Available via license: CC BY 4.0
Content may be subject to copyright.
1
ISOLATION OF POTENTIAL PROBIONTS FROM BRACKISHWATER ENRICHED WITH HIGH LEVELS OF CARBON
SOURCE
Christopher Marlowe A. Caipang1,5*, Kathleen Mae P. Trebol2, Indra Suharman3, Rolando V. Pakingking Jr.4, Joel E. Deocampo Jr.5
Address(es):
1 Division of Biological Sciences, College of Arts and Sciences, University of the Philippines Visayas, Miag-ao 5023, Iloilo, Philippines.
2 Marmi Agricultural Corporation, Silay City, Negros Occidental, Philippines.
3 Department of Aquaculture, Faculty of Fisheries and Marine Sciences, Universitas Riau, Pekanbaru-Riau, Indonesia.
4 Aquaculture Department, Southeast Asian Fisheries Development Center (SEAFDEC/AQD), Tigbauan, Iloilo 5021, Philippines.
5 Department of Biology, College of Liberal Arts, Sciences, and Education, University of San Agustin, Iloilo City 5000, Philippines.
*Corresponding author: cmacaipang@gmail.com
ABSTRACT
Keywords: aquaculture, biofloc, disease control, organic matter, shrimp
INTRODUCTION
Biofloc technology (BFT) is a cutting-edge technology anchored on zero water
exchange and recycling of wastes generated within a cultured system. BFT is a
promising technology for ensuring the sustainability of marine shrimp aquaculture
in shrimp culture (Krummenauer et al., 2011; Ferreira et al., 2015). The bacterial
community that maintains stable levels of nutrients in the water is crucial to BFT-
based shrimp aquaculture systems (Wasielesky et al., 2006). This bacterial
community associated with bioflocs in the culture system can inhibit the growth
and proliferation of pathogens through competitive exclusion (Crab et al., 2010),
as well as supplement the nutrition of the cultured stock (McIntosh et al., 2000).
However, this microbial community may also harbor pathogenic and opportunistic
bacteria that are harmful to farm animals (Schulze et al., 2006).
Vibrios stand out among the opportunistic bacteria in the marine environment
(Song & Lee, 1983). Vibrio harveyi and V. parahaemolyticus are members of the
Vibrionaceae family, which is linked to a number of bacterial diseases in
crustaceans, including luminous vibriosis, early mortality syndrome (EMS), and
acute hepatopancreatopancreatic necrosis syndrome (AHPNS) (Leaño & Mohan,
2012). Vibrios are opportunistic bacteria that influence the growth and survival of
farmed shrimp at various life stages (Costa et al., 2008). Consequently, the threat
posed by Vibrios during shrimp culture is evident. It is essential to manipulate the
rearing water to promote the dominance of beneficial bacteria, which in turn
reduces the population of these opportunistic bacterial pathogens that threaten the
growth and health of cultured shrimp.
Though recently used in aquaculture, most of the probiotics that fish and shrimp
farmers utilize are of terrestrial origins (Lazado & Caipang, 2014). There are
differences in the environment of the shrimp and the source of the probionts; thus,
the beneficial effects of terrestrial probiotics may be affected when applied during
the culture of shrimp. In view of these limitations, there is a need to explore the
possibility of identifying and characterizing host-derived probionts or from the
environment of the cultured organism to ensure higher efficiency of the probionts
(Lazado & Caipang, 2014; Zorriehzahra et al., 2016). Hence, this study aimed
to isolate and characterize potential probionts from brackishwater that is used in
shrimp culture by enriching the water with organic sources with high carbon to
nitrogen (C:N) ratio. These organic carbon sources include the use of brown sugar
and molasses in stimulating biofloc production in brackishwater for the isolation
of bacterial isolates that can be further developed as probiotics in shrimp
aquaculture.
MATERIAL AND METHODS
Collection of water samples and screening of bacterial isolates
This research was conducted in the Biology laboratory of the University of San
Agustin College of Liberal Arts, Sciences, and Education in
Iloilo City, Philippines. Brackishwater samples from Iloilo River were transported
to the laboratory and poured in six 10-li plastic containers with a capacity of 80%.
At the time of sampling, the salinity was 28 ppt and the pH of the water was 7.8.
The production of biofloc was accomplished by adding either brown sugar or
molasses in triplicate containers at a carbon-to-nitrogen (C: N) ratio of 15 in
accordance with the procedures of Caipang et al. (2022), with minor modifications
for small tank systems. Biofloc was maintained in all containers for a duration of
25 days with minimal water exchange.
The biofloc culture water from treatments containing either brown sugar or
molasses was serially diluted and plated onto nutrient agar (NA) containing 1%
sodium chloride (NaCl). The agar plates were incubated between 27 and 30 degrees
Celsius for twenty-four hours. Individual bacterial colonies with diverse
morphological characteristics were restreaked onto fresh NA-1% NaCl plates,
incubated at 27-30oC for 24 hours, and stored at 8oC until further characterization.
Vibrio harveyi, a known crustacean pathogen, was isolated in a previous study
(Pakingking et al., 2018). A single colony of this bacterium was inoculated into
10 ml of nutrient broth (NB) supplemented with 1% NaCl and cultivated overnight
at 27-30 degrees Celsius with gentle shaking. The overnight culture of the
bacterium was diluted with normal saline solution (NSS) to a concentration of 103
colony forming units (CFU) ml -1, and 100 µl of the bacterial suspension was plated
onto a NA-1% NaCl plate and allowed to adhere for 1 hour. Following this was the
spot on-lawn assay (Pilet et al., 1995) with individual bacterial colonies obtained
from the biofloc water. The agar plates were incubated at 27-30 o C for 24 hours
and then the zones of inhibition were observed.
The majority of shrimp producers utilize probiotics derived from terrestrial sources as part of their aquaculture management. The beneficial
effects of terrestrial probiotics on shrimp may be affected due to environmental differences between the cultivated species and the source
of the probiotics. To ensure maximum effects on the host, it is essential to use probionts derived from the host or the environment of the
cultured organism. Consequently, the objective of this study was to isolate and characterize potential probionts from brackishwater by
enriching the water with organic sources containing a high ratio of carbon to nitrogen (C:N). Six 10-li containers were filled with
brackishwater from an estuary for a mesocosm experiment. To stimulate bacterial growth, water was enriched with either molasses or
brown sugar at a C:N ratio of 15. After twenty days, all heterotrophic bacteria in the enriched water were enumerated. The in vitro
antagonistic activities of distinct bacterial colonies against Vibrio harveyi, a crustacean pathogen, were evaluated on fresh Nutrient Agar
plates containing 1% sodium chloride. There were 10 bacterial isolates with in vitro antibacterial activity. These bacterial isolates are
categorized as belonging to the putative genera Acinetobacter, Pseudomonas, Sphingobium, and Rheinheimera. The implications of this
study suggest that enriching brackishwater with organic carbon sources at high C:N ratios may increase the likelihood of isolating and
developing potential probionts for shrimp aquaculture.
ARTICLE INFO
Received 18. 1. 2023
Revised 8. 7. 2023
Accepted 1. 8. 2023
Published xx.xx.201x
Regular article
https://doi.org/10.55251/jmbfs.9819
J Microbiol Biotech Food Sci / Caipang et al. 20xx : x (x) e9819
2
Characterization of bacterial isolates
The bacterial isolates that exhibited inhibition zones on NA plates seeded with V.
harveyi were subjected to standard morphological, physiological, and biochemical
assays. The phenotypic characters and biochemical properties of the different
bacterial isolates were determined based on the descriptions provided in the
Bergey’s Manual of Systematic Bacteriology (Holt et al., 2000).
Molecular identification of the isolates was accomplished by extracting bacterial
genomic DNA from an overnight culture of the isolates in 5 ml Trypticase Soy
Broth (TSB) using a commercial kit (Purelink Genomic DNA Mini, Thermo Fisher
Scientific, California, USA) according to the manufacturer's instructions.
Polymerase chain reaction (PCR) amplification of the 16S rRNA was done using
the eubacterial universal primers (Forward: GAGAGTTTGATCCTGGCTCAG;
Reverse: CTACGGCTACCTTGTTACGA) of Bianciotto et al. (2003) in a 25 µL
PCR reaction. This consisted of: 2 µL (10-15 ng) of DNA as the template, 2 µL of
each primer (5 pmol), 2.5 µL of 10 PCR buffer, 1.5 µL of 2 mM dNTP, 1µL of 50
mM MgCl2 and scaled up to the desired volume using distilled water. The PCR
conditions described by Caipang et al. (2010) were utilized for the amplification.
The PCR products were cleaned and sent for sequencing (Macrogen, Korea). Using
publicly available data from NCBI GenBank (blast.ncbi.nlm.nih.gov), sequenced
data were aligned and analyzed to determine the closest homolog of bacterial
isolates.
Co-incubation assay
The anti-Vibrio harveyi activity of the bacterial isolates was determined utilizing a
modified co-incubation assay (Caipang et al., 2008). Using normal saline solution
(NSS) as a diluent, an overnight culture of V. harveyi and the putative probiotics
were diluted to a concentration of 103 CFU ml-1. In a 1.5 ml microfuge tube, 100
µl of each probiotic isolate and V. harveyi were transferred and thoroughly mixed.
The control consisted of V. harveyi added to an equal volume of nutrient broth
containing 1% NaCl. All mixtures were placed on a rotary agitator and incubated
between 27 and 30 degrees Celsius for 24 hours.
Following a 24-hour incubation, a 10-fold serial dilution of each mixture was
prepared, and 100 µl aliquots of each dilution were plated onto Thiosulfate–citrate–
bile salts–sucrose (TCBS) agar plates for the counting of V. harveyi. The probiotic
candidates did not grow on TCBS plates, as determined by a preliminary assay;
therefore, only V. harveyi grew on TCBS plates. The agar plates were placed in an
incubator at 27 to 30 degrees Celsius for 24 hours. Colonies of bacteria were
enumerated, and the results were expressed as log10 CFU ml-1. Following the
procedures outlined by Caipang et al. (2008), the reduction in V. harveyi counts
in the co-incubation groups was expressed as a percentage reduction relative to the
V. harveyi count in the control group. Each experiment was performed three times.
Bactericidal activity was defined as a decrease in bacterial counts of at least 1.5
log10 units.
Data analyses
Co-incubated samples and the control were compared using one-way ANOVA
(Systat version 8; Systat Software Inc., San Francisco, CA, U.S.A.). Bacterial
counts were expressed as log10 CFU ml-1. If the differences were significant, the
Tukey test was further used for the analysis. All statistical calculations were
performed at a significance level of 0.05.
RESULTS AND DISCUSSION
Bacterial isolates from bracksihwater enriched with high carbon source
A total of 200 bacterial isolates were obtained from brackishwater with biofloc
using either molasses or brown sugar as sources of carbon. From these isolates,
there were 10 bacterial strains that possessed in vitro antagonistic activity against
V. harveyi as shown by the zones of inhibition on the NA plates. Molecular
identification showed that five isolates, namely, Acinetobacter (2 isolates),
Rheinheimera, and Pseudomonas (2 isolates) were obtained from biofloc water
with molasses as carbon source, while Sphingobium, Pseudomonas and three
isolates of Acinetobacter were identified from biofloc water with brown sugar as
carbon source (Table 1).
Bioflocs are composed of flocculated organic matter colonized by heterotrophic
bacteria, filamentous cyanobacteria, dinoflagellates, ciliates, flagellates and
rotifers (Ballester et al., 2007; Avnimelech, 2009). This diverse microbial
community includes pathogenic and opportunistic bacteria, as well as neutral and
beneficial bacteria (Schulze et al., 2006; Ferreira et al., 2015). A previous study
by Anand et al. (2014) used wheat flour as carbon source in the production of
biofloc at a C:N ratio of 10:1. Their results showed that microbial succession in
the shrimp ponds occurred and the main microorganisms were Vibrio,
Lactobacillus, Bacillus and some fungal species. This indicates that dominant
bacterial isolates can be identified in biofloc water during enrichment with carbon
sources at higher C:N ratio.
Table 1 Bacterial isolates obtained from biofloc water enriched with either
molasses or brown sugar as carbon source
Isolate Number
Source
Closest match
SB-C1-2021
Biofloc with molasses
Acinetobacter indicus
SB-C2-2021
Biofloc with molasses
Acinetobacter indicus
SB-C3-2021
Biofloc with molasses
Rheinheimera sp.
SB-C4-2021
Biofloc with molasses
Pseudomonas aeruginosa
SB-C5-2021
Biofloc with molasses
Pseudomonas
plecoglossicida
SB-C6-2021
Biofloc with brown
sugar
Sphingobium sp.
SB-C7-2021
Biofloc with brown
sugar
Acinetobacter sp.
SB-C8-2021
Biofloc with brown
sugar
Pseudomonas stutzeri
SB-C9-2021
Biofloc with brown
sugar
Acinetobacter sp.
SB-C10-2021
Biofloc with brown
sugar
Acinetobacter sp.
Table 2 Morphological characteristics of the bacterial isolates obtained from biofloc water enriched with either molasses or brown sugar as carbon source
Characteristics
Isolate Number
1
2
3
4
5
6
7
8
9
10
Gram stain
Cell Shape1/
Colony description
1. Margin
Entire (smooth)
Undulate (wavy)
2. Colour
Orange
Opaque or white
Milky (yellowish)
3. Elevation
Flat
Convex
4. Texture
Slimy,Moist
Matte
Mucoid
5. Shape
Round
Punctiform
6. Motility
7. Endospore
8. Acid fast
-
CB
+
+
+
+
+
-
-
-
-
CB
+
+
+
+
+
-
-
-
-
CB
+
+
+
+
+
-
-
-
-
B
+
+
+
+
+
+
-
-
-
B
+
+
+
+
+
+
-
-
-
CB
+
+
+
+
+
-
-
-
-
CB
+
+
+
+
+
-
-
-
-
B
+
+
+
+
+
+
-
-
-
CB
+
+
+
+
+
-
-
-
-
CB
+
+
+
+
+
-
-
-
Legend: 1/CB- coccobacillus; B – bacillus
J Microbiol Biotech Food Sci / Caipang et al. 20xx : x (x) e9819
3
Characterization of bacterial isolates
All of the identified bacterial isolates were either rod-shaped or coccobacilli and
Gram-negative (Table 2). The biochemical characterization of these isolates
revealed that they contained catalase (Table 3). In addition, all isolates, with the
exception of isolates 9 and 10 (Acinetobacter), can ferment carbohydrates. The
addition of higher quantities of carbon sources to the rearing water could be
responsible for the isolation of sugar-fermenting bacteria, as these bacteria
catabolize the complex carbon molecules present in the water as their population
increases. Acetoin was only found in isolates 9 and 10. Bacillus species, lactic acid-
producing bacteria, and members of the Enterobacteriaceae family are well-known
acetoin-producing microorganisms (Xiao & Lu, 2014). Bacillus is the most well-
known acetoin producer among these families due to its high production efficiency
and safety. Isolates 9 and 10 are putative Acinetobacter in this study. Though this
bacterial group is not known for its ability to produce acetoin, Lee et al. (2009)
isolated Acinetobacter capable of acetoin production from tobacco plant roots
during the screening of antiviral substances that possessed inhibitory effects
against Tobacco mosaic virus (TMV).
Table 3 Biochemical characteristics of the bacterial isolates obtained from biofloc
water enriched with either molasses or brown sugar as carbon source
Biochemical
Characteristics
Isolate Number
1
2
3
4
5
6
7
8
9
10
β-galactosidase
+
+
+
Arginine
dihydrolase
+
Citrate utilization
+
+
+
Detection of
acetoin
+
+
Gelatinase
+
+
+
Fermentation of
glucose
+
+
+
+
Fermentation of
melibiose
+
+
+
Fermentation of
arabinose
+
+
+
+
+
+
Oxidase
+
+
+
Catalase
+
+
+
+
+
+
+
+
+
+
Reduction of Vibrio harveyi in a co-incubation assay
Table 4 shows the counts of V. harveyi on NA plates when co-incubated with
various bacterial isolates. Using a co-incubation assay, all 10 isolates significantly
reduced the population of V. harveyi in vitro. Except for isolates 8 and 10, co-
incubation with the bacterial isolates resulted in at least a 1.5 log10 reduction of V.
harveyi. Similarly, the population of V. harveyi was reduced by 17.7% to 23.9%
relative to the control in the co-incubation assay. With the exception of isolates 8,
9, and 10, all other isolates reduced V. harveyi by more than 20%.
Sphingobium is a recently described genus (Takeuchi et al., 2001) that is thought
to be a component of the crustacean intestinal microbiota (Hu et al., 2019). This
bacterium has been previously isolated from both untreated and treated water
(Sheu et al., 2013; Corre et al., 2019) as well as the gut of Pacific white shrimp
fed a yeast cell wall-based feed additive (Servin Arce et al., 2021). This group of
bacteria can degrade polycyclic aromatic hydrocarbons; therefore, it is utilized in
soil bioremediation (Chen et al., 2016). It was also isolated from an aquaponics
system and linked to antibiotic resistance in an aquaculture facility (Colombo et
al., 2016). In contrast, Brisou & Prévot (1954) were the first to describe
Acinetobacter, a genus of non-motile, aerobic, Gram-negative bacteria. Some
species of Acinetobacter, specifically A. baumannii, are regarded as human and
marine pathogens (Bergogne-Berezin & Towner, 1996; Xia et al., 2008). Recent
studies, however, have shown its denitrifying activity in the elimination of nitrite
in wastewaters (Cao et al., 2012) and its probiotic activities for juvenile catfish by
enhancing lysozyme and respiratory activities (Bunnoy et al., 2019). While the
present investigation demonstrated in vitro anti-V. harveyi activity of
Acinetobacter sp., Verschuere et al. (2000) recommend evaluating this bacterial
isolate for pathogenicity if it is to be used as probiotics in shrimp aquaculture in
the future.
The presence of Pseudomonas, Acinetobacter, Sphingobium, and Rheinheimera in
brackishwater that had been supplemented with high carbon sources may indicate
the significance of these substances in promoting the growth and dominance of
beneficial bacterial species that possess anti-V. harveyi activities. Particularly,
Pseudomonas and Acinetobacter were isolated from brackish water enriched with
brown sugar and molasses. These bacterial isolates are capable of producing
substances with antagonistic activity against V. harveyi, or they can directly
compete with the bacterial pathogen via mechanisms such as competition,
exclusion, and displacement (Lazado et al., 2011; El-Saadony et al., 2020). Since
the bacterial pathogen and probiotic candidates were introduced at comparable
concentrations at the same time, the reduction in V. harveyi counts is likely due to
competition, according to Lazado et al. (2011). However, a previous study in fish
demonstrated that displacement is also one of the mechanisms that inhibited the
proliferation of bacterial pathogens in the gut (Lazado et al., 2011). Future
research will investigate what specific mechanism is responsible for inhibiting
shrimp bacterial pathogens in water.
Table 4 Vibrio harveyi counts* and their reductiona, expressed as Mean + SD, during a co-incubation assay with the different bacterial isolates
Isolate
1
2
3
4
5
6
7
8
9
10
Control
Vibrio
harveyi
counts
(Log10
CFU/ml)
6.26 + 0.05
6.23 + 0.21
6.24 + 0.06
6.30 + 0.02
6.37 + 0.32
6.46 + 0.41
6.43 + 0.31
6.74 + 0.23
6.63 + 0.25
6.71 + 0.02
8.19 + 0.31
Reduction in
V. harveyi
counts (%)
relative to
Control
23.6 + 0.05
23.9 + 0.21
23.8 + 0.06
23.1 + 0.02
22.2 + 0.32
21.2 + 0.41
21.5 + 0.31
17.7 + 0.23
19.0 + 0.25
18.1 + 0.02
Legend: *Co-incubation of the bacterial isolates with V. harveyi (pathogen) had significantly lower counts of the pathogen than the control at p < 0.05. N=3.
aReduction of V. harveyi co-incubated with the different bacterial isolates was computed relative to the population of V. harveyi grown in Nutrient Broth supplemented
with 1% NaCl.
CONCLUSION
In conclusion, the addition of high carbon sources to brackish water facilitated the
isolation of bacterial isolates with potential probiotic applications in shrimp
aquaculture. The isolation of Acinetobacter and Pseudomonas from
brackishwaters enriched with brown sugar and molasses suggests that these
bacteria could be the dominant isolates in a biofloc system. The ability of the
various bacterial isolates to inhibit in vitro the proliferation of V. harveyi, a known
crustacean bacterial pathogen, demonstrates their probiotic potential. If these
isolates are to be used as probionts in shrimp culture, it is necessary to conduct
additional research into their probiotic mechanisms.
Acknowledgments: This work was supported by the research project, “Biofloc-
based Nursery Tank Production of Shrimp for Quality and Sustainable Supply of
Aquaculture Products in the New Normal” funded by the Department of Science
and Technology (DOST) through the Science for Change Program (S4CP) –
Collaborative Research and Development to Leverage Philippine Economy
(CRADLE) and monitored by DOST – Philippine Council for Agriculture, Aquatic
and Natural Resources Research and Development (PCAARRD) with Project
Number 8444 awarded to CMA Caipang. The authors of this paper also appreciate
the support provided by their respective institutions; namely, the University of the
Philippines Visayas, Marmi Agricultural Corporation, SEAFDEC Aquaculture
Department, Universitas Riau and the University of San Agustin during the
preparation of the manuscript.
Data Availability: The data used to support the findings of this study are available
from the corresponding author upon request.
Conflict of Interest: No conflict of interest declared.
REFERENCES
Anand, P. S., Kohli, M. P. S., Kumar, S., Sundaray, J. K., Roy, S. D.,
Venkateshwarlu, G., Sinha, A., & Pailan, G. H. (2014). Effect of dietary
supplementation of biofloc on growth performance and digestive enzyme activities
in Penaeus monodon. Aquaculture, 418, 108-115.
https://doi.org/10.1016/j.aquaculture.2013.09.051
Avnimelech, Y. (2009). Biofloc Technology-a Practical Guide Book. The World.
Aquaculture Society, Baton Rouge.
J Microbiol Biotech Food Sci / Caipang et al. 20xx : x (x) e9819
4
Ballester, E. L. C., Wasielesky, W., Cavalli, R. O., & Abreu, P. C. (2007). Nursery
of the pink shrimp Farfantepenaeus paulensis in cages with artificial substrates:
biofilm composition and shrimp performance. Aquaculture, 265, 355–362.
https://doi.org/10.1016/j.aquaculture.2007.04.003
Bergogne-Berezin, E., & Towner, K. J. (1996). Acinetobacter spp. as nosocomial
pathogens: microbiological, clinical and epidemiological features. Clinical
Microbiology Reviews , 9, 148-165
Brisou, J., & Prévot, A. R. (1954). Études de systématique bactérienne. X. Révision
des espèces reunites dans le denre Achromobacter. Annales de l’Institut Pasteur
(Paris), 86, 722-728.
Bunnoy, A., Na-Nakorn, U., Kayansamruaj, P., & Srisapoome, P. (2019).
Acinetobacter Strain KUO11TH, a unique organism related to Acinetobacter pittii
and isolated from the skin mucus of healthy bighead catfish and its efficacy against
several fish pathogens.. Microorganisms, 7 (11), 549.
https://doi.org/10.3390/microorganisms7110549
Caipang, C. M. A., Brinchmann, M. F., & Kiron, V. (2010). Antagonistic activity
of bacterial isolates from intestinal microbiota of Atlantic cod, Gadus morhua, and
an investigation of their immunomodulatory capabilities. Aquaculture Research,
41, 249-256. https://doi.org/10.1111/j.1365-2109.2009.02327.x
Caipang, C. M. A., Hynes, N., Brinchmann, M. F., Korsnes, K., & Kiron, V.
(2008). Antimicrobial activity in serum of Atlantic cod Gadus morhua L.:
comparison between cultured and wild fish. Journal of Fish Biology, 73, 115-122.
https://doi.org/10.1111/j.1095-8649.2008.01914.x
Caipang, C.M., Trebol, K.M.P., Abeto, M.J.S., Coloso, R.M., Pakingking, R.,
Calpe, A.T. & Deocampo Jr, J.E. (2022). An innovative biofloc technology for the
nursery production of Pacific whiteleg shrimp, Penaeus vannamei in tanks.
International Journal of Biosciences, 21(4), 71-79. DOI:
http://dx.doi.org/10.12692/ijb/21.4.71-79
Cao, H., Wang, H., He, S., Ou, R., Hou, S., & Yang, X. (2012). Isolation and
characterization of a denitrifying Acinetobacter baumannii H1 using NO2--N as
nitrogen source from shrimp farming ponds. African Journal of Microbiology
Research, 6, 2258-2264.
Chen, C., Lei, W., Lu, M., Zhang, J., Zhang, Z., Luo, C, Chen, Y., Hong, Q., &
Shen, Z. (2016). Characterization of Cu (II) and Cd (II) resistance mechanisms in
Sphingobium sp. PHE-SPH and Ochrobactrum sp. PHE-OCH and their potential
application in the bioremediation of heavy metal-phenanthrene co-contaminated
sites. Environmental Science and Pollution Research, 23, 6861-6872.
https://doi.org/10.1007/s11356-015-5926-0
Colombo, S., Arioli, S., Guglielmetti, S., Lunelli, F., & Mora, D. (2016). Virome-
associated antibiotic-resistance genes in an experimental aquaculture facility.
FEMS Microbiology Ecology, 92, fiw003. https://doi.org/10.1093/femsec/fiw003
Corre, M. H., Delafont, V., Legrand, A., Berjeaud, J. M., & Verdon, J. (2019).
Exploiting richness of environmental waterborne bacterial species to find natural
Legionella pneumophila competitors. Frontiers in Microbiology, 9, 3360.
https://doi.org/10.3389/fmicb.2018.03360
Costa, R. A., Vieira, G. H. F., Silva, G. C., Peixoto, J. R. O, Silva dos Fernandes
Vieira, R. H., & Saker-Sampaio, S. (2008). Vibrio microfauna associated with
different development stages of the marine shrimp Litopenaeus vannamei. Indian
Journal of Comparative Microbiology, Immunology and Infectious Diseases, 29,
49-51.
Crab, R., Lambert, A., Defoirdt, T., Bossier, P., & Verstraete, W. (2010). The
application of bioflocs technology to protect brine shrimp (Artemia franciscana)
from pathogenic Vibrio harveyi. Journal of Applied Microbiology, 109, 1643-
1649. https://doi.org/10.1111/j.1365-2672.2010.04791.x
El-Saadony, M. T., Alagawany, M., Patra, A. K., Kar, I., Tiwari, R., Dawood, M.
A., Dhama, K., & Abdel-Latif, H. M. (2021). The functionality of probiotics in
aquaculture: an overview. Fish & Shellfish Immunology, 117, 36-52.
https://doi.org/10.1016/j.fsi.2021.07.007
Ferreira, G. S., Bolivar, N. C., Pereira, S. A., Guertler, C., do Nascimento Vieira,
F., Mouriño, J. L. P. & Seiffert, W. Q. (2015). Microbial biofloc as source of
probiotic bacteria for the culture of Litopenaeus vannamei. Aquaculture, 448, 273-
279. https://doi.org/10.1016/j.aquaculture.2015.06.006
Holt, J. G., Krieg, N. R., Sneath, P. H. A., Staley, J. T., & Williams, S. T. (2000).
Bergey's Manual of Determinative Bacteriology. Lippincott Williams and Wilkins,
New York, USA.
Hu, X., Yang, H. L., Yan, Y. Y., Zhang, C. X., Ye, J. D., Lu, K. L., Hu, L. H.,
Zhang, J. J., Ruan, L., & Sun, Y. Z. (2019). Effects of fructooligosaccharide on
growth, immunity and intestinal microbiota of shrimp (Litopenaeus vannamei) fed
diets with fish meal partially replaced by soybean meal. Aquaculture Nutrition, 25,
194-204. https://doi.org/10.1111/anu.12843
Krummenauer, D., Peixoto, S., Cavalli, R. O., Poersch, L. H., & Wasielesky Jr, W.
(2011). Superintensive culture of white shrimp, Litopenaeus vannamei, in a biofloc
technology system in southern Brazil at different stocking densities. Journal of the
World Aquaculture Society, 42, 726-733.
Lazado, C. C., & Caipang, C. M. A. (2014). Atlantic cod in the dynamic probiotics
research in aquaculture. Aquaculture, 424, 53-62.
https://doi.org/10.1016/j.aquaculture.2013.12.040
Lazado, C. C., Caipang, C. M. A., Brinchmann, M. F., & Kiron, V. (2011). In vitro
adherence of two candidate probiotics from Atlantic cod and their interference with
the adhesion of two pathogenic bacteria. Veterinary Microbiology, 148, 252-259.
https://doi.org/10.1016/j.vetmic.2010.08.024
Leaño, E. M., & Mohan, C. V. (2012). Early mortality syndrome threatens Asia´s
shrimp. Global Aquaculture Advocate, 4, 38-39.
Lee, J. S., Lee, K. C., Kim, K. K., Hwang, I. C., Jang, C., Kim, N. G., Yeo, W. H.,
Kim, B. S., Yu, Y. M., & Ahn, J. S. (2009). Acinetobacter antiviralis sp. nov., from
tobacco plant roots. Journal of Microbiology and Biotechnology, 19, 250-256.
McIntosh, D., Samocha, T. M., Jones, E. R., Lawrence, A. L., McKee, D. A.,
Horowitz, S., & Horowitz, A. (2000). The effect of a commercial bacterial
supplement on the high-density culturing of Litopenaeus vannamei with a low-
protein diet in an outdoor tank system and no water exchange. Aquacultural
Engineering, 21, 215-227. https://doi.org/10.1016/S0144-8609(99)00030-8
Pakingking Jr, R., Bautista, N. B., Catedral, D., & de Jesus-Ayson, E. G. (2018).
Characterisation of Vibrio isolates recovered from the eyes of cage-cultured
pompano (Trachinotus blochii) infested with caligid parasites (Lepeophtheirus
spinifer). Bulletin of the European Association of Fish Pathologists, 38, 35-41.
Pilet, M. F., Dousset, X., Barre, R., Novel, G., Desmazeaud, M., & Piard, J. C.
(1995). Evidence of two bacteriocins produced by Carnobacterium piscicola and
Carnobacterium divergens isolated from fish and active against Listeria
monocytogenes. Journal of Food Protection, 58, 256-262.
https://doi.org/10.4315/0362-028X-58.3.256
Schmautz, Z., Graber, A., Jaenicke, S., Goesmann, A., Junge, R., & Smits, T. H.
(2017). Microbial diversity in different compartments of an aquaponics system.
Archives of Microbiology, 199, 613-620. https://doi.org/10.1007/s00203-016-
1334-1
Schulze, A. D., Alabi, A. O., Tattersall-Sheldrake, A. R., & Miller, K. M. (2006).
Bacterial diversity in a marine hatchery: balance between pathogenic and
potentially probiotic bacterial strains. Aquaculture, 256, 50-73.
https://doi.org/10.1016/j.aquaculture.2006.02.008
Servin Arce, K., de Souza Valente, C., do Vale Pereira, G., Shapira, B., Davies, S.
J. (2021). Modulation of the gut microbiota of Pacific white shrimp (Penaeus
vannamei Boone, 1931) by dietary inclusion of a functional yeast cell wall‐based
additive. Aquaculture Nutrition, 27, 1114-1127. https://doi.org/10.1111/anu.13252
Sheu, S. Y., Shiau, Y. W., Wei, Y. T., & Chen, W. M. (2013). Sphingobium
fontiphilum sp. nov., isolated from a freshwater spring. International Journal of
Systematic and Evolutionary Microbiology, 63, 1906-1911.
https://doi.org/10.1099/ijs.0.046417-0
Song, Y. L., & Lee, S. P. (1983). Characterization and ecological implication of
luminous Vibrio harveyi isolated from tiger shrimp (Penaeus monodon). Bulletin
of the Institute of Zoology Academia Sinica, 3, 217-220.
Takeuchi, M., Hamana, K., & Hiraishi, A. (2001). Proposal of the genus
Sphingomonas sensu stricto and three new genera, Sphingobium,
Novosphingobium and Sphingopyxis, on the basis of phylogenetic and
chemotaxonomic analyses. International Journal of Systematic and Evolutionary
Microbiology, 51, 1405-1417. https://doi.org/10.1099/00207713-51-4-1405
Verschuere, L., Rombaut, G., Sorgeloos, P., & Verstraete, W. (2000). Probiotic
bacteria as biological control agents in aquaculture. Microbiology and Molecular
Biology Reviews, 64, 655-671. https://doi.org/10.1128/MMBR.64.4.655-671.2000
Wasielesky Jr, W., Atwood, H., Stokes, A., & Browdy, C. L. (2006). Effect of
natural production in a zero exchange suspended microbial floc based super-
intensive culture system for white shrimp Litopenaeus vannamei. Aquaculture,
258, 396-403. https://doi.org/10.1016/j.aquaculture.2006.04.030
Xia, L., Xiong, D., Gu, Z., Xu, Z., Chen, C., Xie, J., & Xu, P. (2008). Recovery of
Acinetobacter baumannii from diseased channel catfish (Ictalurus punctatus) in
China. Aquaculture, 284, 285-288.
https://doi.org/10.1016/j.aquaculture.2008.07.038
Xiao, Z., & Lu, J. R. (2014). Strategies for enhancing fermentative production of
acetoin: a review. Biotechnology Advances, 32, 492-503.
https://doi.org/10.1016/j.biotechadv.2014.01.002
Zorriehzahra, M. J., Delshad, S. T., Adel, M., Tiwari, R., Karthik, K., Dhama, K.,
& Lazado, C. C. (2016). Probiotics as beneficial microbes in aquaculture: an
update on their multiple modes of action: a review. Veterinary Quarterly, 36, 228-
241. https://doi.org/10.1080/01652176.2016.1172132
