Available via license: CC BY 4.0
Content may be subject to copyright.
Citation: Aseel, D.G.; Sobhy, S.; Samy,
M.A.; Hamdy, E.; Behiry, S.I.;
Abdelkhalek, A. Comparative
Analysis of the Expression Profiles of
Pathogenesis-Related Genes in
Tomato Systemically Infected with
Tobacco Mosaic and Cucumber
Mosaic Viruses. Int. J. Plant Biol. 2023,
14, 458–473. https://doi.org/
10.3390/ijpb14020035
Academic Editor: Mohammad
Anwar Hossain
Received: 23 April 2023
Revised: 15 May 2023
Accepted: 16 May 2023
Published: 17 May 2023
Copyright: © 2023 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
Article
Comparative Analysis of the Expression Profiles of
Pathogenesis-Related Genes in Tomato Systemically Infected
with Tobacco Mosaic and Cucumber Mosaic Viruses
Dalia G. Aseel 1, Sherien Sobhy 1, Marwa A. Samy 1, Esraa Hamdy 1, Said I. Behiry 2and Ahmed Abdelkhalek 1,*
1Plant Protection and Biomolecular Diagnosis Department, Arid Lands Cultivation Research Institute,
City of Scientific Research and Technological Applications, Alexandria 21934, Egypt;
daliagamil52@gmail.com (D.G.A.); sherienmorsey4@gmail.com (S.S.); smarwa201291@gmail.com (M.A.S.)
2Agricultural Botany Department, Faculty of Agriculture (Saba Basha), Alexandria University,
Alexandria 21531, Egypt
*Correspondence: aabdelkhalek@srtacity.sci.eg; Tel.: +20-10-0755-6883
Abstract:
In this study, we used RT-qPCR to examine how PR genes were expressed in model
tomato (Solanum lycopersicum L.) plants that had been infected with TMV or CMV. Under greenhouse
conditions, the indirect ELISA data showed that both viruses were detected for the first time at 6 dpi.
Then, the levels of accumulation increased very quickly, reaching a peak of 15 dpi. During the course
of the study (1–15 dpi), the Delta C
T
, NormFinder, BestKeeper, and GeNorm software tools revealed
that the
β
-actin gene was the most informative reference gene in the virally infected tomato tissues.
For both the TMV- and CMV-infected tomato plants, the transcriptional expression levels of most
tested genes changed between activation and repression, especially in the first 12 dpi. Compared
to mock-inoculated plants, the expression levels of PR-1 were induced at all time intervals except
at 8 dpi for CMV and at 6, 7, and 8 dpi for TMV infection. Conversely, the greater activation and
accumulation of both viruses were associated with the greater up-regulation of PR-2 at 8 dpi, with
relative expression levels of 7.28- and 5.84-fold for TMV and CMV, respectively. The up-regulated
expression of PR-3,PR-4, and PR-7 was shown at 4 dpi. In contrast, the PR-5 gene was inhibited in
TMV at 1 dpi until 9 dpi, and the induction of this gene at 10 dpi increased by 1.72-fold, but PR-5
was observed to up-regulate the expression of CMV at 1 dpi. This study provides the first valuable
information on the comparative transcriptional levels of these tomato genes between TMV and CMV
infections.
Keywords:
tobacco mosaic virus; cucumber mosaic virus; tomato; pathogenesis-related proteins;
RT-qPCR; gene expression
1. Introduction
Plant viruses are the most important pathogens that cause serious crop production
problems once they appear in the field [
1
,
2
]. Plant viruses are responsible for the world’s
most damaging agricultural diseases, which cost billions of dollars every year [
3
]. Tobacco
mosaic virus (TMV)—genus Tobamovirus, family Virgaviridae—is one of the most common
plant viruses that causes serious quality and crop production damage worldwide [
4
,
5
]. TMV
is a single-stranded RNA virus that infects approximately 885 plant species from 65 families,
mainly tobacco and tomato plants, as well as other members of the Solanaceae family [
4
,
5
].
TMV infection causes mosaic symptoms on the leaves as well as plant tissue yellowing. The
virus has resulted in significant economic losses all over the world [
6
]. Cucumber mosaic
virus (CMV)—genus Cucumovirus, family Bromoviridae—is one of the most damaging
and economically essential plant viruses, causing serious crop quality and productivity
problems worldwide [
6
]. It affects about 1200 species of plants in over 100 plant families
around the world, including monocots and dicots [
7
]. CMV has three single-stranded
Int. J. Plant Biol. 2023,14, 458–473. https://doi.org/10.3390/ijpb14020035 https://www.mdpi.com/journal/ijpb
Int. J. Plant Biol. 2023,14 459
linear RNAs with a positive sense (RNA-1, RNA-2, and RNA-3) that code for four viral
proteins [8].
When a pathogen attacks a plant, several signaling pathways are activated, leading
to the production of secondary metabolites and the release of antimicrobial defense pro-
teins. Pathogenesis-related (PR) proteins are a family of proteins that have been shown
to accumulate in large amounts in plants following a pathogen infection. Since they were
discovered in tobacco (Nicotiana tabacum L.) as a result of TMV infection, these proteins have
been thoroughly studied and characterized [
9
]. Upon viral infection, the plant undergoes
a series of gene expression changes, with several PR genes being induced as part of the
defense response [
9
,
10
]. PR genes are involved in plant defense against biotic stressors, and
a subset of these genes may be responsible for systemic acquired resistance to pathogens
such as plant viruses [
9
]. Based on their functions, interactions with antibodies, amino
acid sequences, number of molecules, and a few other factors, Linthorst and Van Loon [
11
]
classified PR proteins into different categories. Because they are either extremely acidic or
extremely basic, PR proteins are highly soluble and, as a result, reactive. At least 14 different
protein families belong to the PR category. Most of these have known functions or activities:
for example, PR-2 is a
β
-1,3-glucanase; PR-3,-4,-8, and -11 are different types of chitinase;
PR-5 is a thaumatin-like protein; PR-6 is a proteinase inhibitor; PR-7 is an endoproteinase;
PR-9 is a peroxidase; PR-10 is a ribonuclease; PR-12 is a defensin; PR-13 is a thionin; and
PR-14 is a lipid-transfer protein [
12
]. There are often a large number of isoforms of each PR
protein present in the diverse host plants.
Real-time quantitative polymerase chain reaction (RT-qPCR) has been shown to be
a good way to measure gene expression in many situations, including those involving
plant viruses [
13
]. This is because it is sensitive, accurate, and repeatable when it comes
to detecting small amounts of RNA molecules. However, the results are only reliable if
they have been normalized using a reference gene that is expressed the same way in all
tissues and experimental conditions. Housekeeping genes are thus good candidates for
universal internal controls. As a result, if an inappropriate reference gene is used, then
the reliability and accuracy of RT-qPCR are compromised [
14
,
15
]. For the purpose of this
study, we evaluated the stability of three potential housekeeping genes (EF1-
α
,18S rRNA,
and
β
-actin) in a TMV and/or CMV tomato infection, grading their reliability as internal
controls. Additionally, we examined how six tomato PR genes (PR-1,PR-2,PR-3,PR-4,
PR-5, and PR-7) were expressed differently between TMV-infected, CMV-infected, and
mock-inoculated samples every day for 15 days after infection (1–15 dpi) to compare and
study how the plants reacted to the two viruses.
2. Materials and Methods
2.1. Sources of Tomato Seeds and Viruses
The Egyptian Agriculture Research center provided the virus-free tomato (Solanum
lycopersicum L.) seeds of the Carmen F1 variety, which is susceptible to viral infection.
In addition, two purified viral isolates (TMV; accession number MG264131 and CMV;
accession number MN594112) were utilized as viral inoculums [16,17].
2.2. Greenhouse Experimental Design, Mechanical Inoculation and Sample Collection
The tomato seeds were sterilized in a controlled environment and then grown in
sterile vermiculite pots. After 28 days of growth, the seedlings were moved to other pots.
Each pot (20 cm) contained 3 kg of autoclave-sterilized sand and clay (1:1). After a week,
each plant’s top two true leaves were mechanically inoculated with 0.5 mL of 20
µ
g/mL
freshly prepared TMV or CMV [
18
]. The experiment was carried out over three treatments
(Figure 1). The first treatment (mock) was the control treatment, in which tomato plants
were inoculated with viral inoculation buffer. The second treatment was tomato plants
inoculated with TMV. The third treatment was tomato plants inoculated with CMV. Each
treatment consisted of five pots (five biological replicates), and each pot contained five
tomato plants. All the plants were kept in the greenhouse at a temperature of 28/16
◦
C
Int. J. Plant Biol. 2023,14 460
day and night with a relative humidity of 65%. The CMV and TMV symptoms were
observed on each day. The tomato leaves (not mechanically inoculated) were collected daily
from 0 to 15 dpi and then subjected to further analyses (ELISA and RNA extraction). The
independent biological replicate of each treatment was a pool of 15 tomato leaves that were
collected from five plants, with three leaves per plant, grown in each pot. Each biological
replicate was tested in three independent technical replicates for reliability.
Int. J. Plant Biol. 2023, 14, FOR PEER REVIEW 3
with TMV. The third treatment was tomato plants inoculated with CMV. Each treatment
consisted of ve pots (ve biological replicates), and each pot contained ve tomato
plants. All the plants were kept in the greenhouse at a temperature of 28/16 °C day and
night with a relative humidity of 65%. The CMV and TMV symptoms were observed on
each day. The tomato leaves (not mechanically inoculated) were collected daily from 0 to
15 dpi and then subjected to further analyses (ELISA and RNA extraction). The independ-
ent biological replicate of each treatment was a pool of 15 tomato leaves that were collected
from ve plants, with three leaves per plant, grown in each pot. Each biological replicate
was tested in three independent technical replicates for reliability.
Figure 1. A schematic diagram summarizing the experimental study.
2.3. Detection of TMV or CMV by Enzyme-Linked Immunosorbent Assay
The indirect enzyme-linked immunosorbent assay (I-ELISA) was used to detect the
viral infection in the collected samples as previously described [19]. An absorbance at 405
nm was used as the unit of measurement for the ELISA results. If the absorbance value of
the sample was double the threshold value of the healthy control samples, then it was said
that there were viruses in the sample.
2.4. RNA Extraction and cDNA Synthesis
Total RNA was isolated from tomato leaves (100 mg fresh weight) using the RNeasy
Plant Mini Kit (QIAGEN, Hilden, Germany), as recommended by the supplier. UV–Vis
spectroscopy was used to determine the purity and quantity of the isolated RNA (EM-
CLAB Instruments GmbH, Duisburg, Germany). The RNA integrity was assessed by vis-
ualizing the quality of the isolated RNA via 1.2% agarose gel electrophoresis. For each
sample, 1 µg of DNase-I-treated RNA was used as a template for cDNA synthesis using a
reverse transcriptase enzyme (M-MuLV Reverse Transcriptase, Biolabs, New England,
Figure 1. A schematic diagram summarizing the experimental study.
2.3. Detection of TMV or CMV by Enzyme-Linked Immunosorbent Assay
The indirect enzyme-linked immunosorbent assay (I-ELISA) was used to detect the
viral infection in the collected samples as previously described [
19
]. An absorbance at
405 nm was used as the unit of measurement for the ELISA results. If the absorbance value
of the sample was double the threshold value of the healthy control samples, then it was
said that there were viruses in the sample.
2.4. RNA Extraction and cDNA Synthesis
Total RNA was isolated from tomato leaves (100 mg fresh weight) using the RNeasy
Plant Mini Kit (QIAGEN, Hilden, Germany), as recommended by the supplier. UV–Vis
spectroscopy was used to determine the purity and quantity of the isolated RNA (EMCLAB
Instruments GmbH, Duisburg, Germany). The RNA integrity was assessed by visualizing
the quality of the isolated RNA via 1.2% agarose gel electrophoresis. For each sample,
1
µ
g of DNase-I-treated RNA was used as a template for cDNA synthesis using a reverse
transcriptase enzyme (M-MuLV Reverse Transcriptase, Biolabs, New England, Ipswich,
MA, USA) with oligo (dT) and random hexamer primers. The RT-PCR reaction was carried
out in 20
µ
L and programmed at 42
◦
C for 1 h, followed by a deactivation step at 80
◦
C for
5 min. The cDNA was then stored at −20 ◦C until used in RT-qPCR.
Int. J. Plant Biol. 2023,14 461
2.5. Normalization and Standardization of the Housekeeping Genes
Three housekeeping genes were tested during the post-viral infection time course
to identify the most stably expressed reference gene(s) in virally infected tomato plants:
β
-actin, elongation factor 1-
α
(EF1-
α
), and the 18S rRNA. The data were analyzed using
four different programs: the Delta C
T
method (https://toptipbio.com/delta-delta-ct-qpcr;
accessed on 1 January 2023), NormFinder (https://moma.dk/normfinder-software;
accessed on 2 January 2023), BestKeeper (https://www.gene-quantification.de/bestkeeper.
html; accessed on 2 January 2023), and GeNorm (https://genorm.cmgg; accessed on 3
January 2023).
2.6. RT-qPCR Assay
Six different PR genes (PR-1,PR-2,PR-3,PR-4,PR-5, and PR-7) were tested in this
investigation. Table 1displays the primer sequences. A total of 20
µ
L of a combination
containing 1
µ
L of each primer at 10 pmol/
µ
L, 1
µ
L of template cDNA, 10
µ
L of 2xSYBR
Green PCR Master Mix, and 7
µ
L of nuclease-free water were used for the RT-qPCR reaction.
Three independent replicates of each sample were run on the Rotor-Gene 6000 (QIAGEN,
ABI System, Miami, FL, USA). The thermal cycling amplification technique included a
10 min denaturation at 95 ◦C, then 40 cycles of 15 s denaturation at the same temperature,
30 s annealing at 60
◦
C, and 30 s extension at 72
◦
C. After 40 cycles, melting curves were
obtained to filter out any non-specific products. The qPCR efficiency was measured for
each gene and was between 93% and 100% for all genes. The melting curve study at
temperatures between 55 and 95 ◦C showed only one amplified product for all genes.
Table 1. Nucleotide sequences of PR gene primers used in this study.
Gene
Name Specific Class Accession
Number Nucleotide Sequence (50-30) Reference
PR-1 Pathogenesis related protein-1 AJ011520 Forward: CCAAGACTATCTTGCGGTTC
Reverse: GAACCTAAGCCACGATACCA [20]
PR-2 β-1, 3-glucanases M80604 Forward: TATAGCCGTTGGAAACGAAG
Reverse: CAACTTGCCATCACATTCTG
PR-3 Chitinase AF043248 Forward: ACTGGAGGATGGGCTTCAGCA
Reverse: TGGATGGGGCCTCGTCCGAA [21]
PR-4 Chitin-binding proteins
Classes I (hevein-like domain)
Forward: GACAACAATGCGGTCGTCAAGG
Reverse: AGCATGTTTCTGGAATCAGGCTG [22]
PR-5 Thaumatin-Like Protein X67244F Forward: ATGGGGTAAACCACCAAACA
Reverse: GTTAGTTGGGCCGAAAGACA [23]
PR-7 Endoproteinase Y17275 Forward: AACTGCAGAACAAGTGAAGG
Reverse: AACGTGATTGTAGCAACAGG [24]
β-actin Housekeeping gene BT013707 Forward: AGGCAGGATTTGCTGGTGATGATGCT
Reverse: ATACGCATCCTTCTGTCCCATTCCGA
[25]
EF1-αHousekeeping gene AB061263 Forward: ATTGGAAATGGATATGCTCCA
Reverse: TCCTTACCTGAACGCCTGTCA
18S
rRNA Housekeeping gene X51576 Forward: GGGCATTCGTATTTCATAGTCAGA
Reverse: GTTCTTGATTAATGAAAACATCCT
2.7. RT-qPCR Data Analysis
To figure out the relative expression ratio, the method created by Livak and Schmittgen [
26
]
was used. With the use of an automated threshold analysis using the Applied Biosystems
Integrated (ABI) system, we were able to calculate the C
T
(threshold of cycle) value for each
Int. J. Plant Biol. 2023,14 462
gene. The equations show the mathematical model of the relative expression ratio to be
obtained, where:
∆CT target = (CT target −CT reference), ∆CT control = (CT control −CT reference)
The equations show the mathematical model of the relative gene expression level ratio
to be obtained, where:
∆∆CT expression = (∆CT target −∆CT control), accordingly 2−∆ ∆CTalgorithm.
2.8. Statistical Analysis
Using the CoStat program, we performed a one-way analysis of variance (ANOVA)
on the relative expression of three biological replicates for each time, and we used post hoc
Tukey’s honest differences (HSD) to distinguish between means at the p
≤
0.05 level. The
relative expression levels with the most statistically significant differences were plotted,
and the standard deviation (
±
SD) is shown as a column bar. If the value was more than
one, then it meant that gene expression was being turned up (up-regulated), and if it was
less than one, then it meant that expression was being turned down (down-regulated).
3. Results and Discussion
3.1. Symptoms Development and Virus Detection
Under greenhouse conditions, both TMV- and CMV-infected tomato plants displayed
multiple morphological changes. Similar to previous reports [
27
,
28
], the development of
systemic mosaic with chlorosis symptoms on TMV tomato leaves was reported at 11 dpi.
On the other hand, early CMV symptoms were noticed at 13 dpi. At 14 dpi, all the TMV-
inoculated plants showed severe TMV-like symptoms such as mosaic, leaf deformation,
and thickness on some tomato leaves (Figure 2B). On the other hand, at 16 dpi, all of the
plants that had been infected with CMV showed severe symptoms such as mottling, mosaic,
yellowing, and flecks of dead tissue (Figure 2C). The viral infections had a significant effect
on leaf morphogenesis, which changed the shape of the leaves and slowed the growth
of the whole plant [
29
,
30
]. An I-ELISA assay (Table 2) revealed that the first detection of
viral infections was at 6 dpi for both TMV and CMV infection. Then, there was a dramatic
increase in the accumulation levels, reaching a maximum of 15 dpi. No virus was detected
in the mock-inoculated samples. The obtained results support previous studies, which
showed that a viral infection might be detected in the early stages of an infected potato
plant or other differential hosts [31,32].
Int. J. Plant Biol. 2023, 14, FOR PEER REVIEW 5
2.7. RT-qPCR Data Analysis
To gure out the relative expression ratio, the method created by Livak and
Schmigen [26] was used. With the use of an automated threshold analysis using the Ap-
plied Biosystems Integrated (ABI) system, we were able to calculate the CT (threshold of
cycle) value for each gene. The equations show the mathematical model of the relative
expression ratio to be obtained, where:
ΔCT target = (CT target − CT reference), ΔCT control = (CT control − CT reference)
The equations show the mathematical model of the relative gene expression level ra-
tio to be obtained, where:
ΔΔCT expression = (ΔCT target − ΔCT control), accordingly 2−ΔΔCT algorithm.
2.8. Statistical Analysis
Using the CoStat program, we performed a one-way analysis of variance (ANOVA)
on the relative expression of three biological replicates for each time, and we used post
hoc Tukey’s honest dierences (HSD) to distinguish between means at the p ≤ 0.05 level.
The relative expression levels with the most statistically signicant dierences were plot-
ted, and the standard deviation (±SD) is shown as a column bar. If the value was more
than one, then it meant that gene expression was being turned up (up-regulated), and if it
was less than one, then it meant that expression was being turned down (down-regulated).
3. Results and Discussion
3.1. Symptoms Development and Virus Detection
Under greenhouse conditions, both TMV- and CMV-infected tomato plants dis-
played multiple morphological changes. Similar to previous reports [27,28], the develop-
ment of systemic mosaic with chlorosis symptoms on TMV tomato leaves was reported at
11 dpi. On the other hand, early CMV symptoms were noticed at 13 dpi. At 14 dpi, all the
TMV-inoculated plants showed severe TMV-like symptoms such as mosaic, leaf defor-
mation, and thickness on some tomato leaves (Figure 2B). On the other hand, at 16 dpi, all
of the plants that had been infected with CMV showed severe symptoms such as moling,
mosaic, yellowing, and ecks of dead tissue (Figure 2C). The viral infections had a signif-
icant eect on leaf morphogenesis, which changed the shape of the leaves and slowed the
growth of the whole plant [29,30]. An I-ELISA assay (Table 2) revealed that the rst detec-
tion of viral infections was at 6 dpi for both TMV and CMV infection. Then, there was a
dramatic increase in the accumulation levels, reaching a maximum of 15 dpi. No virus was
detected in the mock-inoculated samples. The obtained results support previous studies,
which showed that a viral infection might be detected in the early stages of an infected
potato plant or other dierential hosts [31,32].
Figure 2.
Overview of tomato plants showing TMV and CMV symptoms under greenhouse con-
ditions at 14 days post-viral infection. (
A
) Tomato control plants; (
B
) TMV-infected tomato plants;
(C) CMV-infected tomato plants.
Int. J. Plant Biol. 2023,14 463
Table 2.
Indirect ELISA detection of TMV or CMV in a 1:10 dilution of sap extracted from inoculated
tomato plants collected at different time intervals (1:15 dpi).
Days Post-Inoculation (dpi)
Absorbance ELISA Values at 405 nm
TMV CMV
ELISA Value Result ELISA Value Result
1 0.212 ±0.024 - 0.208 ±0.035 -
2 0.223 ±0.037 - 0.217 ±0.029 -
3 0.243 ±0.049 - 0.255 ±0.041 -
4 0.267 ±0.019 - 0.287 ±0.052 -
5 0.347 ±0.027 - 0.315 ±0.063 -
6 0.424 ±0.036 + 0.417 ±0.043 +
7 0.517 ±0.044 + 0.491 ±0.079 +
8 0.580 ±0.025 + 0.538 ±0.095 +
9 0.654 ±0.068 + 0.576 ±0.082 +
10 0.750 ±0.024 + 0.638 ±0.076 +
11 0.808 ±0.043 + 0.781 ±0.097 +
12 0.926 ±0.079 + 0.856 ±0.081 +
13 0.997 ±0.087 + 0.894 ±0.099 +
14 1.174 ±0.089 + 0.975 ±0.098 +
15 1.561 ±0.103 + 1.269 ±0.111 +
Mock-inoculated plants (healthy)
0.187 ±0.011 - 0.187 ±0.011 -
3.2. Determination and Standardization of the Housekeeping Genes
In order to provide an overview of the relative abundance of the three reference
(housekeeping) genes in tomatoes, we determined cycle threshold (C
T
) values for all of these
genes under both TMV and CMV infections (Supplementary Figure S1). The C
T
values for
EF1-
α
and 18S rRNA greatly fluctuated, with a difference between the largest and smallest
values of about 60% for 18S rRNA and 48% for EF-1
α
. Even though there was little
β
-actin C
T
fluctuation observed, the difference between the largest and smallest values did not exceed
4%, and it had the lowest standard error of all samples
(Figures 3and 4
). This provided the
necessary evidence that
β
-actin could be used appropriately as an internal control in the
downstream gene expression analyses of TMV and/or CMV tomato infection. The stability
of the housekeeping genes was demonstrated in four distinct ways (
Figures 3and 4
). Based
on the data analysis, it was determined that actin exhibited the highest level of gene
expression stability.
The obtained results are consistent with those of Mascia et al. [
25
], who reported that
β
-actin was one of the four least stable genes throughout virally infected tomato tissues. In
RT-qPCR assays, the two housekeeping genes (18S rRNA and EF1-
α
) are typically used as
reference genes [
33
], and 18S rRNA has been shown to be suitable for normalization in cere-
als infected with the barley yellow dwarf virus [
34
]. Even though EF1-
α
was sequentially
rated by the GeNorm analysis, the performance of EF1-
α
and 18S rRNA was inadequate [
35
].
Additionally, our findings are in line with previous research in virus-infected tomatoes,
which found highly varied levels of expression for both 18S rRNA and EF1-
α
[
25
]. On the
other hand, the incorrect use of invalidated reference genes might introduce bias into the
research and lead to data misinterpretation [
36
]. Nevertheless, precise transcript normaliza-
tion using stably expressed reference genes at diverse biological and physiological states is
required for an accurate target gene expression analysis [
37
]. The data for the melt curve
analysis and standard curves developed for each potential reference gene were included in
the study, as well as a set of primers constructed for the ten candidate genes. In the future,
this information can be used to choose one reference gene for use in normalizing RT-qPCR
data related to tomato–virus interactions [38].
Int. J. Plant Biol. 2023,14 464
Int. J. Plant Biol. 2023, 14, FOR PEER REVIEW 7
reference gene were included in the study, as well as a set of primers constructed for the
ten candidate genes. In the future, this information can be used to choose one reference
gene for use in normalizing RT-qPCR data related to tomato–virus interactions [38].
Figure 3. The four dierent methods used to evaluate the gene expression stability levels of house-
keeping genes in healthy, TMV-, and CMV-infected tomato plants. The Delta CT method,
NormFinder, and BestKeeper (as is harbored by β-actin) indicates more stable gene expression. Av-
erage gene stability values (M value) across all treatment groups using GeNorm revealed more sta-
ble β-actin and EF-1α genes. The values in the columns represent the means of ve independent
biological samples, while the error bars show the standard deviation (SD). According to Tukey’s
HSD test (p ≤ 0.05), the values in the columns labeled with the same leer (a, b, and c) do not dier
statistically.
Figure 4. Comprehensive gene expression stability levels of three housekeeping genes (β-actin, EF-
1α, and 18S rRNA) in healthy, TMV-, and CMV-infected leaf tissue samples of tomato plants. Statis-
tically, there is no signicant change between the means of the columns that start with the same
leer.
Figure 3.
The four different methods used to evaluate the gene expression stability levels of house-
keeping genes in healthy, TMV-, and CMV-infected tomato plants. The Delta C
T
method, NormFinder,
and BestKeeper (as is harbored by
β
-actin) indicates more stable gene expression. Average gene
stability values (M value) across all treatment groups using GeNorm revealed more stable
β
-actin and
EF-1
α
genes. The values in the columns represent the means of five independent biological samples,
while the error bars show the standard deviation (SD). According to Tukey’s HSD test (p
≤
0.05), the
values in the columns labeled with the same letter (a, b, and c) do not differ statistically.
Int. J. Plant Biol. 2023, 14, FOR PEER REVIEW 7
reference gene were included in the study, as well as a set of primers constructed for the
ten candidate genes. In the future, this information can be used to choose one reference
gene for use in normalizing RT-qPCR data related to tomato–virus interactions [38].
Figure 3. The four dierent methods used to evaluate the gene expression stability levels of house-
keeping genes in healthy, TMV-, and CMV-infected tomato plants. The Delta CT method,
NormFinder, and BestKeeper (as is harbored by β-actin) indicates more stable gene expression. Av-
erage gene stability values (M value) across all treatment groups using GeNorm revealed more sta-
ble β-actin and EF-1α genes. The values in the columns represent the means of ve independent
biological samples, while the error bars show the standard deviation (SD). According to Tukey’s
HSD test (p ≤ 0.05), the values in the columns labeled with the same leer (a, b, and c) do not dier
statistically.
Figure 4. Comprehensive gene expression stability levels of three housekeeping genes (β-actin, EF-
1α, and 18S rRNA) in healthy, TMV-, and CMV-infected leaf tissue samples of tomato plants. Statis-
tically, there is no signicant change between the means of the columns that start with the same
leer.
Figure 4.
Comprehensive gene expression stability levels of three housekeeping genes (
β
-actin,EF-1
α
,
and 18S rRNA) in healthy, TMV-, and CMV-infected leaf tissue samples of tomato plants. Statistically,
there is no significant change between the means of the columns that start with the same letter.
3.3. RT-qPCR Analysis of Pathogenesis-Related (PR) Gene Expressions
There have been a number of studies that point to pathogenesis-related proteins
(PR) as the proteins that are responsible for systemic acquired resistance (SAR), as well
as the proteins that are effective at halting the progression, multiplication, or spread of
pathogens [
27
,
35
,
39
]. In the current study, both TMV and CMV infections induced the
expression of PR-1 at almost identical time intervals (Figure 5). The highest transcriptional
levels of PR-1 were observed in TMV-infected tomato plants at 1, 2, 4, 5, 9, and 15 dpi, with
Int. J. Plant Biol. 2023,14 465
levels 2.93-fold, 2.92-fold, 2.09-fold, 4.79-fold, and 2.30-fold, and 1.99-fold, respectively,
higher than the control. On the other hand, the higher gene expression of CMV-infected
tomato plants was shown at 1, 2, 4, 6, 7, 10, and 11 dpi, with the relative expression being
2.80-fold, 3.37-fold, 4.35-fold, 2.50-fold, 4.84-fold, 2.10-fold, and 3.44-fold, respectively,
greater than the control. These results agree with those of ElMorsi et al. [
35
], who reported
that the PR-1 gene was quickly induced or up-regulated during the early stages of an
onion plant with IYSV infection, and it was continuously expressed in onion tissues.
Additionally, similar results here agree with Cutt et al. [40], who found that PR-1 proteins
in tobacco were associated with viral resistance. Similar results indicated that the induction
of PR-1 at 2 dpi appeared to reflect the early activation of SA biosynthesis in PVY-infected
potato tissues [
41
]. On the other hand, the PR-1 gene expression decreased at 6, 7, and
8 dpi (
0.81-fold
,
0.99-fold
, and 0.90-fold, respectively) in the TMV-infected tomato plants
compared with the CMV-infected tomato plants, where the down-regulation of the gene
expression occurred at 8 dpi only (Figure 5). These data suggest that the tomato PR-1 is not
sufficient for resistance to TMV or CMV. Plants synthesize different PR-1 proteins and have
different ways of fighting off various plant pathogens [
42
,
43
]. Many studies have found
that the increased expression of PR-1 in transgenic plants is linked to increased resistance
to bacteria, fungi, and oomycetes, but not to viruses [
44
,
45
]. According to the findings
of this study, the relative gene expression of PR-1 may be associated with a response to
viral infection.
Int. J. Plant Biol. 2023, 14, FOR PEER REVIEW 8
3.3. RT-qPCR Analysis of Pathogenesis-Related (PR) Gene Expressions
There have been a number of studies that point to pathogenesis-related proteins (PR)
as the proteins that are responsible for systemic acquired resistance (SAR), as well as the
proteins that are eective at halting the progression, multiplication, or spread of patho-
gens [27,35,39]. In the current study, both TMV and CMV infections induced the expres-
sion of PR-1 at almost identical time intervals (Figure 5). The highest transcriptional levels
of PR-1 were observed in TMV-infected tomato plants at 1, 2, 4, 5, 9, and 15 dpi, with levels
2.93-fold, 2.92-fold, 2.09-fold, 4.79-fold, and 2.30-fold, and 1.99-fold, respectively, higher
than the control. On the other hand, the higher gene expression of CMV-infected tomato
plants was shown at 1, 2, 4, 6, 7, 10, and 11 dpi, with the relative expression being 2.80-
fold, 3.37-fold, 4.35-fold, 2.50-fold, 4.84-fold, 2.10-fold, and 3.44-fold, respectively, greater
than the control. These results agree with those of ElMorsi et al. [35], who reported that
the PR-1 gene was quickly induced or up-regulated during the early stages of an onion
plant with IYSV infection, and it was continuously expressed in onion tissues. Addition-
ally, similar results here agree with Cu et al. [40], who found that PR-1 proteins in to-
bacco were associated with viral resistance. Similar results indicated that the induction of
PR-1 at 2 dpi appeared to reect the early activation of SA biosynthesis in PVY-infected
potato tissues [41]. On the other hand, the PR-1 gene expression decreased at 6, 7, and 8
dpi (0.81-fold, 0.99-fold, and 0.90-fold, respectively) in the TMV-infected tomato plants
compared with the CMV-infected tomato plants, where the down-regulation of the gene
expression occurred at 8 dpi only (Figure 5). These data suggest that the tomato PR-1 is
not sucient for resistance to TMV or CMV. Plants synthesize dierent PR-1 proteins and
have dierent ways of ghting o various plant pathogens [42,43]. Many studies have
found that the increased expression of PR-1 in transgenic plants is linked to increased
resistance to bacteria, fungi, and oomycetes, but not to viruses [44,45]. According to the
ndings of this study, the relative gene expression of PR-1 may be associated with a re-
sponse to viral infection.
Figure 5. Comparison between the relative transcriptional levels of the tomato PR-1 gene in TMV-
and CMV-infected tissues compared to control at 1 to 15 dpi. The columns show the mean value
from ve biological replicates, and the bars represent the standard deviation (SD). Means were dis-
tinguished using Tukey’s HSD test at p ≤ 0.05 levels, and small leers are used to represent dier-
ences. Columns of data showing dierent leers are signicant.
Figure 5.
Comparison between the relative transcriptional levels of the tomato PR-1 gene in TMV- and
CMV-infected tissues compared to control at 1 to 15 dpi. The columns show the mean value from five
biological replicates, and the bars represent the standard deviation (SD). Means were distinguished
using Tukey’s HSD test at p
≤
0.05 levels, and small letters are used to represent differences. Columns
of data showing different letters are significant.
The PR-2 gene in tomato plants infected with TMV or CMV showed significant tran-
scriptional levels at 8 dpi, with levels of 7.28-fold and 5.84-fold, respectively, as compared
to uninfected tomato plants. The expression level was down-regulated at the first three
days of TMV infection, with relative expression level changes of 0.7-fold, 0.97-fold, and
0.81-fold, respectively. On the other hand, compared to the control, the CMV-infected
tomato plants showed up-regulation at all days post-infection (Figure 6). Therefore, we
hypothesized that the PR-2 gene was related to viral infection. The PR-2 gene, which codes
for a 1,3-glucanase, plays a role in the cell-to-cell spread of virus movement complexes by
limiting callose accumulation around the plasmodesmata [
46
]. TMV is thought to increase
Int. J. Plant Biol. 2023,14 466
tobacco activation for PR-2 genes, allowing it to move more easily into cells [
47
]. Our
findings are in agreement with the previous studies that reported a clear induction of PR-2
during viral infections in Arabidopsis, tobacco, potato, onion and tomato plants [
35
,
48
,
49
].
Furthermore, lowering tobacco PR-2 reduces susceptibility to viral infection [
50
]. Moreover,
the reduction in tobacco PR-2 expression decreased viral infection susceptibility, whereas
overexpression increased potato virus Y movement across cells [
51
,
52
]. Although PR-1
expression is the most commonly utilized as a marker for resistance response after viral
infection, it has been demonstrated that PR-2 is elevated in response to viral infection in
tobacco leaves [53].
Int. J. Plant Biol. 2023, 14, FOR PEER REVIEW 9
The PR-2 gene in tomato plants infected with TMV or CMV showed signicant tran-
scriptional levels at 8 dpi, with levels of 7.28-fold and 5.84-fold, respectively, as compared
to uninfected tomato plants. The expression level was down-regulated at the rst three
days of TMV infection, with relative expression level changes of 0.7-fold, 0.97-fold, and
0.81-fold, respectively. On the other hand, compared to the control, the CMV-infected to-
mato plants showed up-regulation at all days post-infection (Figure 6). Therefore, we hy-
pothesized that the PR-2 gene was related to viral infection. The PR-2 gene, which codes
for a 1,3-glucanase, plays a role in the cell-to-cell spread of virus movement complexes by
limiting callose accumulation around the plasmodesmata [46]. TMV is thought to increase
tobacco activation for PR-2 genes, allowing it to move more easily into cells [47]. Our nd-
ings are in agreement with the previous studies that reported a clear induction of PR-2
during viral infections in Arabidopsis, tobacco, potato, onion and tomato plants [35,48,49].
Furthermore, lowering tobacco PR-2 reduces susceptibility to viral infection [50]. Moreo-
ver, the reduction in tobacco PR-2 expression decreased viral infection susceptibility,
whereas overexpression increased potato virus Y movement across cells [51,52]. Although
PR-1 expression is the most commonly utilized as a marker for resistance response after
viral infection, it has been demonstrated that PR-2 is elevated in response to viral infection
in tobacco leaves [53].
Figure 6. Comparison between the relative transcriptional levels of the tomato PR-2 gene in TMV-
and CMV-infected tissues compared to control at 1 to 15 dpi. The columns show the mean value
from ve biological replicates, and the bars represent the standard deviation (SD). Means were dis-
tinguished using Tukey’s HSD test at p ≤ 0.05 levels, and small leers are used to represent dier-
ences. Columns of data showing dierent leers are signicant.
The PR-3 family of proteins includes chitinases, which are responsible for catalyzing
the hydrolysis of chitin [39,54]. Chitinases are mainly involved in the organism’s defense
against pathogen aack in both animals and plants [55]. The present study showed that
PR-3 gene expression was rapidly induced following the TMV infection of tomato plants,
increasing from 1.45-fold at 1 dpi to 4-fold at 8 dpi (Figure 7). Conversely, PR-3 was down-
regulated at 11 and 12 dpi, with a relative expression level about 0.53-fold lower than the
control (Figure 7). On the other hand, PR-3 was induced in most of the CMV-infected to-
mato plants, with the highest relative expression levels being 4.90-, 4.07-, and 4.26-fold
higher than the control at 4, 9, and 14 dpi, respectively (Figure 7). These results are the
Figure 6.
Comparison between the relative transcriptional levels of the tomato PR-2 gene in TMV-
and CMV-infected tissues compared to control at 1 to 15 dpi. The columns show the mean value
from five biological replicates, and the bars represent the standard deviation (SD). Means were
distinguished using Tukey’s HSD test at p
≤
0.05 levels, and small letters are used to represent
differences. Columns of data showing different letters are significant.
The PR-3 family of proteins includes chitinases, which are responsible for catalyzing
the hydrolysis of chitin [
39
,
54
]. Chitinases are mainly involved in the organism’s defense
against pathogen attack in both animals and plants [
55
]. The present study showed that
PR-3 gene expression was rapidly induced following the TMV infection of tomato plants,
increasing from 1.45-fold at 1 dpi to 4-fold at 8 dpi (Figure 7). Conversely, PR-3 was down-
regulated at 11 and 12 dpi, with a relative expression level about 0.53-fold lower than the
control (Figure 7). On the other hand, PR-3 was induced in most of the CMV-infected
tomato plants, with the highest relative expression levels being 4.90-, 4.07-, and 4.26-fold
higher than the control at 4, 9, and 14 dpi, respectively (Figure 7). These results are the
same as those of Abdelkhalek et al. [
56
], who found that PR-3 accumulated in the first
few days after a viral infection and became more active and higher until it reached its
highest level at 4 days post-infection, which was 4.64-fold higher than in the control group.
Additionally, the present findings agree with those of earlier research on the activation
of chitinases in response to viral infections [
57
,
58
]. It has also been discovered that the
infection caused by a pathogen boosts the naturally occurring production of enzymes that
hydrolyze chitin [
55
,
59
–
61
]. On the other hand, it was seen that Setaria viridis at 10 days
post-viral infection had a substantial reduction in PR-3 expression [
62
]. Such a down-
Int. J. Plant Biol. 2023,14 467
regulation or decreased PR-3 expression level may be due to viral suppressor activity or
cellular damage [56].
Int. J. Plant Biol. 2023, 14, FOR PEER REVIEW 10
same as those of Abdelkhalek et al. [56], who found that PR-3 accumulated in the rst few
days after a viral infection and became more active and higher until it reached its highest
level at 4 days post-infection, which was 4.64-fold higher than in the control group. Addi-
tionally, the present ndings agree with those of earlier research on the activation of chi-
tinases in response to viral infections [57,58]. It has also been discovered that the infection
caused by a pathogen boosts the naturally occurring production of enzymes that hydro-
lyze chitin [55,59–61]. On the other hand, it was seen that Setaria viridis at 10 days post-
viral infection had a substantial reduction in PR-3 expression [62]. Such a down-regulation
or decreased PR-3 expression level may be due to viral suppressor activity or cellular
damage [56].
Figure 7. Comparison between the relative transcriptional levels of the tomato PR-3 gene in TMV-
and CMV-infected tissues compared to control at 1 to 15 dpi. The columns show the mean value
from ve biological replicates, and the bars represent the standard deviation (SD). Means were dis-
tinguished using Tukey’s HSD test at p ≤ 0.05 levels, and small leers are used to represent dier-
ences. Columns of data showing dierent leers are signicant.
The PR-4 protein family is classied as chitinases [39] and can be linked with a chitin-
binding domain, also known as the hevein-like domain. This relationship distinguishes
PR-4 classes I (presence of a hevein-like domain) and II (absence of a hevein-like domain)
[63,64]. However, other reports have shown its RNase activity [65] or nuclease activity
[66]. In this study, the results revealed that PR-4 (class I) was induced after three days of
both viral infection and then increased, reaching maximum expression levels of 4.62-fold
at 8 dpi in TMV-infected plants and 2.26-fold at 4 dpi in CMV-infected plants when com-
pared to the control (Figure 8). Compared to the TMV-infected plant prole, the CMV-
infected plants exhibited lower levels of PR-4 expression, either through down-regulation
at 1, 2, 6, and 7 dpi or up-regulation at 3, 4, 5, 8, 9, 10, 14, and 15 dpi (Figure 8). Thus, the
expression prole of PR-4 may depend on the type of viral infection. The outcomes ob-
tained are consistent with those that Wang et al. [67] reported. They stated that the TMV-
infection-induced tobacco plants expressed PR-4 at moderate levels. It was reported that
the increased overexpression of the PR-4 gene in Vitis vinifera led to improved resistance
to infection by powdery mildew [68]. As a result, we hypothesized that PR-4 might not be
associated with TMV or CMV resistance.
Figure 7.
Comparison between the relative transcriptional levels of the tomato PR-3 gene in TMV-
and CMV-infected tissues compared to control at 1 to 15 dpi. The columns show the mean value
from five biological replicates, and the bars represent the standard deviation (SD). Means were
distinguished using Tukey’s HSD test at p
≤
0.05 levels, and small letters are used to represent
differences. Columns of data showing different letters are significant.
The PR-4 protein family is classified as chitinases [
39
] and can be linked with a chitin-
binding domain, also known as the hevein-like domain. This relationship distinguishes PR-
4classes I (presence of a hevein-like domain) and II (absence of a hevein-like domain) [
63
,
64
].
However, other reports have shown its RNase activity [
65
] or nuclease activity [
66
]. In this
study, the results revealed that PR-4 (class I) was induced after three days of both viral
infection and then increased, reaching maximum expression levels of 4.62-fold at 8 dpi in
TMV-infected plants and 2.26-fold at 4 dpi in CMV-infected plants when compared to the
control (Figure 8). Compared to the TMV-infected plant profile, the CMV-infected plants
exhibited lower levels of PR-4 expression, either through down-regulation at 1, 2, 6, and
7 dpi or up-regulation at 3, 4, 5, 8, 9, 10, 14, and 15 dpi (Figure 8). Thus, the expression
profile of PR-4 may depend on the type of viral infection. The outcomes obtained are
consistent with those that Wang et al. [
67
] reported. They stated that the TMV-infection-
induced tobacco plants expressed PR-4 at moderate levels. It was reported that the increased
overexpression of the PR-4 gene in Vitis vinifera led to improved resistance to infection by
powdery mildew [
68
]. As a result, we hypothesized that PR-4 might not be associated with
TMV or CMV resistance.
Concerning PR-5, it encodes a thaumatin-like protein, is present in cell vacuoles, and
has antifungal activities [
69
]. PR-5 is activated by the host plant against a wide range of
pathogens, and it is thought to be a basal resistance protein [
9
,
67
]. In the current study,
the PR-5 gene exhibited down-regulation at almost all time intervals after TMV infection,
except at 10, 13, 14, and 15 dpi, with relative expression levels that were 1.72-, 2.15-, 1.32-,
and 1.15-fold higher than the control, respectively (Figure 8). In the current study, the
PR-5 gene had a low expression level at 1 to 9 dpi with a range of 0.25- to 0.96-fold in
TMV-infected tomato plants (Figure 9). However, the highest expression level of PR-5 was
observed at 13, 14 and 15 dpi, with values of 2.15-fold, 1.32-fold, and 1.15-fold, respectively.
Compared to the TMV-infected tomato plants, the CMV-infected tomato plants showed PR-
5expression at 1 dpi, which was 2.11-fold higher than the control (Figure 9). Additionally,
the PR-5 gene reached its highest level of expression after it increased by 4.34-fold at 4 dpi.
After that, the gene expression decreased and fell from 0.67-fold to 0.47-fold at 5, 6, 7, 8,
Int. J. Plant Biol. 2023,14 468
and 9 dpi. We suggest that in this study, the viral infection switched off the PR-5 gene
expression in this time period, which then highly increased to 4.85 at 10 dpi (Figure 9).
It was reported that the virus infection had a moderate effect on PR-5 expression [
35
].
The up-regulation of PR-5 induces resistance in tomatoes, resulting in delayed symptom
appearance and tomato spotted wilt virus accumulation [
70
]. The overexpression of PR-5
in tobacco-vein-banding-mosaic-virus-infected tobacco plants and beet-severe-curly-top-
virus-infected Arabidopsis has also been observed [
71
,
72
]. Similar results were reported
by Wang et al. [
73
], who noticed that infection with the turnip crinkle virus resulted in an
increase in PR-5 expression. In addition, the rice dwarf virus also leads to the activation
of the PR-5 gene, suggesting that the PR-5 domain might bind a polypeptide ligand and
raising the possibility that mature PR-5 proteins may also interact with polypeptides [74].
Int. J. Plant Biol. 2023, 14, FOR PEER REVIEW 11
Figure 8. Comparison between the relative transcriptional levels of the tomato PR-4 gene in TMV-
and CMV-infected tissues compared to control at 1 to 15 dpi. The columns show the mean value
from ve biological replicates, and the bars represent the standard deviation (SD). Means were dis-
tinguished using Tukey’s HSD test at p ≤ 0.05 levels, and small leers are used to represent dier-
ences. Columns of data showing dierent leers are signicant.
Concerning PR-5, it encodes a thaumatin-like protein, is present in cell vacuoles, and
has antifungal activities [69]. PR-5 is activated by the host plant against a wide range of
pathogens, and it is thought to be a basal resistance protein [9,67]. In the current study,
the PR-5 gene exhibited down-regulation at almost all time intervals after TMV infection,
except at 10, 13, 14, and 15 dpi, with relative expression levels that were 1.72-, 2.15-, 1.32-,
and 1.15-fold higher than the control, respectively (Figure 8). In the current study, the PR-
5 gene had a low expression level at 1 to 9 dpi with a range of 0.25- to 0.96-fold in TMV-
infected tomato plants (Figure 9). However, the highest expression level of PR-5 was ob-
served at 13, 14 and 15 dpi, with values of 2.15-fold, 1.32-fold, and 1.15-fold, respectively.
Compared to the TMV-infected tomato plants, the CMV-infected tomato plants showed
PR-5 expression at 1 dpi, which was 2.11-fold higher than the control (Figure 9). Addition-
ally, the PR-5 gene reached its highest level of expression after it increased by 4.34-fold at
4 dpi. After that, the gene expression decreased and fell from 0.67-fold to 0.47-fold at 5, 6,
7, 8, and 9 dpi. We suggest that in this study, the viral infection switched o the PR-5 gene
expression in this time period, which then highly increased to 4.85 at 10 dpi (Figure 9). It
was reported that the virus infection had a moderate eect on PR-5 expression [35]. The
up-regulation of PR-5 induces resistance in tomatoes, resulting in delayed symptom ap-
pearance and tomato spoed wilt virus accumulation [70]. The overexpression of PR-5 in
tobacco-vein-banding-mosaic-virus-infected tobacco plants and beet-severe-curly-top-vi-
rus-infected Arabidopsis has also been observed [71,72]. Similar results were reported by
Wang et al. [73], who noticed that infection with the turnip crinkle virus resulted in an
increase in PR-5 expression. In addition, the rice dwarf virus also leads to the activation
of the PR-5 gene, suggesting that the PR-5 domain might bind a polypeptide ligand and
raising the possibility that mature PR-5 proteins may also interact with polypeptides [74].
Figure 8.
Comparison between the relative transcriptional levels of the tomato PR-4 gene in TMV-
and CMV-infected tissues compared to control at 1 to 15 dpi. The columns show the mean value
from five biological replicates, and the bars represent the standard deviation (SD). Means were
distinguished using Tukey’s HSD test at p
≤
0.05 levels, and small letters are used to represent
differences. Columns of data showing different letters are significant.
Int. J. Plant Biol. 2023, 14, FOR PEER REVIEW 12
Figure 9. Comparison between the relative transcriptional levels of the tomato PR-5 gene in TMV-
and CMV-infected tissues compared to control at 1 to 15 dpi. The columns show the mean value
from ve biological replicates, and the bars represent the standard deviation (SD). Means were dis-
tinguished using Tukey’s HSD test at p ≤ 0.05 levels, and small leers are used to represent dier-
ences. Columns of data showing dierent leers are signicant.
PR-7, which codes for plant proteases, is known to be an important part of defensive
response proteins and to help break down the cell walls of microorganisms [39,75]. TMV
was shown to shut down PR-7 gene expression at 1 dpi by 0.77-fold compared to the con-
trol (Figure 10). These two viruses (TMV and CMV) were up-regulated at 2 dpi and had
almost the same expression levels at this point (1.77-fold and 1.65-fold, respectively). At
14 and 15 dpi, TMV-infected tomato plants showed that PR-7 was building up and ex-
pressing itself much more than before (Figure 10). However, in tomato plants infected
with CMV, PR-7 was found to have rapid accumulation and signicant maximum expres-
sion at 10, 11, and 14 dpi, with 4.3-fold, 4.2-fold, and 3.6-fold increases, respectively (Fig-
ure 10). On the other hand, in TMV or CMV-infected tomato plants, these two viruses shut
down the PR-7 gene expression at 5, 6, 7, and 8 dpi, and at 9 dpi in TMV only (Figure 10).
These results agree with the previous report that stated that the PR-7 expression level was
increased by 11.1-fold at 9 days and reached higher levels of 34.7-fold at 15 days of TMV
infection [16]. In another study, the up-regulation of tomato PR-7 expression in response
to pathogen infections was detected [75]. The results of this study showed that the PR-5
and PR-7 genes had a similar transcriptional prole in terms of how much they were ex-
pressed. It is also possible that these genes are co-regulated in a cis-acting way [72], which
shows that they work together.
Figure 9.
Comparison between the relative transcriptional levels of the tomato PR-5 gene in TMV-
and CMV-infected tissues compared to control at 1 to 15 dpi. The columns show the mean value
from five biological replicates, and the bars represent the standard deviation (SD). Means were
distinguished using Tukey’s HSD test at p
≤
0.05 levels, and small letters are used to represent
differences. Columns of data showing different letters are significant.
Int. J. Plant Biol. 2023,14 469
PR-7, which codes for plant proteases, is known to be an important part of defensive
response proteins and to help break down the cell walls of microorganisms [
39
,
75
]. TMV
was shown to shut down PR-7 gene expression at 1 dpi by 0.77-fold compared to the control
(Figure 10). These two viruses (TMV and CMV) were up-regulated at 2 dpi and had almost
the same expression levels at this point (1.77-fold and 1.65-fold, respectively). At 14 and
15 dpi, TMV-infected tomato plants showed that PR-7 was building up and expressing
itself much more than before (Figure 10). However, in tomato plants infected with CMV,
PR-7 was found to have rapid accumulation and significant maximum expression at 10, 11,
and 14 dpi, with 4.3-fold, 4.2-fold, and 3.6-fold increases, respectively (Figure 10). On the
other hand, in TMV or CMV-infected tomato plants, these two viruses shut down the PR-7
gene expression at 5, 6, 7, and 8 dpi, and at 9 dpi in TMV only (Figure 10). These results
agree with the previous report that stated that the PR-7 expression level was increased by
11.1-fold at 9 days and reached higher levels of 34.7-fold at 15 days of TMV infection [
16
].
In another study, the up-regulation of tomato PR-7 expression in response to pathogen
infections was detected [
75
]. The results of this study showed that the PR-5 and PR-7 genes
had a similar transcriptional profile in terms of how much they were expressed. It is also
possible that these genes are co-regulated in a cis-acting way [
72
], which shows that they
work together.
Int. J. Plant Biol. 2023, 14, FOR PEER REVIEW 13
Figure 10. Comparison between the relative transcriptional levels of the tomato PR-7 gene in TMV-
and CMV-infected tissues compared to control at 1 to 15 dpi. The columns show the mean value
from ve biological replicates, and the bars represent the standard deviation (SD). Means were dis-
tinguished using Tukey’s HSD test at p ≤ 0.05 levels, and small leers are used to represent dier-
ences. Columns of data showing dierent leers are signicant.
4. Conclusions
Globally, TMV and CMV have a signicant impact on the tomato, a model species
for the family Solanaceae. The comparative expression proling of two destructive plant
viruses infecting tomato plants, TMV and CMV, found a positive correlation between PR
gene expression (PR-1, PR-2, PR-3, PR-4, PR-5, and PR-7) during the time course study (1
to 15 dpi). All the tested genes exhibited uctuations in their expression levels at dierent
time intervals, except PR-2, which showed up-regulation for both viruses at all intervals.
Based on the expression proles of other PR genes, we can divide the time course study
into three time groups: The rst is the virus replication stage or virus incubation period
(1–6 dpi), in which almost all genes exhibited up-regulation, indicating a rapid response
of the plant against viral infection. The second group, at the early stage of infection or
virus activation (7–10 days), is when most of these genes were down-regulated or exhib-
ited lower expression levels, which may be related to viral suppressor activity. The last
group is the late stage of infection or the symptom appearance stage (11–15 days), in which
the genes begin to increase again after the virus has succeeded in multiplying and system-
ically transferring between cells. Finally, the dierences between the expression proles
of PR genes for both viruses indicated that the response of the defense system of the same
plant might be changed or dierent from one pathogen to another or from one virus to
another. Overall, our results give important information about the biology behind how
the tomato, TMV, and CMV interact. Based on the transcriptional data, future research
should be able to nd the host genes that are needed for a virus to take hold. This could
lead to ways to control these and other viruses.
Supplementary Materials: The following supporting information can be downloaded at:
www.mdpi.com/xxx/s1, Figure S1: The cycle threshold (Ct) for all samples with the three house-
keeping genes (EF-1α, 18S rRNA, and β-actin).
Author Contributions: Conceptualization, A.A.; methodology, D.G.A., S.S., E.H., M.A.S., S.I.B. and
A.A.; software, D.G.A. and A.A.; validation, D.G.A., S.S., E.H., M.A.S., S.I.B. and A.A.; investigation,
S.S., E.H., M.A.S., and A.A.; writing—original draft preparation, D.G.A. and A.A.; writing—review
Figure 10.
Comparison between the relative transcriptional levels of the tomato PR-7 gene in TMV-
and CMV-infected tissues compared to control at 1 to 15 dpi. The columns show the mean value
from five biological replicates, and the bars represent the standard deviation (SD). Means were
distinguished using Tukey’s HSD test at p
≤
0.05 levels, and small letters are used to represent
differences. Columns of data showing different letters are significant.
4. Conclusions
Globally, TMV and CMV have a significant impact on the tomato, a model species
for the family Solanaceae. The comparative expression profiling of two destructive plant
viruses infecting tomato plants, TMV and CMV, found a positive correlation between PR
gene expression (PR-1,PR-2,PR-3,PR-4,PR-5, and PR-7) during the time course study
(
1 to 15 dpi
). All the tested genes exhibited fluctuations in their expression levels at different
time intervals, except PR-2, which showed up-regulation for both viruses at all intervals.
Based on the expression profiles of other PR genes, we can divide the time course study
into three time groups: The first is the virus replication stage or virus incubation period
(1–6 dpi), in which almost all genes exhibited up-regulation, indicating a rapid response
Int. J. Plant Biol. 2023,14 470
of the plant against viral infection. The second group, at the early stage of infection or
virus activation (7–10 days), is when most of these genes were down-regulated or exhibited
lower expression levels, which may be related to viral suppressor activity. The last group
is the late stage of infection or the symptom appearance stage (11–15 days), in which the
genes begin to increase again after the virus has succeeded in multiplying and systemically
transferring between cells. Finally, the differences between the expression profiles of PR
genes for both viruses indicated that the response of the defense system of the same plant
might be changed or different from one pathogen to another or from one virus to another.
Overall, our results give important information about the biology behind how the tomato,
TMV, and CMV interact. Based on the transcriptional data, future research should be able
to find the host genes that are needed for a virus to take hold. This could lead to ways to
control these and other viruses.
Supplementary Materials:
The following supporting information can be downloaded at: https://
www.mdpi.com/article/10.3390/ijpb14020035/s1, Figure S1: The cycle threshold (Ct) for all samples
with the three housekeeping genes (EF-1α,18S rRNA, and β-actin).
Author Contributions:
Conceptualization, A.A.; methodology, D.G.A., S.S., E.H., M.A.S., S.I.B. and
A.A.; software, D.G.A. and A.A.; validation, D.G.A., S.S., E.H., M.A.S., S.I.B. and A.A.; investigation,
S.S., E.H., M.A.S., and A.A.; writing—original draft preparation, D.G.A. and A.A.; writing—review
and editing, D.G.A., S.S., E.H., M.A.S., S.I.B. and A.A.; project administration, A.A.; funding acquisi-
tion, A.A. All authors have read and agreed to the published version of the manuscript.
Funding: This research received no external funding.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: Data are available upon request.
Acknowledgments:
This paper is based upon work supported by the Science, Technology & Innova-
tion Funding Authority (STDF) under grant (30102).
Conflicts of Interest: The authors declare no conflict of interest.
References
1. Nicaise, V. Crop immunity against viruses: Outcomes and future challenges. Front. Plant Sci. 2014,5, 660. [CrossRef] [PubMed]
2.
Hanˇcinský, R.; Mihálik, D.; Mrkvová, M.; Candresse, T.; Glasa, M. Plant Viruses Infecting Solanaceae Family Members in the
Cultivated and Wild Environments: A Review. Plants 2020,9, 667. [CrossRef] [PubMed]
3.
Mumford, R.A.; Macarthur, R.; Boonham, N. The role and challenges of new diagnostic technology in plant biosecurity. Food
Secur. 2016,8, 103–109. [CrossRef]
4.
Ge, Y.; Liu, K.; Zhang, J.; Mu, S.; Hao, X. The limonoids and their antitobacco mosaic virus (TMV) activities from Munronia
unifoliolata Oliv. J. Agric. Food Chem. 2012,60, 4289–4295. [CrossRef]
5.
Abdelkhalek, A.; Sanan-Mishra, N. A comparative analysis of the suppressor activity of Tobacco mosaic virus proteins in the tomato
plant. Jordan J. Biol. Sci. 2018,11, 469–473.
6.
Scholthof, K.G.; Adkins, S.; Czosnek, H.; Palukaitis, P.; Jacquot, E.; Hohn, T.; Hohn, B.; Saunders, K.; Candresse, T.; Ahlquist, P.
Top 10 plant viruses in molecular plant pathology. Mol. Plant Pathol. 2011,12, 938–954. [CrossRef]
7.
Mochizuki, T.; Ohki, S.T. Cucumber mosaic virus: Viral genes as virulence determinants. Mol. Plant Pathol.
2012
,13, 217–225.
[CrossRef]
8. Palukaitis, P.; Roossinck, M.J.; Dietzgen, R.G.; Francki, R.I.B. Cucumber mosaic virus. Adv. Virus Res. 1992,41, 281–348.
9.
Van Loon, L.C.; Rep, M.; Pieterse, C.M.J. Significance of inducible defense-related proteins in infected plants. Annu. Rev.
Phytopathol. 2006,44, 135–162. [CrossRef]
10.
Whitham, S.A.; Yang, C.; Goodin, M.M. Global impact: Elucidating plant responses to viral infection. Mol. Plant-Microbe Interact.
2006,19, 1207–1215. [CrossRef]
11.
Linthorst, H.J.M.; Van Loon, L.C. Pathogenesis-related proteins of plants. CRC. Crit. Rev. Plant Sci.
1991
,10, 123–150. [CrossRef]
12.
Sehgal, O.P.; Mohamed, F. Pathogenesis-related proteins. In Plant Viruses; CRC Press: Boca Raton, FL, USA, 2018; pp. 65–83. ISBN
1351075780.
13.
Deepak, S.A.; Kottapalli, K.R.; Rakwal, R.; Oros, G.; Rangappa, K.S.; Iwahashi, H.; Masuo, Y.; Agrawal, G.K. Real-time PCR:
Revolutionizing detection and expression analysis of genes. Curr. Genom. 2007,8, 234–251. [CrossRef] [PubMed]
Int. J. Plant Biol. 2023,14 471
14.
Remans, T.; Keunen, E.; Bex, G.J.; Smeets, K.; Vangronsveld, J.; Cuypers, A. Reliable gene expression analysis by reverse
transcription-quantitative PCR: Reporting and minimizing the uncertainty in data accuracy. Plant Cell
2014
,26, 3829–3837.
[CrossRef] [PubMed]
15.
Xu, Z.; Dai, J.; Su, W.; Wu, H.; Shah, K.; Xing, L.; Ma, J.; Zhang, D.; Zhao, C. Selection and validation of reliable reference genes for
gene expression studies in different genotypes and TRV-infected fruits of peach (Prunus persica L. Batsch) during Ripening. Genes
2022,13, 160. [CrossRef]
16.
Abdelkhalek, A. Expression of tomato pathogenesis related genes in response to Tobacco mosaic virus.JAPS J. Anim. Plant Sci.
2019,29, 1596–1602.
17. Abdelkhalek, A.; Behiry, S.I.; Al-Askar, A.A. Bacillus velezensis PEA1 Inhibits Fusarium oxysporum Growth and Induces Systemic
Resistance to Cucumber Mosaic Virus. Agronomy 2020,10, 1312. [CrossRef]
18.
Kumar, S.; Udaya Shankar, A.C.; Nayaka, S.C.; Lund, O.S.; Prakash, H.S. Detection of Tobacco mosaic virus and Tomato mosaic virus
in pepper and tomato by multiplex RT–PCR. Lett. Appl. Microbiol. 2011,53, 359–363. [CrossRef]
19.
Khalil, A.M.; Behiry, S.I.; Abdelkhalek, A.; Younes, H.A. Isolation and purification of Alfalfa mosaic virus-infecting potato (Solanum
tuberosum L.) in Beheira governorate. Middle East J. 2020,9, 617–623.
20.
Kavroulakis, N.; Ehaliotis, C.; Ntougias, S.; Zervakis, G.I.; Papadopoulou, K.K. Local and systemic resistance against fungal
pathogens of tomato plants elicited by a compost derived from agricultural residues. Physiol. Mol. Plant Pathol.
2005
,66, 163–174.
[CrossRef]
21.
Arasimowicz-Jelonek, M.; Floryszak-Wieczorek, J.; Izbia´nska, K.; Gzyl, J.; Jelonek, T. Implication of peroxynitrite in defence
responses of potato to Phytophthora infestans.Plant Pathol. 2016,65, 754–766. [CrossRef]
22.
Aseel, D.G.; Madian, R.A.; Aggag, S.A.; Elseehy, M.A. Evaluation of some defensin genes against tomv in different tomato
cultivars using pathogenesis related protein genes. J. Microbiol. Biotechnol. Food Sci. 2021,2021, 29–33.
23.
Wang, X.; El Hadrami, A.; Adam, L.R.; Daayf, F. Differential activation and suppression of potato defence responses by
Phytophthora infestans isolates representing US-1 and US-8 genotypes. Plant Pathol. 2008,57, 1026–1037. [CrossRef]
24.
Dixit, R.; Agrawal, L.; Gupta, S.; Kumar, M.; Yadav, S.; Chauhan, P.S.; Nautiyal, C.S. Southern blight disease of tomato control by
1-aminocyclopropane-1-carboxylate (ACC) deaminase producing Paenibacillus lentimorbus B-30488. Plant Signal. Behav.
2016
,11,
e1113363. [CrossRef] [PubMed]
25.
Mascia, T.; Santovito, E.; Gallitelli, D.; Cillo, F. Evaluation of reference genes for quantitative reverse-transcription polymerase
chain reaction normalization in infected tomato plants. Mol. Plant Pathol. 2010,11, 805–816. [CrossRef]
26.
Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-
∆∆
CT method.
Methods 2001,25, 402–408. [CrossRef]
27.
Abdelkhalek, A.; Al-Askar, A.A.; Alsubaie, M.M.; Behiry, S.I. First Report of Protective Activity of Paronychia argentea Extract
against Tobacco mosaic virus Infection. Plants 2021,10, 2435. [CrossRef]
28.
Deloko, D.C.T.; Chofong, N.G.; Ali, I.M.; Kachiwouo, I.G.; Songolo, F.O.; Manock, A.R.N.; Kamgaing, M.; Fonkou, T.; Njukeng,
A.P. Detection of Cucumber mosaic virus on Solanum lycopersicum L. and Capsicum annuum L. in the Western region of Cameroon. J.
Agric. Food Res. 2022,8, 100294.
29.
Pfitzner, A.J.P. Resistance to Tobacco mosaic virus and Tomato mosaic virus in tomato. In Natural Resistance Mechanisms of Plants to
Viruses; Springer: Berlin/Heidelberg, Germany, 2006; pp. 399–413.
30.
Abdelkhalek, A.; Sanan-Mishra, N. Differential expression profiles of tomato miRNAs induced by Tobacco mosaic virus.J. Agric.
Sci. Technol. 2019,21, 475–485.
31.
El-Helaly, H.S.; Ahmed, A.A.; Awad, M.A.; Soliman, A.M. Biological and molecular characterization of potato infecting Alfalfa
mosaic virus in Egypt. Int. J. Virol. 2012,8, 106–113. [CrossRef]
32.