Human Immunodeficiency Virus Genotyping in Baghdad, Iraq

Abstract

Abstract: HIV-1 is the major cause of the worldwide pandemic. Therefore, Determination of the HIV-1 genetic subtypes has been shown to be useful for understanding the origin and global spread of the virus. HIV-1 subtyping may also be helpful for evaluation of the pathogenicity, transmissibility,andcandidateHIVvaccines. ThisstudyaimedtodeterminetheHIV-1genotypesintheIraqipopulationfromdifferentcitiesof Baghdad province –Iraq. This study included 65 HIV infected patients; they were referred for diagnosis and treatment to the Ibn Zuhur Hospital and AL- Karama Hospital in Baghdad during the period from October 2019 to May 2020. Data were collected for each patient using a special form. Following amplification gp41 region of env gene for HIV-1 with nested -RT- PCR, the sequences of this region was determined, HIV-1 subtype was reported and phylogenetically analysed. The age of HIV infected patients in this study ranged between 20 - 76 years. Most of them were males (83%). After amplified 628bp of env gene coding region by nested PCR, Nucleic acid sequencing was conducted to emphasize their specificity and introduce the ultimate means to detect the virus subtype. Therefore, in Iraqi patients from Baghdad -Iraq, HIV-1 genotype was belonging to group M subtypes A sub- subtypes A1 was detected.

Full text

Human Immunodeficiency Virus Genotyping in Baghdad, Iraq
Manuscript Number: S-957
NAAS Rating: 5.79
Abstract: HIV-1 is the major cause of the worldwide pandemic. Therefore, Determination of the HIV-1 genetic subtypes has been shown to be
useful for understanding the origin and global spread of the virus. HIV-1 subtyping may also be helpful for evaluation of the pathogenicity,
transmissibility, and candidate HIV vaccines. This study aimed to determine the HIV-1 genotypes in the Iraqi population from different cities of
Baghdad province –Iraq. This study included 65 HIV infected patients; they were referred for diagnosis and treatment to the Ibn Zuhur Hospital
and AL- Karama Hospital in Baghdad during the period from October 2019 to May 20 . Data were collected for each patient using a special 20
form. Following amplification gp41 region of gene for HIV-1 with nested -RT- PCR, the sequences of this region was determined, HIV-1 env
subtype was reported and phylogenetically analysed. The age of HIV infected patients in this study ranged between 20 - 76 years. Most of
them were males (83%). After amplified 628bp of gene coding region by nested PCR, Nucleic acid sequencing was conducted to env
emphasize their specificity and introduce the ultimate means to detect the virus subtype. Therefore, in Iraqi patients from Baghdad -Iraq, HIV-1
genotype was belonging to group M subtypes A sub- subtypes A1 was detected.
Keywords: HIV-1, Genotyping, Nested-PCR, Baghdad, Phylogenetic analysis
Hayder Saad Al- Qassab and Nawal Mohammed Utba*
Department of Biology, College of Science, University of Baghdad, Al-Jaderia, Baghdad-10071, Iraq
*E-mail: nawal.utba@sc.uobaghdad.edu.iq
Indian Journal of Ecology (2022) 49 Special Issue (19): 318-323
Acquired immunodeficiency syndrome (AIDS) is
associated with high morbidity and mortality due to the
increased risk of opportunistic infections and malignancy that
caused by global pandemic virus which is called the Human
immunodeficiency virus (HIV). The WHO reported that HIV
prevalence in the Eastern Mediterranean Region is low
epidemic (0.1%), since Iraq is one of the countries in this
region was characterized as a low-prevalence HIV epidemic.
However, the number of HIV infected cases registered in the
Iraqi Ministry of Health after 2008 have increased more than
previous years. The new cases in Iraq were increased each
year from 5 cases in 2008 to 124 cases in 2018 (MOH 2019).
The human immunodeficiency viruses have a high degree of
genetic variation; which regards one of an important
advantage to confer survival against negative selection
pressures such as host antiretroviral agents and immune
response. The high genetic diversity of HIV results from a
high replication rate of the virus, error in replication, and
recombination-prone reverse transcription (Sherpa et al
2020). HIV has two types HIV-1 results from chimpanzees
and gorillas living in Western Africa, and consists of four
groups (M, N, O, and P) ( HIV-2 Nikolopoulos et al 2016).
result from endangered West African primate sooty
mangabey ( The HIV-1 differing genetically D'arc et al 2015).
by 55% and it is more widespread than from HIV-2 (Beloukas
et al 2016). The group M from HIV-1 causing up to 85% of
global HIV infections and can be subdivided into 9 subtypes
(A, B, C, D, F, G, H, J, and K), at least six sub-subtypes of A
and F (A1–A6, F1–F2), circulating recombinant forms
(CRFs), and numerous unique recombinant forms (URFs),
104 CRFs have been registered in April 2020 by the Los
Alamos National Laboratory. The A subtype is common in
Eastern Africa The B (Abecasis and Vandamme 2015).
subtype is the dominant form in Europe, the Americas,
Japan, and Australia. The subtype B is the most common
form in the Middle East and North Africa. The C subtype is the
main in Southern and Eastern Africa, India, Nepal, and parts
of China. The D subtype is seen only in Eastern and Central
Africa. The E subtype in Southeast Asia is the dominant form
for heterosexuals as transmission rate is much higher than
most other subtypes The F Subtype has (Sallam et al 2017).
been found in central Africa, South America, and Eastern
Europe. The G and the CRF02-AG Subtypes have been
found in Africa and Central Europe, The H subtype is limited
to central Africa. The K Subtype is limited to the Democratic
Republic of Congo (DRC) and Cameroon (Fox et al 2010) .
The J Subtype found in North, Central and West Africa, and
the Caribbean ( Determination of the genetic Cohen 2014).
subtypes of human immunodeficiency virus type 1 (HIV-1)
has been shown to be useful for understanding the origin and
global spread of the virus. Subtyping may also be helpful for
evaluation of pathogenicity, transmissibility, and candidate
HIV vaccines ( Depending on our best Kessler et al 2001).
knowledge, no study has been performed in Iraq for
identifying HIV genotypes and its distribution among Iraqi
patients. This study aimed to determination HIV genotypes

and its distribution among Iraqi patients in Baghdad province
and compares the result with the neighbor countries. In
addition, identification of genetic relatedness among local
HIV isolates.
MATERIAL AND METHODS
Study subjects: A total of 65 patients infected with HIV-1
were included in this study and were referred for the
diagnosis and treatment to IbnZuhur Hospital and AL-
Karama Hospital in Baghdad during October 201 to May 9
2020. Anti - HIV antibodies were detected in their sera by
ELISA technique and confirmed by Western blot test and real
time PCR analysis to expose the viral genetic material. This
investigation with the diagnosis was done by the advisor
medical staff in the previous hospital. Data were collected for
each patient using a special form; all participants gave
informed consent before enrolling in the research, which was
approved by the Biology Department, College of Science,
Baghdad University ethics committee.
Sample collection: Initially, 5 mL blood samples were
collected in ethylene diaminetetra acetic acid blood collection
tubes. The plasma was separated by centrifugation at 3000
r/min and frozen at −20°C until use for RNA extraction. The
HIV gp 41 regain (628bp), were amplified and sequenced env
to determine the subtype .HIV RNA extraction and cDNA
synthesis: μ HIV RNA was extracted from 200 L of plasma
using the column purification method (Viral Nucleic Acid
Extraction Kit II (Geneaid, Taiwan) according to manufacturer
instructions. PCR reaction for amplification of gp41env
regains was done according to Badreddine et al (2007). With
some adjustment GoTaq® 1-Step RT-qPCR System kit
(Promega/ USA) contains all the components necessary for
sequential cDNA synthesis and amplification by PCR in one
tube (one-step RT-PCR).
PCR mixture was prepared by using an Eppendorf
gradient PCR system thermal cycler in two runs In the first .
run conventional PCR was achieved with 10 l volume (2 l of μ μ
extracted RNA + 8 l of Master Mix, RT-Mix, MgCl2 primers μ ,
(Macrogen, Korea), and Nuclease free water (Table 1). In
reaction conditions as follows; enzyme activation at 37 C for ˚
15 min , initial denaturation at 95 C for 5 min for 1 for 1 cycle ˚
cycle, after those 40 cycles of PCR were performed. Each
Id Primer name Thermo cycler type Sequence (5ˊ-3ˊ)
1 JH35F Conventional PCR TGARGGACAATTGGAGAARTGA
2 menv24R TGTCTTGCTCKCCACCTYCTTCTTC
3 menv23F Nested PCR GGTGGAGAGAGAAAAAAGAGC
4 JH38 GGTGARTATCCCTKCCTAAC
Table 1. Sequence of primers
cycle consisted of denaturation at 95 C for 30 Sec., ˚
a at 50 for 30 Sec. at72 for 1 min. ˚ ˚ nnealing C and extension C
then, at for 7 min. for 1 cycleand˚ final extension 72 C hold at
10˚for 10min.
In the second run, Nested PCR with 25 l volume was μ
achieved. An aliquot (3 L) of the primary PCR product and μ
primers (Table 1) were used as follows: initial denaturation at
95°C for 5 min. for 1 cycle, then 30 cycles consist
denaturation for 0.30 min. at 95°C, annealing for 0.30 min. at
50°C and extension for 1 min. at 72 °C. Finally, 1 cycle of final
elongation at 72°C for 7 min. and hold 10 °C for 10 min. was
used for all PCR reactions. The results were checked by
electrophoresis of the nested PCR products on 1.5%
agarose gel and visualized with ethidium bromide under UV
light. The PCR products (628 pb) were confirmed by
comparing its molecular weight with 100bp DNA Ladder.
However, PCR product was sequenced using ABI3730XL,
automated DNA sequencer by Macrogen Corporation –
Korea.
Statistical analysis: Sequences were then compared with
the HIV sequences present in Los Alamos National
Laboratory on line at (https://www.hiv.lanl.gov/content
/sequence/BASIC_BLAST/basic_blast.html), Geneious
program version 2021.01 and GenBank using the National
Center Biotechnology Information (NCBI) online at
(http://www.ncbi.nlm.nih.gov) the NCBI program and aligned
with the corresponding sequence fragments of the database
using the Basic Local Alignment Search Tool (BLAST)
BLASTX program ( Phylogenetic trees Morgulis et al 2008).
were created by the neighbor-joining method using the
MEGA_ X program version 10.1.8.
RESULTS AND DISCUSSION
The plasma samples were collected from 65 Iraqi HIV
infected patients. Of these 83% were males and rest were
females The primary routes of with age 20-76 years.
HIV/AIDS transmission were sexual contact (72.3%),
homosexual routes (12.3%) and other routs (15.4%). To
understand the genetic variation and characterization of HIV-
1 in the current study, eleven positive samples were
sequenced after amplified 628bp of gene coding region env
by nested PCR. Nucleic acid sequencing was conducted to
319Human Immunodeficiency Virus Genotyping in Baghdad, Iraq

emphasize their specificity and introduce the ultimate means
to detect the virus subtype. Therefore, amplicons have HIV-1
isolated sequences of conserved regions that had not been
previously sequencing recorded in Iraq and showed that the
HIV-1 genotype was belonging to group M subtypes A sub-
subtypes A1. env Ten sequences isolates of the gene region
from HIV-1 was recorded in Genebank (NCBI) under
accession numbers [LC594633, LC594634.1, LC594635.1,
LC594636.1, LC594637.1, LC594638.1, LC594639.1,
LC594640.1, LC594641.1, and LC594642.1].
The results of this study with studies conducted in
neighbouring countries such as Iran, Turkey, Kuwait and
Saudi Arabia, and there are differences in the distribution and
prevailing HIV-1 subtypes in each country Although, HIV-1 .
Subtype B was predominated in most neighbouring
countries, Subtype A rather than B was reported in Baghdad
–Iraq and this different results evaluated may be due to the
main source of infection is different from other countries and
to the small samples size in this study. In Iran Sarrami-
Forooshani et al (2006) reported that the first molecular study
of HIV-1 genotypes suggests two parallel outbreaks in
distinct high-risk populations and may offer clues to the origin
and spread of infection. HIV-1 subtyping and phylogenetic
analysis were done to HIV-1 seropositives belonging to the
two groups (hemophiliacs and intravenous drug users) and
all hemophiliacs are infected with HIV-1 subtype B and all
intravenous drug users are infected with HIV-1 subtype A.
Since intravenous drug abuse is the major transmission route
in Iran, HIV-1 subtype A is likely to be the dominant viral
subtype circulating in the country The analysis of genetic .
distances showed subtype B viruses in Iran to be twice as
heterogeneous as the subtype A viruses. phylogenetic
analysis showed subtypes A1 and B in 58 and 42% patients,
respectively (Baesi et al 2012). Baesi et al (2016) the
recombinant CRF 35_AD (88%) be the predominant HIV
subtype, followed by subtypes CRF 28_BF in 8% and CRF
29_BF in 4% of patients failing treatment in Tehran, which is
consistent with other reports of HIV in Iran, and in addition.
Mozhgani et al (2017) reported that CRF35-AD was specified
as the predominant circulating subtype among different high-
risk groups. Most of the HIV-positive patients (70%) were
intravenous drug users (IDUs) after the p17 region of the gag
and the c2-v5 region of the genes were sequenced and env
then clustered by phylogenetic analyses. In Turkey, Ziyade et
al (2019) indicated that HIV-1 subtype B was most frequent
type (39.3%). Subtype A (17.9%;), CRF02_AG (14.3%),
subtype C (10.7%), B+CRF02_AG recombinant (3.6%),
CRF01_AE (3.6%), subtype D (3.6%), as well as subtype F
(3.6%) and subtype G (3.6%) strains were also detected in
the circulation. Biçeroğlu et al (2014) reported that the
subtypes of the isolates according to phylogenetic analysis
were as 44.2% subtype B, 34.2% CRF42_BF, 8.5%
B/CRF02_AG recombinants, 7.1% sub-subtype A1, 1.4%
sub-subtype F1, %1.4 CRF 25_cpx, 1.4% CRF02_AG and
1.4% CRF01_AE In Kuwait, Chehadeh et al (2015) .
observed that a total of ten different HIV-1 subtypes and
recombinant forms were in Kuwait with predominance of
subtypes B, C, and CRF01_AE. However, in Saudi Arabia,
Zaki et al (2020) reported that a total of 57 samples of
treatment-naive patients were tested for HIV-1 genotypes
through direct sequencing. The HIV-1 Genotypes were as
follow; C: 66.6%, D: 10.5%, G: 8.8%, B: 7.0%, CRF01_AE:
3.5%, A and CRF02_AG: 1.8% Molecular epidemiological .
studies showed that, with the exception of Sub-Saharan
Africa, where almost all subtypes, CRFs, and several URFs
have been detected, there is a specific geographic
distribution pattern for HIV-1 subtypes (Hemelaar et al2006).
This distribution pattern seems to be the consequence of
either accidental trafficking (viral migration), with a resulting
“founder effect,” or a prevalent route of transmission, which
results in a strong advantage for and local predominance of
the prevalent subtype transmitted in that population
(Buonaguro et al 2007). HIV-1 sequences from the gene env
region studied in all 11 HIV-1 isolates are displayed in the
phylogenetic tree constructed by the neighbour-joining
method. The optimal tree with the sum of branch length =
0.36477717. The tree is drawn to scale, with branch lengths
(above the branches) in the same units as those of the
evolutionary distances used to infer the phylogenetic tree.
The evolutionary distances were computed using the
maximum composite likelihood method, and are in the units
of the number of base substitutions per site. This analysis
involved 17 nucleotide sequences. There were a total of 523
positions in the final dataset (Fig. 1). Separate clusters of
related HIV-1 strains can be observed among isolates from
Iraqi HIV-1 infected patients in Baghdad province of
genotypes M Subtype A sub- subtypes A1. However, distinct
clusters of highly related sequences were observed in A1
sub-sub genotypes, suggesting highly prevalence and
endemic circulation of HIV-1 strains belonged to M subtype in
this area.
In phylogenetic tree analysis the isolate showed nearly to
the Uganda, Tanzania, Cameroon, and Rwanda isolates.
Greater percent near to Uganda isolate under accession
number [ID: KU865746.1] and less percent with another
countries Rwanda accession numbers [ID: KX983501.1, and
ID: JX508883.1], Tanzania accession numbers [ID:
AY7 75603.1 ], Came roon ac c ession number [ID:
MK086122.1], and Kenya accession number [KT022382.1].
The genotype results of HIV in this study were comparable
320 Hayder Saad Al- Qassab and Nawal Mohammed Utba

Fig. 1. Phylogenetic tree of 11 HIV-1 isolates sequences in the region, clustering based on neighbor-joining method by env
using MEGA-X program version 10.1.8
with the results of many neighbor countries. In Iran a study
conducted at 2013 reported that all HIV -1 genotype M
subtype A1 related to Ugandan , Kenyan and Sub-Saharan
isolates detected by used gene and gene (env gag Baesi et al
2014). In other study the viral sequences of the Iranian IDUs
are strongly related and form a single cluster within the A
subtype related to African Ugandan/ Kenyan Sub-Saharan
isolate ( pointed Tagliamonte et al 2007). Leung et al (2019)
that in Hong Kong, most of the A1 isolates were strongly
clustered with the reference sequences collected in African
countries such as Cameroon, Kenya, and Uganda.
The origin of HIV-1 has been documented around
Kinshasa in the present day Democratic Republic of Congo
around the 1920s from where it spread along a transport
network to other areas in Sub-Saharan Africa, West Africa,
Europe and the rest of the world ( This global Faria et al 2014).
spread was marked by a geographically defined distribution
of several genetically distinct viruses. Subtype A remains the
most prevalent strain in parts of East Africa, Russia and
former Soviet Union countries; subtype B in Europe,
Americas and Oceania; subtype C in Southern Africa and
India; CRF01_AE in Asia and CRF02_AG in Western Africa.
Recent studies based on near full-length genome
sequencing highlighted the growing importance of
recombinant variants and subtype C viruses (Bbosa et al
2019). There was significant increase in the prevalence of
recombinants in some countries (Lee et al (2017) and several
newly discovered CRFs/URFs in parts of Asia and Africa
( The co-infection or super-infection by Miao et al 2018).
divergent HIV-1 strains has become more common in regions
where multiple subtypes co-circulate (Li et al 2017) Viral .
sequences from recombinant forms affect the accuracy of
phylogenetic reconstructions. This is due to the different
regions of the aligned recombinant genome having distinct
evolutionary relationships that affect tree topology and
branch lengths ( Furthermore, such Paraskevis et al 2009).
sequences introduce errors in phylodynamic inferences by
biasing ancestral state reconstruction and estimations for the
most recent common ancestor (Frost et al 2015) As the .
prevalence of recombinant forms increases, these
challenges are expected to become more important form
molecular epidemiological-based investigations. Recovery
321Human Immunodeficiency Virus Genotyping in Baghdad, Iraq

of near full-length HIV-1 genomes from a plasma source
coupled with advances in next generation sequencing (NGS)
technologies and development of universal methods for
amplifying whole genomes of HIV-1 circulating in a target
geography or population provides the opportunity for a
detailed analysis of HIV-1 strain identification, evolution and
dynamics ( The scale up of cheaper Alampalli et al 2017).
near full-length genome sequencing approaches is critical in
improving the accuracy of viral classification. The high
mutation rate of HIV is one of the major factors that have
hindered development of an HIV vaccine; this problem is
compounded by the enhanced diversity of the virus resulting
from its high recombination rate ( Thus, Su et al 2000).
understanding the molecular epidemiology of HIV/AIDS is
increasingly important as it will shed light on the origin and
global distribution of AIDS, and will facilitate.
CONCLUSION
Although, HIV infection prevalence in Iraq was low, the
number of new cases of HIV infected patients increased in
the past recent years accompanied with changing in the
transmission mode of HIV from the contaminated blood and
blood products to the sexual contact. The determination of
HIV genetic subtypes has been shown to be useful for
understand the origin and global spread of the virus. On the
other hand, HIV subtyping may also be helpful for
development of candidate HIV vaccines, evaluation of
pathogenicity and transmissibility.
Ethics Approval and Consent to Participate: Ethical
clearance was obtained from the Biology Department,
College of Science, University of Baghdad ethics committee
in accordance with the Helsinki Declaration.
Human and Animal Rights: All human research procedures
followed were in accordance with the ethical standards of the
committee responsible for human experimentation
(institutional and national), and with the Helsinki Declaration,
2013.No Animals were used in this research.
Consent for publication: Written and informed consent was
obtained from the participants prior to the study.
Conflict of interest: There are no conflicts of interest.
Acknowledgements: Authors would like to express their
sincere thanks to the all HIV patients participated in this
study. We are grateful to staff of IbnZuhur Hospital, AL-
Karama Hospital and CDC for their support for this project.
REFERENCES
Abecasis A, Vandamme A 2015. Origin and distribution of HIV-1
subtypes. : 1-16.Encyclopedia of AIDS 1
Alampalli SV, Thomson MM, Sampathkumar R, Sivaraman K, UKJ
AJ, Dhar C, and Vyakarnam A 017. Deep Souza GD, Berry N 2
sequencing of near full-length HIV-1 genomes from plasma
identifies circulating subtype C and infrequent occurrence of AC
recombinant form in Southern India. (12) e0188603.Plos one : 12
Badreddine S, Smith K, Van Zyl H, Bodelle P, Yamaguchi J, Swanson
P, Devare SG and Brennan CA 2007. Identification and
characterization of HIV type 1 subtypes present in the Kingdom
of Saudi Arabia: High level of genetic diversity found. AIDS
Research and Human Retroviruses (5): 667-674.23
Baesi K, Moallemi S, Farrokhi M, Alinaghi SAS and Truong HHM
2014. Subtype classification of Iranian HIV-1 sequences
registered in the HIV databases, 2006-2013. one (9): PloS 9
e105098
Baesi K, Moradbeigi M, Ravanshad M, Baghban A 2016. Phylogeny
and drug resistance of HIV PR gene among HIV patients
receiving RT inhibitors in Iran. Asian Pacific Journal of Tropical
Biomedicine (5): 451-454.6
Baesi K, Ravanshad M, Hosseini Y and HAJI AM 2012. Drug
resistance profile and subtyping of HIV-1 RT gene in Iranian
patients under treatment. Iranian Journal Of Biotechnology 10
(1): 1-7.
Bbosa N, Kaleebu P, Ssemwanga D 2019. HIV subtype diversity
worldwide. (3): 153-160Current Opinion in HIV and AIDS 14
Beloukas A, Psarris A, Giannelou P, Kostaki E, Hatzakis A and
Paraskevis D 2016. Molecular epidemiology of HIV-1 infection in
Europe: An overview. (1): Infection, Genetics and Evolution 46
180-189.
Biçeroğlu SU, Altuğlu İ, Zeka AN, Gökengin D and Sertöz RY 2014.
Ege bölgesi'nde izole edilen HIV-1 izolatlarının alttip dağılımının
pol gen bölgesi filogenetik analizi ve otomatize araçlar
kullanılarak belirlenmesi. (3): 420-428.Mikrobiyol Bulletin 48
Buonaguro L, Tornesello ML and Buonaguro FM 2007. Human
immunodeficiency virus type 1 subtype distribution in the
worldwide epidemic: Pathogenetic and therapeutic implications.
Journal of virology (19): 10209-10219.81
Chehadeh W, Albaksami O, Altawalah H, Ahmad S, Madi N, John SE,
Abraham P and Al Nakib W 2015. Phylogenetic analysis of ‐
HIV 1 subtypes and d rug resistance profile among ‐
treatment naïve people in Kuwait. ‐Journal of Medical Virology
87(9): 1521-1526.
Cohen J 2014. Early AIDS virus may have ridden Africa's rails.
Virology, Science (New York, N.Y.). (6205): 21-22. 346
D'arc M, Ayouba A, Esteban A, Learn GH, Boué V, Liegeois F,
Etienne L, Tagg N, Leendertz FH, Boesch C, Madinda NF,
Robbins MM, Gray M, Cournil A, Ooms M, Letko M, Simon, VA,
Sharp PM, Hahn BH, Delaporte E, Ngole EM and Peeters M
2015. Origin of the HIV-1 group O epidemic in western lowland
gorillas. Proceedings of the National Academy of Sciences
112(11): E1343-E1352.
Faria NR, Rambaut A, Suchard MA, Baele G, Bedford T, Ward MJ,
Tatem AJ, Sousa JD, Arinaminpathy N, Pépin J, Posada D,
Peeters M, Pybus OG and Lemey P 2014. The early spread and
epidemic ignition of HIV-1 in human populations. Science
346(6205): 56-61.
Fox J, Castro H, Kaye S, McClure M, Weber JN and Fidler S 2010.
UK Collaborative Group on HIV Drug Resistance and
Epidemiology of non-B clade forms of HIV-1 in men who have
sex with men in the UK. (15): 2397-2401.Aids 24
Frost SD, Pybus OG, Gog JR, Viboud C, Bonhoeffer S and Bedford T
2015. Eight challenges in phylodynamic inference. Epidemics
10(1): 88-92.
Hemelaar J, Gouws E, Ghys PD and Osmanov S 2006. Global and
regional distribution of HIV-1 genetic subtypes and
recombinants in 2004. (16): W13-W23.Aids 20
Kessler HH, Deuretzbacher D, Stelzl E, Daghofer E, Santner BI and
Marth E 2001. Determination of human immunodeficiency virus
type 1 subtypes by a rapid method useful for the routine
diagnostic laboratory. Clinical and Diagnostic Laboratory
Immunology 8 (5): 1018-1020.
Lee GQ, Bangsberg DR, Mo T, Lachowski C, Brumme CJ, Zhang W,
322 Hayder Saad Al- Qassab and Nawal Mohammed Utba

Lima DV, Boum Y, Mwebesa BB, Muzoora C, Andia I, Mbalibulha
Y, Kembabazi A, Carroll R, Siedner MJ, Haberer JE, Mocello AR,
Kigozi SH, Hunt PW, Martin JM and Harrigan PR 2017.
Prevalence and clinical impacts of HIV-1 intersubtype
recombinants in Uganda revealed by near-full-genome
population and deep sequencing approaches. AIDS (London,
England) 31 (17): 2345–2354.
Leung KSS, To SWC, Chen JHK, Siu GKH, Chan KCW and Yam WC
2019. Molecular characterization of HIV-1 minority subtypes in
Hong Kong: A recent epidemic of CRF07_BC among the men
who have sex with men population. (1): Current HIV research 17
53-64.
Li F, Li Y, Feng Y, Hu J, Ruan Y, Xing H and Shao Y 2017. Four closely
related HIV-1 CRF01_AE/CRF07_BC recombinant forms
identified in East China. AIDS Research and Huma n
Retroviruses (7): 740-744.33
Miao J, Ran J, Song Y, Liu Y, Gao L, Miao Z, Zhang C, Feng Y and Xia
X 2018. Characterization of a novel HIV-1 circulating
recombinant form, CRF01_AE/B′/C (CRF96_cpx), in Yunnan,
China. (4): 393-AIDS Research and Human Retroviruses 34
397.
MOH 2019: Iraqi Ministry of Health and environment / CDC/ National
AIDS Center.
Morgulis A, Coulouris G, Raytselis Y, Madden TL, Agarwala R and
Schäffer AA 2008. Database indexing for production Mega
BLAST searches. (16): 1757-1764.Bioinformatics 24
Mozhgani SH, Ebrahimian SA, Gudarzi H, Jazayeri SM,
Jahanbakhsh F, Mohraz M, Rezaee S, Azadmanesh K, Soltani
S and Norouzi M 2017. CRF35-AD as the main circulating
genotype of human immunodeficiency virus type 1 infection in
Iran: A phylogenetic and demographic-based study. Intervirology
60 (4): 144-148.
Nikolopoulos GK, Kostaki EG and Paraskevis D 2016. Overview of
HIV molecular epidemiology among people who inject drugs in
Europe and Asia. (1): 256-Infection, Genetics and Evolution 46
268.
Paraskevis D, Pybus O, Magiorkinis G, Hatzakis A, Wensing AM, van
de Vijver DA, Wensing AM, A van de Vijver D, Albert J, Angarano
G, Åsjö B, Balotta C, Boeri E, Camacho R, Chaix M, Coughlan S,
Costagliola D, De Luca A, de Mendoza C, Derdelinckx I,
Grossman Z, Hamouda O, Hoepelman I, Horban A, Korn K,
Kücherer C, Leitner T, Loveday C, MacRae E, Maljkovic-Berry I,
Meyer L, Nielsen C, Op de Coul EL, Ormaasen V, Perrin L,
Puchhammer-Stöckl E, Ruiz L, Salminen MO, Schmit,Jean-C,
Schuurman R, Soriano V, Stanczak J, Stanojevic M, Struck D,
Van K , Laethem M, Laethem KV, Violin M, Yerly S, Zazzi M,
Boucher CA and Vandamme AM 2009. Tracing the HIV-1
subtype B mobility in Europe: A phylogeographic approach.
Retrovirology 6 (1): 1-11.
Sallam M, Şahin GÖ, Ingman M, Widell A, Esbjörnsson J and
Medstrand P 2017. Genetic characterization of human
immunodeficiency virus type 1 transmission in the Middle East
and North Africa. (7): e00352Heliyon .3
Sarrami Forooshani R, Das SR, Sabahi F, Adeli A, Esmaeili R, ‐
Wahren B, Mohraz M, Haji-Abdolbaghi M, Rasoolinejad M,
Jameel S and Mahboudi F 2006. Molecular analysis and
phylogenetic characterization of HIV in Iran. Journal of Medical
Virology 78 (7): 853-863.
Sherpa C, Rausch JW and Le Grice SF 2020. HIV genetic diversity-
superpower of a formidable virus. (2): Current HIV Research 18
69-73.
Su L, Graf M, Zhang Y, von Briesen H, Xing H, Köstler J, Meizi H, Wolf
H, Shao Y and Wagner R 2000. Characterization of a virtually
full-length human immunodeficiency virus type 1 genome of a
prevalent intersubtype (C/B′) recombinant strain in China.
Journal of Virology (23): 11367-11376.74
Tagliamonte M, Naderi HR, Tornesello ML, Farid R, Buonaguro FM
and Buonaguro L 2007. HIV type 1 subtype A epidemic in
injecting drug user (IDU) communities in Iran. AIDS Research
and Human Retroviruses (12):1569-1574.23
Zaki EA, El-Daly MM, Abdulhaq A, Al-Subhi TL, Hassan AM, El-
Kafrawy SA, Alhazmi MM, Darraj MA and Azhar EI 2020.
Genotyping and antiretroviral drug resistance of human
immunodeficiency Virus-1 in Jazan, Saudi Arabia. Medicine
99(49): e23274.
Ziyade N, Sayan M, Elgörmüş N and Büyük Y 2019. Postmortem
molecular epidemiology of HIV-1 strains isolated in Turkey.
Mikrobiyoloji Bulteni (4): 374-387.53
Received 11 January, 2022; Accepted 05 May, 2022
323Human Immunodeficiency Virus Genotyping in Baghdad, Iraq