Content uploaded by Tatjana Popović Milovanović
Author content
All content in this area was uploaded by Tatjana Popović Milovanović on Jan 29, 2023
Content may be subject to copyright.
Citation: Jeluši´c, A.; Mitrovi´c, P.;
Markovi´c, S.; Iliˇci´c, R.; Milovanovi´c,
P.; Stankovi´c, S.; Popovi´c
Milovanovi´c, T. Diversity of Bacterial
Soft Rot-Causing Pectobacterium
Species Affecting Cabbage in Serbia.
Microorganisms 2023,11, 335.
https://doi.org/10.3390/
microorganisms11020335
Academic Editor: Denis Faure
Received: 9 December 2022
Revised: 20 January 2023
Accepted: 27 January 2023
Published: 29 January 2023
Copyright: © 2023 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
microorganisms
Article
Diversity of Bacterial Soft Rot-Causing Pectobacterium Species
Affecting Cabbage in Serbia
Aleksandra Jeluši´c 1, * , Petar Mitrovi´c 2, Sanja Markovi´c 1, Renata Iliˇci´c 3, Predrag Milovanovi´c 4,
Slaviša Stankovi´c 5and Tatjana Popovi´c Milovanovi´c 6,*
1Institute for Multidisciplinary Research, University of Belgrade, Kneza Višeslava 1, 11030 Belgrade, Serbia
2Institute for Field and Vegetable Crops, National Institute of the Republic of Serbia, Maksima Gorkog 30,
21000 Novi Sad, Serbia
3Faculty of Agriculture, University of Novi Sad, Trg Dositeja Obradovi´ca 8, 21000 Novi Sad, Serbia
4Agrosava doo, Palmira Toljatija 5, 11070 Belgrade, Serbia
5Faculty of Biology, University of Belgrade, Studentski Trg 16, 11000 Belgrade, Serbia
6Institute for Plant Protection and Environment, Teodora Drajzer 9, 11040 Belgrade, Serbia
*Correspondence: jelusic.aleksandra@gmail.com (A.J.); tanjaizbis@gmail.com (T.P.M.)
Abstract:
The aim of this work was to identify and characterize the pectolytic bacteria responsible
for the emergence of bacterial soft rot on two summer cabbage hybrids (Cheers F1 and Hippo
F1) grown in the Futog locality (Baˇcka, Vojvodina), known for the five-century-long tradition of
cabbage cultivation in Serbia. Symptoms manifesting as soft lesions on outer head leaves were
observed during August 2021, while the inner tissues were macerated, featuring cream to black
discoloration. As the affected tissue decomposed, it exuded a specific odor. Disease incidence
ranged from 15% to 25%. A total of 67 isolates producing pits on crystal violet pectate (CVP)
medium were characterized for their phenotypic and genotypic features. The pathogenicity was
confirmed on cabbage heads. Findings yielded by the repetitive element palindromic-polymerase
chain reaction (rep-PCR) technique confirmed interspecies diversity between cabbage isolates, as
well as intraspecies genetic diversity within the P. carotovorum group of isolates. Based on multilocus
sequence typing (MLST) using genes dnaX,mdh,icdA, and proA, five representative isolates were
identified as Pectobacterium carotovorum (Cheers F1 and Hippo F1), while two were identified as
Pectobacterium versatile (Hippo F1) and Pectobacterium odoriferum (Hippo F1), respectively, indicating
the presence of diverse Pectobacterium species even in combined infection in the same field. Among
the obtained isolates, P. carotovorum was the most prevalent species (62.69%), while P. versatile and
P. odoriferum were less represented (contributing by 19.40% and 17.91%, respectively). Multilocus
sequence analysis (MLSA) performed with concatenated sequences of four housekeeping genes (proA,
dnaX,icdA, and mdh) and constructed a neighbor-joining phylogenetic tree enabled insight into the
phylogenetic position of the Serbian cabbage Pectobacterium isolates. Bacterium P. odoriferum was
found to be the most virulent species for cabbage, followed by P. versatile, while all three species
had comparable virulence with respect to potato. The results obtained in this work provide a better
understanding of the spreading routes and abundance of different Pectobacterium spp. in Serbia.
Keywords:
bacterial soft rot; cabbage; Pectobacterium spp.; MLSA; rep-PCR; pathogenicity; virulence
1. Introduction
Cabbage (Brassica oleracea var. capitata L.) is one of the world’s most important veg-
etable crops, as its high yield and adaptability have facilitated worldwide distribution [
1
].
Owing to the abundance of health-promoting phytochemicals (glucosinolates, polyphenols,
vitamins, and proteins), cabbage features in the traditional cuisine of many countries and
has also been traditionally used for medicinal purposes [
2
]. According to the data provided
by the Food and Agriculture Organization Corporate Statistical Database (FAOSTAT) for
2020, globally, about 2,414,288 ha were designated for cabbage cultivation [3].
Microorganisms 2023,11, 335. https://doi.org/10.3390/microorganisms11020335 https://www.mdpi.com/journal/microorganisms
Microorganisms 2023,11, 335 2 of 16
Futog, a suburban settlement located in the province of Vojvodina (Serbia), has been
known for cabbage cultivation since the 18th century [
4
]. However, numerous pests and
pathogens currently threaten cabbage production both in Serbia and worldwide, with
Pectobacterium species (fam. Enterobacteriaceae), the causative agents of bacterial soft rot
disease, being particularly harmful. The symptoms of infection with these pectinolytic
enterobacteria may be found in the cabbage fields during cultivation, as well as post-
harvest, during transport, storage, and marketing, leading to considerable yield reduction
and economic losses [
5
]. According to Bhat [
6
], bacterial soft rot causes greater total
post-harvest yield loss than any other bacterial disease. Losses on cabbage caused by
soft rot alone, or in combination with other storage issues, are estimated at 25–50% in a
single season in the USA, with the greatest loss occurring in New York and Wisconsin [
7
].
However, the extent of yield loss is influenced by pathogen
−
host specificity, as well as
numerous external factors (temperature, humidity, etc.) [
8
]. Although bacterial soft rot
is a disease that affects only agricultural and horticultural crops, the presence of the soft
rot-causing Pectobacteriaceae is not only limited to host plants but extends to the weed
species growing near the infected fields, as well as water, air, and soil, thus serving as a
potent source of inoculum [
9
]. In addition, soft rot-causing bacteria can survive in infected
fleshy organs during storage, as well as in debris, on roots or other parts of host plants, and
in the pupae of several insects [
10
]. Thus, the most likely entry routes for the pathogen
involve either roots or natural openings/mechanically created wounds on the upper plant
parts. Once inside the plant, the soft rot-causing bacteria begin to move and multiply in the
intercellular spaces, softening the affected tissues and transforming them into a slimy mass.
The slimy mass extrudes through cracks in the epidermis into the soil, or to other plants
that are placed in close proximity during storage, which subsequently become infected [
10
].
Bacterial survival in nature is dependent on various factors. For instance, their survival in
soil depends on soil pH, temperature, moisture, magnesium concentration, and calcium
nutrition and mostly takes up to six months in the absence of plant debris [
11
]. Temperature
greatly affects the survival as well as the pathogenicity of Pectobacterium species [12].
Scientific interest in Pectobacteria primarily stems from their broad host range and
an emerging genetic diversity associated with dynamic evolutionary processes, mainly
occurring through gene acquisition, genome rearrangement, and gene loss [
13
]. Acht-
man [
14
] pointed out that higher rates of divergence in Pectobacterium spp. were detected
on metabolic genes compared to the ribosomal operon and posited that the observed
changes may be related to the adaptation of strains to specific environmental niches. There-
fore, typing and analysis of several protein-coding loci (multilocus sequence typing and
analysis, MLST/MLSA) could allow the degree of phenotypic relatedness to be established
more reliably than is possible by analyzing 16S rRNA or some nonprotein-coding genes [
15
].
In extant research, different combinations of housekeeping genes have been used for MLST
and MLSA. For example, Ma et al. [
16
] examined seven genes (acnA,gapA,icdA,mdh,mtlD,
pgi, and proA) to reconstruct the phylogeny of the tested Pectobacterium and Dickeya strains,
due to (i) their proven ability to provide sufficient sequence diversity for distinguishing
closely related species, (ii) their ubiquity in most enterobacteria, and (iii) the involvement
of their products in diverse aspects of bacterial metabolism. Further, Moleleki et al. [
17
]
and Pitman et al. [
18
] reconstructed the phylogeny of P. wasabiae strains obtained from
potato grown in South Africa and New Zealand based on the gapA and mdh, and acnA
and mdh genes, respectively. In their work, Waleron et al. [
19
] used a combination of nine
housekeeping genes (gapA,gyrA,icdA,pgi,proA,recA,recN,rpoA, and rpoS) for MLSA of P.
zantedeschiae strains isolated from calla lily in central Poland and Serbia. On the other hand,
Markovi´c et al. [
20
] used a combination of genes dnaX,proA, and mdh to identify the causal
agents (P. versatile and P. carotovorum) of potato blackleg disease in Serbia. The gene dnaX
was shown to reliably distinguish between Pectobacterium and Dickeya isolates in several
prior studies focusing on the potato blackleg causal agents in different countries [
21
–
23
].
Considering the aforementioned factors (high discriminatory power and reproducibility)
and previous experience gained in working with plant pathogens within the Enterobacteri-
Microorganisms 2023,11, 335 3 of 16
aceae family, four housekeeping genes (i.e., dnaX,icdA,mdh, and proA) were utilized in the
present study for typing the pectolytic isolates obtained from cabbage.
Repetitive element palindromic PCR (rep-PCR) is widely recognized as a useful tech-
nique for profiling different Pectobacterium species. In their study, Norman et al. successfully
used rep-PCR with primers for BOX-, ERIC-, and REP-PCR for strain-level differentiation of
P. carotovorum populations isolated from nursery retention ponds and large hypereutrophic
lakes [
24
]. In addition to the aforementioned rep-PCR techniques (BOX-, ERIC-, and REP-
PCR), for the first time, Maisuria and Nerurkar [
25
] also used GTG
5
-PCR, due to its highest
discriminatory power, to differentiate P. carotovorum strains from soil and diseased fruits
and vegetables. According to Zoledowska et al. [
26
], REP-PCR is the most useful tool for
grouping P. parmentieri potato strains and is superior to BOX- and ERIC-PCR. Thus, as BOX-,
ERIC-, REP-, and GTG
5
-PCR are among the most commonly used rep-PCR methods for
DNA profiling and are proven to be sufficiently discriminative to reveal subtle differences
even among strains belonging to the same species, all four methods were adopted in the
present study.
According to Song et al. [
27
], P. carotovorum is ranked among the most common
causative agents of cabbage soft rot. Nonetheless, P. aroidearum,P. brasiliense,P. odoriferum,
P. polaris, and P. wasabiae species have also been reported to result in cabbage soft rot in
different countries [
28
–
33
]. In Serbia, different Pectobacterium species (i.e., P. atrosepticum,P.
brasiliense, P. carotovorum, P. punjabense, P. zantedeschiae, and P. versatile) have been isolated from
broccoli, calla lily, carrot, celery, parsley, potato, squash, and watermelon [19,20,23,34–39].
Given the expanding genetic diversity of Pectobacterium spp. and the lack of recent data
on the agents causing soft rot on cabbage in Serbia, the goal of this study was to contribute
to their identification and characterization based on molecular and pathogenic features.
2. Materials and Methods
2.1. Sample Collection and Pathogen Isolation
In August 2021, bacterial soft rot symptoms were noted on the summer cabbage
hybrids Cheers F1 (Takii Seed, Field I (geographic coordinates 45.2507100, 19.7247660)) and
Hippo F1 (Sakata Seed, Field II (geographic coordinates 45.2567200, 19.7275470)) grown
in two fields located in Futog (Baˇcka, Vojvodina) of 0.5 ha and 1 ha size, respectively.
Soft rot symptoms on outer leaves, along with deep maceration of inner head leaves
accompanied by black discoloration, were found on the inspected plants (Figure 1). Due to
decomposition, the affected tissue exuded a specific odor. Disease incidence in the visited
fields was estimated at 15−25%.
Microorganisms 2022, 10, x FOR PEER REVIEW 4 of 17
Figure 1. Bacterial soft rot symptoms in visited cabbage fields in Futog (Bačka, Vojvodina).
2.2. Pathogenicity on cabbage
The pathogenicity of 67 isolates obtained in this study was evaluated using cabbage
heads (unknown cultivar). Before inoculation, cabbage heads were washed under running
tap water, uniformly sprayed with 70% ethanol, and dried at room temperature. Isolates
used for inoculation were grown in nutrient broth (NB, HiMedia Laboratories) at 26 °C
for 48 h while shaking and were adjusted to approximately 1 × 108 CFU mL−1. Inoculations
were performed by puncturing holes in cabbage heads and filling them with bacterial sus-
pensions (~200 µ L). The assays were performed in two sets of three independent repli-
cates. Inoculated cabbage heads were placed in plastic boxes which were kept under room
temperature (25 ± 1 °C) and high humidity (90−100%) conditions. Sterile distilled water
(SDW) was used as a negative control, while the P. carotovorum strain Pcc10, previously
isolated from cabbage in Bosnia and Herzegovina [8], served as a positive control treat-
ment.
Cabbage heads were visually observed daily in order to monitor the occurrence of
soft rot symptoms and the disease progress until complete decay. Emergence of soft le-
sions around the holes 24 h after the inoculation of cabbage heads with the suspension of
tested isolates was considered a pectolytic-positive reaction.
2.3. Genotyping methods
2.3.1. DNA extraction
Genomic DNA from the 67 cabbage isolates was extracted according to the hexa-
decyltrimethylammonium bromide (CTAB) procedure described previously by Popović
et al. [43].
2.3.2. Preliminary identification
All cabbage isolates were preliminarily identified using specific primers
(F0145/E2477) designed based on the partial sequence of gene pmrA (response regulator)
of P. carotovorum [44]. The sequences of the used primers are listed in Table 1. PCR ampli-
fications were performed in a mixture (25 µL) consisting of Thermo Scientific DreamTaq
PCR Master Mix (2×) (12.5 µ L), nuclease-free water (Thermo ScientificTM, Waltham, MA,
USA ) (9.5 µ L), 10 µM primers (forward/reverse) (1 µL each), and sample DNA (1 µ L),
according to the conditions proposed by Kettani-Halabi et al. [44]. Presence of a band in
the searched position of 666 bp was checked on 1% agarose gel in relation to the positive
control P. carotovorum strain Pcc10 and 200–10,000 bp SmartLadder MW-1700-10 (Euro-
gentec).
Figure 1. Bacterial soft rot symptoms in visited cabbage fields in Futog (Baˇcka, Vojvodina).
Microorganisms 2023,11, 335 4 of 16
Prior to isolation, collected samples were washed under running tap water and dried
on filter paper at room temperature. Isolations were performed on crystal violet pectate
(CVP) media [
40
] from the small leaf sections (2–3 mm) that encompassed the transition
zones between healthy and diseased tissue. CVP plates were incubated at 26
◦
C. All bacte-
rial colonies forming characteristic cavities on the medium were selected and transferred
onto nutrient agar (NA) [
41
] to obtain pure cultures. Isolates were long-term stored at
−80 ◦C in lysogeny broth (LB) [42] supplemented with 30% (v/v) of sterile glycerol.
2.2. Pathogenicity on Cabbage
The pathogenicity of 67 isolates obtained in this study was evaluated using cabbage
heads (unknown cultivar). Before inoculation, cabbage heads were washed under running
tap water, uniformly sprayed with 70% ethanol, and dried at room temperature. Isolates
used for inoculation were grown in nutrient broth (NB, HiMedia Laboratories) at 26
◦
C for
48 h while shaking and were adjusted to approximately 1
×
10
8
CFU mL
−1
. Inoculations
were performed by puncturing holes in cabbage heads and filling them with bacterial
suspensions (~200
µ
L). The assays were performed in two sets of three independent repli-
cates. Inoculated cabbage heads were placed in plastic boxes which were kept under room
temperature (25
±
1
◦
C) and high humidity (90
−
100%) conditions. Sterile distilled water
(SDW) was used as a negative control, while the P. carotovorum strain Pcc10, previously
isolated from cabbage in Bosnia and Herzegovina [
8
], served as a positive control treatment.
Cabbage heads were visually observed daily in order to monitor the occurrence of soft
rot symptoms and the disease progress until complete decay. Emergence of soft lesions
around the holes 24 h after the inoculation of cabbage heads with the suspension of tested
isolates was considered a pectolytic-positive reaction.
2.3. Genotyping Methods
2.3.1. DNA Extraction
Genomic DNA from the 67 cabbage isolates was extracted according to the hex-
adecyltrimethylammonium bromide (CTAB) procedure described previously by Popovi´c
et al. [43].
2.3.2. Preliminary Identification
All cabbage isolates were preliminarily identified using specific primers (F0145/E2477)
designed based on the partial sequence of gene pmrA (response regulator) of P. carotovo-
rum [
44
]. The sequences of the used primers are listed in Table 1. PCR amplifications were
performed in a mixture (25
µ
L) consisting of Thermo Scientific DreamTaq PCR Master Mix
(2
×
) (12.5
µ
L), nuclease-free water (Thermo Scientific
TM
, Waltham, MA, USA) (9.5
µ
L),
10
µ
M primers (forward/reverse) (1
µ
L each), and sample DNA (1
µ
L), according to the con-
ditions proposed by Kettani-Halabi et al. [
44
]. Presence of a band in the searched position
of 666 bp was checked on 1% agarose gel in relation to the positive control P. carotovorum
strain Pcc10 and 200–10,000 bp SmartLadder MW-1700-10 (Eurogentec).
Table 1. Primers used in this study.
Primer Sequence (50-30)Reference
Pectobacterium-specific primers
F0145
TACCCTGCAGATGAAATTATTGATTGTTGAAGAC
[44]
E2477 TACCAAGCTTTGGTTGTTCCCCTTTGGTCA
Primers for rep-PCR
ERIC1R ATGTAAGCTCCTGGGGATTCAC
[45]
ERIC2 AAGTAAGTGACTGGGGTGAGCG
REP1R-I IIIICGICGICATCIGGC
REP2-I ICGICTTATCIGGCCTAC
BOXA1R CTACGGCAAGGCGACGCTGACG
GTG5GTGGTGGTGGTGGTG [46]
Microorganisms 2023,11, 335 5 of 16
Table 1. Cont.
Primer Sequence (50-30)Reference
Primers for MLST
dnaX-F TATCAGGTYCTTGCCCGTAAGTGG [22]
dnaX-R TCGACATCCARCGCYTTGAGATG
icdA400F GGTGGTATCCGTTCTCTGAACG
[16]
icdA977R TAGTCGCCGTTCAGGTTCATACA
proAF1 CGGYAATGCGGTGATTCTGCG
proAR1 GGGTACTGACCGCCACTTC
mdh2 GCGCGTAAGCCGGGTATGGA [17]
mdh4 CGCGGCAGCCTGGCCCATAG
2.3.3. Repetitive Element Palindromic PCR (Rep-PCR)
Genetic diversity among the obtained 67 cabbage isolates was evaluated using the
rep-PCR fingerprinting method with two oligonucleotide primer pairs [ERIC1R/ERIC2
(ERIC-PCR) and REP1R-I/ REP2-I (REP-PCR)] and two single oligonucleotide primers
[BOXA1R (BOX-PCR) and GTG
5
(GTG
5
-PCR)] corresponding to the interspersed repetitive
sequence elements. Primer sequences of the used primers are listed in Table 1. The PCR
mixture (25
µ
L) comprised 12.5
µ
L of Thermo Scientific DreamTaq PCR Master Mix (2
×
),
9.5
µ
L of nuclease-free water (Thermo Scientific
TM
, Waltham, MA, USA), 1
µ
L of each
(forward/reverse) primer (10
µ
M) and 1
µ
L of sample DNA. PCR amplifications for BOX-,
ERIC-, and REP-PCR were performed under the conditions proposed by Louws et al. [
45
],
while the methodology described by Versalovic et al. [
46
] was adopted for GTG
5
-PCR. After
amplification, PCR products (5
µ
L) were mixed with DNA Gel Loading Dye (6X) (Thermo
Scientific
TM
, Waltham, MA, USA) (2
µ
L) and were visualized on 2% agarose gel (FastGene
®
)
strained with Midori Green Advance (Nippon Genetics Europe, Düren, Germany). PCR
products were electrophoretically separated for 2.5 h (at 90 V and 300 mA) before being
checked under a UV transilluminator. The obtained patterns were compared using PyElph
1.4 program and were subsequently used for the construction of the unweighted pair group
method with arithmetic mean (UPGMA) phylogenetic tree. To easily compare the patterns
obtained with each of the four used rep-PCR primers and to select all isolates that were
potentially genetically different, each tree cluster, representing one DNA fingerprinting
pattern, was provided with a number (DNA fingerprinting group). One isolate representing
each combination of obtained DNA fingerprinting groups was randomly selected for further
characterization (MLST and MLSA, and virulence assessment).
2.3.4. Multilocus Sequence Typing and Analysis (MLST/MLSA)
DNA of the seven selected representative cabbage isolates (Pc2321, Pc3821, Pc4821,
Pc5421, Pv6321, Po7521, and Pc8321) was amplified with the primers produced based on
the partial sequences of four housekeeping genes (dnaX (dnaX-F/dnaX-R), icdA (icdA400F/
icdA977R), mdh (mdh2/mdh4),and proA (proAF1/proAR1)), encoding DNA polymerase
III subunit tau, isocitrate dehydrogenase, malate dehydrogenase, and gamma-glutamyl
phosphate reductase, respectively. Primer sequences of the used primers are listed in Table 1.
For all reactions, PCR mixtures were created as described in the previous subsection for
rep-PCR. PCR amplifications were performed under the conditions described by Sławiak
et al. [
22
] for the gene dnaX, while those reported by Ma et al. [
16
] were adopted for the
genes icdA and proA, and the strategy employed by Moleleki et al. [
17
] was utilized for
the gene mdh. Presence of bands in the searched positions was checked on 1% agarose gel
in relation to 200–10,000 bp SmartLadder MW-1700-10 (Eurogentec). PCR products were
purified using the Qiagen QIAquick PCR Purification Kit before being sent to the Eurofins
Genomics’ DNA sequencing service (Germany) for sequencing. The obtained sequences
were manually checked for quality and were compared with the strains deposited in
the National Center for Biotechnology Information (NCBI) database using the nucleotide
Microorganisms 2023,11, 335 6 of 16
BLAST (BLASTn) tool. All newly identified sequences were deposited to the NCBI database
to obtain the accession numbers.
The phylogenetic position of the seven representative isolates was determined in
relation to 19 strains of three Pectobacterium species, i.e., P. odoriferum (CFBP 1878, BC
S7, and JK2.1), P. carotovorum (ATCC 15713, 25.1, WPP14, BP201601.1, JR1.1, XP-13, and
Pcc2520), and P. versatile (14A, 3-2, SCC1, F131, DSM 30169, MYP201603, SR1, SR12, and
Pv1520) isolated from different hosts (cabbage, carrot, Chinese cabbage, chicory, coleslaw,
cucumber, kimchi cabbage, potato, and radish) and countries (Belarus, China, Denmark,
Finland, France, Germany, Russia, Serbia, South Korea, and the USA) and retrieved from
the NCBI database (Table 2). A neighbor-joining (NJ) phylogenetic tree was constructed
based on the concatenated sequences (1639 nt) of genes dnaX (416 nt), icdA (479 nt), mdh
(240 nt), and proA (504 nt). Before the tree construction, the sequences of all genes were
aligned to the same size using the biological sequence alignment editor BioEdit 7.2 program
and the ClustalW Multiple alignment tool. The tree was constructed in MEGA7 Software
and was rooted with the Dickeya solani strain RNS 05.1.2A (Accession No. CP104920).
Table 2.
List of the comparative Pectobacterium spp. strains used for phylogenetic analysis with
GenBank accession numbers.
Strain aIsolation Source Locality Year GenBank Accession Numbers
dnaX icdA mdh proA
Pectobacterium odoriferum
CFBP 1878 TChicory France 1978
MK516907
JF926783 JF926793 JF926823
BC S7 Chinese cabbage Beijing (China) 2007 CP009678 CP009678 CP009678 CP009678
JK2.1 Kimchi cabbage South Korea 2016 CP034938 CP034938 CP034938 CP034938
Pectobacterium carotovorum
ATCC 15713
TPotato Denmark 1952
MW979047
FJ895850 FJ895851 FJ895853
25.1 Cucumber Svietlahorsk (Belarus) 2009 CP088019 CP088019 CP088019 CP088019
WPP14 Potato Wisconsin (USA) 2015 CP051652 CP051652 CP051652 CP051652
BP201601.1 Potato Boseong (South Korea) 2016 CP034236 CP034236 CP034236 CP034236
JR1.1 Radish South Korea 2016 CP034237 CP034237 CP034237 CP034237
XP-13 Potato Zhouning (China) 2018 CP063242 CP063242 CP063242 CP063242
Pcc2520 Potato Serbia 2020
MW805307
OP751390 OP751392 OP751393
Pectobacterium versatile
14A Potato Minsk (Belarus) 1978 CP034276 CP034276 CP034276 CP034276
3-2 Potato Minsk (Belarus) 1979 CP024842 CP024842 CP024842 CP024842
SCC1 Potato Finland 1982 CP021894 CP021894 CP021894 CP021894
F131 Potato Moscow (Russia) 1993 CP065030 CP065030 CP065030 CP065030
DSM 30169 Cabbage Germany 2010 CP065143 CP065143 CP065143 CP065143
MYP201603 Potato Miryang (South Korea) 2013 CP051628 CP051628 CP051628 CP051628
SR1 Carrot Iowa, Ames (USA) 2019 CP084656 CP084656 CP084656 CP084656
SR12 Coleslaw Iowa, Ames (USA) 2019 CP084654 CP084654 CP084654 CP084654
Pv1520 Potato Serbia 2020
MW805306
OP751391
MZ682621 MZ682624
aType strains are marked with the superscript T.
2.4. Virulence Assessment
The virulence potential of the seven representative cabbage isolates (Pc2321, Pc3821,
Pc4821, Pc5421, Pv6321, Po7521, and Pc8321) was assessed using cabbage heads (unknown
cv.) and potato tubers (cv. Arizona). Prior to inoculation, cabbage heads and potato
tubers were sterilized as previously described (Section 2.2), and approximately 100 surface
punctures (around 5 mm in depth) were made using a needle to allow bacteria to penetrate
the tissue. Bacterial suspensions were prepared as described for the pathogenicity test
(Section 2.2) and SDW was used as a negative control. Inoculations were performed by
spraying cabbage heads/potato tubers as uniformly as possible, making sure to cover the
entire outer surface. The experiment was conducted in three independent replicates, with
three cabbage heads (nine in total per isolate) and five potato tubers (15 in total per isolate)
Microorganisms 2023,11, 335 7 of 16
for each replicate. Two experiments—for disease progress rating five and seven days after
inoculation (d.a.i.), respectively—were performed in parallel. For both experiments, the
initial weights of cabbage heads and potato tubers were recorded. To obtain statistically
comparable results, sums of the initial weights for each of the tested cabbage isolates were
almost equal. The inoculated cabbage heads and potato tubers were placed in plastic
boxes under high humidity conditions (90
−
100%). The experiment was performed during
summer when the room temperature was 28 ±2◦C.
Cabbage heads and potato tubers were weighed, whereby the mean values of the
initial and the final (5 and 7 d.a.i.) weights were used to calculate the disease progress
curve (AUDPC) according to the following equation:
AUDPC =
n−1
∑
i=1yi+yi+1
2(ti+1−ti)(1)
where y
i
= disease progress assessment at the ith observation, t
i
= time (days) at the ith
observation, and n= total number of observations.
All obtained values were statistically processed using Minitab 21 Statistical Software,
whereby one-way analysis of variance (one-way ANOVA) was performed, and the resulting
values were compared using Tukey’s honestly significant difference (HSD) test. Values
having p< 0.05 were considered statistically significant.
3. Results
3.1. Isolation, Preliminary Identification, and Pathogenicity
In this study, 67 isolates were selected from cabbage hybrids Cheers F1 (34 isolates)
and Hippo F1 (33 isolates), forming characteristic cavities on CVP medium and small,
whitish, irregularly shaped colonies on NA (Table 3). All isolates produced bands at 666 bp
after amplification with the Pectobacterium-specific primer pair F0145/E2477 (Table 3).
Table 3.
Serbian cabbage Pectobacterium spp. isolates used in the present study, the hybrid they
originate from, pectolytic activity, confirmation with Pectobacterium-specific primers, and DNA
fingerprinting group affiliation.
Isolate Code Hybrid Pectolytic
Activity
Genus
Confirmation
DNA Fingerprinting Group
BOX ERIC GTG5REP
Pc2021 Cheers F1 ++ IIII
Pc2121 Cheers F1 + + I I I I
Pc2221 Cheers F1 + + I I I I
Pc2321 Cheers F1 + + I I I I
Pc2421 Cheers F1 + + I I I I
Pc2521 Cheers F1 + + I I I I
Pc2621 Cheers F1 + + I I I I
Pc2721 Cheers F1 + + I I I I
Pc2821 Cheers F1 + + I I I I
Pc3121 Cheers F1 + + II II II II
Pc3221 Cheers F1 + + II II II II
Pc3321 Cheers F1 + + II II II II
Pc3421 Cheers F1 + + II II II II
Pc3521 Cheers F1 + + II II II II
Pc3621 Cheers F1 + + II II II II
Pc3721 Cheers F1 + + II II II II
Pc3821 Cheers F1 + + II II II II
Pc3921 Cheers F1 + + II II II II
Pc4221 Cheers F1 + + III II III III
Pc4321 Cheers F1 + + III II III III
Pc4421 Cheers F1 + + III II III III
Pc4521 Cheers F1 + + III II III III
Microorganisms 2023,11, 335 8 of 16
Table 3. Cont.
Isolate Code Hybrid Pectolytic
Activity
Genus
Confirmation
DNA Fingerprinting Group
BOX ERIC GTG5REP
Pc4621 Cheers F1 + + III II III III
Pc4721 Cheers F1 + + III II III III
Pc4821 Cheers F1 + + III II III III
Pc4921 Cheers F1 + + III II III III
Pc5021 Cheers F1 + + IV III IV III
Pc5121 Cheers F1 + + IV III IV III
Pc5221 Cheers F1 + + IV III IV III
Pc5321 Cheers F1 + + IV III IV III
Pc5421 Cheers F1 + + IV III IV III
Pc5521 Cheers F1 + + IV III IV III
Pc5621 Cheers F1 + + IV III IV III
Pc5721 Cheers F1 + + IV III IV III
Pv1021 Hippo F1 + + V IV V IV
Pv1121 Hippo F1 + + V IV V IV
Pv1221 Hippo F1 + + V IV V IV
Pv1321 Hippo F1 + + V IV V IV
Pv1421 Hippo F1 + + V IV V IV
Pv1521 Hippo F1 + + V IV V IV
Pv1621 Hippo F1 + + V IV V IV
Pv6121 Hippo F1 + + V IV V IV
Pv6221 Hippo F1 + + V IV V IV
Pv6321 Hippo F1 + + V IV V IV
Pv6421 Hippo F1 + + V IV V IV
Pv6521 Hippo F1 + + V IV V IV
Pv6621 Hippo F1 + + V IV V IV
Po7021 Hippo F1 + + VI V VI V
Po7121 Hippo F1 + + VI V VI V
Po7221 Hippo F1 + + VI V VI V
Po7321 Hippo F1 + + VI V VI V
Po7421 Hippo F1 + + VI V VI V
Po7521 Hippo F1 + + VI V VI V
Po9121 Hippo F1 + + VI V VI V
Po9221 Hippo F1 + + VI V VI V
Po9321 Hippo F1 + + VI V VI V
Po9421 Hippo F1 + + VI V VI V
Po9521 Hippo F1 + + VI V VI V
Po9621 Hippo F1 + + VI V VI V
Pc8021 Hippo F1 + + VII VI VII VI
Pc8121 Hippo F1 + + VII VI VII VI
Pc8221 Hippo F1 + + VII VI VII VI
Pc8321 Hippo F1 + + VII VI VII VI
Pc8421 Hippo F1 + + VII VI VII VI
Pc8521 Hippo F1 + + VII VI VII VI
Pc8621 Hippo F1 + + VII VI VII VI
Pc8721 Hippo F1 + + VII VI VII VI
All isolates marked in bold are used as representatives in this study.
The pathogenicity of all cabbage isolates was confirmed on cabbage heads by visually
identifying irregularly shaped soft lesions (approximately 3
−
5 cm in diameter) around
the inoculation points (holes) 1 d.a.i. The diameter of decomposing tissue enlarged daily,
and the affected area spread from the outer leaves to the inner tissues, while causing tissue
discoloration from cream to black. At 5 d.a.i., cabbage heads were almost completely
macerated and exuded a specific odor.
Microorganisms 2023,11, 335 9 of 16
3.2. Genetic Characterization
3.2.1. Rep-PCR
The UPGMA trees showing genetic diversity among the 67 tested cabbage isolates—
constructed based on the obtained BOX-, ERIC-, GTG
5
-, and REP-PCR banding patterns—
are shown in Figure S1, which also features virtual gel images of rep-PCR patterns cor-
responding to each group of isolates. Based on the differences found, each tree cluster
was assigned a different number: BOX (I–VII), ERIC (I–VI), GTG
5
(I-VII), and REP (I–VI)
(Table 3). The obtained results indicate that the tested isolates are genetically diverse. BOX-
and GTG
5
-PCR generated seven (I-VII), while ERIC- and REP-PCR generated six distinct
banding patterns (I-VI). Based on the BOX- and GTG
5
-PCR findings, isolates were divided
into the same seven groups, namely
I:
Pc2021–Pc2821,
II:
Pc3121–Pc3921,
III:
Pc4221–
Pc4921,
IV:
Pc5021–Pc5721,
V:
Pv1021–Pv1621 and Pv6121–Pv6621,
VI:
Po7021–Po7521
and Po9121–Po9621, and
VII:
Pc8021–Pc8721 (Table 3). However, ERIC- and REP-PCR did
not separate the isolates into six identical groups. ERIC-PCR implied the homogeneity
of isolates Pc3121–Pc3921 and Pc4221–Pc4921 by placing them in the same tree cluster
(DNA fingerprinting group
II
), while REP-PCR indicated homogeneity of isolates Pc4221–
Pc4921 and Pc5021–Pc5721 (DNA fingerprinting group
III
) (Table 3). The distribution of
the remaining isolates within the UPGMA groups remained the same and coincided with
that obtained for BOX- and GTG
5
-PCR. Based on the combined results obtained with all
four primers, seven isolates (Pc2321, Pc3821, Pc4821, Pc5421, Pv6321, Po7521, and Pc8321),
each representing one group on the UPGMA tree (i.e., one DNA banding pattern), were
randomly selected for further characterization.
3.2.2. MLST and MLSA
Based on the NCBI BLASTn analysis, five representative cabbage isolates (Pc2321,
Pc3821, Pc4821, Pc5421, and Pc8321) were identified as P. carotovorum (representing the
group of isolates Pc2021, Pc2121, Pc2221, Pc2321, Pc2421, Pc2521, Pc2621, Pc2721, Pc2821,
Pc3121, Pc3221, Pc3321, Pc3421, Pc3521, Pc3621, Pc3721, Pc3821, Pc3921, Pc4221, Pc4321,
Pc4421, Pc4521, Pc4621, Pc4721, Pc4821, Pc4921, Pc5021, Pc5121, Pc5221, Pc5321, Pc5421,
Pc5521, Pc5621, Pc5721, Pc8021, Pc8121, Pc8221, Pc8321, Pc8421, Pc8521, Pc8621, and
Pc8721), one representative cabbage isolate (Pv6321) was identified as P. versatile (represent-
ing the group of isolates Pv1021, Pv1121, Pv1221, Pv1321, Pv1421, Pv1521, Pv1621, Pv6121,
Pv6221, Pv6321, Pv6421, Pv6521, and Pv6621), and one isolate Po7521 was identified as
P. odoriferum (representing the group of isolates Po7021, Po7121, Po7221, Po7321, Po7421,
Po7521, Po9121, Po9221, Po9321, Po9421, Po9521, and Po9621), with the percent identity
in the 97.76–100%, 99.78–100%, and 99.57–100% range, respectively, depending on the
sequenced gene (dnaX,icdA,mdh, and proA), as shown in Table 4. Accordingly, P. carotovo-
rum was the most prevalent species (62.69%), while P. versatile and P. odoriferum were less
represented (contributing by 19.40% and 17.91%, respectively). The sequences obtained
for the seven representative cabbage isolates were deposited in the GenBank under the
following accession numbers: OP729211-OP729217 (dnaX), OP729218-OP729224 (icdA),
OP729225-OP729231 (mdh), and OP729232-OP729238 (proA).
The NJ phylogenetic tree generated based on the concatenated sequences of genes
dnaX, icdA,mdh, and proA is presented in Figure 2. Based on these genes, the tested and
comparative P. carotovorum,P. versatile, and P. odoriferum isolates/strains were separated
into three clusters within the tree, each corresponding to one species. However, genetic
heterogeneity (i.e., intraspecies genetic diversity) was observed within each species. Five
of the seven tested cabbage P. carotovorum isolates examined in this study were separated
into four groups (
I:
Pc2321 and Pc4821,
II:
Pc3821,
III:
Pc5421, and
IV:
Pc8321) within the
cluster. The remaining tested P. versatile isolate Pv6321 was the most closely related to the
comparative P. versatile strain DSM 30169 isolated from cabbage in Germany, while the
P. odoriferum isolate Po7521 was most similar to the type P. odoriferum strain CFBP 1878
isolated from chicory in France. D. solani strain RNS 05.1.2A was placed on a monophyletic
tree branch as an outgroup.
Microorganisms 2023,11, 335 10 of 16
Table 4.
The list of the 67 Serbian cabbage Pectobacterium spp. isolates and species affiliation, with the
percent identity of the sequenced isolates based on the partial sequences of four sequenced genes
(dnaX,icdA,mdh, and proA).
Isolate Code Hybrid Identification According to the NCBI BLASTn (Per. Ident)
Species dnaX icdA mdh proA
Pc2321 (group Pc2021–Pc2821) Cheers F1 P. carotovorum 99.79% 99.81% 99.75% 100%
Pc3821 (group Pc3121–Pc3921) Cheers F1 P. carotovorum 99.79% 100% 100% 99.25%
Pc4821 (group Pc4221–Pc4921) Cheers F1 P. carotovorum 100% 100% 99.75% 99.85%
Pc5421 (group Pc5021–Pc5721) Cheers F1 P. carotovorum 99.36% 99.44% 99.02% 97.76%
Pv6321 (group Pv1021–Pv1621,
Pv6121–Pv6621) Hippo F1 P. versatile 99.78% 100% 100% 99.85%
Po7521 (group Po7021–Po7521,
Po9121–Po9621) Hippo F1 P. odoriferum 99.79% 100% 100% 99.57%
Pc8321 (group Pc8021–Pc8721) Hippo F1 P. carotovorum 100% 100% 100% 97.91%
Microorganisms 2022, 10, x FOR PEER REVIEW 11 of 17
Figure 2. The neighbor-joining phylogenetic tree constructed based on the concatenated sequences
of genes dnaX, icdA, mdh, and proA for seven representative P. carotovorum , P. odoriferum , and
P. versatile isolates examined in this study and 19 strains of P. carotovorum, P. odoriferum, and P.
versatile isolated from various hosts and countries, which were retrieved from the GenBank. The
tree was rooted with the D. solani strain RNS 05.1.2A.
3.3. Virulence assessment
The developed disease symptoms observed seven days after the spray-inoculation of
cabbage heads and potato tubers with suspensions of the tested isolates are presented in
Figure 3.
Figure 2.
The neighbor-joining phylogenetic tree constructed based on the concatenated sequences
of genes dnaX,icdA,mdh, and proA for seven representative P. carotovorum
Microorganisms 2022, 10, x FOR PEER REVIEW 11 of 17
Figure 2. The neighbor-joining phylogenetic tree constructed based on the concatenated sequences
of genes dnaX, icdA, mdh, and proA for seven representative P. carotovorum , P. odoriferum , and
P. versatile isolates examined in this study and 19 strains of P. carotovorum, P. odoriferum, and P.
versatile isolated from various hosts and countries, which were retrieved from the GenBank. The
tree was rooted with the D. solani strain RNS 05.1.2A.
3.3. Virulence assessment
The developed disease symptoms observed seven days after the spray-inoculation of
cabbage heads and potato tubers with suspensions of the tested isolates are presented in
Figure 3.
,P. odoriferum
Microorganisms 2022, 10, x FOR PEER REVIEW 11 of 17
Figure 2. The neighbor-joining phylogenetic tree constructed based on the concatenated sequences
of genes dnaX, icdA, mdh, and proA for seven representative P. carotovorum , P. odoriferum , and
P. versatile isolates examined in this study and 19 strains of P. carotovorum, P. odoriferum, and P.
versatile isolated from various hosts and countries, which were retrieved from the GenBank. The
tree was rooted with the D. solani strain RNS 05.1.2A.
3.3. Virulence assessment
The developed disease symptoms observed seven days after the spray-inoculation of
cabbage heads and potato tubers with suspensions of the tested isolates are presented in
Figure 3.
, and
P. versatile
Microorganisms 2022, 10, x FOR PEER REVIEW 11 of 17
Figure 2. The neighbor-joining phylogenetic tree constructed based on the concatenated sequences
of genes dnaX, icdA, mdh, and proA for seven representative P. carotovorum , P. odoriferum , and
P. versatile isolates examined in this study and 19 strains of P. carotovorum, P. odoriferum, and P.
versatile isolated from various hosts and countries, which were retrieved from the GenBank. The
tree was rooted with the D. solani strain RNS 05.1.2A.
3.3. Virulence assessment
The developed disease symptoms observed seven days after the spray-inoculation of
cabbage heads and potato tubers with suspensions of the tested isolates are presented in
Figure 3.
isolates examined in this study and 19 strains of P. carotovorum,P. odoriferum, and
P. versatile isolated from various hosts and countries, which were retrieved from the GenBank. The
tree was rooted with the D. solani strain RNS 05.1.2A.
Microorganisms 2023,11, 335 11 of 16
3.3. Virulence Assessment
The developed disease symptoms observed seven days after the spray-inoculation of
cabbage heads and potato tubers with suspensions of the tested isolates are presented in
Figure 3.
Microorganisms 2022, 10, x FOR PEER REVIEW 11 of 17
Figure 2. The neighbor-joining phylogenetic tree constructed based on the concatenated sequences
of genes dnaX, icdA, mdh, and proA for seven representative P. carotovorum , P. odoriferum , and
P. versatile isolates examined in this study and 19 strains of P. carotovorum, P. odoriferum, and P.
versatile isolated from various hosts and countries, which were retrieved from the GenBank. The
tree was rooted with the D. solani strain RNS 05.1.2A.
3.3. Virulence assessment
The developed disease symptoms observed seven days after the spray-inoculation of
cabbage heads and potato tubers with suspensions of the tested isolates are presented in
Figure 3.
Figure 3.
Examples of the bacterial soft rot symptoms on the cabbage head and potato tuber that were
observed seven days after inoculation with the Serbian P. versatile strain Pv6321 and the P. carotovorum
strain Pc3821, respectively.
The results of the AUDPC analysis of the tested isolates on cabbage heads and potato
tubers are shown in Figure 4A,B, respectively.
The AUDPC values pertaining to cabbage heads ranged from 4964.2 to 5990.46 for
the P. odoriferum isolate Po7521 and P. carotovorum isolate Pc8321, respectively (Figure 4A).
Based on the obtained AUDPC values, the P. odoriferum isolate Po7521 exhibited the highest
virulence potential, followed by the P. versatile isolate Pv6321, while the P. carotovorum
isolates Pc2321, Pc3821, Pc4821, Pc5421, and Pc8321 exhibited the lowest (and comparable)
virulence potential. Statistically significant differences between the initial (0 d.a.i.) and the
final (5 and 7 d.a.i.) weights were observed after cabbage inoculation with the P. carotovorum
isolates Pc2321 and Pc3821, as well as the P. odoriferum isolate Po7521. On the other hand,
the weights measured 5 and 7 d.a.i. with the P. versatile isolate Pv6321 were comparable but
differed significantly from the initial weight (0 d.a.i.).
The AUDPC values pertaining to potato tubers ranged from 249.92 to 342.15 for the
P. carotovorum isolates Pc2321 and Pc4821, respectively (Figure 4B). As the AUDPC values
obtained for the seven representative isolates were comparable, all tested isolates appeared
to be equally virulent with respect to this host. However, the weights measured 5 and
7 d.a.i. were statistically significantly lower than the initial weights when samples were
inoculated with the P. carotovorum isolates Pc4821, Pc5421, and Pc8321. For the remaining
two P. carotovorum isolates (Pc2321 and Pc3821), one P. versatile Pv6321, and one P. odoriferum
Po7521, the weights measured 5 and 7 d.a.i. were comparable, but differed significantly
from the initial values (0 d.a.i.).
Microorganisms 2023,11, 335 12 of 16
Microorganisms 2022, 10, x FOR PEER REVIEW 12 of 17
Figure 3. Examples of the bacterial soft rot symptoms on the cabbage head and potato tuber that
were observed seven days after inoculation with the Serbian P. versatile strain Pv6321 and the P.
carotovorum strain Pc3821, respectively.
The results of the AUDPC analysis of the tested isolates on cabbage heads and potato
tubers are shown in Figure 4A,B, respectively.
Figure 4. Disease progress curves (AUDPC) showing (A) cabbage and (B) potato weight ratings
(obtained 5 and 7 d.a.i.) resulting from tissue maceration due to inoculation with seven representa-
tive Pectobacterium cabbage isolates. Different letters represent statistically significant differences.
The AUDPC values pertaining to cabbage heads ranged from 4964.2 to 5990.46 for
the P. odoriferum isolate Po7521 and P. carotovorum isolate Pc8321, respectively (Figure 4A).
Based on the obtained AUDPC values, the P. odoriferum isolate Po7521 exhibited the high-
est virulence potential, followed by the P. versatile isolate Pv6321, while the P. carotovorum
isolates Pc2321, Pc3821, Pc4821, Pc5421, and Pc8321 exhibited the lowest (and comparable)
virulence potential. Statistically significant differences between the initial (0 d.a.i.) and the
final (5 and 7 d.a.i.) weights were observed after cabbage inoculation with the P. caroto-
vorum isolates Pc2321 and Pc3821, as well as the P. odoriferum isolate Po7521. On the other
hand, the weights measured 5 and 7 d.a.i. with the P. versatile isolate Pv6321 were compa-
rable but differed significantly from the initial weight (0 d.a.i.).
Figure 4.
Disease progress curves (AUDPC) showing (
A
) cabbage and (
B
) potato weight ratings
(obtained 5 and 7 d.a.i.) resulting from tissue maceration due to inoculation with seven representative
Pectobacterium cabbage isolates. Different letters represent statistically significant differences.
4. Discussion
To the best of our knowledge, this is the first study since the pioneering work of Ar-
senijevi´c and Obradovi´c published more than 20 years ago [
47
], in which Erwinia carotovora
subsp. carotovora was identified in the Baˇcka region, to provide evidence on the presence
and diversity of the three bacteria (i.e., P. carotovorum,P. odoriferum, and P. versatile) causing
soft rot in cabbage in Vojvodina (Serbia). The obtained results indicated presence of a com-
bined infection in Field II, where all three identified species were confirmed on the cabbage
hybrid Hippo F1. However, in Field I (hybrid Cheers F1), only P. carotovorum was detected.
Analysis of the 67 cabbage isolates indicated that P. carotovorum was the most represented
(62.69%), followed by P. versatile (19.40%) and P. odoriferum (17.91%). These findings are
not surprising, given that P. carotovorum species is generally recognized as the main causal
agent of soft rot in Brassicaceae plants [
28
]. This species was described on cabbage and
Chinese cabbage in China, Brazil, Malaysia, Korea, and Bosnia and Herzegovina [
8
,
48
–
51
].
However, there is paucity of data on the presence of P. versatile and P. odoriferum on cabbage.
In addition to P. carotovorum,P. versatile, and P. odoriferum, Chen et al. [
31
] also reported
species P. aroidearum,P. brasiliense, and P. polaris on Chinese cabbage grown in different
districts of Beijing (China). Presence of P. odoriferum was also reported on cabbage and
Microorganisms 2023,11, 335 13 of 16
Chinese cabbage in Central Poland, China, and Iran [
28
,
48
,
52
]. However, the lack of data
on the presence of P. odoriferum and P. versatile on cabbage does not imply its absence on this
host, as it is at least partly due to their recent reclassification (i.e., elevation from subspecies
to the species level) within the genus Pectobacterium [53].
It is known that the genus Pectobacterium includes heterogonous strains character-
ized by diverse biochemical, physiological, and genetic properties even within the same
species [54]. Based on the rep-PCR results, the Pectobacterium spp. isolates tested as a part
of the present study were genetically heterogeneous, forming seven (BOX- and GTG
5
-PCR)
and six (ERIC- and REP-PCR) groups on the UPGMA tree, depending on the utilized
primers. In other words, the rep-PCR results indicate interspecies genetic heterogeneity, as
well as intraspecies heterogeneity within P. carotovorum isolates only, which were clustered
in five (BOX- and GTG
5
-PCR) and four (ERIC- and REP-PCR) groups. The rep-PCR (BOX-,
ERIC-, and REP-PCR) analysis conducted by Alvarado et al. [
49
] also revealed high genetic
variability among P. carotovorum strains isolated from Chinese cabbage in Pernambuco state
(north-east Brazil). Based on the rep-PCR with primers for BOX-, ERIC-, and REP-PCR,
Loc et al. [
38
] reached a similar conclusion to the one put forward in this study, positing
that Pectobacterium strains of the same species tend to group closely according to their
respective taxonomic designations. Considering that authors of several extant studies
singled out rep-PCR as discriminative enough to reveal subtle differences between different
Pectobacterium spp., as well as those among the same species, as proposed by Zoledowska
et al. [
26
] for P. parmentieri strains from Poland, rep-PCR is a promising technique for the
clarification of genetic diversity and discrimination of soft rot-causing Pectobacterium spp.
In the present study, typing of four housekeeping genes (dnaX,icdA,mdh, and proA)
enabled appropriate identification of the tested cabbage isolates and a clear separation of
each of the three identified species from one another. The existence of inter- and intra-
species genetic heterogeneity between the three detected Pectobacterium species was again
confirmed based on MLSA with concatenated sequences of the same four genes. According
to Zeigler [
55
], among genes present in all sequenced bacterial genomes, the dnaX gene is
considered one of the best candidates for assigning bacterial strains to the species level.
Sławiak et al. [
22
] also highlighted the usefulness of gene dnaX for the identification of
European potato Dickeya spp. strains. However, despite the demonstrated high resolution
of the dnaX gene, the use of other protein-coding genes should not be discouraged due to
the well-known claim that mutations, as the main engine of evolution, in Pectobacterium
spp. mostly occur on these genes [
14
]. Moreover, using multiple genes allows for a greater
genome coverage, which undoubtedly leads to a more reliable phylogeny reconstruction.
In extant research, the remaining three genes (icdA,mdh, and proA) were successfully used
for the typing of Pectobacterium spp. in different combinations with other housekeeping
genes (e.g., acnA,gapA,mtlD,pgi,recA,rpoS, etc.) [
16
–
20
]. Important parameters when
selecting these genes are (i) ubiquity in most enterobacteria, (ii) high discriminatory ability,
and (iii) indispensable role in key metabolic processes [16].
In the virulence assessment assay performed as a part of this work, the lowest AUDPC
values pertaining to cabbage heads (i.e., the highest virulence potential) was observed
for the P. odoriferum isolate Po7521, followed by the P. versatile isolate Pv6321. On the
other hand, the P. carotovorum isolates Pc2321, Pc3821, Pc4821, Pc5421, and Pc8321 were
the least virulent, with a comparable virulence potential for cabbage. However, such
statistical differences in aggressiveness among isolates/species were not detected on potato
tubers. While these findings may be indicative of host
−
pathogen specificity in the case of
bacteria P. odoriferum and P. versatile, more confident claims about such interactions would
require more extensive studies performed on a larger number of known hosts. Bearing in
mind the wide distribution, ubiquity, and polyphagous nature of P. carotovorum [
56
], and
the resulting genetic diversity that enabled this species to survive and adapt to different
ecological niches (i.e., hosts), it is likely that differences in aggressiveness will be observed
between different hosts. In the study conducted by Li et al. [
57
], P. odoriferum strains
isolated from Chinese cabbage exhibited much higher virulence potential for Chinese
Microorganisms 2023,11, 335 14 of 16
cabbage compared to the tested P. carotovorum and P. brasiliensis strains (measured 24 h
and 30 h post-inoculation), all obtained from the same host. These authors did not observe
statistically significant differences in the virulence potential between P. carotovorum and
P. brasiliensis strains. However, it remains to be established whether the differences between
species would be sustained for the duration of the disease progression. Moreover, based
on the results reported by Waleron et al. [
58
], no statistically significant differences in the
virulence potential on potato were observed between P. carotovorum and P. odoriferum, or
between P. carotovorum and P. brasiliensis, based on the analyses performed 3 d.a.i.
This research significantly contributes to the current knowledge of the diversity of
pectolytic bacteria affecting cabbage in Serbia, which has so far remained unexplored
despite their great importance.
Supplementary Materials:
The following supporting information can be downloaded at: https://
www.mdpi.com/article/10.3390/microorganisms11020335/s1, Figure S1: Unweighted pair group
method with arithmetic mean (UPGMA) phylogenetic trees of the 67 tested cabbage Pectobacterium
spp. isolates and virtual gel images depicting rep-PCR fingerprinting patterns for each of the obtained
isolate groups based on (A) BOX-PCR, (B) ERIC-PCR, (C) GTG5-PCR, and (D) REP-PCR.
Author Contributions:
Conceptualization—T.P.M., A.J., and P.M. (Petar Mitrovi´c); Methodology—
T.P.M., A.J., S.M., R.I., and S.S.; Software—S.M. and R.I.; Investigation—A.J., S.M., and R.I.; Resources—
T.P.M. and A.J.; Data curation—A.J., S.M., P.M. (Petar Mitrovi´c), R.I., P.M. (Predrag Milovanovi´c),
and T.P.M.; Writing—original draft preparation—A.J. and T.P.M.; Writing—review and editing—
A.J., S.M., R.I., P.M. (Predrag Milovanovi´c), S.S., and T.P.M.; Visualization—A.J., R.I., and P.M.
(Predrag Milovanovi´c); Supervision—T.P.M. and S.S.; Funding acquisition—T.P.M., A.J., S.M., P.M.
(Petar Mitrovi´c), R.I., P.M. (Predrag Milovanovi´c), and S.S. All authors have read and agreed to the
published version of the manuscript.
Funding:
This research was supported by the Ministry of Education, Science and Technological
Development of the Republic of Serbia, contract Nos. 451-03-68/2022-14/200053, 451-03-68/2022-
14/200032, 451-03-68/2022-14/200117, 451-03-68/2022-14/200178, and 451-03-68/2022-14/200010.
Data Availability Statement: Not applicable.
Conflicts of Interest:
The authors declare no conflict of interest. The funders had no role in the design
of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or
in the decision to publish the results.
References
1.
Galal, T.M.; Khalafallah, A.A.; Elawa, O.E.; Hassan, L.M. Human health risks from consuming cabbage (Brassica oleracea L. var.
capitata) grown on wastewater irrigated soil. Int. J. Phytoremediation 2018,20, 1007–1016. [CrossRef] [PubMed]
2.
Šamec, D.; Pavlovi´c, I.; Salopek-Sondi, B. White cabbage (Brassica oleracea var. capitata f. alba): Botanical, phytochemical and
pharmacological overview. Phytochem. Rev. 2017,16, 117–135. [CrossRef]
3.
Food and Agriculture Organization of the United Nations. FAOSTAT Statistical Database. Available online: https://www.fao.org/
faostat/en/#data/QCL (accessed on 21 November 2022).
4.
Živanovi´c Miljkovi´c, J.; Popovi´c, V.; Gaji´c, A. Land Take Processes and Challenges for Urban Agriculture: A Spatial Analysis for
Novi Sad, Serbia. Land 2022,11, 769. [CrossRef]
5.
Cui, W.; He, P.; Munir, S.; He, P.; He, Y.; Li, X.; Yang, L.; Wang, B.; Wu, Y.; He, P. Biocontrol of soft rot of Chinese cabbage using an
endophytic bacterial strain. Front. Microbiol. 2019,10, 1471. [CrossRef] [PubMed]
6.
Bhat, K.A.; Masood, S.D.; Bhat, N.A.; Bhat, M.A.; Razvi, S.M.; Mir, M.R.; Akhtar, S.; Wani, N.; Habib, M. Current status of post
harvest soft rot in vegetables: A review. Asian J. Plant Sci. 2010,9, 200–208. [CrossRef]
7.
Harter, L.L.; Jones, L.R. Cabbage Diseases; Farmers’ Bulletin No. 1351; US Government Printing Office: Washington, DC, USA,
1923; p. 20.
8.
Popovi´c, T.; Jeluši´c, A.; Markovi´c, S.; Iliˇci´c, R. Characterization of Pectobacterium carotovorum subsp. carotovorum isolates from a
recent outbreak on cabbage in Bosnia and Herzegovina. Pestic. Phytomedicine 2019,34, 211–222. [CrossRef]
9.
Van Gijsegem, F.; Toth, I.K.; van der Wolf, J.M. Outlook—Challenges and perspectives for management of diseases caused by
Pectobacterium and Dickeya species. In Plant Diseases Caused by Dickeya and Pectobacterium Species; Springer: Cham, Switzerland,
2021; pp. 283–289. [CrossRef]
10.
Agrios, G.N. Plant diseases caused by prokaryotes: Bacteria and mollicutes. Bacterial Soft Rots. In Plant Patholog; Academic Press:
Cambridge, MA, USA, 2005; pp. 615–703. [CrossRef]
Microorganisms 2023,11, 335 15 of 16
11.
Czajkowski, R.; Perombelon, M.C.; van Veen, J.A.; van der Wolf, J.M. Control of blackleg and tuber soft rot of potato caused by
Pectobacterium and Dickeya species: A review. Plant Pathol. 2011,60, 999–1013. [CrossRef]
12. Charkowski, A.O. The changing face of bacterial soft-rot diseases. Annu. Rev. Phytopathol. 2018,56, 269–288. [CrossRef]
13.
Jonkheer, E.M.; Brankovics, B.; Houwers, I.M.; van der Wolf, J.M.; Bonants, P.J.; Vreeburg, R.A.; Bollema, R.; de Haan, J.R.; Berke,
L.; Smit, S.; et al. The Pectobacterium pangenome, with a focus on Pectobacterium brasiliense, shows a robust core and extensive
exchange of genes from a shared gene pool. BMC Genom. 2021,22, 265. [CrossRef]
14.
Achtman, M. Evolution, population structure, and phylogeography of genetically monomorphic bacterial pathogens. Annu. Rev.
Microbiol. 2008,62, 53–70. [CrossRef]
15.
Nabhan, S.; De Boer, S.H.; Maiss, E.; Wydra, K. Taxonomic relatedness between Pectobacterium carotovorum subsp. carotovorum,
Pectobacterium carotovorum subsp. odoriferum and Pectobacterium carotovorum subsp. brasiliense subsp. nov. J. Appl. Microbiol.
2012
,
113, 904–913. [CrossRef] [PubMed]
16.
Ma, B.; Hibbing, M.E.; Kim, H.S.; Reedy, R.M.; Yedidia, I.; Breuer, J.; Charkowski, A.O. Host range and molecular phylogenies of
the soft rot enterobacterial genera Pectobacterium and Dickeya.Phytopathology 2007,97, 1150–1163. [CrossRef] [PubMed]
17.
Moleleki, L.N.; Onkendi, E.M.; Mongae, A.; Kubheka, G.C. Characterisation of Pectobacterium wasabiae causing blackleg and soft
rot diseases in South Africa. Eur. J. Plant Pathol. 2013,135, 279–288. [CrossRef]
18.
Pitman, A.R.; Harrow, S.A.; Visnovsky, S.B. Genetic characterisation of Pectobacterium wasabiae causing soft rot disease of potato in
New Zealand. Eur. J. Plant Pathol. 2010,126, 423–435. [CrossRef]
19.
Waleron, M.; Misztak, A.; Waleron, M.; Franczuk, M.; Jo´nca, J.; Wielgomas, B.; Mikici´nski, A.; Popovi´c, T.; Waleron, K. Pectobac-
terium zantedeschiae sp. nov. a new species of a soft rot pathogen isolated from Calla lily (Zantedeschia spp.). Syst. Appl. Microbiol.
2019,42, 275–283. [CrossRef] [PubMed]
20.
Markovi´c, S.; Mili´c Komi´c, S.; Jeluši´c, A.; Iliˇci´c, R.; Bagi, F.; Stankovi´c, S.; Popovi´c, T. First report of Pectobacterium versatile causing
blackleg of potato in Serbia. Plant Dis. 2022,106, 312. [CrossRef] [PubMed]
21.
Ma, X.; Schloop, A.; Swingle, B.; Perry, K.L. Pectobacterium and Dickeya responsible for potato blackleg disease in New York State
in 2016. Plant Dis. 2018,102, 1834–1840. [CrossRef]
22.
Sławiak, M.; van Beckhoven, J.R.; Speksnijder, A.G.; Czajkowski, R.; Grabe, G.; van der Wolf, J.M. Biochemical and genetical
analysis reveal a new clade of biovar 3 Dickeya spp. strains isolated from potato in Europe. Eur. J. Plant Pathol.
2009
,125, 245–261.
[CrossRef]
23.
Markovi´c, S.; Stankovi´c, S.; Jeluši´c, A.; Iliˇci´c, R.; Kosovac, A.; Pošti´c, D.; Popovi´c, T. Occurrence and Identification of Pectobacterium
carotovorum subsp. brasiliensis and Dickeya dianthicola Causing Blackleg in some Potato Fields in Serbia. Plant Dis.
2021
,105,
1080–1090. [CrossRef]
24.
Norman, D.J.; Yuen, J.M.F.; Resendiz, R.; Boswell, J. Characterization of Erwinia populations from nursery retention ponds and
lakes infecting ornamental plants in Florida. Plant Dis. 2003,87, 193–196. [CrossRef]
25.
Maisuria, V.B.; Nerurkar, A.S. Characterization and differentiation of soft rot causing Pectobacterium carotovorum of Indian origin.
Eur. J. Plant Pathol. 2013,136, 87–102. [CrossRef]
26.
Zoledowska, S.; Motyka, A.; Zukowska, D.; Sledz, W.; Lojkowska, E. Population structure and biodiversity of Pectobacterium
parmentieri isolated from potato fields in temperate climate. Plant Dis. 2018,102, 154–164. [CrossRef] [PubMed]
27.
Song, H.; Lee, J.Y.; Lee, H.W.; Ha, J.H. Inactivation of bacteria causing soft rot disease in fresh cut cabbage using slightly acidic
electrolyzed water. Food Control. 2021,128, 108217. [CrossRef]
28.
Oskiera, M.; Kału˙
zna, M.; Kowalska, B.; Smoli´nska, U. Pectobacterium carotovorum subsp. odoriferum on cabbage and Chinese
cabbage: Identification, characterization and taxonomic relatedness of bacterial soft rot causal agents. J. Plant Pathol.
2017
,99, 149–160.
[CrossRef]
29.
Xie, H.; Li, X.Y.; Ma, Y.L.; Tian, Y. First report of Pectobacterium aroidearum causing soft rot of Chinese cabbage in China. Plant Dis.
2018,102, 674. [CrossRef]
30.
Fujimoto, T.; Nakayama, T.; Ohki, T.; Maoka, T. First Report of Soft Rot of Cabbage Caused by Pectobacterium wasabiae in Japan.
Plant Dis. 2021,105, 2236. [CrossRef]
31.
Chen, C.; Li, X.; Bo, Z.; Du, W.; Fu, L.; Tian, Y.; Cui, S.; Shi, Y.; Xie, H. Occurrence, Characteristics, and PCR-Based Detection of
Pectobacterium polaris Causing Soft Rot of Chinese Cabbage in China. Plant Dis. 2021,105, 2880–2887. [CrossRef]
32.
Lee, S.; Vu, N.-T.; Oh, E.-J.; Rahimi-Midani, A.; Thi, T.-N.; Song, Y.-R.; Hwang, I.-S.; Choi, T.-J.; Oh, C.-S. Biocontrol of soft rot
caused by Pectobacterium odoriferum with bacteriophage phiPccP-1 in Kimchi cabbage. Microorganisms 2021,9, 779. [CrossRef]
33.
Smoktunowicz, M.; Jonca, J.; Stachowska, A.; May, M.; Waleron, M.M.; Waleron, M.; Waleron, K. The International Trade of Ware
Vegetables and Orna-Mental Plants-An Underestimated Risk of Accelerated Spreading of Phytopathogenic Bacteria in the Era of
Globalisation and Ongoing Climatic Changes. Pathogens 2022,11, 728. [CrossRef]
34.
Gavrilovi´c, V.; Obradovi´c, A.; Arsenijevi´c, M. Bacterial soft rot of carrot, parsley and celery. In Plant Pathogenic Bacteria; De Boer,
S.H., Ed.; Springer: Dordrecht, The Netherlands, 2001; pp. 269–271.
35.
Gaši´c, K.; Gavrilovi´c, V.; Dolovac, N.; Trkulja, N.; Živkovi´c, S.; Risti´c, D.; Obradovi´c, A. Pectobacterium carotovorum subsp.
carotovorum-the causal agent of broccoli soft rot in Serbia. Pestic. Phytomedicine 2014,29, 249–255. [CrossRef]
36.
Popovi´c, T.; Jeluši´c, A.; Milovanovi´c, P.; Janjatovi´c, S.; Budnar, M.; Dimki´c, I.; Stankovi´c, S. First report of Pectobacterium
atrosepticum, causing bacterial soft rot on calla lily in Serbia. Plant Dis. 2017,101, 2145. [CrossRef]
Microorganisms 2023,11, 335 16 of 16
37.
Zlatkovi´c, N.; Proki´c, A.; Gaši´c, K.; Kuzmanovi´c, N.; Ivanovi´c, M.; Obradovi´c, A. First report of Pectobacterium carotovorum subsp.
brasiliense causing soft rot on squash and watermelon in Serbia. Plant Dis. 2019,103, 2667. [CrossRef]
38.
Loc, M.; Miloševi´c, D.; Ivanovi´c, Ž.; Ignjatov, M.; Budakov, D.; Grahovac, J.; Grahovac, M. Genetic Diversity of Pectobacterium spp.
on Potato in Serbia. Microorganisms 2022,10, 1840. [CrossRef] [PubMed]
39.
Loc, M.; Miloševi´c, D.; Ignjatov, M.; Ivanovi´c, Ž.; Budakov, D.; Grahovac, J.; Vlajkov, V.; Pajˇcin, I.; Grahovac, M. First report of
Pectobacterium punjabense causing potato soft rot and blackleg in Serbia. Plant Dis. 2022,106, 1513. [CrossRef]
40.
Hélias, V.; Hamon, P.; Huchet, E.; Wolf, J.V.D.; Andrivon, D. Two new effective semiselective crystal violet pectate media for
isolation of Pectobacterium and Dickeya.Plant Pathol. 2012,61, 339–345. [CrossRef]
41. Fahy, P.C.; Persley, G.J. Plant Bacterial Diseases: A diagnostic Guide; Academic Press: Sydney, Australia, 1983; 393p.
42.
Bertani, G. Studies on lysogenesis I: The mode of phage liberation by lysogenic Escherichia coli.J. Bacteriol.
1951
,62, 293–300.
[CrossRef]
43.
Popovi´c, T.; Jeluši´c, A.; Dimki´c, I.; Stankovi´c, S.; Pošti´c, D.; Aleksi´c, G.; Veljovi´c Jovanovi´c, S. Molecular characterization of
Pseudomonas syringae pv. coriandricola and biochemical changes attributable to the pathological response on its hosts carrot, parsley,
and parsnip. Plant Dis. 2019,103, 3072–3082. [CrossRef]
44.
Kettani-Halabi, M.; Terta, M.; Amdan, M.; El Fahime, E.M.; Bouteau, F.; Ennaji, M.M. An easy, simple inexpensive test for the
specific detection of Pectobacterium carotovorum subsp. carotovorum based on sequence analysis of the pmrA gene. BMC Microbiol.
2013,13, 176. [CrossRef]
45.
Louws, F.J.; Fulbright, D.W.; Stephens, C.T.; De Bruijn, F.J. Specific genomic fingerprints of phytopathogenic Xanthomonas and
Pseudomonas pathovars and strains generated with repetitive sequences and PCR. Appl. Environ. Microbiol.
1994
,60, 2286–2295.
[CrossRef]
46.
Versalovic, J.; Schneider, M.; De Bruijn, F.J.; Lupski, J.R. Genomic fingerprinting of bacteria using repetitive sequence-based
polymerase chain reaction. Methods Mol. Cell. Biol. 1994,5, 25–40.
47.
Arsenijevi´c, M.; Obradovi´c, A. Occurrence of bacterial wilt and soft rot of seed cabbage plants (Brassica oleracea var. capitata L.) in
Yugoslavia. J. Phytopathol. 1996,144, 315–319. [CrossRef]
48.
Zhu, L.; Xie, H.; Chen, S.; Ma, R. Rapid isolation, identification and phylogenetic analysis of Pectobacterium carotovorum ssp.
J. Plant Pathol. 2010,92, 479–483.
49.
Alvarado, I.C.M.; Michereff, S.J.; Mariano, R.L.R.; Souza, E.B.; Quezado-Duval, A.M.; Resende, L.V.; Cardoso, E.; Mizubuti, E.S.G.
Characterization and variability of soft rot-causing bacteria in Chinese cabbage in North Eastern Brazil. J. Plant Pathol.
2011
,93,
173–181.
50.
Nazerian, E.; Sijam, K.; Mior Ahmad, Z.A.; Vadamalai, G. First report of cabbage soft rot caused by Pectobacterium carotovorum
subsp. carotovorum in Malaysia. Plant Dis. 2011,95, 491. [CrossRef]
51.
Park, T.H.; Choi, B.S.; Choi, A.Y.; Choi, I.Y.; Heu, S.; Park, B.S. Genome sequence of Pectobacterium carotovorum subsp. carotovorum
strain PCC21, a pathogen causing soft rot in Chinese cabbage. J. Bacteriol. 2012,194, 6345–6346. [CrossRef] [PubMed]
52.
Rezaei, R.; Taghavi, S.M. Phenotypic and genotypic characteristics of Iranian soft rot bacterial isolates from different hosts.
Phytopathol. Mediterr. 2010,49, 194–204.
53.
Portier, P.; Pédron, J.; Taghouti, G.; Fischer-Le Saux, M.; Caullireau, E.; Bertrand, C.; Laurent, A.; Chawki, K.; Oulgazi, S.; Moumni,
M.; et al. Elevation of Pectobacterium carotovorum subsp. odoriferum to species level as Pectobacterium odoriferum sp. nov., proposal
of Pectobacterium brasiliense sp. nov. and Pectobacterium actinidiae sp. nov., emended description of Pectobacterium carotovorum and
description of Pectobacterium versatile sp. nov., isolated from streams and symptoms on diverse plants. Int. J. Syst. Evol. Microbiol.
2019,69, 3207–3216. [CrossRef]
54.
Öztürk, M.; Umar, A.R. Occurrence, identification, and host range of Pectobacterium brasiliense causing soft rot on seed potato
tubers in Turkey. J. Plant Dis. Prot. 2022, 1–12. [CrossRef]
55.
Zeigler, D.R. Gene sequences useful for predicting relatedness of whole genomes in bacteria. Int. J. Syst. Evol. Microbiol.
2003
,53,
1893–1900. [CrossRef]
56.
Cariddi, C.; Sanzani, S.M. A severe outbreak of bacterial lettuce soft rot caused by Pectobacterium carotovorum subsp. carotovorum
in Apulia (Italy). J. Plant Pathol. 2013,95, 441–446.
57.
Li, X.; Fu, L.; Chen, C.; Sun, W.; Tian, Y.; Xie, H. Characteristics and rapid diagnosis of Pectobacterium carotovorum ssp. associated
with bacterial soft rot of vegetables in China. Plant Dis. 2020,104, 1158–1166. [CrossRef] [PubMed]
58.
Waleron, M.; Waleron, K.; Lojkowska, E. Characterization of Pectobacterium carotovorum subsp. odoriferum causing soft rot of
stored vegetables. Eur. J. Plant Pathol. 2014,139, 457–469. [CrossRef]
Disclaimer/Publisher’s Note:
The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.
