Improvement of resistance to rice blast and bacterial leaf streak by CRISPR/Cas9-mediated mutagenesis of Pi21 and OsSULTR3;6 in rice (Oryza sativa L.)

Abstract

Rice (Oryza sativa L.) is a staple food in many countries around the world, particularly in China. The production of rice is seriously affected by the bacterial leaf streak and rice blast, which can reduce rice yield or even cause it to fail to be harvested. In this study, susceptible material 58B was edited by CRISPR/Cas9, targeting a target of the Pi21 gene and a target of the effector-binding element (EBE) of the OsSULTR3;6 gene, and the mutants 58b were obtained by Agrobacterium-mediated method. The editing efficiency of the two targets in the T0 generation was higher than 90.09%, the homozygous mutants were successfully selected in the T0 generation, and the homozygous mutation rate of each target was higher than 26.67%. The expression of the edited pi21 and EBE of Ossultr3;6 was significantly reduced, and the expression of defense responsive genes was significantly upregulated after infected with rice blast. The lesion areas of rice blast and bacterial leaf streak were significantly reduced in 58b, and the resistance of both was effectively improved. Furthermore, the gene editing events did not affect the agronomic traits of rice. In this study, the resistance of 58b to rice blast and bacterial leaf streak was improved simultaneously. This study provides a reference for using Clustered Regularly Interspaced Short Palindromic Repeats/Cas9 (CRISPR/Cas9) to accelerate the improvement of rice varieties and the development of new materials for rice breeding.

Full text

Improvement of resistance
to rice blast and bacterial
leaf streak by CRISPR/Cas9-
mediated mutagenesis of
Pi21 and OsSULTR3;6 in rice
(Oryza sativa L.)
Jinlian Yang
1
†
, Yaoyu Fang
1
†
,HuWu
1
, Neng Zhao
1
,
Xinying Guo
1
, Enerand Mackon
1
, Haowen Peng
1
,
Sheng Huang
2
, Yongqiang He
1
, Baoxiang Qin
1
, Yaoguang Liu
3
,
Fang Liu
1
, Shengwu Chen
4
*and Rongbai Li
1
*
1
State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, College of
Agriculture, Guangxi University, Nanning, China,
2
State Key Laboratory for Conservation and
Utilization of Subtropical Agro-bioresources, College of Life Science and Technology, Guangxi
University, Nanning, China,
3
State Key Laboratory for Conservation and Utilization of Subtropical
Agricultural Bioresources, South China Agricultural University, Guangzhou, China,
4
Guangxi Lvhai
Seed Co., Ltd, Marketing Department, Nanning, China
Rice (Oryza sativa L.) is a staple food in many countries around the world,
particularly in China. The production of rice is seriously affected by the bacterial
leaf streak and rice blast, which can reduce rice yield or even cause it to fail to be
harvested. In this study, susceptible material 58B was edited by CRISPR/Cas9,
targeting a target of the Pi21 gene and a target of the effector-binding element
(EBE) of the OsSULTR3;6 gene, and the mutants 58b were obtained by
Agrobacterium-mediated method. The editing efficiency of the two targets in
the T
0
generation was higher than 90.09%, the homozygous mutants were
successfully selected in the T
0
generation, and the homozygous mutation rate of
each target was higher than 26.67%. The expression of the edited pi21 and EBE of
Ossultr3;6 was significantly reduced, and the expression of defense responsive
genes was significantly upregulated after infected with rice blast. The lesion areas
of rice blast and bacterial leaf streak were significantly reduced in 58b, and the
resistance of both was effectively improved. Furthermore, the gene editing
events did not affect the agronomic traits of rice. In this study, the resistance
of 58b to rice blast and bacterial leaf streak was improved simultaneously. This
study provides a reference for using Clustered Regularly Interspaced Short
Palindromic Repeats/Cas9 (CRISPR/Cas9) to accelerate the improvement of
rice varieties and the development of new materials for rice breeding.
KEYWORDS
rice, CRISPR/Cas9, Pi21,OsSULTR3;6, rice blast, bacterial leaf streak
Frontiers in Plant Science frontiersin.org01
OPEN ACCESS
EDITED BY
Suprasanna Penna,
Amity University, Mumbai, India
REVIEWED BY
Subhasis Karmakar,
National Rice Research Institute
(ICAR), India
Shakeel Ahmad,
Ministry of Environment, Water and
Agriculture, Saudi Arabia
*CORRESPONDENCE
Rongbai Li
lirongbai@126.com
Shengwu Chen
692792063@qq.com
†
These authors have contributed
equally to this work and share
first authorship
RECEIVED 20 April 2023
ACCEPTED 27 June 2023
PUBLISHED 17 July 2023
CITATION
Yang J, Fang Y, Wu H, Zhao N, Guo X,
Mackon E, Peng H, Huang S, He Y, Qin B,
Liu Y, Liu F, Chen S and Li R (2023)
Improvement of resistance to rice blast
and bacterial leaf streak by CRISPR/Cas9-
mediated mutagenesis of Pi21 and
OsSULTR3;6 in rice (Oryza sativa L.).
Front. Plant Sci. 14:1209384.
doi: 10.3389/fpls.2023.1209384
COPYRIGHT
© 2023 Yang, Fang, Wu, Zhao, Guo, Mackon,
Peng, Huang, He, Qin, Liu, Liu, Chen and Li.
This is an open-access article distributed
under the terms of the Creative Commons
Attribution License (CC BY). The use,
distribution or reproduction in other
forums is permitted, provided the original
author(s) and the copyright owner(s) are
credited and that the original publication in
this journal is cited, in accordance with
accepted academic practice. No use,
distribution or reproduction is permitted
which does not comply with these terms.
TYPE Original Research
PUBLISHED 17 July 2023
DOI 10.3389/fpls.2023.1209384

Introduction
Rice (Oryza sativa L.) is one of the most important food crops
in the world. Bacterial leaf streak and rice blast are two deadly
diseases that can cause serious damage to rice (Ke et al., 2017).
Bacterial leaf streak is a bacterial disease caused by Xanthomonas
oryzae pv.oryzicola (Xoc) that mainly infects rice leaves through leaf
stomata or wounds (Jiang et al., 2020). The genome similarity between
Xoc and another Xanthomonas oryzae pv. oryzae (Xoo)ismorethan
90%, and they both lead to rice disease by introducing transcription
activator–like effectors (TALEs) into plant cells to activate the
expression of the susceptibility gene(Cox et al., 2017). TALE is a
class of proteins unique to Xanthomonas species (Jens and Ulla, 2010;
Boch et al., 2014). TALE can activate either the susceptibility gene (S)
or the resistance gene (R) of the plant, thereby making the host
susceptible or activating the defense mechanism of the pathogen
(Boch et al., 2014). TALE contains a conserved central repeat region
consisting of 34 amino acid repeats, an N-terminal region of the type
III secretion system, and a C-terminal region containing
transcriptional activation domains and nucleoplasm localization
signals (Xu et al., 2022). So far, the targeting of TALE has been
determined by the central repeat region, where each repeat unit
recognizes a nucleotide through a specific degenerate codon,
resulting in a contiguous DNA sequence [effector-binding element
(EBE)] (Matthew and Adam, 2009;Jens and Ulla, 2010). Magnaporthe
oryzae–caused rice blast is one of the most damaging diseases to rice,
with a large damage area and severity (Liu et al., 2014). Rice blast can
infect the leaves, stems, panicles, and roots of rice at various
developmental stages (Wilson and Talbot, 2009), resulting in a
significant decrease in rice yield (Ebbole, 2007). Following pathogen
infection, rice plants activate the biosynthesis and signal transduction
of various hormones that act as immune signals to activate host
defense responses against pathogen invasion (David et al., 2013;Yang
et al., 2013). Jasmonic acid (JA) enhances resistance to rice blast by
activating defense-related genes and accumulating antimicrobial
substances (Shiduku et al., 2014). It has been reported that the
ubiquitin-proteasome system negatively regulates OsWRKY45
through periodic degradation in the absence of pathogen infection
(Zhou et al., 2022) and salicylic acid (SA) signaling, whereas
OsWKRY45-mediated defense can be activated in the presence of
SA signaling or pathogen infection reactions (Matsushita et al., 2013).
Known as a powerful gene editing tool, CRISPR/Cas9 has been
widely used in rice to improve yield and quality traits, enhance
disease resistance, and create male sterile rice lines to accelerate the
process of hybrid rice breeding. For example, Yamauchi et al. used
CRISPR/Cas9 technology to knock out the RBOHH gene and
demonstrated its role in reducing Reactive oxygen species (ROS)
accumulation in rice roots (Yamauchi et al., 2017); Li et al. used
CRISPR/Cas9 to knock out four rice yield genes Gn1a,DEP1,GS3,
and IPA1 to assess their roles in rice yield (Li et al., 2016); Usman
et al. (2020) improved the fragrance quality of rice by editing the
Badh2 gene (Usman et al., 2020); Zhou et al., (2022) edited the Bsr-
d1,Pi21, and ERF922 genes of LK638S and improved the resistance
of LK638S to rice blast and bacterial blight (Zhou et al., 2022).
The evolution of Magnaporthe oryzae may lead to decreased or
even completely lost rice blast resistance. Therefore, developing new
rice lines with broad-spectrum resistance (BSR) to blast is necessary.
However, bacterial leaf streak resistance is a quantitative trait
controlled by multiple quantitative trait loci, and it is difficult to
effectively select Xoc-resistant varieties by traditional breeding (Bossa-
Castro et al., 2018;Xie et al., 2021). CRISPR/Cas9 gene editing
technology has advantages in high efficiency, simple operation,
affordable cost, and the ability to simultaneously edit multiple
targets. CRISPR transgenic progeny can be screened for
homozygous mutants without T-DNA insertion, reducing breeding
time and labor costs significantly. In this study, CRISPR/Cas9
technology was used to edit the TALE-binding region of the
susceptibility gene OsSULTR3;6 and the second exon of Pi21 gene
in the high-quality indica maintainer line 58B, which simultaneously
improved the resistance to rice blast and bacterial leaf streak. This
work provides new and interesting breeding materials with both
broad-spectrum blast resistance and bacterial leaf streak resistance.
Materials and methods
Material and pathogen materials
In this experiment, the indica maintainer line 58B preserved in
Guangxi University was selected as the recipient material. This
material has high quality and yield but is susceptible to rice blast
and bacterial leaf streak. All experimental materials were
independently planted in a planting pool in the rice net room or
planting pond of Guangxi University. The CRISPR/Cas9 gene
editing system used in this experiment was provided by YL, the
South China Agricuture University. Xoc GX01 used was from in
Guangxi University; M. oryzae H322 was a strain of rice blast
isolated and preserved in the experimental field of Guangxi
University by HP’s laboratory. The list of primers used in the
study is shown in Supplementary Table 1.
Vertor construct and rice transformation
Target sites of Pi21 and OsSULTR3;6-EBE were selected by the
CRISPR-Genome Editing (GE) (http://skl.scau.edu.cn/home). The
target sites were introduced separately into the promoter and the
Single guide RNA (sgRNA) using overlapping PCR. Subsequently,
the promoter-target-sgRNA units were assembled into the CRISPR/
Cas9 vector, following the method described by Zeng et al. (Zeng
et al., 2018). The validated CRISPR/Cas9 plasmid was transformed
into Agrobacterium tumefaciens EHA105, which was then used for
rice transformation of the 58B variety (Supplementary Figure 1).
Specific primer pairs Cas9-F/Cas9-R and HPT-F/HPT-R were used
to confirm T
0
transgenic-positive plants. Pi21-TF/Pi21-TR and
OsSULTR3;6-TF/OsSULTR3;6-TR were used to amplify the
genomic regions containing each target site, and the amplified
products were followed for Sanger sequencing in T
0
and T
1
Yang et al. 10.3389/fpls.2023.1209384
Frontiers in Plant Science frontiersin.org02

generations. The sequencing results were analyzed to determine the
target mutation by an online tool DSDecodeM (http://
skl.scau.edu.cn/dsdecode/)(Liu et al., 2015). Transgene-free plants
were identified using the primer pairs Cas9-F/Cas9-R and HPT-F/
HPT-R and determined by both showing negative amplification
(Supplementary Figure 3). The genomic DNA was amplified with
specific primers, and the amplified products were sequenced. The
sequencing results were compared with the The Rice Annotation
Project-Database (RAP-DB) sequence to analyze the off-target of
each gene.
Magnaporthe oryzae and Xoc inoculation
Magnaporthe oryzae H322 was used for inoculation in this
experiment. The activated strain was transferred to oat medium for
culture, placed in a 28°C incubator, and exposed to light for 24 h a
day for 10 days to induce sporulation. Before inoculation, rice was
selected with consistent growth to the three-leaf stage and the
suspension prepared (the spore concentration was adjusted to 1 ×
10
5
/mL, the total number of spores is about 30 in 16 middle squares
of the blood count plate). The seedlings were sprayed evenly with
the suspension, three biological replicates per strain. After
inoculation, a layer of black film was placed on the transparent
plastic film for shading and treatment for 36 h. After the treatment,
the black film was removed, and it was kept moist for 5 days to
investigate the incidence and lesions.
At the tillering stage, bacterial leaf streak inoculation was
performed on transgene-free homozygous mutant. A single colony
was selected from the streak-activated GX01 strain on NA medium
(5 g/L tryptone, 1 g/L beeg extract, 1 g/L yeast extract, 10 g/L
sucrose, 17 g/L agar, PH 6.8–7.0), and put into 500 mL of NB
medium, which was cultured at 28°C at 180 rpm for 2 days. The
OD
600
value of bacterial suspension ranged between 0.6 and 0.8.
GX01 was inoculated by acupuncture at the tillering stage (6 weeks)
of rice (Supplementary Figure 4). The disease infection was
investigated 14 days after inoculation and photographed.
Gene expression difference analysis
Total RNA was extracted from fresh leaves using the FastPure
Universal Plant Total RNA Isolation Kit (catalog no. RC411,
Vazyme). The extracted RNA reverse-transcribed into
Complementary DNA (cDNA), and Quantitative real-time
(qRT)-PCR was performed. The gene expression levels of pi21
and Ossultr3;6 were detected in the mutant and wild types.
Measurement of main agronomic traits
Wild-type (58B) and mutant lines were planted in Guangxi
University. Each line was planted in four rows with eight plants in
each row. At the maturity stage, five plants were randomly selected
to investigate the plant height, effective panicle number, panicle
length, number of grains per panicle, and 1,000-grain weight. Then,
the data were analyzed using Excel and IBM SPSS Statistics 20.
Results
CRISPR/Cas9-mediated targeted
mutagenesis of Pi21 and
OsSULTR3;6-EBE genes
To generate Pi21 and OsSULTR3;6-EBE mutants, two sgRNAs
that are in the second exon of the Pi21 gene (LOC_Os04g32850)and
EBE in the promoter region of OsSULRT3;6 gene (LOC_Os01g52130)
were designed (Figure 1A). Two sgRNAs were constructed into the
CRISPR/Cas9 vertor (Figure 1B), and the vector plasmid was used to
transform 58B rice by Agrobacterium tumefaciens EHA105. All 15
transgenic seedlings of 58b were positive plants with a transformation
rate of 100% (Supplementary Figure 2). There was only one
transgenic plant in target Pi21 that did not have a detected target
mutation, with a frequency of 6.67%. The frequencies of heterozygous
and biallelic mutations were also the same at 26.67%, and the
A
B
FIGURE 1
CRISPR/Cas9-mediated targeted mutagenesis of Pi21 and OsSULTR3;6-EBE. (A) Target sites of CRISPR/Cas9. One target was chosen in the in the
second exon of the Pi21 gene; another target was chosen around effector-binding element (EBE) in the promoter region of OsSULRT3;6 gene; the
PAM sequences were marked in red. (B) The expression CRISPR/Cas9 vector. OsU6a and OsU6b, rice promoter; HPT, hygromycin; NLS, nuclear
localization signal; Tons, the terminator; LB and RB, left border and right border, respectively.
Yang et al. 10.3389/fpls.2023.1209384
Frontiers in Plant Science frontiersin.org03

frequency of homozygous mutations was as high as 40%. Only one
transgenic plant in the OsSULTR3;6-EBE target was not mutated.
There were five heterozygous and five biallelic plants with a frequency
of 33.33%, respectively. There were four plants with homozygous
mutations with a frequency of 26.67% (Table 1). The mutation types
of Pi21 and OsSULTR3;6-EBE both include base insertions,
substitutions, and deletions, including mainly base deletions
(43.33% and 40%, respectively; Table 2).
CRISPR/Cas9 gene editing technology inevitably presents off-
target phenomena, which will interfere with experimental results.
To avoid off-target events as much as possible, the potential off-
target sites were predicted through the CRISPR-GE website
(Table 3), and specific primers were designed for amplification
and sequencing to analyze the off-target rate of each target. Pi21 has
three off-target sites located in the CDS region of the gene, namely,
Os03g0349200,Os01g0184800, and Os09g0380300, and the highest
off-target index reached 0.557. Os03g0349200 presumably encodes a
cyclin-dependent kinase C-2 protein involved in the cell cycle;
Os01g0184800 presumably encodes a photoconductive protein;
and Os09g0380300 presumably encodes a cytochrome P450 family
protein. The two off-target sites of OsSULTR3;6-EBE were in the
CDS region of Os03g0209500 and Os11g0568600, respectively, and
the other off-target sites were located in the non-coding region, with
the highest off-target index of 0.405. The protein encoded by
Os03g0209500 belongs to the zinc finger family of proteins,
whereas Os11g0568600 encodes a protein containing a THUMP
domain. The specific functions of these two proteins are unknown.
Specific primers were designed for the abovementioned off-target
sites in the CDS region of the gene, the DNA of the homozygous
plants of the T
0
generation was extracted for PCR amplification, and
TABLE 1 Analysis of T
0
mutation types.
No. of plants Target site
Proportion of mutation types(%)
Wild type Heterozygous Biallelic Homozygous
15
Pi21 6.67 (1) 26.67 (4) 26.67 (4) 40 (6)
OsSULTR3;6-EBE 6.67 (1) 33.33 (5) 33.33 (5) 26.67 (4)
TABLE 2 Frequency of T
0
mutation types.
Target site
Frequency of mutation types (%)
WT Insertion Substitution Deletion
Pi21 20 10 26.67 43.33
OsSULTR3;6-EBE 23.33 23.34 13.33 40
WT, wild type.
TABLE 3 Potential off-target analysis of the two target sites.
Target site Off-target sequence Off-score Gene Region
Pi21
GGAGAAGAAGCCGCCGAAGC CGG 0.557 Os03g0349200 CDS
GGAGAAGAAGACGCCGAAGC CGG 0.418 Null Intergenic
GGGGAACCTGCCGCCGAAGC CGG 0.368 Os01g0184800 CDS
GGAGAAGCCGCCGTCGCAGC CGG 0.129 Os09g0380300 CDS
OsSULTR3;6-EBE
TAGCAACAAAGAAAAGCTAC GGG 0.405 Null Intergenic
GATCAACAAGAAGAGACTGC TGG 0.375 Os03g0209500 CDS
GAGCAACGGGGAGAGGCTAC GGG 0.244 Null Intergenic
AACTAAAAAGGAGAGGCTAC TGG 0.231 Os11g0568600 Intron
CAACAACAAGGAGGAGCTAC GGG 0.224 Null Intergenic
CATTAAGGAGGGGAGGCTAC GGG 0.142 Null Intergenic
AACAAACAAGGAGAGGCCAC CGG 0.139 Null Intergenic
GGTCCACAAGAAGAGGCGAC GGG 0.133 Null Intergenic
Yang et al. 10.3389/fpls.2023.1209384
Frontiers in Plant Science frontiersin.org04

then the off-target situation was analyzed by sequencing. The results
showed that no off-target events were detected in the two
homozygous seedlings of 58b (Supplementary Figure 5).
Knockout of single Pi21 enhanced
resistance to rice blast
The resistance to rice blast of a single Pi21 homozygous mutant
with a base insertion in the T
1
generation was identified in seedling
and maturity rice blast, three biological replications (Table 4). The
single Pi21 mutant was found to exhibit increased resistance to M.
oryzae H322 at the seedling stage. To test whether enhanced blast
resistance still existed at reproductive stage, the blast evaluation on
rice panicles was conducted, and the mutants were transplanted in a
field rice blast area in Wutang, Nanning. The results showed that
percentage of diseased panicles in mutants were significantly lower
than that in 58B (Figure 2).
Loss-of-function mutations of
OsSULTR3;6-EBE increase resistance
against Xoc
A single homozygous OsSULTR3;6-EBE mutant line with a 4-
base deletion was selected for further analysis (Table 5). The
mutants were inoculated Xoc strain GX01 using the acupuncture
method at the tillering stage, three biological replications. At 15
days after inoculation, disease length was about 75% shorter on the
Ossultr3;6-EBE mutant than that on 58B (Figure 3). The results
TABLE 4 sgRNA sequence and mutations at the target site of Pi21 in the T
1
homozygous mutant.
Name
Edited gene sequence
Sanger chromotogram Editing types
Pi21
58B GGAGAAGCCGCCGCCGAAGC WT
pi21 GGAGAAGCCGCCGCCGATAGC +1 bp
WT, wild type.
ABC
FIGURE 2
Enhanced blast resistance of the single Pi21 mutant lines. (A) The percentage of lesion areas of rice blast (n = 3 leaves). (B) Rice mutant lines and
wild-type 58B were tested for resistance to M. oryzae at the seedling stage. (C) The resistance to M. oryzae rice mutant lines and wild-type 58B was
tested at rice reproductive stage. t-test: **P < 0.01.
Yang et al. 10.3389/fpls.2023.1209384
Frontiers in Plant Science frontiersin.org05

demonstrate that disrupting OsSULTR3;6-EBE significantly reduces
susceptibility to Xoc in rice.
The Pi21/OsSULTR3;6-EBE double mutant
shows enhanced resistance to both M.
oryzae and Xoc
Two homozygous pi21/Ossultr3;6-EBE double mutant plants
with different editing types in the T
1
generation (pi21/Ossultr3;6-
EBE-7 and pi21/Ossultr3;6-EBE-11) were used to identify the
resistance (Table 6). pi21/Ossultr3;6-EBE-7 produced 21-bp
deletion at Pi21,resultinginseven–amino acid “PEKPPPK”
deletion in the Pi21 protein; 1-bp insertion at OsSULTR3;6-EBE
did not cause a sequence change in the OsSULTR3;6 gene and
OsSULTR3;6 protein. pi21/Ossultr3;6-EBE-11 produced 1-bp
insertion at Pi21 and caused the frameshift in the Pi21 coding
region, generating the premature translation termination codon;
pi21/Ossultr3;6-EBE-11 produced 33-bp deletion at OsSULTR3;6-
EBE but did not directly affect the OsSULTR3;6 gene and
OsSULTR3;6 protein (Figure 4).
To identify the blast resistance of the pi21 in homozygous
mutant, pi21/Ossultr3;6-EBE-7 and pi21/Ossultr3;6-EBE-11 were
collected and inoculated M. oryzae H322 at the three-leaf stage by
spraying. After 7 days, the area of lesions was counted, and the
resistance to rice blast at the seedling stage was identified.
AB
FIGURE 3
Enhanced bacterial leaf streak resistance of the single OsSULTR3;6-EBE mutant lines. (A) The percentage of lesion length of bacterial leaf streak (n = 3
leaves). (B) Rice mutant lines and wild-type 58B were tested for resistance to Xoc at the tillering stage. t-test: **P < 0.01.
TABLE 5 Sequence at the target site of OsSULTR3;6-EBE in the T
1
homozygous mutant.
Name
Edited gene sequence
Sanger chromotogram Editing types
OsSULTR3;6-EBE
58B GATCAACAAGGAGAGGCTAC WT
Ossultr3;6-EBE GATCAACAAGGAG****TAC −4bp
WT, wild type.
Yang et al. 10.3389/fpls.2023.1209384
Frontiers in Plant Science frontiersin.org06

Simultaneously, pi21/Ossultr3;6-EBE-7 and pi21/Ossultr3;6-EBE-11
were also planted in Wutang, Nanning, where the rice blast naturally
occurred, and the rice blast resistance was identified after the rice was
mature. The results showed that, compared with the wild type, the
pi21/Ossultr3;6-EBE homozygous mutant had significantly decreased
lesion area, indicating that knockout of the pi21 gene significantly
improved the rice blast resistance at seedling and mature stages
(Figures 5A–C). To identify bacterial leaf streak resistance of
homozygous mutants of pi21/Ossultr3;6-EBE, acupuncture was
used to inoculate Xoc GX01, and the lesion length was measured
and analyzed 15 days after inoculation. The results showed that,
compared with the wild type, the length of the lesions of the pi21/
Ossultr3;6-EBE-7 and pi21/Ossultr3;6-EBE-11 lines was significantly
reduced, indicating that the knockout of the OsSULTR3;6-EBE had
significantly improved resistance (Figures 5D,E).
Expression analysis of pi21,Ossultr3;6
genes and defense responsive genes
As susceptibility genes, the Pi21 and OsSULTR3;6 genes play an
important role in the invasion of pathogens and promote rice disease
through transcription and translation into corresponding proteins,
and their expression levels have a huge impact on the degree of
disease. To further study the effect of pi21 and Ossultr3;6 genes
mutations on rice plant susceptibility, the expression levels of pi21
and Ossultr3;6 in the knockout mutants were detected. The wild type
was used as the control, and OsActin was used as the internal
reference gene for qRT-PCR detection. The results showed that the
expression of the pi21 gene of pi21/Ossultr3;6-EBE-7 and pi21/
Ossultr3;6-EBE-11 plants was significantly decreased by compared
with that of the wild type (Figure 6A). The Ossultr3;6 gene expression
levels of pi21/Ossultr3;6-EBE-7 and pi21/Ossultr3;6-EBE-11 were
decreased, respectively, compared with that of the wild type
(Figure 6B). The result showed that the pi21 gene can significantly
reduce its expression and improve the resistance to rice blast; after
editing EBE, it can prevent the TALE secreted by Xoc from binding
with EBE, thereby significantly reducing the expression of Ossultr3;6
gene and achieving disease resistance.
After the pathogenic bacteria infect rice, the plant will initiate
an immune response through the hormone signaling pathway. To
study the role of the pi21 in the pathogenic infection of rice, the
leaves of the inoculated site were taken 24 h after inoculation, and
the extracted RNA was used to detect the expression of SA signaling
A
B
FIGURE 4
pi21/Ossultr3;6-EBE double mutation plants with different editing types (A) The mutated sequences of Pi21 and OsSULTR3;6. The number of base
deletion and insertion is shown by the mark of minus (−) and plus (+). (B) Amino acid variations of the Pi21 protein in the mutant. The red line
indicates the missing protein. *indicates the termination of translation.
TABLE 6 sgRNA sequence and mutations at the target site of Pi21/OsSULTR3;6-EBE in the T
1
homozygous mutant.
Name Gene Edited gene sequence Editing types
58B
Pi21 GGAGAAGCCGCCGCCGAAGC WT
OsSULTR3;6-EBE GATCAACAAGGAGAGGCTAC WT
pi21/Ossultr3;6-EBE-7
Pi21 GGAG********************* TGC −21 bp
OsSULTR3;6-EBE GATCAACAAGGAGAGGCTTAC +1 bp
pi21/Ossultr3;6-EBE-11
Pi21 GGAGAAGCCGCCGCCGAAAGC +1 bp
OsSULTR3;6-EBE GATCAACAAGGAGAGGCGTAC +1 bp
WT, wild type.
Yang et al. 10.3389/fpls.2023.1209384
Frontiers in Plant Science frontiersin.org07

pathway marker genes OsPR1a,OsPR1b,OsWRKY45,andJA
signaling pathway marker gene OsPR4. The results showed that
the gene expression levels of the SA signaling pathway and the JA
signaling pathway were significantly increased after rice blast
inoculation (Figure 6C), which may be the reason why pi21
showed disease resistance.
Main agronomic traits of wild-type and
mutant lines
To study the effects of Pi21 and OsSULTR3;6 gene editing on the
main agronomic traits of rice, the homozygous mutants without
foreign genes in the T
2
generation were chosen and planted in
separate planting ponds. Their main agronomic traits were then
statistically analyzed under the same growing conditions. pi21/
Ossultr3;6-EBE-7 and pi21/Ossultr3;6-EBE-11 lines with both Pi21
and OsSULTR3;6-EBE mutations did not differ significantly from
the wild type in plant height, 1,000-grain weight, panicle length,
number of grains per panicle, or effective panicle number, This
results indicated that the Pi21 and OsSULTR3;6-EBE mutation did
not affect the main agronomic traits (Figure 7).
Discussion
Currently, rice breeding should consider not only high yield but
also high rice quality. Rice blast and bacterial leaf streak are the
A
B
DE
C
FIGURE 5
Bacterial leaf streak and rice blast resistance were enhanced in mutants. (A) The percentage of lesion areas of rice blast. (B) Rice mutant lines and
wild-type 58B were tested for resistance to M. oryzae at the seedling stage. (C) Rice mutant lines and wild-type 58B were tested for resistance to M.
oryzae at the mature stage. (D) The percentage of lesion length of bacterial leaf streak. (E) Rice mutant lines and wild-type 58B were tested for
resistance to Xoc at the tillering stage. t-test: **P < 0.01.
Yang et al. 10.3389/fpls.2023.1209384
Frontiers in Plant Science frontiersin.org08

main diseases that seriously harm the yield and quality of rice (Liu
et al., 2014;Asibi et al., 2019). With the rapid development of
CRISPR/Cas9-mediated genomic technologies, modifying S genes
to produce new varieties with BSR has become feasible for many
crops (Xu et al., 2019). For example, the CRISPR/Cas9 knockout
mutant of the rice S gene Pi21 is resistant to M. oryzae (Nawaz et al.,
2020). 58B is an Indica rice variety independently bred by our
laboratory for many years. 58B originated from yexiang B/
IR58025B//43B/DP15; among them, yexiang B and 43B are indica
rice maintainer line from China. IR58025B is derived from the
International Rice Research Institute indica rice maintainer line.
DP15 is a common wild rice (O. rufipogon Griff). It has outstanding
advantages, high rice quality, first grade rice, and good taste. It has
short stalks, strong tillering power, narrow leaves, upright, good
plant shape, strong compatibility, strong hybrid advantage, and
good productivity. However, it is susceptible to rice blast and
bacterial leaf streak, which affects yield and quality.
To address this issue, in the study, CRISPR/Cas9 technology
was used to precisely edit both the BSR rice blast gene Pi21 and the
promoter region EBE of the susceptibility gene OsSULRT3;6, which
produced to the single pi21 mutants, single Ossultr3;6-EBE mutants,
and pi21/Ossultr3;6-EBE double mutants. After inoculation of M.
oryzae and Xoc, the results showed that single mutants of the S gene
Pi21 or OsSULTR3;6-EBE can enhance resistance to M. oryzae or
Xoc, and this is consistent with the previous results (Nawaz et al.,
2020;Xu et al., 2020). Noteworthy, when both Pi21 and
OsSULTR3;6-EBE were edited, the pi21/Ossultr3;6-EBE double
mutant has resistance against both M. oryzae and Xoc. Similar to
the resistance conferred by the single mutants, no superimposed or
attenuated effects were found. The mutant that was planted in the
AB
C
FIGURE 6
Expression analysis of pi21,Ossultr3;6 genes and defense responsive genes. (A) Relative expression of pi21.(B) Relative expression of ossultr3;6.
(C) Relative expression level of defense responsive genes after inoculation of rice blast. t-test: *P < 0.05 and **P < 0.01.
Yang et al. 10.3389/fpls.2023.1209384
Frontiers in Plant Science frontiersin.org09

rice blast–infected field also demonstrated heightened resistance
against rice blast. However, the current shortage of M. oryzae or Xoc
strains in the laboratory hinders the ability to determine whether
the pi21/Ossultr3;6-EBE double mutants exhibit BSR. This crucial
investigation will need to be conducted in the future.
Disruption of the S gene can cause other effects including reduced
growth, low fertility, and reduced tolerance to other stresses (Zaidi
et al., 2018). For example, knockdown of the S gene OsSWEET11 in
rice significantly reduced the sucrose concentration in the embryo sac
of the mutants, resulting in seed germination deficiency (Ma et al.,
2017). The Xa13 gene controls not only disease resistance but also
reproductive growth in rice. If its expression is suppressed while
enhancing resistance to strain PX099A, then it can also cause pollen
abortion in rice and reduce the fruiting rate (Yang et al., 2018). To
eliminate this side effect, Li used CRISPR/Cas9 to edit the Xa13
promoter to obtain Xoo resistant rice with normal fertility (Li et al.,
2011). Xoc introduces TALE into the plant cell through the type III
secretion system, which recognizes and binds EBEs in the promoter
region of the host susceptibility gene, activating the transcriptional
expression of the susceptibility gene and making the host susceptible
to disease (Hui et al., 2019). At present, there are still few studies on
the genes corresponding to TALE in Xoc. The sulfate transporter
protein gene OsSULTR3;6 is a susceptible gene, which can be bound
by Tal2g, one TALE of Xoc, and cause bacterial leaf streak in host rice
(Cernadas et al., 2014). By modifying the Tal2g-binding region (EBE)
of the OsSULTR3;6 gene, we were able to obtain homozygous
mutants that had a 1-bp base insertion and a 33-bp base deletion
within the EBE region. It is important to note that the actual sequence
of the OsSULTR3;6 gene itself remained unchanged. The bacterial leaf
streak resistance was identified by acupuncture method, and both
mutant strains showed significantly lower spot length and higher
resistance than wild-type 58B, indicating that editing the EBE region
of the susceptibility gene could effectively improve the resistance of
rice to bacterial leaf streak, and this is consistent with the previous
results (Xu et al., 2020). In the study, higher levels of SA signaling
related genes OsPRla,OsPRlb,OsWRKY45 and JA signaling related
gene OsPR4 were detected in mutants than in wild-type plants when
the plants were infected with M. oryzae (Figure 6). These results
suggest that the enhanced resistance of the mutant to rice blast may
be associated with the activation of SA and JA signaling transduction
A
B
DEF
C
FIGURE 7
The agronomic traits of the mutants and the wild type (WT). (A) Phenotypes of pi21/Ossultr3;6-EBE mutant lines. (B) Plant height. (C) Effective spike
number. (D) Panicle length. (E) Grain number per panicle. (F) 1,000-grain weight.
Yang et al. 10.3389/fpls.2023.1209384
Frontiers in Plant Science frontiersin.org10

genes. In the study, five key agronomic traits were evaluated in the
field for the pi21/Ossutr3;6-EBE double mutants and observed no
significant differences in these traits between the mutant and
WT plants.
In conclusion, our work provides a rapid and effective approach
to breed rice varieties resistant to rice blast and bacterial leaf streak,
which could significantly accelerate the breeding of rice varieties
with multiple disease resistance.
Data availability statement
The original contributions presented in the study are included
in the article/Supplementary Material. Further inquiries can be
directed to the corresponding authors.
Author contributions
RL, SC, and FL designed and supervised the research. JY, YF,
and HW performed most experiments. JY, YF, and XG analyzed
date. JY, YF, NZ, EM, and RL wrote the paper. HP, SH, YH, BQ, YL,
SC, and RL provided resources. All authors contributed to the
article and approved the submitted version.
Funding
This study was supported by the State Key Laboratory for the
Conservation and Utilization of Subtropical Agro bioresources (No.
SKLWSA‐a201914 and No. SKLCUSA-b202203). This research was
funded by the Guangxi Zhuang Autonomous Region Science and
Technology Department, grant numbers AA17204070, AB16380066,
and AB16380093.
Conflict of interest
Author SC was employed by the company Guangxi Lvhai Seed
Co., Ltd.
The remaining authors declare that the research was conducted
in the absence of any commercial or financial relationships that
could be construed as a potential conflict of interest.
Publisher’s note
All claims expressed in this article are solely those of the authors
and do not necessarily represent those of their affiliated
organizations, or those of the publisher, the editors and the
reviewers. Any product that may be evaluated in this article, or
claim that may be made by its manufacturer, is not guaranteed or
endorsed by the publisher.
Supplementary material
The Supplementary Material for this article can be found online
at: https://www.frontiersin.org/articles/10.3389/fpls.2023.1209384/
full#supplementary-material
References
Asibi, A., Chai, Q., and Coulter, J. (2019). Rice blast: a disease with implications for
global food security. Agronomy 9 (8), 451. doi: 10.3390/agronomy9080451
Boch, J., Bonas, U., and Lahaye, T. (2014). TAL effectors- pathogen strategies and
plant resistance engineering. New Phytol. 204 (4), 823–832. doi: 10.1111/nph.13015
Bossa-Castro, A., Tekete, C., Raghavan, C., Delorean, E., Dereeper, A., Dagno, K.,
et al. (2018). Allelic variation for broad-spectrum resistance and susceptibility to
bacterial pathogens identified in a rice MAGIC population. Plant Biotechnol. J. 16 (9),
1559–1568. doi: 10.1111/pbi.12895
Cernadas, R., Doyle, E., Nino-Liu, D., Wilkins, K., Bancroft, T., Wang, L., et al.
(2014). Code-assisted discovery of tal effector targets in bacterial leaf streak of rice
reveals contrast with bacterial blight and a novel susceptibility gene. PloS Pathog. 10 (4).
doi: 10.1371/journal.ppat.1004126
Cox, K., Meng, F., Wilkins, K., Li, F., Wang, P., Booher, N., et al. (2017). TAL effector
driven induction of a SWEET gene confers susceptibility to bacterial blight of cotton.
Nat. Commun. 24 (8), 15588. doi: 10.1038/ncomms15588
David, D., Godelieve, G., and Monica, H. (2013). Hormone defense networking in
rice: tales from a different world. Trends Plant Sci. 18 (10), 555–565. doi: 10.1016/
j.tplants.2013.07.002
Ebbole, D. (2007). Magnaporthe as a model for und erstanding host-pathogen
interactions. Annu.Rev.Phytopathol.45, 437–456. doi: 10.1146/annurev.phyto.
45.062806.094346
Hui, S., Shi, Y., Tian, J., Wang, L., Li, Y., Wang, S., et al. (2019). TAL-carrying
bacterial pathogens trap host nuclear import receptors for facilitation of infection of
rice. Mol. Plant Pathol. 20 (4), 519–532. doi: 10.1111/mpp.12772
Hummel, A., Doyle, E., and Bogdanove, A. (2012). Addition of transcription
activator-like effector binding sites to a pathogen strain-specific rice bacterial blight
resistance gene makes it effective against additional strains and against bacterial leaf
streak. New Phytol. 195 (4), 883–893. doi: 10.1111/j.1469-8137.2012.04216.x
Jens, B., and Ulla, B. (2010). Xanthomonas avrbs3 family-type III effectors:discovery
and function. Annu. Rev. Phytopathol. 48 (1), 419–436. doi: 10.1146/annurev-phyto-
080508-081936
Jiang, N., Yan, J., Liang, Y., Shi, Y., He, Z., Wu, Y., et al. (2020). Resistance genes and
their interactions with bacterial blight/leaf streak pathogens (Xanthomonas oryzae)in
rice (Oryza sativa l.)–an updated review. Rice 13, 3. doi: 10.1186/s12284-019-0358-y
Ke, Y., Deng, H., and Wang, S. (2017). Advances in understanding broad-spectrum
resistance to pathogens in rice. Plant J. 90 (4), 738–748. doi: 10.1111/tpj.13438
Li, M., Li, X., Zhou, Z., Wu, P., Fang, M., Pan, X., et al. (2016). Reassessment of the
four yield-related genes Gn1a,DEP1,GS3, and IPA1 in rice using a CRISPR/Cas9
system. Front. Plant Sci. 7. doi: 10.3389/fpls.2016.00377
Li, C., Wei, J., Lin, Y., and Chen, H. (2011). Gene silencing using the recessive rice
bacterial blight resistance gene xa13 as a new paradigm in plant breeding. Plant Cell
Rep. 31 (5), 851–862. doi: 10.1007/s00299-011-1206-8
Li, W., Zhu, Z., Chen, M., Yin, J., Yang, C., Ran, L., et al. (2017). A natural allele of a
transcription factor in rice confers broad-spectrum blast resistance. Cell 170 (1), 114–
126.e15. doi: 10.1016/j.cell.2017.06.008
Liu, W., Liu, J., Triplett, L., Leach, J., and Wang, G. (2014). Novel insights into rice
innate immunity against bacterial and fungal pathogens. Annu. Rev. Phytopathol. 52,
213–241. doi: 10.1146/annurev-phyto-102313-045926
Liu, , Xie, W. X., Ma, X., Li, J., Chen, J., Liu, Y.-G., et al. (2015). DSDecode: a web-
based tool for decoding of sequencing chromatograms for genotyping of targeted
mutations. Molecular Plant. 8 (9), 1431–1433. doi: 10.1016/j.molp.2015.05.009
Yang et al. 10.3389/fpls.2023.1209384
Frontiers in Plant Science frontiersin.org11

Ma, L., Zhang, D., Miao, Q., Yang, J., Xuan, Y., and Hu, Y. (2017). Essential role of
sugar transporter OsSWEET11 during the early stage of rice grain filling. Plant And Cell
Physiol. 58 (5), 863–873. doi: 10.1093/pcp/pcx040
Matsushita, A., Inoue, H., Goto, S., Nakayama, A., Sugano, S., Hayashi, N., et al.
(2013). Nuclear ubiquitin proteasome degradation affects WRKY45 function in the rice
defense program. Plant J. 73 (2), 302–313. doi: 10.1111/tpj.12035
Matthew, J., and Adam, J. (2009). A simple cipher governs DNA recognition by TAL
effectors. Science 326 (5959), 1501. doi: 10.1126/science.1178817
Nawaz,G.,Usman,B.,Peng,H.,Zhao,N.,Yuan,R.,Liu,Y.,etal.(2020).Knockoutof
pi21 by CRISPR/Cas9 and itraq-based proteomic analysis of mutants revealed new insights
into M. oryzae resistance in elite rice line. Genes 11 (7), 735. doi: 10.3390/genes11070735
Shiduku, T., Seika, M., Daisuke, T., Shoko, Y., Keiichiro, T., and Yuya, U. (2014).
Isolation of jasmonate-induced sesquiterpene synthase of rice: product of which has an
antifungal activity against Magnaporthe oryzae.J. Plant Physiol. 171 (8), 625–632.
doi: 10.1016/j.jplph.2014.01.007
Usman, B., Nawaz, G., Zhao, N., Liao, S., Qin, B., Liu, F., et al. (2021). Programmed
editing of rice (Oryza sativa l.) OsSPL16 gene using CRISPR/Cas9 improves grain yield
by modulating the expression of pyruvate enzymes and cell cycle proteins. Int. J. Mol.
Sci. 22 (1), 249. doi: 10.3390/ijms22010249
Usman, B., Nawaz, G., Zhao, N., Liu, Y., and Li, R. (2020). Generation of high
yielding and fragrant rice (Oryza sativa l.) lines by crispr/cas9 targeted mutagenesis of
three homoeologs of cytochrome P450 gene family and OsBADH2 and transcriptome
and proteome profiling of revealed changes triggered by mutations. Plants 9 (6), 788.
doi: 10.3390/plants9060788
Wilson, R., and Talbot, N. (2009). Under pressure: investigating the biology of plant infection
by Magnaporthe oryzae. Nature reviews.Microbiology 7 (3), 185–195. doi: 10.1038/nrmicro2032
Xie, X., Zheng, Y., Lu, L., Yuan, J., Hu, J., Bu, S., et al. (2021). Genome-wide
association study of QTLs conferring resistance to bacterial leaf streak in rice. Plants 10
(10), 2039. doi: 10.3390/plants10102039
Xu, X., Li, Y., Xu, Z., Yan, J., Wang, Y., Wang, Y., et al. (2022). TALE-induced
immunity against the bacterial blight pathogen Xanthomonas oryzae pv. oryzae in rice.
Phytopathol. Res. 4 (1), 47. doi: 10.1186/s42483-022-00153-x
Xu, Z., Xu, X., Gong, Q., Li, Z., Li, Y., Wang, S., et al. (2019). Engineering broad-
spectrum bacterial blight resistance by simultaneously disrupting variable tale-binding
elements of multiple susceptibility genes in rice. Mol. Plant 12 (11), 1434–1446.
doi: 10.1016/j.molp.2019.08.006
Xu, X., Xu, Z., Li, Z., Zakria, M., Zou, L., and Chen, G. (2020). Increasing resistance
to bacterial leaf streak in rice by editing the promoter of susceptibility gene
OsSULRT3;6.Plant Biotechnol. J. 19 (6), 1101–1103. doi: 10.1111/pbi.13602
Yamauchi, T., Yoshioka, M., Fukazawa, A., Mori, H., Nishizawa, N., Tsutsumi, N.,
et al. (2017). An NADPH oxidase RBOH functions in rice roots during lysigenous
aerenchyma formation under oxygen-deficient conditions. Plant Cell 29 (4), 775–790.
doi: 10.1105/tpc.16.00976
Yang, J., Luo, D., Yang, B., Formmer, W., and Emo, J. (2018). SWEET11 and 15 as
key players in seed filling in rice. New Phytol. 218 (2), 604–615. doi: 10.1111/nph.15004
Yang, D., Yang, Y., and He, Z. (2013). Roles of plant hormones and their interplay in
rice immunity. Mol. Plant 6 (3), 675–685. doi: 10.1093/mp/sst056
Zaidi, S., Mukhtar, M., and Mansoor, (2018). Genome editing: targeting
susceptibility genes for plant disease resistance. Trends In Biotechnol. 36 (9), 898–
906. doi: 10.1016/j.tibtech.2018.04.005
Zeng, D., Ma, X., Xie, X., Zhu, Q., and Liu, Y. (2018). A protocol for CRISPR/Cas9-
based multi-gene editing and sequence decoding of mutant sites in plants (in Chinese).
Sci. Sin. Vitae 48, 783–794. doi: 10.1360/N052018-00069
Zhou, Y., Xu, S., Jiang, N., Zhao, X., Bai, Z., Liu, J., et al. (2022). Engineering of rice
varieties with enhanced resistances to both blast and bacterial blight diseases via
CRISPR/Cas9. Plant Biotechnol. J. 20, 876–885. doi: 10.1111/pbi.13766
Yang et al. 10.3389/fpls.2023.1209384
Frontiers in Plant Science frontiersin.org12