Available via license: CC BY 4.0
Content may be subject to copyright.
Arq. Bras. Med. Vet. Zootec., v.75, n.1, p.71-82, 2023
Morphology and molecular phylogeny of trypanorhynchid metacestodes infecting
commercial fish of the Mediterranean Sea
[Morfologia e filogenia molecular das metacestodes de tripanorhynchid que infectam os
peixes comerciais do Mar Mediterrâneo]
K. Morsy1,2 , S.B. Dajem1, A. Alghamdi3, A. El–kott1,4, E. Ibrahim1,5 , K. Attia6,7 ,
A. Al–Doaiss1, 8 , H. El–Mekkawy1, N. Sheraba9, A. Baiomy2, M. Fahmy2, F. Shalaby1,10
1Biology Department, College of Science, King Khalid University, 61421, Abha, Saudi Arabia
2Zoology Department, Faculty of Science, Cairo University, 12613, Cairo, Egypt
3Biology Department, Faculty of Science, Albaha University, Al-Baha, Saudi Arabia
4Zoology Department, Faculty of Science, Damanhour University, Damanhour, Egypt
5Blood Products Quality Control and Research Department, National Organization for
Research and Control of Biologicals, Cairo, Egypt
6 Clinical Nutrition Department, College of Applied Medical Sciences, Jazan University, Jazan, Saudi Arabia
7 Evaluation of Natural Resources Department, Environmental Studies and Research Institute,
University of El-Sadat City, Egypt
8 Anatomy and Histology Department, Faculty of Medicine, Sana'a University, Sana’a, Republic of Yemen
9 VACSERA ˗ the Holding Company for Biological Products and Vaccines ˗ Giza, Egypt
10 Zoology Department, Faculty of Science, Mansoura University, Mansoura, Egypt
ABSTRACT
Members of the order Trypanorhyncha are cestode parasites that are frequently found infecting the
muscles of several marine fish species, affecting fish health, and resulting in consumers’ rejection of fish.
Fifty-two specimens of marine fish were freshly caught throughout the year 2020 from boat landing sites
at the Alexandria coast along the Mediterranean Sea in Egypt, including the grey trigger fish Balistes
carolinensis (F: Balistidae); the mottled grouper Mycteroperca rubra (F: Serranidae) and the common
sole Solea vulgaris (F: Soleidae). Blastocysts were isolated and ruptured; the generated pleurocerci were
described morphologically and morphometrically by light and scanning electron microscopy. Also,
multiple–sequence alignment was performed, and a phylogenetic tree was constructed following
maximum likelihood analysis of the 18s and 28s ribosomal RNA sequences of the recovered worms.
Thirty fish were infected; the infection was recorded as blastocysts embedded in fish flesh. Three
different parasitic species were recovered and classified morphologically as Gymnorhynchus isuri,
Pseudotobothrium dipsacum and Heteronybelinia estigmena. The taxonomic position of these parasites
was justified by molecular analysis of their 18s and 28s rRNAs, which revealed high percentages of
homology with species recovered from the GenBank. The accession numbers ON157059, ON139663 and
ON139662 were respectively assigned to the recovered parasites after their deposition in GenBank. The
results obtained from the molecular analyses confirmed the morphological records of the recovered
parasites. Since metacestodes are found in the musculature of infected fish specimens, it is necessary to
remove these areas in the commercialization of fish.
Keywords: Cestoda, Trypanorhyncha, Taxonomy, morphology, molecular analysis
RESUMO
Os membros da ordem Trypanorhyncha são parasitas de cestóides que são freqüentemente encontrados
infectando os músculos de várias espécies de peixes marinhos, afetando a saúde dos peixes e resultando
na rejeição do peixe por parte dos consumidores. Cinqüenta e dois espécimes de peixes marinhos foram
capturados recentemente durante todo o ano de 2020 nos locais de desembarque de barcos na costa de
Alexandria ao longo do Mar Mediterrâneo, no Egito, incluindo o peixe de gatilho cinzento Balistes
Corresponding author: kareemsaid156@yahoo.com
Submitted: September 13, 2022. Accepted: September 20, 2022.
http://dx.doi.org/10.1590/1678-4162-12892
Morsy et al.
72 Arq. Bras. Med. Vet. Zootec., v.75, n.1, p.71-82, 2023
carolinensis (F: Balistidae); a garoupa mosqueada Mycteroperca rubra (F: Serranidae) e o linguado
comum Solea vulgaris (F: Soleidae). Os blastocistos foram isolados e rompidos; os pleurocistos gerados
foram descritos morfologicamente e morfometricamente por microscopia eletrônica de luz e varredura.
Além disso, foi realizado o alinhamento de sequências múltiplas e uma árvore filogenética foi construída
seguindo a análise de máxima probabilidade das sequências de RNA ribossômico de 18s e 28s dos
vermes recuperados. Trinta peixes foram infectados; a infecção foi registrada como blastocistos
embutidos na carne do peixe. Três espécies diferentes de parasitas foram recuperadas e classificadas
morfologicamente como Gymnorhynchus isuri, Pseudotobothrium dipsacum e Heteronybelinia
estigmena. A posição taxonômica desses parasitas foi justificada pela análise molecular de seus rRNAs
de 18 e 28 anos, que revelou altas porcentagens de homologia com espécies recuperadas do GenBank.
Os números de acesso ON157059, ON139663 e ON139662 foram respectivamente atribuídos aos
parasitas recuperados após sua deposição no GenBank. Os resultados obtidos a partir das análises
moleculares confirmaram os registros morfológicos dos parasitas recuperados. Como as metacestodes
são encontradas na musculatura dos espécimes de peixes infectados, é necessário remover estas áreas na
comercialização dos peixes.
Palavras-chave: Cestoda, Trypanorhyncha, Taxonomia, morfologia, análise molecular
INTRODUCTION
Members of the order Trypanorhyncha Diesing
(1863) represent parasitic cestodes of fish and
sea invertebrates; adults infect the stomach and
intestines of sharks and rays as definitive hosts,
while the larval stages are found in the
musculature and coelomatic cavity of teleosteans
as intermediate hosts (Campbell and Beveridge,
1994; Palm, 2004; Morsy et al., 2013; Santoro et
al., 2020). Detection of these parasites among
infected fish poses marketing problems (Morsy
et al., 2013). Humans can be accidentally
infected by larvae of Trypanorhyncha after
ingesting raw fish meat which, in most cases,
leads to allergic reactions. Further, the presence
of larvae in the fish musculature may release
toxins that affect humans (Deadorff et al., 1984;
Caira and Jensen, 2017). Previous reports have
concluded that experimental inoculation of
Trypanorhyncha species extracts is responsible
for immune responses in mice, indicating the
possibility of allergic reactions in humans
(Vásquez–López et al., 2001; Gòmez–Morales et
al., 2008; Al Quraishy et al., 2019). Despite the
worldwide distribution of these parasites in
commercial fishes, and the great diversity of
their species, trypanorhynchids are still a
relatively poorly studied group (Palm, 2004;
Menezes et al., 2018). Only a few life cycles are
completely known, but those that involve several
intermediate hosts before the final infestation of
sharks are still missed. Few reports have been
published on these parasites, likely due to the
challenges associated with classification
(Menezes et al., 2018). Trypanorhynchid
cestodes are characterized by the presence of two
or four bothria and a tentacular apparatus, which
consists of tentachular sheaths with tentacles that
bear numerous hooks. The hooks originate at the
anterior extremity of bulbs and extend in a spiral
anteriorly toward the scolex (Dollfus, 1942;
Richmond and Caira, 1991; Campbell and
Beveridge, 1994; Palm, 1995, 1997).
Taxonomists originally identified the species of a
larva in an invertebrate or teleost intermediate
host based on the shape of the scolex, number of
bothridia, tentacular armature (Palm and Caira,
2008), zoogeographical distribution (Palm, 2004,
Palm et al., 2007), and parasite evolution (Palm
and Klimpel, 2007; Palm et al., 2009) as the
most important morphological features of the
trypanorhynchid taxonomy. During a recent
parasitological survey of marine fish of the
Mediterranean Sea at the Alexandria coasts in
Egypt, three species of trypanorhynchid
metacestodes were captured from the
musculature and coelomatic cavities of three
examined fish species belonging to families
Balistidae, Serranidae and Soleidae. The
taxonomic status of the parasites was determined
based on both morphological characterization
and the molecular analysis of the parasites’ 18s
and 28s rRNA.
MATERIALS AND METHODS
A total of 52 specimens of marine fish were
freshly caught throughout the year 2020 from
boat landing sites at the Alexandria coasts along
the Mediterranean Sea, Egypt. These were the
grey trigger fish Balistes carolinensis (F:
Morphology and molecular…
Arq. Bras. Med. Vet. Zootec., v.75, n.1, p.71-82, 2023 73
Balistidae, no. 15); the mottled grouper
Mycteroperca rubra (F: Serranidae, no. 20); the
common sole Solea vulgaris (F: Soleidae, no.
17). Fish specimens were transported to the
laboratory and were morphologically identified
according to the methods of Kvach et al. (2018).
Morphology: After fish dissection, blastocysts
were isolated in an isotonic saline solution (7%)
in a Petri dish, where they were ruptured to
release the coiled larvae that were left to relax
between two slides within hot 10% formalin as a
fixative. The fixed worms were washed with
distilled water to remove the excess fixative. The
worms were stained using acetic acid alum
carmine (Carleton, 1976). Dehydration was
achieved using an ascending series of ethyl
alcohol, cleared in clove oil and xylene, and then
the worms were permanently mounted in Canada
balsam (Ergens, 1969). The worms were
subsequently examined and photographed using
a BX53 microscope (Olympus Corporation,
Toyko, Japan) and drawn using a camera lucida.
The nomenclature of the different body parts
followed the convention published by) for
trypanorhynchids. Measurements were given in
millimeters (mm) and were reported as means
and ranges in parentheses. To study the surface
ultrastructure of worms by scanning electron
microscopy (SEM), the worms were fixed in
buffered glutaraldehyde (3%, pH 7.3, 3 hours),
washed in the same buffer, and post–fixed in
osmium tetroxide (4 hours) according to the
instructions detailed by Madden and Tromba
(1976). The worms were dehydrated in acetone
solution, dried in a BOMER–900 drier (Leica
Microsystems, Wetzlar, Germany), Jones et al.
(2004mounted on an aluminum stub, coated with
gold palladium in a JEOL JEC– DNA Extraction,
PCR, and Sequencing: Genomic DNA (gDNA)
was extracted from the preserved samples in
70% ethanol using a DNeasy tissue kit (Qiagen,
Hilden, Germany) following the manufacturer’s
instructions. Polymerase chain reaction (PCR)
amplification of partial 18s ribosomal RNA
sequences was carried out on an MJ Research
PTC–150 thermocycler (Marshall Scientific,
Hampton, NH, USA) using the universal primers
1F 5′–AACCTGGTTGATCCTGCCAG–3′ and
1528R 5′–
TGATCCTTCTGCAGGTTCACCTAC–3′. The
PCR was conducted using a final volume of
25μL containing 3.5mM of MgCl2, 0.5 mM of
each primer, 0.2 mM of dNTPs, 0.6 units (U) of
Thermus aquaticus (Taq) polymerase in 1× PCR
buffer, 0.1μg of extracted parasite genomic
DNA, and nuclease–free sterile double–distilled
water up to 25μL. The thermocycling conditions
were as follows: 94°C for 2 minutes; 3 cycles of
94°C for 40 seconds, 51°C for 40 seconds, 72°C
for 1 minute; 5 ‘touchdown’ cycles of 94°C for
40 seconds, 50°C–46°C for 40 seconds (dropping
1°C per cycle), 72°C for 1 minute; 35 cycles of
94°C for 40 seconds, 45°C for 40 seconds, 72°C
for 1 minute; and a final extension at 72°C for 5
minutes. DNA gel electrophoresis (1.5% agarose
gel) was used to confirm the amplified product
(10–15 μL). The DNA bands were stained with
ethidium bromide (0.5 μg/mL) against the
GeneRuler 100 bp Plus ready–to–use DNA
ladder (Fermentas, Waltham, MA, USA) as a
molecular weight marker. A DNA gel
purification kit (Abgene, Portsmouth, NH, USA)
was used to purify the appropriate–sized PCR
amplicons from the gel. The sequencing
reactions were carried out with 10 µL and
contained 1 µL BigDye Terminator (BDT) v3.1
(Applied Biosystems, Waltham, MA, USA), 2
µL of BDT buffer, 0.16 µM of primer, and 1–2
µL of PCR product. Sequencing products were
purified with the DyeEx® 2.0 Spin Kit (Qiagen)
and run on a 3130xlGenetic Analyzer (Applied
Biosystems). The sequences were aligned and
compared with different trypanorhychid species
previously accessed in GenBank.
Phylogeny: Phylogenetic analysis and
evolutionary history for the isolated parasites
were carried out using the Maximum Likelihood
method and Tamura 3–parameter model. The
recovered sequences were aligned and compared
against Trypanorhyncha species previously
accessible in the GeneBank. Sequence identity
for the recovered data was checked using the
Basic Local Alignment Search Tool (BLAST,
available at
http://blast.ncbi.nlm.nih.gov/Blast.cgi). The
sequence trimming for the congeneric species
recovered was carried out by BIOEDIT v7.5.3;
sequence alignment was done by CLUSTAL W
v2 while the phylogenetic tree was constructed
using MEGA 7 programme.
RESULTS
Three species of trypanorhynch metacestodes
were isolated from the peritoneal cavity and
mesenteries of the examined fish as blastocysts.
Morsy et al.
74 Arq. Bras. Med. Vet. Zootec., v.75, n.1, p.71-82, 2023
All the included species represent the first
locality records in the investigated area. These
include: Gymnorhynchus isuri (Figure 1a)
isolated from the grey trigger fish Balistes
carolinensis (46.7%, 7/15), Pseudotobothrium
dipsacum (Figure 1b) from the mottled grouper
Mycteroperca rubra (50.0%, 10/20),
Heteronybelinia estigmena (Figure 1c) from the
common sole Solea vulgaris (76.5%, 13/17).
Worms were encapsulated within blastocysts;
after rupture, each blastocyst generated a post
larva called pleurocercus (Figure 1d; plural
pleurocerci).
Figure 1. (a–d) Photographs showing encapsulated blastocysts of trypanorhynch metacestodes (arrows) in
the peritoneal cavity of: (a) Balistes carolinensis; (b) Mycteroperca rubra; (c) Solea vulgaris; (g)
Blastocyst sheathed a post larvae (plerocercus), Bars: a-d 1 cm; d 0.2 cm.
Morphology and molecular…
Arq. Bras. Med. Vet. Zootec., v.75, n.1, p.71-82, 2023 75
Morphology:
Super family: Gymnorhynchoidea Dollfus (1935)
Family: Gymnorhynchidae Dollfus (1935)
Genus: Gymnorhynchus Rudolphi (1819)
Gymnorhynchus isuri Robinson (1959)
Description (based on 8 pleurocerci): The
capsule ranged from bladder–like to elongate and
was usually white; the blastocyst was 1500–2800
(2630) µm long. The post larva had an elongated
acraspedote and cylindrical scolex (Figure 2a)
that was 740–880 (800) µm long × 87–145 (102)
µm wide and featuring two short, auriculate,
bothridia 211–243 (237) µm long x 278 –386
(329) µm wide in lateral view with rounded
edges (Figure 3a, b). It is divided into four parts;
the anterior pars bothridialis, the middle pars
vaginalis, and the posterior pars bulbosa and pars
post bulbosa. The length of the pars vaginalis
was 351–483 (442) µm long, that of the pars
bulbosa was 244–392 (363) µm, and that of the
pars post bulbosa was 56–97 (72) µm. The
tentacles (Figure 2b, 3c) were relatively short
and tapered with corona of long falciform hooks
around base of tentacles, and spiral rows of
hooks, ascending from internal to external part of
tentacle. The tentacle sheaths were spiral and
tightly coiled. The tentacle bulbs (Figure 2c)
reached the end of the scolex, but they did not
occupy its entire width; they were about three
times longer than their width. The metabasal
armature was poeciloacanthous, with hollow
hooks began on the internal surface. The longest
hooks are in the middle row, 9 hooks/ row, 56–
188 long, 12–68 wide, hooks 4(4’) 60–195 long,
16–76 wide, hooks 5(5’) 64–196 long, 20–76
wide, hooks 6(6’) 40–192 long, 12–68 wide.
Hooks 7(7’)–9(9’), pointed, spiniform, becoming
smaller in size; hooks 7(7’) 36–168 long, 12–40
wide, hooks 8(8’) 32–124 long, 12–40 wide,
hooks 9(9’) 28–76 long, 8–28 wide. Figure 4 (a,
b), showing line diagrams for the recorded G.
isuri.
Figure 2. Photomicrographs of trypanorhynch
metacestodes, isolated from the examined fish
showing: (a–c) Gymnorhynchus isuri, (a) Entire
worm, lateral view, PB pars bothridialis, PV
pars vaginalis, PBL pars bulbulosa, PPB pars
post bulbulosa, BU bulbs, Bar 500 µm; (b) The
anterior part, BO bothridia, TS tentacle sheaths,
TE tentacles, Bar 200 µm; (c) Four bulbs (BU),
Bar 200 µm; (d). Pseudotobothrium dipsacum,
Entire worm, lateral view, Bar 500 µm; (e)
Heteronybelinia estigmena, Entire worm, lateral
view, Bar 200 µm.
Morsy et al.
76 Arq. Bras. Med. Vet. Zootec., v.75, n.1, p.71-82, 2023
Superfamily: Otobothrioidea Dollfus (1942)
Family: Otobothriidae Dollfus (1942)
Genus: Pseudotobothrium Linton (1897)
Pseudotobothrium dipsacum Linton (1897)
Description (based on 10 pleurocerci): Plerocerci
were isolated from club–shaped blastocysts with
a broad anterior and blunt posterior ends,
blastocysts were 1362–1857 (1557) µm long x
340–621 (566) µm wide at the broad end. The
post larva was found attached to one end of the
cyst by their heads (Figure 2d). Scolex
craspedote, 462–856 (738) µm long; the
maximum width was at mid–level of pars
bulbosa, 436–568 (511) µm; pars bothrialis 361–
495 (482) µm. Two patelliform notched bothria
were observed, 234–315 (291) µm long. The
length of the pars bothridialis was 163–195 µm,
that of the pars vaginalis was 75–96 µm, that of
the pars bulbosa was 22–35 µm. Pars post
bulbosa reduced. The four tentacle sheaths were
highly coiled and started from bothridial region
till the anterior end of each bulb without
tentacular swelling. The tentacular armature was
heteroacanthous, heteromorphous; at the distal
and metabasal regions consisted of longitudinal
rows of slender hooks (Figure 3d) which were
identical within each longitudinal row. Four
ovoid bulbs were observed, three times longer
than wide, 46–80 µm long x 15.1–19.6 µm wide.
Seven hooks were observed per row with
prominent space between in between. Hooks
1(1’) uncinate, 13–17 (15) µm long; hooks 2(2’)
smaller, uncinate, 10–14 (13) µm long, hooks
3(3’) uncinate, 11–15 (13) µm long; hooks 4(4’)
and 5(5’) uncinate, smaller, 10–13 (12) and 8–10
(9) µm long respectively; hooks 6(6’), 7(7’)
smaller, falcate, 2–6 (3) mm long, 1–5 (4) µm
long respectively. Figure 4 (c, d) showing line
diagrams for the recorded P. dipsacum.
Figure 3. Scanning electron micrographs showing: (a–c) Gymnorhynchus isuri, (a, b) Pars bothridialis
(PB), bothridia (BO), tentacles (TE), and tentacle sheaths (TS), Bar 100 µm, 50µm, (c) Tentacles and
hooks (HO), Bar 50µm; (d) Pseudotobothrium dipsacum, tentacles and hooks, Bar 20µm; (e, f)
Heteronybelinia estigmena, (e) Pars bothridialis and the four tentacles, Bar 100µm, (f) One tentacle and
their hooks, Bar 10µm.
Morphology and molecular…
Arq. Bras. Med. Vet. Zootec., v.75, n.1, p.71-82, 2023 77
Superfamily Tentacularioidea Poche (1926)
Family Tentaculariidae Poche (1926)
Genus Heteronybelinia Palm (1999)
Heteronybelinia estigmena Dollfus (1960)
Description (based on 8 pleurocerci): Plerocerci
were isolated as encapsulated larvae from
blastocysts which had broad anterior and tapered
posterior ends (Figure 2e), they were 423–644
(451) µm long x 122–203 (140) µm wide at the
broad end. Scolex short, with broad anterior and
posterior ends, 122–253 (189) µm long x 61–84
(066) µm wide at the bothridial region. The total
length/ bulbs ratio was 2.1–3.6 length of pars
bothridialis 44–68 (57) µm long, pars vaginalis
49–73 (55) µm long, pars bulbosa 35–46 (0.38)
µm long, pars post bulbosa reduced. The tentacle
sheaths 29–35 (32) µm long, tentacles reached
the apical end of the bulbs with no tentacular
swelling (Figure 3e). Bulbs 146–210 (177) µm
long x 7.5–18.1 (13.2) µm wide. The tentacular
armature was homeoacanthous and
heteromorphous, the hooks (Figure 3f) were
rose–thorn shaped and diminished in size
towards the basal part of the tentacle. Figure 4 (e,
f), showing line diagrams for the recorded H.
estigmena.
Figure 4. Line diagrams of trypanorhynch metacestodes isolated in the present study: Gymnorhynchus
isuri, (a) Entire worm, Bar 500µm; (b) Enlarged tentacle, Bar 20µm; Pseudotobothrium dipsacum, (c)
Entire worm, Bar 500µm; (d) Enlarged tentacle, Bar 20µm; Heteronybelinia estigmena, (e) Entire worm,
Bar 200µm; (f) Enlarged tentacle, Bar 300 µm. PB pars bothridialis, PV pars vaginalis, PBL pars
bulbulosa, PPB pars post bulbulosa, BO bothridia, TS tentacle sheaths, TE tentacles, HO hooks, BU
bulbs.
Morsy et al.
78 Arq. Bras. Med. Vet. Zootec., v.75, n.1, p.71-82, 2023
Molecular Study: A phylogenetic tree was
constructed from the sequences of the partial 18s
and 28s ribosomal RNA isolated from the three
species of trypanorhynchid larvae (Figure 5).
Calculating the estimates of evolutionary
divergence between sequences, the recovered
data were compared to the available sequences of
some Trypanorhyncha members recovered from
GenBank. According to the phylogenetic
analyses, there are four major lineages within the
order Trypanorhyncha: the first clade includes
the superfamilies “Lacistorhynchoidea”,
“Otobothrioidea ”, “Gymnorhynchoidea” and
“Tentacularioidea”. Members of the first major
lineage include monophyletic trypanorhych
cestodes of family Lacistorhynchidae and consist
of the genera Grillotia, Grillotiella,
Paragrillotia, Pseudogilquinia, Floriceps,
Lacistorhynchus, and Callitetrarhynchus.
Families Pseudotobothriidae , Otobothriidae are
the sister groups to this clade. The monophyletic
clade of Tentacularioidea has a sister group that
includes members of the family Tentaculariidae
and Sphyriocephalidae. Members of
Gymnorhynchidae and Phyllobothriidae are
sister groups to Gilquiniidae. The constructed
tree was polyphyletic and included the three
queued species in different clades. The query
sequences of the cestode parasite isolated from
B. carolinensis showed high similarity (identity
percentages of 98.91%, 96.58) with the
previously deposited sequences of G. isuri in
GenBank (DQ642909.1, MT667257.1). The
recovered sequences were deposited in GenBank
under accession number ON157059. The BLAST
results also indicated that the 18s rRNA
sequences of the cestode isolated from
Mycteroperca rubra showed different identities
from Pseudotobothrium species, which was
identified in GenBank. The maximum identity
was 98.40% with P. dipsacum (Acc. No.
AF286972.1), followed by 96.59% with P. balli
(FJ572959.1), and 94.20% with P. arii (Acc. No.
DQ642910); it was deposited in GenBank under
accession number ON139663. The 28s RNA
sequences of the parasite isolated from Solea
vulgaris yielded identity percentages with
Heteronybelinia species, 90.73% with 28s
ribosomal RNA sequences of H. yamagutii (Acc.
No. FJ572932.1), with a maximum identity was
95.25% with H. estigmena (Acc. No.
FJ572931.1) recovered from GenBank. The
recovered sequences were deposited in GenBank
under accession number ON139662.
DISCUSSION
There are 277 species of marine cestodes within
Trypanorhyncha Diesing (1863) that use
elasmobranches as their final hosts (Palm, 2004;
Palm et al., 2009). The present study provides
the first data on the spectrum of trypanorhynch
infestations among commercially important
teleost fishes from the Mediterranean Sea, as
illustrated through morphological and molecular
analyses. The three recovered metacestodes in
the present study possess most of the
characteristic features of the order
Trypanorhyncha, which include the following:
the presence of two or four bothria and a
tentacular apparatus with 4 eversible tentacles at
its apex; and tentacles that generally bear a
complex array of diverse hooks used to attach to
the mucosa of the gastrointestinal tract (Dollfus,
1942; Richmond and Caira, 1991; Campbell and
Beveridge, 1994; Palm, 1995, 1997; Morsy et al.,
2013). Cestodes in this group are unique because
a specialist can often identify the larval species,
usually in an invertebrate or teleost intermediate
host, simply by observing the morphology of the
scolex. The cestodes serve as a model group for
understanding the patterns of host specificity
(Palm and Caira, 2008), zoogeographic
distribution, and parasite evolution within the
marine ecosystem (Palm, 2004, Palm and
Klimpel, 2007, Palm et al., 2007, Palm et al.,
2009, Palm and Caira, 2008). The genus
Gymnorhynchus includes two species, namely G.
gigas and G. isuri (Knoff et al., 2007; Santoro et
al., 2020). The number of hooks in the basal
armature is the most conspicuous point of
differentiation; G. gigas has approximately a ring
of 18 large hooks in its basal armature, whereas
G. isuri has only a ring of 8 or 9 of widely
varying size (Caira and Bardos, 1996).
Morphology and molecular…
Arq. Bras. Med. Vet. Zootec., v.75, n.1, p.71-82, 2023 79
Figure 5. Phylogenetic analysis and evolutionary history using the Maximum Likelihood method and
Tamura 3-parameter model according to the parasites 18s and 28s rRNA sequence analyses, the
percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial
tree (s) for the heuristic search was obtained by applying the BioNJ method to a matrix of pairwise
distances estimated using the Maximum Composite Likelihood (MCL) approach. The tree is drawn to
scale, with branch lengths measured in the number of substitutions per site. This analysis involved 60
nucleotide sequences. There were a total of 1000 positions in the final dataset.
Morsy et al.
80 Arq. Bras. Med. Vet. Zootec., v.75, n.1, p.71-82, 2023
The lack of microtriches in several regions of the
scolex is in agreement with the observations of
Caira and Bardos (1996), who only detected
densely packed, slender, filiform microtriches on
distal bothrial surfaces. The recovered P.
dipsacum possessed a characteristic morphology
similar to the species previously described
trypanorynch cestodes of the genus
Pseudotobothrium (Dollfus, 1942; Carvajal and
Rego, 1985; Palm, 2004). It is one of the five
most common trypanorhynch species found in
teleosts on coral reefs by Beveridge et al. (2014).
Pseudotobothrium sp. showed remarkably low
specificity, it has been recorded previously from
three orders and seven families, it was previously
recorded from perciform fish teleosts of the
families Apogonidae, Carangidae, Labridae,
Lutjanidae, Serranidae; from Tetraodontiformes
fish of the family Balistidae and from
Scorpaeniformes fish of the family
Platycephalidae (Beveridge et al., 2014). The
absence of any detectable specificity in these
species leads to the prediction that further
sampling will lead to even larger host ranges for
these species. The morphological description of
Plerocercoids of P. dipsacum agrees with that
isolated from from Lutjanus argentimaculatus,
Pomadasys argenteus given by Al–Zubaidy and
Mhaisen (2011) from the Yemeni coasts of the
Red Sea and those of Beveridge et al. (2000)
from teloest fishes off Australian coasts. The
prevalence of infection reported in the present
study (50%) is higher than that reported from P.
maculates (22%) from the Northeast Brazilian
coastal waters (Palm, 1997) and from P.
argenteus (24%) and Thunnus tonggol (36.7%)
from the Red Sea (Al–Zubaidy and Mhaisen,
2011). Species of the genera Gymnorhynchus
occur as adults in pelagic fish, with the larval
stages infecting a wide range of teleosts and
sharks (Campbell and Beveridge, 1994; Palm,
2004). Our present description of the
trypanorhnch cestode isolated from Solea
vulgaris and the morphology of its
heteromorphous tentacular hooks assigns it to the
genus Heteronybelinia as described by Palm
(1999). Heteronybelinia estigmena is a typical
tentaculariid trypanorhynch, its scolex consisting
of a pedunculus scolecis bearing four anterior
bothria with free margins and four apical
tentacles. By comparison, the current specimen is
similar in morphology to H. alloiotica, H.
punctatissima and H. dakari, all are similar in
having a heteromorphous tentacular armature
with hooks diminishing in size towards the basal
part of the tentacle, with no characteristic basal
armature. Also, all these species have a very
similar scolex and hook morphology, mainly
differing from each other by a different bulb ratio
and different scolex proportions. H. alloiotica
differs from H. estigmena in having a bulb ratio
of about 4, H. punctatissima have a slightly
different bulb ratio and different scolex
dimensions, while the bulb ratio of H. dakari was
small (about 2.5:1). The parasite recorded in the
present study is very similar to H. estigmena
described by Dollfus (1960), both have similar
morphology as well as bulb ratios and the
presence of four tentacles equipped with solid,
homeomorphous hooks arranged in a
homeoacanthous pattern in accordance with
(Palm, 1995; Palm and Walter, 1999). The
phylogenetic analysis used 18s and 28s small
ribosomal RNA for the recovered metacestodes,
which led to the construction of multiple
alignments that supported the taxonomic position
of these parasites representing three genera:
Gymnorhynchus, Pseudotobothrium and
Heteronybelinia. These genera are sister taxons
to Pseudogilquinia pillersi, Otobothrium
penetrans, and Nybelinia sp., respectively, in
accordance with Olson et al. (2010). The
molecular evidence shows that Trypanorhncha
consists of four well–supported lineages, and
important morphological cross–linking has been
mapped, where the highly variable armature
pattern represents the main morphological
diagnostic tool. The molecular phylogeny and
tree topology in the present study are similar to
the cladistic analysis of trypanorhynch cestodes
reported by Palm (2004), where, there are four
lineages within Trypanorhyncha, the branch
including lacistorhynchoids consists of two main
paraphyletic clades: poeciloacanthous
multiatypical (Dasyrhynchus, Protogrillotia, and
Grillotia) and poeciloacanthous atypical
(Pseudotobothrium and Gymnorhynchus) with
heteroacanthous, heteromorphous tentacular
armature with a monophyletic sister taxon,
Otobothrium and pseudogilquinia species (Palm
and Overstreet, 2000, Palm et al., 2009). Also,
the monophyletic clade of superfamily
Tentacularioidea includes metacestodes of family
Tentaculariidae (Heteronybelinia) with
homeoacanthous and heteromorphous armature
with Nybelinia species of as sister taxons, this in
accordance with the study of Palm and
Overstreet (2000).
Morphology and molecular…
Arq. Bras. Med. Vet. Zootec., v.75, n.1, p.71-82, 2023 81
CONCLUSION
Both the molecular analysis and morphological
characterization performed in the present
study support the taxonomic identification of
four parasitic metacestodes: Gymnorhynchus
isuri, Pseudotobothrium dipsacum and
Heteronybelinia estigmena. To ensure good food
hygiene, trypanorhynch cestodes should be
removed from infected fish, as parasitized fish
are generally rejected by consumers due to their
repulsive appearance, and humans are at greater
risk for accidental infection and allergic reactions
following the ingestion of raw infected fish meat.
ACKNOWLEDGMENTS
The authors extend their appreciation to the
Deanship of Scientific Research at King Khalid
University for funding this work through the
Research Group Project under grant number
(R.G.P.2–72–43).
REFERENCES
AL QURAISHY, S.; DKHIL, M.A.M.; ABDEL–
GABER, R. et al. Morphological and molecular
insights of a new species of trypanorhynchid cestode
parasite, Nybelinia exostigmi, in the Narrowstripe
cardinal fish Apogon exostigma. Rev. Bras. Parasitol.
Vet., v.28, p.266-282, 2019.
AL–ZUBAIDY, A.B.; MHAISEN, F.T. First record of
Derogenes varicus and Dinurus scombri (Digenea:
Hemiurata) from Red Sea fishes, Yemen. Mesopot. J.
Mar. Sci., v.26, p.122-133, 2011.
BEVERIDGE, I.; BRAY, R.A.; CRIBB, T.H.;
JUSTINE, J.L. Diversity of trypanorhynch
metacestodes in teleost fishes from coral reefs off
eastern Australia and New Caledonia. Parasite, v.21,
p.60, 2014.
BEVERIDGE, I.; CAMPBELL, R.A.; JONES, M.K.
New records of the cestode genus Pseudotobothrium
(Trypanorhyncha: Otobothriidae) from Australian
fishes. Trans. R. Soc. S. Aust., v.124, p.151-162, 2000.
CAIRA, J.N.; BARDOS, T. Further information on
Gymnorhynchus isuri (Trypanorhyncha:
Gymnorhynchidae) from the shortfin mako shark. J.
Helminth. Soc. Wash., v.63, p.188-192, 1996.
CAIRA, J.N.; JENSEN, K. Tapeworms from
vertebrate bowels of the earth, Planetary Biodiversity
Inventory (2008–2017): University of Kansas, Natural
History Museum, Lawrence: [University of Kansas],
2017. (Special Publication No. 25).
CAMPBELL, R.A.; BEVERIDGE, I. Order
Trypanorhyncha Diesing, 1863. In: KHALIL, L.F.;
JONES, A.; BRAY, R.A. (Eds.). Keys to the cestode
parasites of vertebrates. Wallingford: CAB
International, 1994. p.51-148.
CARLETON, H. CARLETON'S histopathological
technique. 4.ed. New York: Oxi. Univ. Press, 1976.
CARVAJAL, J.; REGO, A.A. Critical studies on the
genus Callitetrarhynchus (Cestoda: Trypanorhyncha)
with recognition of Rhynchobothrium speciosum
Linton, 1897 as a valid species of the genus
Callitetrarhynchus. Syst. Parasitol., v.57, p.161-167,
1985.
DEARDORFF, R.B.; RAYBOURNE, R.B.; MATTIS,
T.E. Infections with trypanorhynch plerocerci
(Cestoda) in Hawaiiasn fishes of commercial
importance. Sea Grant. Quart., v.6, p.1-6, 1984.
DIESING, K.M. Sitzungsberichte der Kaiserlichen
Akademie der Wissenschaften, Mathematisch–
Naturwissenschaftliche Classe, Austria. Akad. Wiss.
Math. Naturwiss. Classe, v.48, p.200345, 1863.
DOLLFUS, R.P. Études critiques sur les
tetrarhynchiques du Muséum de Paris. Paris: Archives
du Muséum D'Histoire Naturelle, 1942.
DOLLFUS, R.P. Sur quelques parasites de poissons
recoltes a Castiglione (Algerie). Bull. Trav., v.2,
p.199-279, 1935.
DOLLFUS, R.P. Sur une collection de tetrarhynques
homeacanthes de la famille des tentaculariidae recotes
principalement dans la region de Dakar. Bull. Ins. Fr.
Afr. Noire, v.22, p.788-852, 1960.
ERGENS, R. The suitability of ammonium picrate-
glycerin in preparing slides of lower Monogenoidea.
Folia Parasitol., v. 16, p. 320, 1969.
GÒMEZ–MORALES, M.A.; LUDOVISI, A.;
GIUFFRA, E. et al. Allergenic activity of Molicola
horridus (Cestoda, Trypanorhyncha), a cosmopolitan
fish parasite, in a mouse model. Vet. Parasitol., v.157,
p.314-320, 2008.
JONES, M.K.; BEVERIDGE, I.; CAMPBELL, R.A.;
PALM, H.W. Terminology of the sucker-like organs
of the scolex of trypanorhynch cestodes. Syst
Parasitol., v. 59, p.121-126, 2004
KNOFF, M.; CLEMENTE, S.C.; PINTO, R.M.;
LANFREDI, R.M.; GOMES, D.C. Redescription of
Gymnorhynchus isuri (Cestoda: Trypanorhyncha)
from Isurus oxyrinchus (Elasmobranchii: Lamnidae).
Folia Parasitol., v.54, p.208-214, 2007.
KVACH, Y.; ONDRAČKOVÁ, M.; JANÁČ, M.;
JURAJDA, P. Methodological issues affecting the
study of fish parasites. III. Effect of fish preservation
method. Dis. Aquat. Organ., v.12, p.213-224, 2018.
MADDEN, P.A.; TROMBA, F.G. Scanning electron
microscopy of the lip denticles of Ascaris suum adults
of known ages. J. Parasitol., v.62, p.265-271, 1976.
Morsy et al.
82 Arq. Bras. Med. Vet. Zootec., v.75, n.1, p.71-82, 2023
MENEZES, P.Q.F.; KNOFF, M.; FELIZARDO, N.N.
et al. Callitetrarhynchus gracilis (Rudolphi, 1819)
Pintner, 1931 (Cestoda: Trypanorhyncha) parasitizing
the musculature of Sardinella brasiliensis
(Steindachner, 1879) (Actinopterygii) off the coast of
the state of Rio de Janeiro, Brazil. PLoS One, v.14,
p.e0206377, 2018.
MORSY, K.; BASHTAR, A.R.; ABDEL–GHAFFAR,
F. et al. First identification of four trypanorhynchid
cestodes: Callitetrarhynchus speciouses,
Pseudogrillotia sp. (Lacistorhynchidae), Kotorella
pronosoma and Nybelinia bisulcata (Tentaculariidae)
from Sparidae and Mullidae fish. Parasitol. Res.,
v.112, p.2523-2532, 2013.
OLSON, P.D.; CAIRA, J.N.; JENSEN, K. et al.
Evolution of the trypanorhynch tapeworms: parasite
phylogeny supports independent lineages of sharks
and rays. Int. J. Parasitol., v.40, p.223-242, 2010.
PALM H. W.; WALTER T. Nybelinia southwelli sp.
nov. (Cestoda: Trypanorhyncha) with the re–
description of N. perideraeus (Shipley & Hornell,
1906) and synonymy of N. herdmani (Shipley &
Hornell, 1906) with Kotorella pronosoma (Stossich,
1901). Bull. Br. Mus. Nat. His. Zool., v.65, p.123-131,
1999.
PALM, H.W. Nybelinia Poche, 1926, Heteronybelinia
gen. nov. and Mixonybelinia gen. nov. (Cestoda,
Trypanorhyncha) in the collections of the Natural
History Museum, London. Bull. Nat. Hist. Mus.
London Zoolog., v.65, p.133-153, 1999.
PALM, H.W. The Trypanorhyncha Diesing, 1863.
Borgo: PKSPL, IPB Press, 2004.
PALM, H.W. Trypanorhynch cestodes of commercial
fishes from Northeast Brazilian coastal waters. Mem.
Inst. Oswaldo Cruz., v.92, p.69-79, 1997.
PALM, H.W. Untersuchungen zur Systematik von
Rüsselbandwürmern (Cestoda: Trypanorhyncha) aus
atlantischen Fischen Christian–Albrechts–Universität
Kiel, Kiel, Germany, 238 pp. Ber. Inst. Meereskd.
Christian Albrechts Univ. Kiel, v.275, p.1-238, 1995.
PALM, H.W.; CAIRA, J.N. Host specificity of adult
versus larval cestodes of the elasmobranch tapeworm
order Trypanorhyncha. Int. J. Parasitol., v.38, p.381-
388, 2008.
PALM, H.W.; KLIMPEL, S. Evolution of parasitic
life in the ocean. Trends Parasitol., v.23, p.10-12,
2007.
PALM, H.W.; OVERSTREET, R.M. New records of
trypanorhynch cestodes from the Gulf of Mexico,
including Kotorella pronosoma (Stossich, 1901) and
Heteronybelinia palliata (Linton, 1924) comb. n.
Folia Parasitol., v.47, p.293-302, 2000.
PALM, H.W.; WAESCHENBACH, A.;
LITTLEWOOD, D.T. Genetic diversity in the
trypanorhynch cestode Tentacularia coryphaenae
Bosc, 1797: evidence for a cosmopolitan distribution
and low host specificity in the teleost intermediate
host. Parasitol. Res., v.101, p.153-159, 2007.
PALM, H.W.; WAESCHENBACH, A.; OLSON,
P.D.; LITTLEWOOD, D.T. Molecular phylogeny and
evolution of the Trypanorhyncha Diesing, 1863
(Platyhelminthes: Cestoda). Mol. Phylogenet. Evol.,
v.52, p.351-367, 2009.
RICHMOND, C.; CAIRA, J.N. Morphological
investigations into Floriceps minacanthus
(Trypanorhyncha: Lacistorhynchidae) with analysis of
the systematic utility of scolex microtriches. Syst.
Parasitol., v.19, p.25-32, 1991.
ROBINSON, E.S. Some new cestodes from New
Zealand marine fishes. Trans. R. Soc. N. Z., v.86,
p.381-392, 1959.
SANTORO, M.; IACCARI`NO, D.; BELLISARIO, B.
Host biological factors and geographic locality
influence predictors of parasite communities in
sympatric sparid fishes off the southern Italian coast.
Sci. Rep., v.10, p.13283, 2020.
VÁZQUEZ–LÓPEZ, C.; ARMAS–SERRA, C.;
BERNARDINA, W.; RODRÍGUEZ–CAABEIRO, F.
Oral inoculation with Gymnorhynchus gigas induces
anti–parasite anaphylatic antibody production in both
mice and rats and adverse reactions in challenge mice.
Int. J. Food Microbiol., v.64, p.307-315, 2001.
