through phenotype scoring and/or sequencing [11,12]. A drawback of
this approach is that huge numbers of phenotype-restoring variants must be screened in order
to capture the complete spectrum of mutations necessary for robust mutation rate computa-
tion. This is because the initial phenotype-abolishing change(s) usually alter just one or very
few nucleotides of a viral genome. Accordingly, the chance of spontaneous phenotype-restor-
ing mutations occurring at these few sites would be extremely low, necessitating the screening
of enormous numbers of descendant copies. Finally, most of these methods required a pre-
propagation step to bulk up the inoculum pools. As a result, mutations occurring during this
pre-propagation stage may distort the estimation of mutation rates [11,13].
To address these limitations, we initiated a study to obtain a more accurate estimation of
mutation rates incurred during replication of a (+) RNA virus. We decided to focus our atten-
tion on (-)-strand RNA intermediates [referred to as (-) strands hereafter for simplicity] pro-
duced during (+) RNA virus replication in single cells. This decision was based on the
understanding that production of (-) strands was the first step of (+) RNA virus replication,
thus errors detectable in the (-) strands in primarily infected cells would directly reflect the
PLOS PATHOGENS
Discerning the error rate of a (+) RNA virus by interrogating its (-)-strand intermediates
PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011395 August 14, 2023 2 / 17
Promotion of Science (JSPS) KAKENHI grant
21K05591. The funders had no role in study
design, data collection and analysis, decision to
publish, or preparation of the manuscript.
Competing interests: The authors have declared
that no competing interests exist.
mutation rate of a viral RdRp, commonly defined as substitutions per nucleotide site per cell
infection (s/n/c) [2]. Therefore, the hypothesis for the current study was that (-) strands in sin-
gle cells, having been exposed to minimal selection pressure, retained the full spectrum of rep-
lication errors, including lethal ones.
An added benefit of analyzing (-) strands was to permit the estimation of viral replication
cycles per cell. This is because, should (-) strands be produced from the (+) strands of progeny
viruses arisen from repeated cycles of replication, the number of errors in them would increase
at a rate of two folds for every additional cycle [(-) strand to (+) strand, then back to (-) strand].
This would cause cells to contain a mixture of (-) strands containing varying number of errors
depending on the number of replication cycles they repeated. As a result, individual (-) strands
sampled for sequencing would be expected to contain errors whose numbers varied dramati-
cally from each other, and severely deviate from the error frequency mean obtained by divid-
ing the total number of (-) strands with the total number of errors. More precisely, they would
deviate from the random distribution pattern governed by the Poisson distribution law. In
short, by comparing the observed error distributions in different (-) strands with Poisson dis-
tribution predictions, we would be able to determine whether all (-) strands in an average cell
descended from a single primary (+) strand through a stamping machine replication mode.
The Poisson distribution rationale was invoked by previous authors [13] to conclude that bac-
teriophage f6 with a double-stranded RNA genome replicated through a predominantly
stamping machine mode.
To test the feasibility of our idea, we adopted turnip crinkle virus (TCV) as the model for
the current study. TCV is a small virus belonging to the Genus Betacarmovirus, Family Tom-
busviridae, with a (+) RNA genome of 4,054 nucleotides (nt) (Fig 1). TCV genomic RNA
(gRNA) encodes five proteins: the 5’ proximal p28 and its translational read-through product
p88 are both essential for TCV replication. Two subgenomic RNAs (sgRNA1 and 2) are pro-
duced inside the infected cells, with sgRNA1 serving as mRNAs for the p8 and p9 movement
proteins (MPs) [14,15], and sgRNA2 the p38. p38 is both the viral capsid protein (CP), and the
TCV-encoded suppressor of RNA silencing (VSR) [16–18]. Our results suggested that TCV
RdRp incurred errors at a rate of 8.47 X 10
−5
for every nucleotide incorporated in the (-)
strands in single cells. This rate translates into approximately 0.69 error for every new (+) TCV
genome synthesized, and is within the range of previous estimates obtained with other plant-
infecting (+) RNA viruses [2,19]. Notably, our approach permitted detection of errors with
lethal consequences. Finally, the observed pattern of error distribution in individual (-) strands
suggested that progeny TCV genome copies rarely repeated replication in the cells of their
own genesis.
Results and discussion
Strategy to capture errors in the (-) strands of replicating TCV with high
confidence
In an effort to determine the error rate of TCV RdRp, we introduced several measures to over-
come various limitations associated with existing error-profiling methods (Table 1). First, to
address the uncertainty related to errors introduced into viral inoculums through pre-propa-
gation, we delivered TCV cDNA directly into plant cells to initiate viral infections. To accom-
modate such delivery, the full-length TCV cDNA was inserted in a binary plasmid (pAI101)
[20–22], under control of the strong 35S promoter (P35S) of cauliflower mosaic virus (CaMV).
The resulting plasmid was sent into cells of Nicotiana benthamiana plants via agro-infiltration
(see Materials and Methods for details). While the viral cDNA still needed to be transcribed
into replication-initiating RNA upon entering plant cells, we reasoned that the DNA-
PLOS PATHOGENS
Discerning the error rate of a (+) RNA virus by interrogating its (-)-strand intermediates
PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011395 August 14, 2023 3 / 17
dependent RNA polymerase II (Pol II) of N.benthamiana cells, recruited by P35S to carry out
transcription, would incur relatively few errors [23,24]. Although this assumption was proven
to be inaccurate by our data, Pol II-introduced errors were easily controlled with a non-repli-
cating construct (RTRC. Fig 1A, bottom) that produced (-) strands only, in a Pol II-dependent
manner (see Section 3).
Second, to avoid errors introduced sequentially through reiterative replication in successive
cells, TCV cDNA was modified to disrupt the MP-coding region, thereby restricting viral rep-
lication in single cells. Note that earlier studies concluded that such disruption had little effect
on TCV replication [14,25]. Additionally, to permit microscopical monitoring of viral replica-
tion, the TCV cDNA was further modified to encode an mCherry reporter in place of p38,
enabling replication-dependent expression of the mCherry fluorescent protein. Previous
Fig 1. Generation of (-)-strand-specific RT-PCR products of TCV for error profiling. A. Constructs assembled for
the current study. The top diagram depicts the (+)-strand genome of TCV encoding proteins p28, p88, p8, p9, and p38.
Among them, p8 and p9 are translated from sgRNA1, p38 sgRNA2. TCVdMP_sg2R is a modified TCV replicon
integrated in the binary plasmid pAI101, downstream of the strong P35S promoter so that once inside plant cells, the
host cell PolII would be recruited to transcribe replication-initiating viral RNAs. Note that the p8 and p9 MP ORFs
were deleted, and the p38 ORF was replaced by that of mCherry. Note that the short, arrowed lines in blue symbolize
the four primers used in strand-specific RT-PCR, with the one in light blue used in the RT step, whereas the three in
dark blue used in the PCR step. RTdMP_sg2R was further modified from TCVdMP_sg2R by eliminating the p28 stop
codon, rendering its transcripts incapable of launching replication, hence are exclusively (+) strands. RTRC contains
the reverse-complemented form of the first 2,489 nt of RTdMP_sg2R, so that P35S-driven transcription leads to RNAs
that are exclusively (-)-stranded relative to TCV genome. B. Confocal microscopy images of N. benthamiana
epidermal cells showing that only TCVdMP_sg2R replicated to produce mCherry fluorescene. C. Strand-specific
RT-PCR showing that only the two constructs expected to synthesize (-) strands, TCVdMP_sg2R and RTRC, produced
PCR products of expected size (2,363 bp). Note that at 24 PCR cycles, the RTRC-specific product was much less
abundant.
https://doi.org/10.1371/journal.ppat.1011395.g001
PLOS PATHOGENS
Discerning the error rate of a (+) RNA virus by interrogating its (-)-strand intermediates
PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011395 August 14, 2023 4 / 17
studies [17,26] established that TCV replication in single cells was not compromised by loss of
p38, as long as its VSR function was compensated by a transiently expressed VSR of a different
virus, which in our experiments was p19 of tomato bushy stunt virus (TBSV) [16,26]. Combin-
ing these modifications led to the TCVdMP_sg2R replicon (Fig 1A and 1B).
Most importantly, to preclude natural selection-based differential amplification of muta-
tion-containing genomes, we focused on errors incurred in the process of synthesizing viral (-)
strands. We reasoned that should TCV replicate for a single cycle in each cell, all (-) strands
would incur similar numbers of errors. On the other hand, were multiple cycles of replication
to occur in each cell, such occurrences could be detected in the form of (-) strands containing
varying numbers of errors concomitant with the number of replication cycles they experi-
enced. More specifically, using primary (-) strands as reference, error frequencies in 2
nd
, 3
rd
,
and 4
th
generation (-) strands would increase by 3, 5, and 7 folds, respectively, because they
would have experienced (-)-to-(+), then back to (-), for one, two, and three rounds, respec-
tively. Therefore, should multi-cycle replication be the predominant mode of replication, we
would expect to detect a mixture of (-) strands with varying error numbers. Of course, this
could only be true when TCV replication was allowed to continue for a sufficient length of
time. This concern was addressed by harvesting samples at 4 days post agro-infiltration, thus
surpassing the previously established time (18–24 hours) needed for maximal accumulation of
TCV gRNA in single cells [14,25].
We further recognized that, given the rarity of errors in short reads, definitive differentia-
tion between these two error distribution patterns would only be possible if the sequence reads
were of sufficient lengths (Table 1). Thus, (-)-strand-specific of cDNAs of 2,450 bp in size were
produced. These cDNAs were cloned, and individual clones were subject to Sa¨nger sequencing
to resolve sequences of the cDNA inserts. In pilot experiments we also attempted to use high
throughput sequencing (PacBio SMRT sequencing) to achieve greater sequencing depths for
the long cDNA fragments, but had to abandon that technique due to its high error rates
(�10
−4
). Excluding terminal sequences that were part of RT-PCR primers, the sequence
usable for error screening was 2,363 bp. This region corresponded to TCV positions 43–2,405,
encompassing the entire p88 open reading frame (ORF; positions 64 to 2,391. Figs 1and 2),
and accounting for 58% of the 4,054-nt TCV genome.
Another advantage of exclusive profiling of (-) strands was that it permitted unambiguous
separation of replication progeny from Pol II transcripts. This is because, while (+) strands in
Table 1. Experimental design–challenges and solutions.
Challenge Solution
1. Replication-initiating viruses might contain
variable numbers of founding errors
Initiate replication with RNA transcribed by host Pol II that
incurs one round of errors at a constant rate.
2. Viral genomes might have replicated in a
variable number of cells prior to sampling
Restrict replication in single cells by using a plant-infecting virus
(TCV) with MP genes disrupted.
3. Phenotype-based selection might enrich
certain mutations
Profile errors in the non-protein-coding (-)-strand replication
intermediates.
4. Differentiate between primary and secondary
(-) strands
Generate and analyze continuous cDNA fragments of at least
2,000 nt in length.
5. Ensure cDNA of (-) strands is exclusively
derived from (-) strands
a. Carry out strand-specific RT-PCR following an established
procedure;
b. Include control constructs that produce exclusively (+) and
(-) strands, respectively.
6. Account for errors incurred during all steps of
the error-profiling experiment
Include appropriate controls at every step. Especially relevant to
current study was the RTRC control producing (-) strands
independent of viral replication.
https://doi.org/10.1371/journal.ppat.1011395.t001
PLOS PATHOGENS
Discerning the error rate of a (+) RNA virus by interrogating its (-)-strand intermediates
PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011395 August 14, 2023 5 / 17
the cell could be Pol II transcripts or progeny of viral replication, (-) strands could only be pro-
duced through viral replication. This is important because our previous studies showed that
very few (as few as one) of Pol II-transcribed (+) strands initiated TCV replication in each cell,
even though thousands of them were probably present [27–30]. Note although (-)-strands with
virus sequences could also be produced by host-encoded RNA-dependent RNA polymerases
(RDRs), these were normally subject to swift processing to produce small interfering RNAs
(siRNAs) [31–33], hence undetectable in sizes longer than 200 nt.
Experimentally, to ensure exclusive use of (-) strands for cDNA synthesis, a strand-specific
RT-PCR procedure developed by Plaskon and colleagues [34] was adopted with minor modifi-
cations (Fig 1A). Briefly, (-)-strand-specific RT (ssRT) was primed with ssRT-Tg3-25F (Fig
1A, light blue letters and arrows), a chimeric primer containing a 24-nt non-TCV 5’ tail (the
ssRT-Tg3 tail), and an 18-nt TCV-specific 3’ terminus (TCV positions 25–42) complementary
to the 3’ end of TCV (-) strands. At the PCR step, ssRT-Tg3, a different primer whose sequence
was identical to the non-TCV tail of ssRT-Tg3-25F, was paired with a two-primer mix consist-
ing of ssRT-Tg4 and ssRT-Tg4-2425R, at a 1: 0.05 ratio. ssRT-Tg4 did not contain any TCV
sequence. By contrast, ssRT-Tg4-2425R had the sequence of ssRT-Tg4 as its 5’ tail, and a 20-nt
sequence complementary to TCV positions 2,425–2,406 at its 3’ terminus (Fig 1A).
Finally, to control for occasional contamination of (+) strands, and to account for errors
incurred during various steps of the experiment, such as Pol II transcription, RT-PCR, cloning,
and sequencing, two control constructs were always delivered into plant cells in parallel to
TCVdMP_sg2R (Fig 1A). The first, RTdMP_sg2R, contained a 1-nt mutation that abolished
the stop codon of p28, causing its transcripts to lose the ability to replicate, thus remaining
exclusively (+) sense (Fig 1A). Conversely, the second control, RTRC, harbored the first 2,489
nt of RTdMP_sg2R (including the 1-nt replication-abolishing mutation), but in the reverse-
complemented orientation, causing its transcripts to be exclusively (-)-sense (Fig 1A. Also
note the landing positions of RT-PCR primers in TCVdMP_sg2R and RTRC). Combining
these considerations (Table 1) led to an experimental procedure that yielded highly specific
cDNAs of approximately 2,500 bp from RNA samples of TCVdMP_sg2R and RTRC (Fig 1C,
lanes 2 and 4), but not those of p19 only or RTdMP_sg2R (lanes 1 and 3) (Also see Fig 1B).
These results indicated that the PCR products were derived exclusively from TCV (-) strands.
Fig 2. Mapping the identified errors to TCV genome. The top diagram depicts the 2,363-bp range, corresponding to
TCV genome positions 43 to 2,435, used for error identification. The numbers on top were added as references for
convenient allocation of the errors. Within this range, positions 64–2391 encompasses the 775-aa p88 ORF. The
middle diagram depicts the 23 errors identified in TCVdMP_sg2R-derived clones, and their corresponding aa changes.
The nt changes, converted to (+) polarity, are shown in black font, whereas the corresponding aa changes are shown in
dark blue. The unaltered aa residues are underlined. Errors identified from the same clone are highlighted with same-
colored boxes (light blue or orange). The bottom diagram depicts 13 errors identified in RTRC-derived clones. Errors
occurring in the same clone are highlighted with either light or dark gray boxes.
https://doi.org/10.1371/journal.ppat.1011395.g002
PLOS PATHOGENS
Discerning the error rate of a (+) RNA virus by interrogating its (-)-strand intermediates
PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011395 August 14, 2023 6 / 17
Error rate of (-) strands produced by TCV replication
To determine the error rate of TCV RdRp, we then cloned the 2,450-bp (-)-strand-specific
PCR products, derived from both TCVdMP_sg2R and RTRC, into the plasmid pUC19. For
each of the two PCR products, 50 clones were subject to Sa¨nger sequencing to identify errors.
Surprisingly, while 17 out of 50 (34%) clones derived from replicating TCVdMP_sg2R con-
tained one or more errors, 11 out of 50 (22%) clones derived from the non-replicating RTRC
also contained errors, making the difference less than two-fold (Table 2). Out of the 17
TCVdMP_sg2R-derived, error-containing clones, 15 had just 1 error each, none had 2 or 3
errors, yet two contained 4 errors each (Table 2). By contrast, among the 11 RTRC-derived,
error-containing clones, nine had 1 error each, two had 2 each. The difference in total num-
bers of errors, 23 versus 13, translated into error rates of 1.947 X 10
−4
and 1.100 X 10
−4
s/n/c,
for TCVdMP_sg2R and RTRC (-) strands, respectively. An error rate for TCV RdRp was
deduced by subtracting the latter rate from the former, resulting in 0.847 X 10
−4
, or 8.47 X
10
−5
. Considering the size of TCV genome (4,054 nt), this error rate meant approximately 34%
of (-)-strands synthesized, or 68% of (+)-stranded progeny TCV genome copies, would con-
tain one error, if all progeny genome copies arose from a single cycle of replication. This error
rate was within the range of the mutation rates of other (+) RNA plant viruses [5,8,19].
Unexpectedly frequent error introduction by Pol II
To determine whether certain class(es) of mutations occurred more frequently than others, we
next attempted to categorize the specific error classes found in the sequenced DNA fragments.
Note that the mutation classes compiled in Table 3 were formatted as if they all occurred in the
TCV (-) strands, even though some errors must have been introduced through processes such
as Pol II transcription or RT-PCR. As shown in Table 3, the overwhelming majority (11 of 13)
of errors derived from the non-replicating (-) strands of RTRC were C-to-U, with the remain-
ing two being A-to-G and G-to-A. Thus, all of RTRC-specific errors were transitions.
Previous studies suggested that C-to-U errors, which would be G-to-A in the reverse-tran-
scribed cDNA, were over-represented in reverse-transcriptase-generated errors [23,24]. How-
ever, this could not explain why the same class of errors did not occupy a similar percentage of
TCVdMP_sg2R-specific clones (2/50 as opposed to 11/50). On the other hand, over-represen-
tation of C-to-U errors in RTRC (-) strands could not be attributed to PCR either, as PCR-
introduced errors would be expected to have a similar chance to occur in both strands of the
double-stranded DNA, hence would manifest as C-to-U and G-to-A with similar frequencies.
Table 2. Number of errors in replication-generated (-)-strands of TCVdMP_sg2R, and replication-independent
(-)-strands of RTRC.
Construct TCVdMP_sg2R RTRC
Clones sequenced 50 50
Error-free clones 33 39
Error-containing clones 17 11
Clones with 1 error 15 9
Clones with 2 errors 0 2
Clones with 3 errors 0 0
Clones with 4 errors 2 0
Total number of errors 23 13
nt resolved per clone 2,363 2,363
Total nt sequenced 118,150 118,150
Mutation rate (s/n/c) 1.947 X 10
−4
1.100 X 10
−4
https://doi.org/10.1371/journal.ppat.1011395.t002
PLOS PATHOGENS
Discerning the error rate of a (+) RNA virus by interrogating its (-)-strand intermediates
PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011395 August 14, 2023 7 / 17
However, comparing the C-to-U dominance in RTRC-derived clones (11/50) with the G-
to-A dominance in TCVdMP_sg2R-derived clones (11/50) prompted an intriguing revelation.
Keep in mind that the RTRC (-) strands were direct transcripts of Pol II, whereas
TCVdMP_sg2R (-) strands were copied from (+) stands that were in turn transcripts of Pol II.
Therefore, should Pol II be responsible for the C-to-U errors in the RTRC (-) strands, the
same class of errors would have been introduced in the TCVdMP_sg2R (+) strands, hence
manifesting themselves as G-to-A in TCVdMP_sg2R (-) strands. The fact that these two types
of errors occurred in their corresponding (-) strand pools at identical frequencies (both 11/50)
was consistent with this interpretation. Thus, Pol II of N.benthamiana likely contributed a
substantial fraction of errors detected in both (-) strand samples. Conversely, other steps of the
experimental procedure, such as RT-PCR and cloning, likely had very modest contributions.
Interestingly, the C-to-U errors were also found to be the most common class of errors
introduced by Pol II of C.elegans and budding yeast [23,24]. Nevertheless, the error rate of N.
benthamiana Pol II, at approximately 9.31 X 10
−5
(11/118,150), was substantially higher than
Pol II of C.elegans (4 X 10
−6
) and budding yeast (3.9 X 10
−6
) [23,24]. However, in our experi-
ments the N.benthamiana Pol II was driven by P35S, a promoter of virus origin. Though not
yet investigated, it is possible that Pol II error rate could be affected by the origin and/or
strength of the promoters. Nonetheless, unlike pre-propagated virus inoculums, all Pol II tran-
scripts would have experienced a single round of error introduction. As a result, this class of
errors was easily accounted for by including the RTRC control.
Mutation spectrum of TCVdMP_sg2R (-) strands
Aside from the 11 G-to-A errors discussed above, the remaining 12 errors specific to
TCVdMP_sg2R (-) strands encompassed 8 different classes (Table 3). While the 3 remaining
classes of transitions (A-to-G, U-to-C, C-to-U) were all detected twice, only one transversion
class (C-to-A) was detected twice. By contrast, three transversions, U-to-A, G-to-C, and U-to-
G, were completely absent. Intriguingly, despite the relative rarity of transversions, three of
them, A-to-U, C-to-G, and A-to-C, were actually found to co-exist in the same cDNA clone (*
in Table 3), along with another mutation that was a G-to-A transition [Fig 2. All 4 mutations
are highlighted with light blue boxes. Also note that here the error identities were converted to
their (+)-strand complements]. The simultaneous occurrence of these four errors in the same
Table 3. Types of errors [Based on TCV (-)-strands. Stars (*) highlight the fact that the A-to-U, C-to-G, and A-to-C
errors occurred in the same clone].
Error Type TCVdMP_sg2R RTRC
Transversion A !U 1*0
U!A 0 0
C!G 1*0
G!C 0 0
A!C 1*0
U!G 0 0
C!A 2 0
G!U 1 0
Transition A !G 2 1
U!C 2 0
C!U 2 11
G!A 11 1
Indel 0 0
https://doi.org/10.1371/journal.ppat.1011395.t003
PLOS PATHOGENS
Discerning the error rate of a (+) RNA virus by interrogating its (-)-strand intermediates
PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011395 August 14, 2023 8 / 17
clone raised the possibility that one of them might be a primary, fidelity-relaxing error, causing
the TCV RdRp to preferentially mis-incorporate transversions. It was further possible that
such fidelity-relaxing mutation could have been introduced by Pol II, given its relatively high
error rate as discussed above. Consistent with these deliberations, all four of the errors caused
amino acid (aa) identity changes in p88 (Fig 2).
Long reads unveil an error distribution pattern suggestive of one
replication cycle per cell
The relatively long inserts (2,363 bp, or 58% of the TCV genome) of our clones permitted us to
inspect the pattern of error distribution in the clones in comparison with random error occur-
rence, with an error rate of 8.47 X 10
−5
. For this we must first adjust the number of errors in
TCVdMP_sg2R-derived clones against the error number of RTRC-derived clones. The first
adjustment was to subtract the 23 errors with 13 identified in RTRC-derived clones, arriving at
an adjusted error number of 10. The second adjustment dealt with the two clones that con-
tained 4 errors each before adjustment. We assumed that they each contained 2 errors that
were introduced by Pol II and/or other steps of the experiment. This assumption was based on
two rationales: (i) the ratio of RTRC errors vs TCVdMP_sg2R errors was 13/23 = 0.57, mean-
ing that among the 8 errors found in these two clones, 4–5 (8 X 0.57) were probably introduced
by Pol II or other experimental steps; (ii) two of the RTRC-derived clones contained 2 errors
each. As a result of the adjustments, the number of clones with 1 and 2 errors became 6 and 2,
respectively, adding to a total of 10 errors (Table 4, Adjusted column). The remaining 42
clones would be error-free.
In comparison, an error rate of 8.47 X 10
−5
, assuming a single cycle of replication, would
predict that an average 2,363-nt fragment had a chance of 0.2 (8.47 X 10
−5
X 2,363) to contain
one error. Nevertheless, due to the stochastic nature of error occurrence, the probability exists
that some of the (-) strand fragments might contain 2 or even more errors. Such probabilities
can be calculated using the Poisson distribution formula below, with p representing the proba-
bility of having knumber of errors occurring in a fragment, given an error frequency of λper
fragment (0.20 in our case):
pðkÞ ¼ ellk=k!
The probabilities of having 0, 1, 2, 3, and 4 errors, along with the predicted numbers of
clones (out of a total of 50) under each category, are listed in Table 4. The fact that the pre-
dicted numbers closely tracked the adjusted numbers for the 0, 1, 3, and 4 error categories
indicated that most of the (-) strands profiled were direct progeny of the primary replication-
initiating (+) strands. Put it differently, the progeny (+) strands rarely initiated new replication
in the cells of their own genesis. Given the slightly-more-than-expected occurrence of clones
Table 4. Poisson Distribution prediction of probabilities (p) of clones containing 0, 1, 2, 3, and 4 errors (k), and the deduced numbers of clones out of 50sequenced
(#/50). The observed numbers of clones, adjusted or raw, are listed for comparison. Calculations were carried out for two error frequencies (λ): 0.2 (adjusted) and 0.46
(unadjusted), per 2,363-nt (-) strand fragment.
kλ= 0.20 λ= 0.46
p #/50 Adjusted p #/50 Raw
0 0.819 41 42 0.631 31.5 33
1 0.164 8.2 6 0.290 14.5 15
2 0.016 0.8 2 0.067 3.3 0
3 0.001 0 0 0.010 0.5 0
4 0 0 0 0.001 0 2
https://doi.org/10.1371/journal.ppat.1011395.t004
PLOS PATHOGENS
Discerning the error rate of a (+) RNA virus by interrogating its (-)-strand intermediates
PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011395 August 14, 2023 9 / 17
with two errors (2 versus 0.8), one might argue that a fraction of progeny genomes did re-initi-
ate replication without exiting parental cells. While such events could not be completely ruled
out, they are unlikely to be frequent.
To lay out the rationales for this argument, we first imagine that the newly synthesized
progeny genomes repeat replication for just one cycle. Note that only one copy of Pol II-tran-
scribed TCV genome could initiate viral replication in each agro-infiltrated N.benthamiana
cells to synthesize viral (-) strands [27,29,30]. As a result, second-cycle replication by even a
small fraction of progeny (+) strands would produce enough secondary (-) strands to make
themselves detectable. Such secondary (-) strands would have gone through two more copying
steps: (-) to (+), then back to (-), meaning they would be expected to contain 3 times as many
errors as primary (-) strands. Further extrapolating this thought experiment for two more rep-
lication cycles, we could see that (-) strands of 3
rd
and 4
th
generations would have 5 and 7
times as many errors as the primary (-) strands. Therefore, if TCV replication were to repeat
for multiple cycles per cell, we would detect (-) strands that contain errors at varying frequen-
cies, with the overall pattern deviating dramatically from Poisson distribution. Thus, the fact
that the observed pattern conformed to Poisson distribution was highly consistent with the
stamping machine replication mode of one cycle per cell.
Similar conclusions could also be drawn using the raw data without adjustment (Tables 2
and 4). Although Pol II errors occupied a substantial fraction of raw errors, these errors should
maintain a constant frequency irrespective of the number of replication cycles, as Pol II tran-
scripts could not re-enter transcription/replication independent of viral replication. Put differ-
ently, Pol II errors were introduced through one single round of transcription at a relatively
constant rate (approximately 9.31 X 10
−5
) that was very similar to TCV RdRp (8.47 X 10
−5
). As
a result, the raw data with a total number of errors at 23 for TCVdMP_sg2R (-) strands could
also be treated as if they replicated with a higher error frequency (λ) of 0.46 per 2,363-nt frag-
ment. Repeating the Poisson Distribution calculation, the predicted numbers of clones with 0,
1, 2, 3, and 4 errors would be 31.5, 14.5, 3.3, 0.5, and 0 (Table 4). Again the clone numbers
with 0, 1, and 3 errors closely matched Poisson Distribution. By contrast, the clone numbers
with 2 and 4 errors moderately deviated from Poisson distribution predictions. These results
reinforced the conclusion that most of the (-) strands were products of one-cycle replication.
That 2 clones had 4 errors may indicate a small fraction of (-) strands arose from more than
one replication cycles, or from more frequent error introduction by RdRp variants with pri-
mary, fidelity-relaxing mutation(s).
It is important to note that rare multi-cycle replication events could themselves be due to
mutations that perturbed the genetic control of per-cell replication cycles. If one-cycle replica-
tion is an evolutionarily selected, genome-encoded trait of TCV, one can expect this trait being
occasionally undermined by mutations in the gene(s) encoding this trait. Rare viral mutants
containing such mutations, before being purged by natural selection, can amplify themselves
to high numbers through multi-cycle replication, and concomitantly incurring additional
errors, hence detected by error-profiling. Similarly, since the error rate of a viral RdRp is also
optimized through natural selection, it too could be relaxed by occasional mutations. Such
occasional error rate relaxation would be expected to introduce more errors in the progeny
genomes, thereby interfering with both the estimation of error rates and determination of per-
cell replication cycles. In short, while we cannot completely rule out occasional second-cycle
replication, such occurrence could very well reflect primary mutation events subverting certain
genetically encoded traits that safeguard one-cycle-per-cell replication.
We hasten to add two qualifications to the one-replication-cycle-per-cell conclusion. First,
one replication cycle per cell should not be taken to mean just one (-)-strand copy from every
(+)-strand template. Rather, we argue that each of the (+) strands probably templated the
PLOS PATHOGENS
Discerning the error rate of a (+) RNA virus by interrogating its (-)-strand intermediates
PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011395 August 14, 2023 10 / 17
synthesis of numerous (-)-strand copies, and each of the (-) strands then templated the synthe-
sis of numerous (+) strands. This expands the stamping machine model proposed by others by
proposing that “stamping” can occur on both founding (+) strands and their (-)-strand inter-
mediates [13,35]. Second, sgRNAs produced by TCV and other similar viruses need not to
obey the one cycle rule imposed on genomic RNAs. This is because sgRNA production is
known to be dependent on active replication, hence sgRNA (-) strands must be copied from
progeny (+) RNAs. However, sgRNAs are not inherited by the next generation of viruses, thus
can afford to harbor more errors.
It should be noted that at least two other RNA viruses, namely bacteriophage f6 and turnip
mosaic virus, have been reported to replicate through a predominantly stamping machine
mode [13,35]. However, this mode does not appear to apply to the replication of poliovirus
(PV), because “on average the (PV) viral progeny produced from each cell are approximately
five generations removed from the infecting virus” [36]. This is despite the fact that the error
rate of PV RdRp, at 9.0 X 10
−5
[19], is strikingly similar to that of TCV RdRp. The simplest
explanation appears to be that TCV and PV are different viruses that infect drastically different
host cells. For example, TCV synthesizes some of the viral proteins (p8, p9, p38) using subge-
nomic mRNAs produced in the infected cells, whereas PV synthesizes all viral proteins in the
form of a continuous polyprotein precursor that is subsequently proteolytically processed to
yield mature proteins. As a result, there exists a possibility that some, or even most, of PV RNAs
in the infected cells are dedicated mRNAs that do not become part of progeny viruses, thus
could afford to tolerate more errors. Aside from this, it is also possible that the sequence reads
profiled by the PV study [36] were too short to permit the differentiation of primary errors
inherent of the wildtype RdRp from secondary errors introduced by mutated forms of RdRp
that were more error-prone. Finally, errors pre-existing in the PV inoculums might have con-
tributed higher error frequencies in the PV study. Careful assessment of these possibilities
should reveal the underlying evolutionary rationales for the different replication modes.
Two lethal TCV mutants captured through (-)-strand profiling
To determine whether the TCVdMP_sg2R-specific errors would affect the functionality of the
p28/p88 proteins, the (-)-strand errors were converted to their (+)-strand complements and
assessed for their potential to alter the identity of p28/p88 aa residues. Six of the 23 errors
(C399U, C627U, C972U, C1290U, A1539G, U2182C) were predicted to maintain the aa resi-
dues of wildtype RdRp (Fig 2, middle, unaltered aa are underlined). Most of the remaining
errors were predicted to cause aa changes that did not appear to be seriously debilitating (e.g.
A113V, A133V, T172M, A233V, G547S, E748Q), though their specific impacts remain to be
investigated. However, several mutations did have the potential to cause more drastic aa
changes, including S153L, R204H, R273C, Y677N, F726L, and L740R. Finally, the mutation
G2332U caused the most dramatic aa change by converting G757 into a premature stop codon
(Fig 2, middle, red font). Interestingly, this mutation was part of the second clone with 4 errors
(Fig 2, middle, orange boxes), suggesting that this mutation was likewise among the secondary
errors caused by a more error-prone mutant RdRp.
We next wondered if TCV mutants containing the two sets of 4 errors were still capable of
productive replication. To this end, we incorporated the two sets of errors into TCVdMP_sg2R
backbone, creating mut17 (C401U/G674A/C972U/G2332U) and mutY6 (C521U/Y677N/
U2282G/G2305C), respectively. Both mutants were brought into N.benthamiana leaf cells via
agro-infiltration, and their replication levels assessed with Northern blotting. As shown in Fig
3, Neither of the mutants accumulated TCV RNAs to detectable levels. Therefore, although
mutants with multiple errors could emerge in single cell infections, most of them would have
PLOS PATHOGENS
Discerning the error rate of a (+) RNA virus by interrogating its (-)-strand intermediates
PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011395 August 14, 2023 11 / 17
lost the ability to replicate in single cells, thus likely escaping detection by other error-profiling
techniques. We are currently examining the individual errors making up of these two mutants
to determine whether any of them lowers the RdRp fidelity or permits more replication cycles
per cell. Such follow-up examination is expected to reveal additional insights on the evolution-
ary mechanisms of (+) RNA virus replication.
Conclusions
We report an effort to obtain a more accurate estimation of the error rate of a (+) RNA virus.
Our effort focused exclusively on errors incurred in (-)-strand replication intermediates
Fig 3. Inability of mut17 and mutY6 to replicate in N.benthamiana cells. Northern blotting was carried out using
total RNA samples extracted from N.benthamiana leaves agro-infiltrated with the constructs indicated on the top,
with TCV-specific oligonucleotide probes (sequences available upon request). EB: ethidium bromide-stained gel
showing equal loading.
https://doi.org/10.1371/journal.ppat.1011395.g003
PLOS PATHOGENS
Discerning the error rate of a (+) RNA virus by interrogating its (-)-strand intermediates
PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011395 August 14, 2023 12 / 17
produced in single cells in which replication was launched with transcribable viral cDNA. We
additionally included controls that transcribed only (+) or (-) strands, ensuring exclusive cap-
ture of replication-generated (-) strands, and meaningful estimation of experiment-borne
errors. These efforts allowed us to compute an error rate for TCV RdRp that was no higher
than 1.947 X 10
−4
. Further analyses revealed that the host cell Pol II could have contributed
errors at up to 9.31 X 10
−5
. Factoring potential errors introduced by other experimental steps,
we arrived at a TCV RdRp error rate of 8.47 X 10
−5
s/n/c. Moreover, purposeful production of
long continuous cDNA fragments (2,363 bp) permitted us to map errors to their respective
clones with high confidence, revealing an error distribution pattern consistent with the replica-
tion mode of one cycle per cell. Finally, our new procedure also permitted the capture of lethal
errors that would have missed with some of the earlier procedures. Our findings offer novel
insights on the mechanism of (+) RNA virus replication.
Materials and methods
Constructs
Both TCVdMP_sg2R and RTdMP_sg2R are binary constructs modified from TCV_sg2R and
RT_sg2R [21,37], respectively, by creating a 92-nt deletion (positions 2,425–2,516) within the
p8/p9 coding region. This deletion was previously shown to abolish TCV cell-to-cell move-
ment without affecting the production of sgRNAs [14]. Note that the deletion is outside the
region being subject to RT-PCR and error profiling (see later). The insert of the construct
RTRC consists of the first 2,489 nt of RTdMP_sg2R, in reverse-complemented orientation,
cloned immediately downstream of P35S in pAI101 [22,28].
Agrobacterium infiltration (agro-infiltration)
All DNA constructs destined for testing in N.benthamiana plants were transformed into elec-
trocompetent A. tumefaciens strain C58C1 via electroporation using the AGR setting of a Bio-
Rad Micropulser Electroporator. Briefly, 5 μl of the plasmid DNA was mixed with 40 μl of agro
cells and maintained on ice until electroporation. After electroporation, 900 μl of SOB media
was added and the suspension was incubated at 28˚C for one hour. Selection was carried out
on solid Terrific Broth (TB) media containing rifampicin, gentamycin, and kanamycin. Suc-
cessful introduction of the plasmid was confirmed using colony PCR. A single colony con-
firmed to have the desired plasmid was used to inoculate 3 ml TB liquid media with the same
antibiotics, and incubated overnight in a 28˚C shaker (220 rpm). The culture was diluted 1:100
with fresh TB liquid media and incubated under the same conditions for another night. The
second culture was centrifuged at 4,000 rpm for 20 min, and resuspended in agroinfiltration
buffer (10 mM MgCl2, 10 mM MES, and 100 μM acetosyringone). All suspensions were
diluted to OD600 = 1 and incubated at room temperature for 3 hours. They were then mixed
and introduced into leaves of young N.bethamiana plants via a small wound, using a needle-
less syringe.
Confocal microscopy
Four days after agro-infiltration, leaf discs were collected from the plants. Confocal micros-
copy was performed at the Molecular and Cellular Imaging Center (MCIC), the Ohio Agricul-
tural Research and Development Center, using a Leica DMI6000 laser confocal scanning
microscope. To detect GFP and mCherry fluorescence, sequential excitation at 488 nm and
587 nm was provided by argon and helium-neon 543 lasers, respectively.
PLOS PATHOGENS
Discerning the error rate of a (+) RNA virus by interrogating its (-)-strand intermediates
PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011395 August 14, 2023 13 / 17
RNA extraction and Northern blotting
Total RNA was extracted from agro-infiltrated N.benthamiana leaves at 4 days after agro-infil-
tration using the Direct-zol RNA Miniprep kit (Zymo Research, Irvine, CA). To ensure consis-
tency, six equivalent leaf sections derived from infiltrated leaves of three different plants were
pooled before RNA extraction. The RNA extraction procedure included a DNase treatment
step that removed DNA contamination. The RNA was then quantified with NanoDrop and
subjected to Northern blotting as described [21,22].
Strand-specific reverse transcription-polymerase chain reaction (RT-PCR),
cloning of the PCR products
To generate the (-)-strand-specific cDNA of TCV, we adopted the procedure reported by
Plaskon and colleagues [34]. Specifically, to initiate (-)-strand-specific RT, we used the primer
ssRT-Tg3-TCV25F (5’- TTGTAAAACGACGGCCAGT GAGCT CGCCTAAAATTGCCCTCA-
3’). This primer comprised three sections: a 19-nt non-TCV tail at the 5’ end, derived from
the sequence of pUC19, was followed by a 5-nt linker (GAGCT) in the middle, and an 18-nt 3’
terminus derived from positions 25–42 of TCV (+) strand. The GAGCT linker along with the
C downstream created a SacI site (underlined). The RT was carried out with the RevertAid
Reverse Transcriptase (Thermo Scientific) following the Manufacturer’s instructions. For
PCR, we used the primer ssRT-Tg3 (500 nM), whose sequence was identical to the first 22 nt
of ssRT-Tg3-TCV25F, to pair with a primer mix consisting of ssRT-Tg4-TCV2425R (25 nM)
and ssRT-Tg4 (500 nM). The sequence of ssRT-Tg4-TCV2425R (5’-
CTATGACCATGATTACGCCAAGCTT CCTTTCTTCCGTTTTCCTGT-3’) consisted of a 5’
25-nt tail derived from pUC19, and a 20-nt 3’ portion complementary to positions 2406–2425
of TCV (+) strand; whereas that of ssRT-Tg4 corresponded to the first 22 nt of
ssRT-Tg4-TCV2425R. PCR was carried out with the Phusion High Fidelity Master Mix
(Thermo Scientific), according to Manufacturer’s instructions.
The PCR-amplified 2,450-bp cDNA fragment was gel-purified, and cloned into pUC19
(digested with EcoRI plus HindIII) using the NEBuilder kit (New England Biolabs). The clon-
ing products were then transformed into E. coli. Plasmids isolated from the E. coli colonies
were digested with SacI plus HindIII to verify the size of inserts. Those with inserts of expected
size were subject to Sanger sequencing with two sets of primers. The four primers used for
sequencing earlier batches of plasmids were: TCV-755R, -503F, -1104F, and -1711F. The three
primers used for sequencing the later batches of plasmids were: TCV-946R, -832F, and -1627F.
Sequences of these primers are available upon request.
Acknowledgments
We thank the USDA ARS Maize and Soybean viruses Group for generous equipment sharing.
Members of the Qu lab are greatly appreciated for discussions and technical assistances.
Author Contributions
Conceptualization: Feng Qu.
Data curation: Camila Perdoncini Carvalho, Shuhei Miyashita.
Formal analysis: Camila Perdoncini Carvalho, Shuhei Miyashita, Feng Qu.
Funding acquisition: Feng Qu.
Investigation: Camila Perdoncini Carvalho, Junping Han.
PLOS PATHOGENS
Discerning the error rate of a (+) RNA virus by interrogating its (-)-strand intermediates
PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011395 August 14, 2023 14 / 17
Methodology: Camila Perdoncini Carvalho, Junping Han, Khwannarin Khemsom, Ruifan
Ren, Shuhei Miyashita.
Project administration: Junping Han.
Resources: Luis Eduardo Aranha Camargo.
Software: Shuhei Miyashita.
Supervision: Feng Qu.
Validation: Camila Perdoncini Carvalho.
Writing – original draft: Feng Qu.
Writing – review & editing: Feng Qu.
References
1. Duffy S. Why are RNA virus mutation rates so damn high? PLoS Biol. 2018; 16: e3000003–e3000003.
https://doi.org/10.1371/journal.pbio.3000003 PMID: 30102691
2. Peck KM, Lauring AS. Complexities of Viral Mutation Rates. J Virol. 2018; 92: e01031–17. https://doi.
org/10.1128/JVI.01031-17 PMID: 29720522
3. Domingo E, Garcı
´a-Crespo C, Lobo-Vega R, Perales C. Mutation Rates, Mutation Frequencies, and
Proofreading-Repair Activities in RNA Virus Genetics. Viruses. 2021; 13: 1882. https://doi.org/10.3390/
v13091882 PMID: 34578463
4. Elena SF, Sanjua
´n R. Adaptive value of high mutation rates of RNA viruses: separating causes from
consequences. J Virol. 2005; 79: 11555–11558. https://doi.org/10.1128/JVI.79.18.11555-11558.2005
PMID: 16140732
5. Malpica JM, Fraile A, Moreno I, Obies CI, Drake JW, Garcı
´a-Arenal F. The Rate and Character of Spon-
taneous Mutation in an RNA Virus. Genetics. 2002; 162: 1505. https://doi.org/10.1093/genetics/162.4.
1505 PMID: 12524327
6. Sanjua
´n R, Agudelo-Romero P, Elena SF. Upper-limit mutation rate estimation for a plant RNA virus.
Biol Lett. 2009; 5: 394–396. https://doi.org/10.1098/rsbl.2008.0762 PMID: 19324646
7. Tromas N, Elena SF. The rate and spectrum of spontaneous mutations in a plant RNA virus. Genetics.
2010/05/03 ed. 2010; 185: 983–989. https://doi.org/10.1534/genetics.110.115915 PMID: 20439778
8. Lafforgue G, Martı
´nez F, Sardanye
´s J, de la Iglesia F, Niu Q-W, Lin S-S, et al. Tempo and Mode of
Plant RNA Virus Escape from RNA Interference-Mediated Resistance. J Virol. 2011; 85: 9686–9695.
https://doi.org/10.1128/JVI.05326-11 PMID: 21775453
9. Acevedo A, Brodsky L, Andino R. Mutational and fitness landscapes of an RNA virus revealed through
population sequencing. Nature. 2014; 505: 686–690. https://doi.org/10.1038/nature12861 PMID:
24284629
10. Geller R, Estada U
´, Peris JB, Andreu I, Bou J-V, Garijo R, et al. Highly heterogeneous mutation rates in
the hepatitis C virus genome. Nat Microbiol. 2016; 1: 16045. https://doi.org/10.1038/nmicrobiol.2016.45
PMID: 27572964
11. de la Iglesia F, Martı´nez F, Hillung J, Cuevas JM, Gerrish PJ, Daròs J-A, et al. Luria-Delbru¨ck Estima-
tion of Turnip Mosaic Virus Mutation Rate In Vivo. J Virol. 2012; 86: 3386–3388. https://doi.org/10.1128/
JVI.06909-11 PMID: 22238294
12. Pauly MD, Procario MC, Lauring AS. A novel twelve class fluctuation test reveals higher than expected
mutation rates for influenza A viruses. eLife. 2017; 6: e26437. https://doi.org/10.7554/eLife.26437
PMID: 28598328
13. Chao L, Rang CU, Wong LE. Distribution of Spontaneous Mutants and Inferences about the Replication
Mode of the RNA Bacteriophage 6. J VIROL. 2002; 76: 3276–3281.
14. Li W, Qu F, Morris TJ. Cell-to-Cell Movement of Turnip Crinkle Virus Is Controlled by Two Small Open
Reading Frames That Functionin trans. Virology. 1998; 244: 405–416. https://doi.org/10.1006/viro.
1998.9125 PMID: 9601509
15. Lucas WJ. Plant viral movement proteins: Agents for cell-to-cell trafficking of viral genomes. Virol 50th
Anniv Issue. 2006; 344: 169–184. https://doi.org/10.1016/j.virol.2005.09.026 PMID: 16364748
PLOS PATHOGENS
Discerning the error rate of a (+) RNA virus by interrogating its (-)-strand intermediates
PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011395 August 14, 2023 15 / 17
16. Qu F, Ren T, Morris TJ. The Coat Protein of Turnip Crinkle Virus Suppresses Posttranscriptional Gene
Silencing at an Early Initiation Step. J Virol. 2003; 77: 511–522. https://doi.org/10.1128/jvi.77.1.511-
522.2003 PMID: 12477856
17. Cao M, Ye X, Willie K, Lin J, Zhang X, Redinbaugh MG, et al. The Capsid Protein of Turnip Crinkle Virus
Overcomes Two Separate Defense Barriers To Facilitate Systemic Movement of the Virus in Arabidop-
sis. J Virol. 2010; 84: 7793–7802. https://doi.org/10.1128/JVI.02643-09 PMID: 20504923
18. Qu F, Ye X, Morris TJ. Arabidopsis DRB4, AGO1, AGO7, and RDR6 participate in a DCL4-initiated anti-
viral RNA silencing pathway negatively regulated by DCL1. Proc Natl Acad Sci. 2008; 105: 14732–
14737. https://doi.org/10.1073/pnas.0805760105 PMID: 18799732
19. Sanjua
´n R, Domingo-Calap P. Mechanisms of viral mutation. Cell Mol Life Sci. 2016; 73: 4433–4448.
https://doi.org/10.1007/s00018-016-2299-6 PMID: 27392606
20. Lin J, Guo J, Finer J, Dorrance AE, Redinbaugh MG, Qu F. The Bean Pod Mottle Virus RNA2-Encoded
58-Kilodalton Protein P58 Is Required in cis for RNA2 Accumulation. J Virol. 2014; 88: 3213–3222.
https://doi.org/10.1128/JVI.03301-13 PMID: 24390330
21. Zhang S, Sun R, Perdoncini Carvalho C, Han J, Zheng L, Qu F. Replication-Dependent Biogenesis of
Turnip Crinkle Virus Long Noncoding RNAs. Simon AE, editor. J Virol. 2021; 95: e00169–21. https://doi.
org/10.1128/JVI.00169-21 PMID: 34160262
22. Sun R, Zhang S, Zheng L, Qu F. Translation-Independent Roles of RNA Secondary Structures within
the Replication Protein Coding Region of Turnip Crinkle Virus. Viruses. 2020; 12: 350. https://doi.org/
10.3390/v12030350 PMID: 32235750
23. Gout J-F, Li W, Fritsch C, Li A, Haroon S, Singh L, et al. The landscape of transcription errors in eukary-
otic cells. Sci Adv. 2017; 3: e1701484. https://doi.org/10.1126/sciadv.1701484 PMID: 29062891
24. Gout J-F, Thomas WK, Smith Z, Okamoto K, Lynch M. Large-scale detection of in vivo transcription
errors. Proc Natl Acad Sci. 2013; 110: 18584–18589. https://doi.org/10.1073/pnas.1309843110 PMID:
24167253
25. Qu F, Morris TJ. Encapsidation of turnip crinkle virus is defined by a specific packaging signal and RNA
size. J Virol. 1997; 71: 1428. https://doi.org/10.1128/JVI.71.2.1428-1435.1997 PMID: 8995668
26. Qu F, Morris TJ. Efficient Infection of Nicotiana benthamiana by Tomato bushy stunt virus Is Facilitated
by the Coat Protein and Maintained by p19 Through Suppression of Gene Silencing. Mol Plant-Microbe
Interactions. 2002; 15: 193–202. https://doi.org/10.1094/MPMI.2002.15.3.193 PMID: 11952121
27. Zhang X-F, Sun R, Guo Q, Zhang S, Meulia T, Halfmann R, et al. A self-perpetuating repressive state of
a viral replication protein blocks superinfection by the same virus. PLOS Pathog. 2017; 13: e1006253.
https://doi.org/10.1371/journal.ppat.1006253 PMID: 28267773
28. Guo Q, Zhang S, Sun R, Yao X, Zhang X-F, Tatineni S, et al. Superinfection Exclusion by p28 of Turnip
Crinkle Virus Is Separable from Its Replication Function. Mol Plant Microbe Interact. 2020; 33: 364–
375. https://doi.org/10.1094/MPMI-09-19-0258-R PMID: 31880982
29. Qu F, Zheng L, Zhang S, Sun R, Slot J, Miyashita S. Bottleneck, Isolate, Amplify, Select (BIAS) as a
mechanistic framework for intracellular population dynamics of positive-sense RNA viruses. Virus Evol.
2020; 6. https://doi.org/10.1093/ve/veaa086 PMID: 33343926
30. Perdoncini Carvalho C, Ren R, Han J, Qu F. Natural Selection, Intracellular Bottlenecks of Virus Popu-
lations, and Viral Superinfection Exclusion. Annu Rev Virol. 2022; 9: 4.1–4.17. https://doi.org/10.1146/
annurev-virology-100520-114758 PMID: 35567296
31. Qu F, Ye X, Hou G, Sato S, Clemente TE, Morris TJ. RDR6 Has a Broad-Spectrum but Temperature-
Dependent Antiviral Defense Role in Nicotiana benthamiana. J Virol. 2005; 79: 15209–15217. https://
doi.org/10.1128/JVI.79.24.15209-15217.2005 PMID: 16306592
32. Garcia-Ruiz H, Takeda A, Chapman EJ, Sullivan CM, Fahlgren N, Brempelis KJ, et al. Arabidopsis
RNA-Dependent RNA Polymerases and Dicer-Like Proteins in Antiviral Defense and Small Interfering
RNA Biogenesis during Turnip Mosaic Virus Infection. Plant Cell. 2010; 22: 481–496. https://doi.org/10.
1105/tpc.109.073056 PMID: 20190077
33. Wang X-B, Wu Q, Ito T, Cillo F, Li W-X, Chen X, et al. RNAi-mediated viral immunity requires amplifica-
tion of virus-derived siRNAs in Arabidopsis thaliana. Proc Natl Acad Sci. 2010; 107: 484–489. https://
doi.org/10.1073/pnas.0904086107 PMID: 19966292
34. Plaskon NE, Adelman ZN, Myles KM. Accurate Strand-Specific Quantification of Viral RNA. PLOS
ONE. 2009; 4: e7468. https://doi.org/10.1371/journal.pone.0007468 PMID: 19847293
35. Martinez F, Sardanyes J, Elena SF, Daros J-A. Dynamics of a Plant RNA Virus Intracellular Accumula-
tion: Stamping Machine vs. Geometric Replication. Genetics. 2011; 188: 637–646. https://doi.org/10.
1534/genetics.111.129114 PMID: 21515574
PLOS PATHOGENS
Discerning the error rate of a (+) RNA virus by interrogating its (-)-strand intermediates
PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011395 August 14, 2023 16 / 17
36. Schulte MB, Draghi JA, Plotkin JB, Andino R. Experimentally guided models reveal replication princi-
ples that shape the mutation distribution of RNA viruses. Elife. 2015; 4: e03753. https://doi.org/10.7554/
eLife.03753 PMID: 25635405
37. Zhang S, Sun R, Guo Q, Zhang X-F, Qu F. Repression of turnip crinkle virus replication by its replication
protein p88. Virology. 2019; 526: 165–172. https://doi.org/10.1016/j.virol.2018.10.024 PMID: 30391806
PLOS PATHOGENS
Discerning the error rate of a (+) RNA virus by interrogating its (-)-strand intermediates
PLOS Pathogens | https://doi.org/10.1371/journal.ppat.1011395 August 14, 2023 17 / 17
Available via license: CC BY 4.0
Content may be subject to copyright.
