Content uploaded by Antonio Toscano de Brito
Author content
All content in this area was uploaded by Antonio Toscano de Brito on Dec 27, 2022
Content may be subject to copyright.
NUMBER 1 OF 1
AUTHOR QUERIES
DATE 11/17/2022
JOB NUMBER SBOT
ARTICLE 2200004
QUERIES FOR AUTHORS ROYER ET AL.
THIS QUERY FORM MUST BE RETURNED WITH ALL PROOFS FOR CORRECTIONS
There are no queries in this article
Phylogenetic Position of Centroglossa and Dunstervillea (Ornithocephalus Clade:
Oncidiinae: Orchidaceae) Based on Molecular and Morphological Data
Carla A. Royer,
1,6
A. L. V. Toscano de Brito,
2,3
Anna V. S. R. Mauad
4
and Eric C. Smidt
1,4,5
1
Programa de P
os-Graduac¸~
ao em Ci^
encias Biol
ogicas (Biologia Vegetal), Instituto de Bioci^
encias Unesp –Rio Claro, Brazil;
carladriane@gmail.com
2
Marie Selby Botanical Gardens, 811 South Palm Avenue, Sarasota, Florida 34236, USA
3
Orchid Herbarium of Oakes Ames, Harvard University Herbaria, 22 Divinity Avenue, Cambridge,
Massachusetts 02138, USA
4
Programa de P
os-Graduac¸~
ao em Ecologia e Conservac¸~
ao, Universidade Federal do Paran
a, Curitiba, Brazil
5
Universidade Federal do Paran
a, Departamento de Bot^
anica, CX 19031, 81530–900, Curitiba, Brazil
6
Author for correspondence (carladriane@gmail.com)
Communicating Editor: Jacob Landis
Abstract—Even though the monophyly of the Ornithocephalus clade (Oncidiinae) is currently well defined, the systematic positioning of
Centroglossa and Dunstervillea remains obscure in the clade due to the absence in previous phylogenetic studies. Centroglossa has a very similar
habit and is indistinguishable from Zygostates, whereas Dunstervillea has as its main characteristic the calcarate labellum, also found in Centro-
glossa. We clarify the systematic and phylogenetic positioning of Centroglossa and Dunstervillea in the Ornithocephalus clade (OC) through anal-
ysis of maximum likelihood, Bayesian inference, and maximum parsimony from molecular data (nrITS and matK cpDNA) and morphology.
Our results indicate that Dunstervillea is phylogenetically close to Eloyella; both genera have a psigmoid habit, single-sided and flattened
leaves, floral perianth with the same coloring, petals with entire margins, and a short rostellum. Centroglossa appears as a subclade within
Zygostates. In addition to several homoplastic features, these two genera have the dorsal position of viscidium as a synapomorphy. The calca-
rate labellum, common to Centroglossa and Dunstervillea, originated more than once in the OC. Based on the phylogenetic results, we propose
the nomenclatural changes to include Dunstervillea in Eloyella and Centroglossa in Zygostates. Lectotypes are indicated to Centroglossa macroceras
and C. glaziovii.
Keywords—Character encoding, matK, Neotropic, nrITS, synapomorphy.
With about 1600 species and 61 genera, Oncidiinae is one
of the most diverse subtribes of Orchidaceae and is the
second-largest subtribe in the neotropics (Chase 1988; Neubig
et al. 2012). Its members present a great variation in the num-
ber of chromosomes, genome size, floral and vegetative mor-
phology, different pollination syndromes, and great habitat
diversity (Chase and Palmer 1988; Chase 2009).
The Ornithocephalus clade (OC), belonging to Oncidiinae,
consists of 12 genera and approximately 120 species distrib-
uted from southern Mexico to northern Argentina, with a
center of diversity in the rainforests of eastern and western
South America, and probably originated in the Atlantic Forest
areas (Smidt et al. 2018). The clade was treated as an indepen-
dent subtribe until recently, the Ornithocephalinae (Dressler
1993; Toscano de Brito 1994), having its position modified
through phylogenetic studies based on molecular characters
(Williams et al. 2001; Neubig et al. 2012). Except for the OC
and members of the former subtribe Telipogoninae (now also
included in the Oncidiinae), whose pollinarium have four
pollinia, all other members of the Oncidiinae have a pair of
pollinia.
Centroglossa Barb.Rodr., Dunstervillea Garay, and Zygostates
Lindl. belong to OC (
F1 Fig. 1). Even though possessing a vege-
tative and floral morphology that distinguish them within the
clade, the delimitations of these genera have not always had a
consensus, and their circumscriptions have changed over
time. A detailed history of the evolution of these generic con-
cepts has been provided by Toscano de Brito (1994).
Centroglossa, described by Barbosa Rodrigues in 1882, com-
prises six endemic species of the Brazilian Atlantic Forest
(Toscano de Brito 2001; Chase and Toscano de Brito 2009;
Chiron et al. 2011; Royer et al. 2022a). They are sympodial,
pseudobulbous plants, roots glabrous, rarely hairy, and leaves
bifacial and articulated. The inflorescence is racemose, pauci-
florus, with up to eight symmetrical flowers, which are white,
orange, or yellowish, usually with greenish lines and macules.
The labellum is infundibuliform, distinctly saccate and spurred,
with a callus at the base, usually trichomatous. The gynoste-
mium is more or less straight with conspicuous lateral appen-
dages at the base; the rostellum is conspicuous; the anther is
terminal, operculate, acute to acuminate; the pollinarium has
four pollinia, a long stipe, and a dorsal viscidium.
Zygostates, described by Lindley (1837), presents ca. 25 spe-
cies (Toscano de Brito 2017). It is the second-largest genus of
the clade and has the largest number of endemic species in
Brazil (15), presenting a disjunct distribution throughout the
Atlantic Forest and in northern South America (Toscano de
Brito 2001; Chase and Toscano de Brito 2009; Smidt et al.
2018; Royer et al. 2022b). They are sympodial, pseudobulbous
plants, with glabrous or hairy roots. The leaves are bifacial
and articulated. The inflorescence is racemose, pauciflorus or
multiflorous, with up to 15 symmetrical or sometimes dis-
tinctly asymmetrical flowers, usually white with a green cen-
ter, sometimes orange or yellow. The labellum is symmetrical
or twisted and asymmetrical in some species, variable in
shape, entire or trilobed, but never saccate and spurred, usu-
ally with a callus trichomatous at the base. The gynostemium
is sigmoid and provided with lateral appendages in several
species; the rostellum is conspicuous, generally equal to or
exceeding the length of the rest of the gynostemium; the
anther is terminal, operculated, sometimes more or less dor-
sal or ventral, acute, apiculate or acuminate, the pollinarium
has four pollinia, an elongate stipe, and a dorsal or rarely api-
cal viscidium.
The genus Dunstervillea, described by Garay in 1972, has
only one species, Dunstervillea mirabilis Garay, distributed in
1
Systematic Botany (2022), 47(4): pp. 1–11
ISSN 0363-6445 (print); ISSN 1548-2324 (online)
© Copyright 2022 by the American Society of Plant Taxonomists
DOI 10.1600/036364422X16674053033877
Date of publication xx xxxx, 2022
FIG. 1. Representatives of the Ornithocephalus clade, highlighting the genus Zygostates, showing the habit and flower in detail. A. Ornithocephalus gladia-
tus.B.Rauhiella seehawerii. C. Thysanoglossa jordanensis.D.Zygostates aderaldoana.E.Z. alleniana. F. Z. bradei.G.Z. dasyrhiza.H.Z. greeniana.I.Zygostates lunata.
J. Z. nunes-limae.K.Z. ovatipetala. L. Z. pustulata.PhotosbyE.C.Smidt,exceptKbyG.Gerlach.
SYSTEMATIC BOTANY2 [Volume 47
Venezuela, northern Brazil, Ecuador, and Guyana (Toscano
de Brito 2001; Chase and Toscano de Brito 2009; Royer et al.
2022c). Plants are monopodial without pseudobulbs; roots
are hairy; leaves are unifacial, articulate, and laterally com-
pressed; inflorescence is racemose, pauciflorus, with up to
five greenish-white to yellowish flowers. The labellum is
symmetrical, saccate, spurred, internally calloused and tri-
chomatous. The gynostemium is more or less straight, with-
out basal appendages, and slightly auriculate in the apical
region; the rostellum is inconspicuous; the anther is more or
less ventral to operculate, truncate and revolute at the apex,
the pollinarium has four pollinia, a long stipe, and a ventral
viscidium.
Studies based on morphological (Toscano de Brito 1994,
2001) and molecular (Williams et al. 2001; Neubig et al. 2012;
Smidt et al. 2018) data confirm the inclusion of Zygostates in
the Ornithocephalus clade, as well as their synonyms Dactylos-
tylis Scheidw, based on D. fimbriata Scheidw. (5Zygostates
lunata Lindl.), and Dipteranthus Barb.Rodr., based on Ornitho-
cephalus pseudobulbiferus Barb.Rodr. (5Zygostates pellucida
Rchb.f.). A few morphological studies are also available in the
literature for the genus Centroglossa (Hoehne 1953; Toscano
de Brito 1994, 2001), and based on these studies, the genus
has been considered as possibly allied to Zygostates (Toscano
de Brito 1994, 2001; Chase and Toscano de Brito 2009) or even
a synonym of the latter (Neubig et al. 2012). However, unlike
Zygostates, no member of Centroglossa has been investigated
at the molecular level to date.
The genus Dunstervillea has also been morphologically
investigated by Toscano de Brito (1994, 2001) and, like Centro-
glossa, its DNA has never been sampled. As mentioned here,
the structure of the labellum of Dunstervillea resembles that of
Centroglossa, but as indicated by Toscano de Brito (2001), such
similarity is probably due to evolutionary convergence. The
genus has been interpreted as belonging to the OC (Dressler
1981, 1993; Toscano de Brito 1994, 2001; Chase and Toscano
de Brito 2009) and probably related to genera with psigmoid
habit (e.g. Caluera,Eloyella and Ornithocephlaus). However,
when establishing the genus, Garay (1972) relates it to Omoea
Blume and Papillilabium Dockr., Asian and Australian genera,
respectively, from the subtribe Aeridinae.
Phylogenetic approaches based on molecular data, not
only from Orchidaceae as a whole but also from the subtribe
Oncidiinae, have been published and demonstrated the artifi-
ciality of some previously accepted taxonomic and nomencla-
tural proposals (Chase and Palmer 1988; Sosa et al. 2001;
Williams et al. 2001; Van den Berg et al. 2005; Neubig et al.
2012; Freudenstein and Chase 2015; Smidt et al. 2018). On the
other hand, phylogenetic studies based on morphological
data are scarce (Gravendeel and de Vogel 2002; Koehler et al.
2002; Garcia-Cruz and Sosa 2005; Chiron 2007; Sandoval-
Zapotitla et al. 2010; Bateman et al. 2018).
Although the monophyly of the OC has been suggested in
the works of Neubig et al. (2012), Freudenstein and Chase
(2015), and Smidt et al. (2018), the small sampling of the
genus Zygostates and the absence of sampling of Centroglossa
and Dunstervillea have prevented an inference of the evolu-
tionary relationships between their species. The floral mor-
phology of the OC is challenging, mainly due to the fusion
between portions of the labellum and the gynostemium, usu-
ally the most taxonomically informative organs (Toscano de
Brito 2001; Royer et al. 2021). Despite the large number of char-
acters that flowers at anthesis may provide, the complexity of
various floral structures precludes their precise use in morpho-
logical phylogenies (Smidt et al. 2018).
While molecular data are the main source for phylogenetic
reconstruction currently used, only morphological data pro-
vide essential information in interpreting evolutionary events
that are not attainable only with molecular data (Moritz and
Hillis 1996). The inclusion of morphological data, both in the
analysis and interpretation of phylogenetic trees, is the only
way to understand the evolutionary history of the diverse flo-
ral and vegetative characters between taxa.
The addition of morphological data in the analyses allows
rare taxa sampling, such as the monotypic genus Dunstervil-
lea, which is only represented in a few collections and usually
located in places of difficult access. The inclusion of such data
in phylogenetic analysis increases the support of the clades
and provides opportunities to contrast alternative hypotheses
(Lockhart and Cameron 2001).
In order to clarify the delimitation of the aforementioned
genera, we have performed further phylogenetic analyses of
a broad sampling, including for the first time representatives
of the genera Centroglossa,Dunstervillea, and Zygostates.We
used molecular data from nuclear (nrITS) and plastid (matK)
genomes, as well as morphological data to find diagnostic
characters and offer a more complete phylogenetic hypothe-
sis for the Ornithocephalus clade.
MATERIALS AND METHODS
All data have been submitted to Dryad (Royer et al. 2022d) and
updated in GenBank. Leaf samples fresh or preserved in saturated NaCl-
CTAB solution (Rogstad 1992) were obtained from collections in the
regions of occurrence of the species and public and private collections.
Unfortunately, some species were not found (such as Dunstervillea mirabi-
lis), or we were not successful in amplifying and sequencing the studied
regions. In these cases, we used data from GenBank (Royer et al. 2022d;
Appendix 1) or, if it is unavailable from this database, only its morpholog-
ical data was used.
Molecular Data Sampling and Sequencing—For the nuclear ribosomal
internal transcribed spacer (nrITS), we sampled 41 species (15 sequenced
for the first time), of which 36 belong to the OC. For the plastidial region
matK we included 37 species (15 sequenced for the first time), of which 33
belong to the clade under study. Fernandezia ecuadorensis (Dodson)
M.W.Chase, Fernandezia tica Mora-Ret. & Garcıa-Castro, Telipogon bombi-
formis Dressler, Hofmeisterella eumicroscopica (Rchb.f.) Rchb.f., and Tricho-
ceros antennifer (Bonpl.) Kunth, a phylogenetically related external group
in recent works (Chase and Toscano de Brito 2009; Neubig et al. 2012;
Smidt et al. 2018), were used as an outgroup. We extracted the DNA of
21 species through maceration using the 2% CTAB protocol by Doyle
and Doyle (1987) without adding RNAse A. PCR amplification was per-
formed in 20 mL reactions with Top Taq Master Mix (Qiagen) PCR kit
and 20–50 ng of genomic DNA. The nrITS region was amplified and
sequenced with primer pairs 92 (59AAGGTTTCCGTAGGTGAA39)175
(59TATGCTTAAACTCAGCGGG39) (Desfeux and Lejeune 1996) or 17SE
(ACGAATTCATGGTCCGGTGAAGTGTTCG) 126SE (TAGAATTCCCC
GGTTCGCTCGCCGTTAC) (Sun et al. 1994), while the partial matK exon
was amplified and sequenced with primers Kim-3F (59CGTACAGTACT
TTTGTGTTTACGAG3') 1Kim-1R (59ACCCAGTCCATCTGGAAATCTT
GGTTC39)(Cu
enoud et al. 2002), 2.1f (59CCTATCCATCTGGAAATCTTA
G39)15R (59GTTCTAGCACAAGAAAGTCG3') (http://www.barcoding.
si.edu/plant_working_group.htm;Ki-JoongKimpers.comm.)or19F
(59CGTTCTCATATTGCACTATG39)1881R (59TMTTCATCAGAATAAGA
GT39) (Gravendeel et al. 2001).
The thermocycler program was as follows: pre-melt at 94C, followed
by 40 cycles of 30 s of denaturation at 94C, 40 s of annealing at 51Cfor
nrITS and 53C for matK, and 40 s of extension at 72C, and final extension
at 72C for 5 min. The PCR products were visualized with electrophoresis
in agarose gel with GelRed (Crisafuli et al. 2015), and then purified with
10% polyethylene glycol (PEG) and 80% ethanol (Paithankar and Prasad
1991). Sanger sequencing reactions were analyzed on an ABI3739XL
genetic analyzer from Macrogen Inc. (Seoul, South Korea, http://dna.
ROYER ET AL.: PHYLOGENETIC POSITION OF CENTROGLOSSA AND DUNSTERVILLEA 32022]
macrogen.com), or at 3500xL Genetic Analyzer (Applied Biosystems)
from WEMseq (Curitiba, Brazil, https://www.wemseq.com).
Morphological Data Sampling—For the morphological analysis, we
included 54 species from Zygostates (23), Centroglossa (5), Dunstervillea
mirabilis, and another 20 taxa of the OC. Five taxa of phylogenetically close
clades inserted in the molecular analyses were used as the external group
(Smidt et al. 2018). The morphological analysis was based on the protolo-
gues of the species, herbarium specimens deposited at the following her-
baria: B, BR, BHCB, ESA, FUEL, FURB, GUA, HB, HEID, HUCP, HUEFS,
HUPG, ICN, M, MBM, MBML, R, RB, SP, SPF, SPPS, UEC, UPCB, W
(acronyms according to Thiers 2019), complemented with field-collected
material data (Royer et al. 2022d; Appendix 2), and the studies of Toscano
de Brito (1994, 2001, 2007) and Royer et al. (2017a, 2017b). We used charac-
ters found in vegetative (rhizome, stem, and leaf) and reproductive
organs (inflorescence, flowers, sepals, petals, labellum, gynostemium, and
pollinarium). The terminology used in the description of the characters
and their respective states were extracted from Toscano de Brito (1994,
2001), Harris and Harris (1999), and Stearn (2004).
The matrix (Royer et al. 2022d; Appendices S3, S4) was built with Mes-
quite program version 3.31 (Maddison and Maddison 2017). We selected
72 qualitative characters, being ten vegetative characters (nine binaries
and one multistate) and 62 reproductive characters (38 binaries and 24
multistate), according to the following cumulative criteria: 1) their poten-
tial to distinguish taxa through studied genera; 2) the stability of their
states between individuals of the same taxon; 3) the viability of the associ-
ated observations; and 4) independence from each other (Emerson and
Hastings 1998; Sereno 2007). All characters were treated with equal
weight and unordered states (Fitch's parsimony; Fitch 1971).
Data Analysis—The molecular sequences were assembled and edited
using Geneious software version 9 (Kearse et al. 2012). The alignment of
multiple sequences was performed using the MAFFT 7.017 plugin (Katoh
et al. 2002) with standard configurations and visually inspected. Maxi-
mum likelihood (ML) analyses were performed using IQ-TREE 1.6.11
(Nguyen et al. 2014) with 1000 bootstrap replicates in a single run (Cher-
nomor et al. 2016). The best-fit models of substitution were estimated
using ModelFinder (Kalyaanamoorthy et al. 2017) implemented in
IQ-TREE under the Akaike information criterion (AIC). The models
selected were GTR 1I1G for nrITS, TVM 1GformatK,andMK1FQ 1
G4 for morphology. Bootstrap support (values 50–100%) was calculated
based on 1000 ultrafast bootstrap approximation (UFBoot) replicates
(Minh et al. 2013), with a strategy to reduce the risk of overestimating sup-
port (-bnni).
The Bayesian Inference (BI) was conducted using MrBayes 3.2.2
(Ronquist et al. 2012) through the CIPRES platform (Miller et al. 2010).
We started from random trees and employed Monte Carlo Markov chain
(MCMC), over ten million generations, sampling trees and parameters
every 1000 generations. The appropriate nucleotide replacement model for
nrITS was GTR 1I1G and the TVM 1GformatK, which were chosen
based on the Bayesian information criterion conducted with jModelTest2
(Darriba et al. 2012) on CIPRES. We discarded 25% of the initial genera-
tions, after visual inspection of the tree’s log-likelihood stabilization, mea-
sured by standard deviation (s) and PSRF (potential scaling factor)
(Gelman and Rubin 1992). The remaining 7500 trees were used to produce
a 50% majority-rule consensus tree, providing the later clade probabilities
(values 0.5 to 1), visualized in FigTree 1.4.4 (Raumbaut 2009).
Maximum parsimony (MP) analyses were performed with parsimony
by Fitch (1971) using the PAUP software (Swofford 1991). The analysis
included 1000 replicates with random taxa addition, TBR exchange algo-
rithm and retaining ten trees per replication, followed by a second survey
to explore all the topologies of the previous one, limited to 10,000 final
trees. Support was estimated by 1000 bootstrap replicates (values
50–100%) (Felsenstein 1985), with simple addition, TBR algorithm, and
maintenance of 20 trees per replication.
Phylogenetic hypotheses were generated in each analysis for the three
datasets separately, combining the two molecular regions, and combining
the molecular data with the morphological data. The optimization of the
character state in the topology that combined molecular and morphologi-
cal data was made with unambiguous changes using the Winclada pro-
gram (Nixon 2002).
RESULTS
All trees are represented by the result of the maximum like-
lihood (ML) with the values of bootstrap support of ML
(BSML), posterior probability (PP) from Bayesian inference,
and bootstrap support from the analysis of maximum parsi-
mony (BSMP). The statistics of the five datasets are summa-
rized in T1Table 1.
The tree from the molecular dataset (nrITS 1cpmatK;F2Fig. 2A)
confirms the monophyletic nature of the Ornithocephalus clade
and Zygostates, including Centroglossa, with strong support
(100 BSML, 1.00 PP, 99 BSMP). The tree from morphological
data (Fig. 2B) also confirms the monophyletic nature of the
Ornithocephalus clade, but with low support (0.98 PP, 77 BSMP).
Zygostates and Centroglossa are monophyletic, but unrelated
and with low support in all analyses. Dunstervillea is a succes-
sive branch between the Eloyella spp., but with low support.
The total evidence tree ( F3Fig. 3) confirms the monophyletic
nature of the Ornithocephalus clade (100 BSML, 0.99 PP, 94
BSMP), sustained by molecular and morphological data as
the labellum color white with callus green (characters 35 and
47, F4Fig. 4), a characteristic reversed in some species, mainly in
Platyrhiza and Thysanoglossa. Phymatidium is the sister genus
of all the other genera (98 BSML, 0.98 PP, 79 BSMP), sup-
ported among other characters, by spiral phyllotaxy, acute
gynostemium anther cap, and the pollinium with cupulate
caudicle (characters 05, 65, and 71). The clade formed by the
other genera is subdivided into two clades that are sustained
by the presence of dorsal and lateral sepals with obtuse apex
as morphological synapomorphies (characters 19 and 27).
Centroglossa is included in Zygostates (84 BSML, 0.77 PP, 65
BSMP), sharing the dorsal position of viscidium as a morpho-
logical synapomorphy (character 67). The taxa currently
belonging to the genus Centroglossa form a clade within
Zygostates with low support (54 BSML) but supported by the
presence of a spurred labellum (character 38). Hence, with
the inclusion of Centroglossa, Zygostates becomes monophy-
letic, but few highly-supported clades were found in the
genus. Zygostates ovatipetala is sister to Z. pellucida (100 BSML,
1 PP, 97 BSMP), sharing the presence of papillae on the surface
of the petals (character 31) as a morphological synapomorphy.
TABLE 1. Results of phylogenetic analysis using the maximum parsimony criterion for each considered dataset.
nrITS matK ITS1matK Morphological Combined analyses
Number taxa 41 37 41 54 54
Number characters 780 858 1638 72 1710
Number constant characters 383 (49%) 649 (75%) 1032 (62%) 1 (1.3%) 1034 (60%)
Number uninformative characters 100 (12%) 118 (13%) 218 (12%) 1 (1,3%) 218 (12%)
Number informative characters 297 (38%) 91 (11%) 388 (24%) 70 (97%) 458 (26%)
Number retained trees 80 100 100 54 72
Tree length 1069 307 1398 431 1861
Consistency index (CI) 0.56 0.75 0.60 0.27 0.51
Homoplastic index (HI) 0.43 0.24 0.39 0.72 0.48
Retention index (RI) 0.72 0.80 0.73 0.60 0.68
SYSTEMATIC BOTANY4 [Volume 47
Zygostates cornuta is related to Z. lunata (100 BSML, 1 PP, 99
BSMP), however, we did not find any morphological synapo-
morphy for them. Zygostates bradei and Z. cornigera are sister
species that share a hook-shaped viscidium as a morphologi-
cal synapomorphy (character 68) (97 BSML, 0,6 PP).
In the other clade (84 BSML, 0,78 PP, 60 BSMP) we found
well supported relationships also sustained by distinct mor-
phological synapomorphies. Platyrhiza and Thysanoglossa are
sister genera (98 BSML, 1 PP, 99 BSMP), sharing the yellow
and green labellum (character 35) as a synapomorphy. Mem-
bers of the clade formed by Caluera, Dunstervillea,Eloyella,
and Ornithocephalus (98 BSML, 0,94 PP, 75 BSMP), share the
presence of unifacial leaves without stomata on adaxial
groove (character 09). Caluera and Ornithocephalus (96 BSML,
0,97 PP, 72 BSMP) do not have staminodes at any stage of
development (character 53) as a synapomorphy, which was
reversed in Caluera tavaresii.Ornithocephalus is monophyletic
(97 BSML, 1 PP, 95 BSMP), and possesses dorsal sepal with a
trichomatous margin (character 18) as an exclusive character-
istic. Dunstervillea appears phylogenetically closer to Eloyella
(80 BSML, 0,97 PP) supported by homoplastic characters.
DISCUSSION
The phylogenetic hypothesis obtained in this work has
demonstrated that the genus Centroglossa should be treated as
a member of Zygostates and that the genus Dunstervillea is
phylogenetically related to Eloyella. Based on morphological
characters, we have identified additional diagnostic synapo-
morphies that distinguish different groups within the clade.
The hypothesis that Centroglossa and Zygostates are related
(Toscano de Brito 2001; Chase and Toscano de Brito 2009;
Neubig et al. 2012) has been confirmed in all analyses per-
formed in the present study. As already mentioned by
Toscano de Brito (2001), the dorsal position of the viscidium
is a unique characteristic among the genera within the clade.
The similarity of members of these two genera has been
alluded since 1869, when Reichenbach (1869) described
Zygostates greeniana, which was later transferred to Centro-
glossa (Cogniaux 1904).
While there is no doubt about the insertion of Centroglossa
within Zygostates, the interspecific relationships of the genus
are still unclear. The frequency of clades with low support
and polytomies among species of Zygostates demonstrate the
difficulties faced by some taxonomists in the past (e.g. Reich-
enbach 1863; Barbosa Rodrigues 1877, 1882; Cogniaux 1904,
1905; Pabst and Dungs 1977; Toscano de Brito 1994). Floral
development studies (e.g. P
abon-Mora and Gonz
alez 2008;
Royer et al. 2021) reveal high lability of organs in late devel-
opment and these may reflect different evolutionary histories
when explored by different sources of data (e.g. morphologi-
cal, nuclear, or plastid DNA).
FIG. 2. A. Maximum-likelihood tree of Ornithocephalus clade resulting from the combination of molecular datasets (cpmatK 1nrITS). Numbers on nodes
represent ML bootstrap percentages ($50%), posterior probabilities from Bayesian inference ($0.50), and maximum parsimony bootstrap percentages
($50%). B. Strict consensus tree from 54 maximum parsimony trees of morphological data. Numbers on nodes represent ML bootstrap percentages
($50%), posterior probabilities from Bayesian inference ($0.50), and maximum parsimony bootstrap percentages ($50%).
ROYER ET AL.: PHYLOGENETIC POSITION OF CENTROGLOSSA AND DUNSTERVILLEA 52022]
FIG. 3. Maximum-likelihood tree of Ornithocephalus clade resulting from the combination of molecular (cpmatK 1nrITS) and morphological data. Num-
bers on nodes represent ML bootstrap percentages ($50%), posterior probabilities from Bayesian inference ($0.50%), and maximum parsimony bootstrap
percentages ($50%). In detail, the ML tree with proportional branch lengths. In orange, the clade with Dunstervillea, in green Zygostates, and in yellow spe-
cies previously placed in Centroglossa.
SYSTEMATIC BOTANY6 [Volume 47
Despite a similar labellum morphology, Dunstervillea has been
shown to be unrelated to Centroglossa. The spurred labellum, as
well as several other characters within the OC, appeared inde-
pendently more than once in the group, revealing parallelism
between such structures. Although the development of the spur
in these genera has never been investigated, the origin of this
structure appears to be distinct. According to Dressler (1981), in
Centroglossa, the spur grows free of the pedicel and seems to be
formed only by tissues of the labellum, while in Dunstervillea,
the spur has its base attached to the ovary, having its probable
origin through the junction between an extension of the gynoste-
mium and the base of the labellum. However, anatomical stud-
ies of the labellum of Dunstervillea developed by Toscano de
Brito (1994, 2001) did not reveal any evidence of such junction,
instead suggesting the presence of an extension of the gynoste-
mium or a fusion zone between the labellum and the sepals,
since the sepals’base in Dunstervillea is located laterally on the
labellum spur. As demonstrated by Royer et al. (2021) while
studying the formation of callus on the labellum and the growth
of stamens, the presence of a spur is a characteristic formed in
late development and subject to great lability and homoplasy.
Our results suggest a closer relationship between Dunstervil-
lea and Eloyella, which corroborates Toscano de Brito’s (2001)
position, who already indicated a possible close relationship
between these two genera. In our analyses, Dunstervillea and
Eloyella form a clade with high posterior probability (0.97) and
share the position spreading of the sepals and the entire margins
of the petals (characters 22 and 33). In addition, both genera pos-
sess a psigmoid habit, single-faced, laterally flattened leaves,
and a short rostellum (Chase and Toscano de Brito 2009).
TAXONOMIC TREATMENT
1. Eloyella mirabilis (Garay) Royer, Toscano & Smidt, comb. nov.
Dunstervillea mirabilis Garay, Venez. Orchids. Ill. [Dunster-
ville & Garay] 5: 70 (1972). TYPE:VENEZUELA.Bolivar:Road
to Sta. Elena de Uair
en, ca. km. 137 south of El Dorado,
s.d., G.C.K. Dunsterville 1170 (Holotype: AMES!).
Distribution—Brazil North, Ecuador, Venezuela (Oliveira
and Silva 2000; WCSP 2021; Royer et al. 2022c).
2. Zygostates castellensis (Brade) Royer, Toscano & Smidt, comb.
nov. Centroglossa castellensis Brade, Arch. Jard. Bot. Rio de
Janeiro 9: 12, Table 3 (1950). TYPE:BRAZIL. Espirito Santo:
Castelo, Brac¸o do Sul, cult. Jardim Bot^
anico do Rio de
Janeiro, 27 October 1948, A.C. Brade 19141 (Holotype: RB!).
Distribution—Brazil Southeast (Brade 1949; WCSP 2021;
Royer et al. 2022a).
3. Zygostates greeniana (Rchb.f.) Royer, Toscano & Smidt, comb.
nov. Zygostates greeniana Rchb.f. The Gardener
s Chronicle
& Agricultural Gazette 988. 1869. TYPE:BRAZIL.Riode
Janeiro: Without locality, Bowman 1414 (Holotype: W!).
Centroglossa macroceras Barb.Rodr. Genera et Species Orchi-
dearum Novarum 2: 235. 1882. TYPE:BRAZIL.Riode
Janeiro: Rodeio, flowered in October, J. Barbosa Rodrigues
s.n. (Holotype: Lost; Lectotype here indicated: figure B,
Table312,v.6daIconographiedesOrchid
ees du Br
esil,
deposited in RB and reproduced in Sprunger et al. (1996)).
Centroglossa glaziovii Cogn., Fl. Bras. (Martius) 3(6): 189 (1904).
TYPE:BRAZIL.RiodeJaneiro:AltoMaca
e, 05 November
1888, Glaziou 17803 (Holotype not designated; Lectotype
here designated: Rio de Janeiro: Alto Maca
e, 05 November
1888, Glaziou 17803 (P!)).
Centroglossa greeniana var. aurea Cogn.,Bull.Soc.Roy.Bot.Bel-
gique 43: 332 (1907). TYPE:BRAZIL. Rio de Janeiro: Ter-
es
opolis, Serra dos
Org~
aos, November 1888, J. de Moura
124 (Holotype: BR!).
Distribution—Brazil Southeast (Cogniaux 1904; WCSP 2021;
Royer et al. 2022a).
4. Zygostates nunes-limae (Porto & Brade) Royer, Toscano &
Smidt, comb. nov. Centroglossa nunes-limae Porto & Brade,
FIG. 4. Evolution of 72 morphological characters in the maximum likelihood tree. Black circles represent synapomorphies, and white circles represent
homoplasy. Numbers above the branches correspond to the characters, and numbers below the branches to the character state transition according to Royer
et al. 2022d, Appendix S3.
ROYER ET AL.: PHYLOGENETIC POSITION OF CENTROGLOSSA AND DUNSTERVILLEA 72022]
Anais Reuni~
aoSul-Amer.Bot.3:41,Table7,Fig.2(1940).
TYPE:BRAZIL. Minas Gerais: Juiz de Fora, cult. Jardim
Bot^
anico do Rio de Janeiro, 16 October 1937, J. Nunes Lima
s.n. (Holotype: RB00542579!).
Centroglossa aurantiaca Chiron & N.Sanson, Richardiana 11(3):
130 (-133; Fig. 1) (2011). TYPE:BRAZIL.Esp
ırito Santo: Dom-
ingos Martins, s.d., collected by N. Sanson, s.n., ex. Chiron
10129 (Holotype: MBML!).
Distribution—Brazil Southeast (Porto and Brade 1940;
Chiron et al. 2011; WCSP 2021; Royer et al. 2022a).
5. Zygostates tripollinica (Barb.Rodr.) Royer, Toscano & Smidt,
comb. nov. Ornithocephalus tripollinicus Barb.Rodr., Gen.
Sp. Orchid. i. 136 (1877). Centroglossa tripollinica Bar-
b.Rodr., Gen. Sp. Orchid. ii. 235 (1881). TYPE:BRAZIL.Minas
Gerais: Poc¸os de Caldas, in wet forests, flowered in April,
J. Barbosa Rodrigues s.n. (Holotype: Lost; Lectotype desig-
nated in Royer et al. 2017b: illustration Table 312, fig. A,
vol.6,inIconogr.Orchid.Br
esil at the Library of Rio de
Janeiro Botanical Garden, cited as Table 461 (then unpub-
lished) in Barb.Rodr. loc.cit; copied and reproduced in
black and white in Cogn., Fl. Bras. (Mart.) 3(5), Table 46,
Fig. 1, 1.1904.; reproduced in color in Sprunger et al. 1996,
vol. 1: 440, fig. A).
Distribution—Brazil South and Southeast (Barbosa
Rodrigues 1882; Cogniaux 1904; Royer et al. 2017a, 2022a;
WCSP 2021).
ACKNOWLEDGMENTS
This work was supported by Coordenac¸~
ao de Aperfeic¸oamento de
Pessoal de N
ıvel Superior (CAPES) [grant number 001] for the CAR
and AVRSM. ECS was supported by Conselho Nacional de Desenvol-
vimento Cient
ıfico e Tecnol
ogico (CNPq) for Bolsa de Produtividade
em Pesquisa CNPq-N
ıvel 1D [grant number 314642/2020-0]. A.L.V.T.B.
was supported by Coordenac¸~
ao de Aperfeic¸oamento de Pessoal de
N
ıvel Superior (CAPES), Programa Pesquisador Visitante Especial
(PVE) [grant number 88881.065009/2014-0]. We thank Instituto Chico
Mendes de Conservac¸~
ao da Biodiversidade (ICMBio) [Process 30642-1;
50482-1, 50482-2] and Instituto Ambiental do Paran
a (IAP) [Process
32.15] for the collection authorizations.
AUTHOR CONTRIBUTIONS
This paper is part of the doctoral thesis of CAR supervised by ECS and
co-supervised by ALVTB. CAR, ECS, and ALVTB conceived the study,
CAR and ALVTB obtained the specimens, visited the herbaria, and ana-
lyzed the taxa and morphological data. CAR and AVSRM extracted and
amplified the DNA and submitted it to GenBank. CAR and ECS analyzed
the data. All authors discussed the results and contributed to the final
manuscript.
LITERATURE CITED
Barbosa Rodrigues, J. 187 7. Genera et Species Orchidearum Novarum, 1.
Sebastianopolis: Typographia Nacional.
Barbosa Rodrigues, J. 188 2. Genera et Species Orchidearum Novarum, 2.
Sebastianopolis: Typographia Nacional.
Bateman, R. M., A. R. M. Murphy, P. M. Hollingsworth, M. L. Hart, I.
Denholm, and P. J. Rudall. 2018. Molecular and morphological phy-
logenetics of the digitate-tubered clade within subtribe Orchidinae
s.s. (Orchidaceae: Orchideae). Kew Bulletin 73: 54.
Brade, A. C. 1949. Centroglossa castellensis. Arquivos do Jardim Bot^
anico do
Rio de Janeiro 9: 12.
Chase, M. W. 1988. Obligate twig epiphytes: A distinct subset of Neotrop-
ical orchidaceous epiphytes. Selbyana 10: 24–30.
Chase, M. W. 2009. Oncidiinae. Pp 212 in Genera Orchidacearum: Epiden-
droideae, vol. 5, part 2, 1st Ed. eds. A. M. Pridgeon, P. J. Cribb, M. W.
Chase, and F. Rasmussen. New York: Oxford University Press, Inc.
Chase, M. W. and J. D. Palmer. 1988. Chloroplast DNA variation, geo-
graphical distribution and morphological parallelism in subtribe
Oncidiinae (Orchidaceae). American Journal of Botany 75: 163–164.
Chase, M. W. and A. L. V. Toscano de Brito. 2009. Zygostates.Pp391–394
in Genera Orchidacearum: Epidendroideae, vol. 5, part 2, 1st Ed., eds.
A.M.Pridgeon,P.J.Cribb,M.W.Chase,andF.Rasmussen.
New York: Oxford University Press, Inc.
Chernomor, O., A. von Haeseler, and B. Q. Minh. 2016. Terrace aware
data structure for phylogenomic inference from supermatrices.
Systematic Biology 65: 997–1008.
Chiron, G. R. 2007. Phylogenetic analyses of the genus Baptistonia (Orchi-
daceae: Onciidinae) sensu lato based on morphological characters.
Journal of the Botanical Research Institute of Texas 1: 913–931.
Chiron, G. R., N. Sanson, and R. X. Bolsanello. 2011. Quatre nouvelles
esp
eces d’Orchidaceae du Br
esil. Richardiana 11: 129–149.
Cogniaux, A. 1904. Orchidaceae: Centroglossa. Pp. 189–192 in Flora Brasi-
liensis, vol. 3, part 6, eds. C. F. P. Martius, A. G. Eichler, and I. Urban.
Munich and Leipzig: Typographia Regia C. Wolf et fil.
Cogniaux, A. 1905. Orchidaceae: Dipteranthus –Zygostates.Pp.213–220
in Flora Brasiliensis,vol.3,part6,eds.C.F.P.Martius,A.G.Eich-
ler, and I. Urban. Munich and Leipzig: Typographia Regia C.
Wolf et fil.
Crisafuli, F. A., E. B. Ramos, and M. S. Rocha. 2015. Characterizing the
interaction between DNA and GelRed fluorescent stain. European Bio-
physics Journal 44: 1–7.
Cu
enoud, P., V. Savolainen, L. W. Chatrou, M. Powell, R. J. Grayer, and
M. W. Chase. 2002. Molecular phylogenetics of Caryophyllales based
on nuclear 18S rDNA and plastid rbcL, atpB,andmatK DNA
sequences. American Journal of Botany 89: 132–144.
Darriba, D., G. L. Taboada, R. Doallo, and D. Pousada. 2012. jModel-Test
2: More models, new heuristics and parallel computing. Nature Meth-
ods 9: 772.
Desfeux, C. and B. Lejeune. 1996. Systematics of Euromediterranean Silene
(Caryophyllaceae): evidence from a phylogenetic analysis using ITS
sequences. Comptes R endus de l’Acad
emie des Sciences. S
erie III, Sciences
de la Vie 319: 351–358.
Doyle, J. J. and J. L. Doyle. 1987. A rapid DNA isolation procedure for
small amounts of leaf tissue. Phytochemical Bulletin 19: 810–815.
Dressler, R. L. 1981. The Orchids: Natural History and Classification. Cam-
bridge: Harvard University Press.
Dressler, R. L. 1993. Phylogeny and Classification of the Orchid Family. Cam-
bridge: Harvard University Press.
Emerson, S. B. and P. A. Hastings. 1998. Morphological correlations in
evolution: Consequences for phylogenetic analysis. The Quarterly
Review of Biolog y 73: 141–162.
Felsenstein, J. 1985. Confidence limits on phylogenies: An approach using
the bootstrap. Evolution 39: 783–791.
Fitch, W. M. 1971. Towards defining the course of evolution: Minimum
change for a specifictreetopology.Systematic Zoology 20: 406–416.
Freudenstein, J. V. and M. W. Chase. 2015. Phylogenetic relationships in
Epidendroideae (Orchidaceae), one of the great flowering plant
radiations: Progressive specialization and diversification. Annals of
Botany 115: 665–681.
Garay, L. A. 1972. On the systematics of the monopodial orchids I. Botani-
cal Museum Leaflets 23: 149–212.
Garcia-Cruz, J. and V. Sosa. 2005. Phylogenetic relationships and charac-
ter evolution in Govenia (Orchidaceae). Canadian Journal of Botany 83:
1329–1339.
Gelman, A. and D. B. Rubin. 1992. Inference from iterative simulation
using multiple sequences. Statistical Science 7: 457–472.
Gravendeel, B. and E. F. de Vogel. 2002. Revision of Coelogyne section
Moniliformes (Orchidaceae) based on morphology, plastid and nrITS
sequences. Blumea 47: 409–462.
Gravendeel, B., M. W. Chase, E. F. de Vogel, M. C. Roos, T. H. Mes, and
K. Bachmann. 2001. Molecular phylogeny of Coelogyne (Epidendroi-
deae; Orchidaceae) based on plastid RFLPs, matK, and nuclear ribo-
somal ITS sequences: Evidence for polyphyly. American Journal of
Botany 88: 1915–1927.
Harris, J. G. and M. W. Harris. 1999. Plant Identification Term inology: An
Illustrated Glossary. Spring Lake, Utah: Spring Lake Publishing.
Hoehne, F. C . 1953. Centroglossa. Pp. 375–381 in Flora Bras
ılica, Orchidaceas,
vol. 12, number 7, ed. F. C. Hoehne. S~
ao Paulo: Companhia Brasileira
de Impress~
ao e Propaganda.
Kalyaanamoorthy, S., B. Q. Minh, T. K. Wong, A. von Haeseler, and L. S.
Jermiin. 2017. ModelFinder: Fast model selection for accurate phylo-
genetic estimates. Nature Methods 14: 587–589.
SYSTEMATIC BOTANY8 [Volume 47
Katoh, K., K. Misawa, K. Kuma, and T. Miyata. 2002. MAFFT: A novel
method for rapid multiple sequence alignment based on fast Fourier
transform. Nucleic Acids Research 30: 3059–3066.
Kearse, M., R. Moir, A. Wilson, S. Stones-Havas, M. Cheung, S. Sturrock,
S. Buxton, A. Cooper, S. Markowitz, C. Duran, T. Thierer, B. Ashton,
P. Meintjes, and A. Drummond. 2012. Geneious Basic: An integrated
and extendable desktop software platform for the organization and
analysis of sequence data. Bioinformatics 28: 1647–1649.
Koehler, S., N. H. Williams, W. M. Whitten, and M. C. E. Amaral. 2002.
Phylogeny of the Bifrenaria (Orchidaceae) complex based on mor-
phology and sequence data from nuclear rDNA internal transcribed
spacers (ITS) and chloroplast trnL-trn-F region. International Journal of
Plant Sciences 163: 1055–1066.
Lindley, J. 1837. Zygostates. Edwards’s Botanical Register 23: 1927. London:
James Ridgway and Sons, Picadilly.
Lockhart, P. J. and S. A. Cameron. 2001. Trees for bees. Trends in Ecology
& Evolution 16: 84–88.
Maddison, W. P. and D. R. Maddison. 2017. Mesquite: a modular system
for evolutionary analysis. Version 3.31. http://mesquiteproject.org.
(accessed on 05 July 2017) .
Miller, M. A., W. Pfeiffer, and T. Schwartz. 2010. Creating the CIPRES Sci-
ence Gateway for inference of large phylogenetic trees. Pp. 1–8in
Proceedings of the Gateway Computing Environments Workshop (GCE).
New Orleans: Gateway Computing.
Minh, B. Q., M. A. Nguyen, and A. von Haeseler. 2013. Ultrafast approxi-
mation for phylogenetic bootstrap. Molecular Biology and Evolution 30:
1188–1195.
Moritz, C. and D. M. Hillis. 1996. Molecular systematics: Context and
controversies. Pp. 1–10 in Molecular Systematics, 2nd Ed., eds. D. M.
Hillis, C. Moritz, and B. K. Mable. Sunderland: Sinauer Associates.
Neubig, K. M., W. M. Whitten, N. H. Williams, M. A. Blanco, L. Endara,
J. G. Burleigh, K. Silvera, J. C. Cushman, and M. W. Chase. 2012.
Generic recircumscriptions of Oncidiinae (Orchidaceae: Cymbidieae)
based on maximum likelihood analysis of combined DNA datasets.
Botanical Journal of the Linnean Society 168: 117–146.
Nixon, K. C. 2002. Winclada, v. 1.00.08. Published by the author. Ithaca,
New York.
Nguyen, L. T., H. A. Schmidt, A. von Haeseler, and B. Q. Minh. 2014.
IQ-TREE: A fast and effective stochastic algorithm for estimating
maximum-likelihood phylogenies. Molecular Biology and Evolution 32:
268–274.
Oliveira, A. T. and J. B. F. Silva. 2000. Dunstervillea Garay (Orchidaceae
Jussieu Nom. Cons.)-Umanovaocorr
^
encia do g^
enero para o Brasil.
Boletim do Museu Paraense Emilio Goeldi.S
erie Bot^
anica 16: 23–27.
P
abon-Mora, N. and F. Gonz
alez. 2008. Floral ontogeny of Telipogon spp.
(Orchidaceae) and insights on the perianth symmetry in the family.
International Journal of Plant Sciences 169: 1159–1173.
Pabst, G. F. J. and F. Dungs. 1977. Orchidaceae Brasilienses,vol.2.Hildes-
heim: Brucke-Verlag Kurt Schmersow.
Paithankar, K. R. and K. S. Prasad. 1991. Precipitation of DNA by poly-
ethylene glycol and ethanol. Nucleic Acids Research 19: 1346.
Porto, P. C. and A. C. Brade. 1940. Orchidaceae Novae Brasilienses III.
Anais da Primeira Reuni~
ao Sul-Americana de Bot^
anica 3: 31–50.
Raumbaut, A. 2 009. Fi gTree 1.4.4: Tree figure drawing tool. http://tree.
bio.ed.ac.uk/software/figtree (accessed 13 March 2019).
Reichenbach, H. G. 1863. Orchideae. Annales Botanices Systematicae 6:
167–933.
Reichenbach, H. G. 1869. Zygostates greeniana. Gardeners’.The Chronicle
38: 988.
Rogstad, S. H. 1992. Saturated NaCI-CTAB solution as a means of field
preservation of leaves for DNA analyses. Taxon 41: 701–708.
Ronquist,F.,M.Teslenko,P.vanderMark,D.L.Ayres,A.Darling,
S. H€
ohna, B. Larget, L. Liu, M. A. Suchard, and J. P. Huelsenbeck.
2012. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model
choice across a large model space. Systematic Biology 61: 539–542.
Royer, C. A., A. L. V. Toscano de Brito, and E. C. Smidt. 2017a. Centro-
glossa tripollinica (Barb.Rodr.) Barb.Rodr. (Orchidaceae: Oncidiinae):
Lectotypification and rediscovery in the State of Paran
a, Brazil. Hoeh-
nea 44: 139–144.
Royer, C. A., A. L. V. Toscano de Brito, and E. C. Smidt. 2017b. O g^
enero
Zygostates (Orchidaceae: Oncidiinae) no estado do Paran
a, Brasil.
Rodrigu
esia 68: 1431–1446.
Royer, C. A., A. L. V. Toscano de Brito, T. St€
utzel, E. C. Smidtc, and
E. L. P. Nunes. 2021. Floral development of the Ornithocephalus
clade (Oncidiinae, Orchidaceae): The origin of the tabula infrastigma-
tica, gynostemium appendices and labellar callus. Botanical Journal of
the Linnean Society 195: 636–649.
Royer, C. A., E. C. Smidt, and A. L. V. Toscano de Brito. 2022a. Centro-
glossa in Flora e Funga do Brasil. Jardim Bot^
anicodoRiodeJaneiro.
https://floradobrasil.jbrj.gov.br/FB11348 (accessed on 22 April 2022).
Royer,C.A.,E.C.Smidt,andA.L.V.ToscanodeBrito.2022b.Zygostates
in Flora e Funga do Brasil. Jardim Bot^
anicodoRiodeJaneiro.
https://floradobrasil.jbrj.gov.br/FB12390 (accessed on 22 April 2022).
Royer, C. A., A. L. V. Toscano de Brito, and E. C. Smidt. 2022c. Dunstervil-
lea in Flora e Funga do Brasil. Jardim Bot^
anicodoRiodeJaneiro.
https://floradobrasil.jbrj.gov.br/FB37509 (accessed on 22 April 2022).
Royer, C. A., A. L. V. Toscano de Brito, A. V. Mauad, and E. C. Smidt.
2022d. Data from: Phylogenetic position of Centroglossa and Dunster-
villea (Ornithocephalus clade: Oncidiinae: Orchidaceae) based on
molecular and morphological data. Dryad Digital Repository.
https://doi.org/10.5061/dryad.tmpg4f51j.
Sandoval-Zapotitla, E., J. Garc
ıa-Cruz, T. Terrazas, and J. L. Villase~
nor.
2010. Relaciones filogen
eticas de la subtribu Oncidiinae (Orchida-
ceae) inferidas a partir de caracteres estructurales y secuencias de
ADN (ITS y matK): Un enfoque combinado. Revista Mexicana de Biodi-
versidad 81: 263–279.
Sereno, P. C. 2007. Logical basis for morphological characters in phyloge-
netics. Cladistics 23: 565–587.
Smidt, E. C., A. L. V. Toscano de Brito, A. C. Martins, C. A. Royer, W. M.
Whitten, and M. W. Chase. 2018. Phylogenetics, biogeography and
character evolution in the Ornithocephalus clade (Orchidaceae, Onci-
diinae). Botanical Journal of the Linnean Society 188: 339–354.
Sosa, V., M. W. Chase, G. Salazar, W. M. Whitten, and N. H. Williams.
2001. Phylogenetic position of Dignathe (Orchidaceae: Oncidii nae):
Evidence from nuclear ITS ribosomal DNA sequences. Lindleyana 16:
94–101.
Sprunger, S., P. Cribb, and A. L. V. Toscano de Brito. 1996. Jo~
ao Barbosa
Rodrigues, Iconographie des Orchid
ees du Br
esil,vols.1–2. Basel:
Friedrich Reinhardt Verlag.
Stearn, W. T. 2004. Botanical Latin. Portland, Oregon: Timber Press.
Sun,Y.,D.Z.Skinner,G.H.Liang,andS.H.Hulbert.1994.Phylogenetic
analysis of Sorghum and related taxa using internal transcribed
spacers of nuclear ribosomal DNA. Theoretical and Applied Genetics
89: 26–32.
Swofford,D.L.1991.PAUP
Phylogenetic analysis using parsimony
(and other methods), Version 3.1. Computer program distributed
by the Illinois Natural History Survey, Champaign, Illinois.
Thiers, B. 2019 [continuously updated]. Index Herbariorum. New York
Botanical Garden. http://sweetgum.nybg.org/ih/ (accessed 27
March 2019).
Toscano de Brito, A. L. V. 1994. Systematic Studies in the Subtribe Ornithoce-
phalinae (Orchidaceae). London: University of Reading and Royal
Botanic Gardens, Kew.
Toscano de Brito, A. L. V. 2001. Systematic review of the Ornithocephalus
group (Oncidiinae:Orchidaceae) with comments on Hofmeisterella.
Lindleyana 16: 157–217.
Toscano de Brito, A. L. V. 2007. A taxonomic revision of the genus Phyma-
tidium (Orchidaceae: Oncidiinae). Kew Bulletin 62: 529–560.
ToscanodeBrito,A.L.V.2017.Zygostates luerorum —A new species
from Bolivia in the Ornithocephalus clade of subtribe Oncidiinae
(Orchidaceae). Harvard Papers in Botany 22: 133–135.
Van den Berg, C., D. H. Goldman, J. V. Freudenstein, A. M. Pridgeon,
K. M. Cameron, and M. W. Chase. 2005. An overview of the phylo-
genetic relationships within Epidendroideae inferred from multiple
DNA regions and recircumscription of Epidendreae and Arethuseae
(Orchidaceae). American Journal of Botany 92: 613–624.
WCSP. 2021. World Checklist of Selected Plant Families. Facilitated by the
Royal Botanic Gardens, Kew. Published on the Internet. http://
wcsp.science.kew.org/ (accessed March 2021).
Williams, N. H., M. W. Chase, T. Fulcher, and W. M. Whitten. 2001.
Molecular systematics of the Oncidiinae based on evidence from
four DNA sequence regions: Expanded circumscriptions of Cyrtochi-
lum, Erycina, Otoglossum,andTrichocentrum and a new genus (Orchi-
daceae). Lindleyana 16: 113–139.
APPENDIX 1. List of species, collector and number, herbarium, and
accession number of the GenBank sequence for the ITS and matK genes
of the specimens used in this study. sequenced in the study. Long
dash (—) information not available.
Ingroup: Caluera tavaresii Campacci & J.B.F.Silva, Toscano de Brito
3034, (UPCB), KX687827, MW256496.Centroglossa greeniana (Rchb.f.)
Cogn., C.A. Royer 69, (UPCB), MZ575593, MW256497.Centroglossa cf.
ROYER ET AL.: PHYLOGENETIC POSITION OF CENTROGLOSSA AND DUNSTERVILLEA 92022]
nunes-limae Porto & Brade, M. Klingelfuss 274, (UPCB), MZ575594,—.
Centroglossa tripollinica C.A. Royer 135, (UPCB), MZ575595, MZ575609.
Chytroglossa aurata Rchb.f., Gerlach 07/0068, (M), FJ565241, FJ564753.
Chytroglossa marileoniae Rchb.f., Smidt 1046, (UPCB), KX687828,
MW256498.Eloyella thienii Dodson, Whitten 1833, (FLAS), DQ315820,
DQ315888. Hintonella mexicana Ames, Whitten 513, (FLAS), FJ565447,
FJ564940. Ornithocephalus bicornis Lindl., Whitten 2375, (FLAS), FJ565564,
Whitten 3264, (FLAS), FJ565126. Ornithocephalus gladiatus Hook., Tos-
cano de Brito 3411, (UPCB), MZ575596, MW256499.Ornithocephalus
inflexus Lindl., Toscano de Brito 2775, (UPCB), KX687833, Blanco 2645,
(USJ), DQ315891. Ornithocephalus myrticola Lindl., Smidt 1034, (UPCB),
KT709694, C.A. Royer 114, (UPCB), MW256500.Phymatidium aquinoi
Schltr., Lima 343, (UPCB), KT709687, KR709308. Phymatidium delicatu-
lum Lindl., Smidt 965, (UPCB), KX687838, C.A. Royer 17, (UPCB),
KR709309. Phymatidium falcifolium Lindl., Mancinelli 1371, (UPCB),
KT709691, KR709310. Phymatidium geiselii Ruschi, M. Bolson 505,
(UPCB), KT709684, KR709315. Phymatidium mellobarretoi L.O.Williams
&Hoehne,Smidt 1028, (UPCB), KT709692, KR709311. Platyrhiza quadri-
color Barb.Rodr., Cabral 19 (UPCB), KX687840, C.A. Royer 39, (UPCB),
MZ575610.Rauhiella seehawerii (I.Bock) Toscano & Christenson, M.
Klingelfuss 273, (UPCB), MZ575597, Smidt 1047, (UPCB), MW256501.
Rauhiella silvana Toscano, Smidt 674, (HUEFS), KX687842, —.Thysano-
glossa jordanensis Porto & Brade, M. Klingelfuss 276, (UPCB),
MZ575598, Heidelberg BG 120057, (HEID), EF079224. Zygostates ader-
aldoana Toscano, Felix & Dornelas, C.A. Royer 159, (UPCB), MZ575599,
MW256502.Zygostates alleniana Kraenzl., C.A. Royer 56, (UPCB),
MZ575600, MW256503.Zygostates apiculata (Lindl.) Toscano, Toscano
de Brito 2773, (UPCB), MZ575601,Whitten 2929, (FLAS), FJ565111.
Zygostates bradei (Schltr.) Garay, Toscano de Brito 2435, (UPCB),
KX687844, C.A. Royer 171, (UPCB), MW256504.Zygostates cornuta
Lindl., Smidt 1033, (UPCB), KX687845, Smidt 972, (UPCB), KR709313.
Zygostates dasyrhiza (Kraenzl.) Schltr., Mancinelli 1066, (UPCB), KX687846,
C.A. Royer 113, (UPCB), MW256505.Zygostates densiflora (Senghas)
Baptista, XI/1248, (M), MZ575602, MW256506.Zygostates grandiflora
(Lindl.) Mansf., Chase O-103, (K), AF350508, AY368405. Zygostates kuhl-
mannii Brade, Smidt 1049, (UPCB), KX687847, C.A. Royer 57, (UPCB),
MW256507.Zygostates lunata Lindl., Toscano de Brito 3336, (UPCB),
MZ575603,Gerlach92/3883, (M), FJ564835. Zygostates multiflora (Rolfe)
Schltr., F. de Jesus 09, (UPCB), MZ575604, MW256508.Zygostates nec-
tar
ıfera (Senghas) Toscano, 2009/1087 (M), MZ575605,MW256509.
Zygostates obliqua (Schnee) Toscano, Williams 437, (FLAS), MZ575606,
Gerlach93/3251 (M), FJ564838. Zygostates ovatipetala (Brade) Toscano,
Toscano de Brito 3757, (UPCB), MZ575607,—.Zygostates pellucida
Rchb.f., Toscano de Brito 2597, (UPCB), KX687849, Whitten 2792, (FLAS),
FJ565103. Zygostates pustulata (Kraenzl.) Schltr., Mancinellii 1217A,
(JOI), MZ575608, MW256510.
Outgroup: Fernandezia ecuadorensis (Dodson) M.W.Chase, Whitten
3285, (FLAS), FJ565635, FJ565127. Fernandezia tica Mora-Ret. & Garc
ıa
Castro, Dressler & Atwood s.n., (FLAS), FJ565453, Maduro 240, (MO),
DQ315889. Hofmeisterella eumicroscopica (Rchb.f.) Rchb.f., Whitten 2690,
(FLAS), DQ315823, FJ565091. Telipogon bombiformis Dressler, Maduro
138, (FLAS), DQ315854, —.Trichocerus antennifer (Bonpl.) Kunth, Whitten
1803, (FLAS), DQ315883, Trujillo 340, (HURP), FJ564744.
APPENDIX 2. Examined material used in morphological phylogeny.
Centroglossa aurantiaca Chiron & N.Sanson: BRAZIL: Esp
ırito
Santo, Domingos Martins, s.d., collected by N. Sanson, s.n., ex. Chiron
10129 (MBML). Centroglossa castellensis Brade: BRAZIL: Espirito
Santo, Castelo, Brac¸o do Sul, cult. Jardim Bot^
anico do Rio de Janeiro,
27 Oct 1948, A.C. Brade 19141 (RB). Fund~
ao, Goiapaba-Ac¸u, 5 May
2003, A.P. Fontana et al. 577 (MBML). Minas Gerais: Belo Vale, 23 Oct
2001, J.A. Lombardi 4494 (BHCB). Centroglossa greeniana (Rchb.f.)
Cogn.: BRAZIL. Without locality, s.d., A.F.M. Glaziou 17809 (C); 15 Apr
1974, Firma Pfister ex Brasilien (HEID250651); 23 Mar 1984, Firma Pfister
ex Brasilien (HEID250650). Espirito Santo: Alegre, Caveira da Anta, 12
Oct 2007, D.R. Couto et al. 346 (MBML); Domingos Martins, Pedra
Azul, 6 Nov 1972, R. Kautsky & G. Bomba s.n. (HB 58521); Santa Maria
do Jetib
a, Garraf~
ao, 3 Mar 2003, M.V.S. Berger & A. Belz 63 (MBML);
Santa Teresa, Reserva Biol
ogica Augusto Ruschi, 23 Aug 2012, T.B. Flo-
res & G.O. Rom~
ao 1096 (ESA), Santo Ant^
onio, 4 Nov 2005, L. Kollmann
& A.P. Fontana 8427 (MBML). Minas Gerais: Alto Capara
o, Parque
Nacional do Capara
o, Sep 1996, L.S. Leoni 3467 (HB); Araponga, Pedra
do Indio, 21 Nov 2004, A. Heringer Salles et al. 3449 (HEPH); Capara
o,
20 Oct 1922, P. Campos Porto 1135 (RB); Ibitipoca, Parque Estadual do
Ibitipoca, 16 Oct 1993, R.C. Forzza et al. 59 (CESJ); Serra do Cip
o, 3
Nov 1973, P.G. Windisch s.n. (HB 53189). Rio de Janeiro: Miguel Per-
eira, Reserva Biol
ogica do Tingu
a, 11 Jul 2005, M. Bocayuva & E. Saddi
156 (RB); Nova Friburgo, Aug 1965, F. Dungs s.n. (HB 40701); Pet-
r
opolis, Jul 1931, C. Spanngel s.n. (R 35810); Teres
opolis, 27 Sep 1929,
A.C. Brade 9458 (R); 17 Sep 1945, A. Guimar~
aes s.n. (RB 00247644); Serra
dos Org~
aos, 13 Oct 1981, A.C. Brade 17123 (RB); Parque Nacional da
Serra dos Org~
aos, 21 Oct 1977, P.J.M. Maas & G. Martinelli 3390 (HB;
RB). S~
ao Paulo: Santo Andr
e, Alto da Serra, Sep 1898, G. Edwall 4041
(SP); Mairipor~
a, Parque Estadual da Cantareira, s.d., F.A.R.D.P. Arzolla
265 (SPSF). Centroglossa nunes-limae Porto & Brade: BRAZIL. Minas
Gerais, Juiz de Fora, cult. Jardim Bot^
anico do Rio de Janeiro, 16 Oct
1937, J. Nunes Lima s.n. (RB00542579). Rio de Janeiro: without locality,
s.d., C. Gaudichaud s.n. (R35809). Centroglossa tripollinica (Barb.Rodr.)
Barb.Rodr.: BRAZIL. Without locality, 1994, Firma Pfister ex Brasilien
(HEID250652). Without locality, flowery in Curitiba, cultivation by M.
Klingelfus s.n., 22 Jun 2015, A. Toscano de Brito 3408 (UPCB); 01 Jun
2016, C.A. Royer 135 (UPCB). Esp
ırito Santo: Castelo, s.d., A.C. Brade 30
(HB). Minas Gerais: Bom Jardim de Minas, 12 May 1961, J.E. Sal
eh 60
(HB); Caldas, near Fazenda Capivary, 15 May 1874, C.W.H. Mos
en 1708
(S); Caldas, s.d., A.F. Regnell III-1171 (S); Caldas, Pedra Branca, 18 Aug
1857, A.F.Regnell III-1170 (S; SP; P); Conceic¸~
ao do Mato Dentro, Parque
Natural Municipal do Ribeir~
ao do Campo, 8 Aug 2002, R.C. Mota et al.
2516 (BHCB). Rio de Janeiro: Itatiaia, Feb 1942, A.C. Brade 17336 (RB);
Serra dos Org~
aos, 1887, J.T. de Moura 49 (BR). S~
ao Paulo: Campos do
Jord~
ao, Eug^
enio Lefreve, 15 Sep 1968, O. Handro 2068 (SPF). Paran
a:
Without locality, 1908–1916, P.K.H. Dus
en s.n. (S 1644828); Quatro Bar-
ras, Morro M~
ae Catira, Rodovia da Graciosa, 13 May 2016, C.A. Royer
et al. 134 (UPCB). Chytroglossa marileoniae Rchb.f.: BRAZIL: Without
locality, s.d., Smidt 1046 (UPCB). Without locality, in cultivation, 26
Oct 2015, C.A. Royer 55 (UPCB). Ornithocephalus myrticola Lindl.:
BRAZIL. Esp
ırito Santo: Domingos Martins, in cultivation, 17 Feb 2017,
C.A. Royer & W.C. Cardoso 165 (UPCB). Santa Catarina, Benedito Novo,
27 Jan 2016, C.A. Royer 114 (UPCB). Phymatidium aquinoi Schltr.:
BRAZIL. Esp
ırito Santo: Castelo, Parque Estadual do Forno Grande, in
cultivation, 22 Feb 2017, C.A. Royer et al. 166 (UPCB). Paran
a: Quatro
Barras, Estrada da Graciosa, 29 Nov 2015, C.A. Royer & D.C. Imig 80
(UPCB). Phymatidium delicatulum Lindl.: BRAZIL. Esp
ırito Santo:
Marechal Floriano, Santa Maria, in cultivation, 2 Dec 2016, C.A. Royer
et al. 161 (UPCB). Paran
a: Antonina, APA Guaraquec¸aba, SPVS
Cachoeira, 1 May 2012, C.A. Royer 16 (UPCB), Guaratuba, Feb 2013,
C.A. Royer & M. Bornschein 17 (UPCB), Quatro Barras, Estrada da Gra-
ciosa, 28 Nov 2014, C.A. Royer & D.C. Imig 18 (UPCB), Pontal do
Paran
a, rio Guaraguac¸u, 30 Nov 2015, C.A. Royer & D.C. Imig 81
(UPCB). S~
ao Paulo: Iporanga, Parque Estadual Tur
ıstico do Alto
Ribeira, 17 Feb 2012, C.A. Royer & F.F.F. Mazziero 15 (UPCB). Phymati-
dium falcifolium Lindl.: BRAZIL: Paran
a: Telemaco Borba, Usina
Hidrel
etrica de Mau
a, 21 Jan 2015, C.A. Royer 26 (UPCB); Quatro Bar-
ras, Estrada da Graciosa, 29 Nov 2015, C.A. Royer & D.C. Imig 78
(UPCB). Rio de Janeiro: Itatiaia, Parque Nacional do Itatiaia, 24 Aug
2015, C.A. Royer & M. Bolson 47 (UPCB). Phymatidium geiselii Ruschi:
BRAZIL. Esp
ırito Santo: Domingos Martins, in cultivation, Jul 1969, R.
Kautsky s.n. (HB), s.d., F. Dungs s.n. (HB). Rio de Janeiro: Itatiaia, nas
Macieiras, 7 Jan 1929, J. Ferreira 1716 (US, S, AMES, G, F); Itatiaia,
trilha para a estac¸~
ao metereol
ogica, 25 Dec 1915, O. Ames 108 (AMES),
in cultivation, 4 Dec 2015, C.A. Royer & M. Bolson 89 (UPCB). Nova Fri-
burgo, Pico da Caled^
onia, 9 May 2012, A. Bonnet & E. Caglioni 127
(UPCB); Nova Friburgo, 26 Mar 1967, F. Dungs s.n. (HB); Teres
opolis,
Parque Nacional da Serra dos
Org~
aos, Trilha Pedra do Sino, entre os
abrigos 3 e 4, 23 Mar 2014, M. Bolson et al. 505 (UPCB). Phymatidium
mellobarretoi L.O.Williams & Hohene. BRAZIL. Minas Gerais: Alagoa,
Parque Municipal da Serra do Papagaio, 19 May 2005, L. Echternacht &
R.C. Mota 982 (BHCB); Alto Capara
o, Parque Nacional do Capara
o, 2
Mar 2010, I.R. Martins da Costa et al. 147 (BHCB); Airuoca, Parque Esta-
dual da Serra da Papagaio, 18. May 2005, L. Echternacht & R.C. Mota
1019 (BHCB); 12 Mar 2008, P.L.Viana et al. 3921 (BHCB); Delfim Mor-
eira, Serra da Mantiqueira, 15 Mar 2011, R. Fernandes et al. 769 (BHCB);
19 Mar 2011, A.L. Gasper et al. 2703 (BHCB). Rio de Janeiro: Nova Fri-
burgo, 21 Jan 2010, J. Meirelles et al. 436 (UPCB). S~
ao Paulo: Caraguata-
tuba, s.d., E.C. Smidt 1028 (UPCB). Platyrhiza quadricolor Barb.Rodr.:
BRAZIL. Without locality, in cultivation, 17 Dec 2014, C.A. Royer 39
(UPCB); in cultivation, 14 Nov 2015, C.A. Royer 61 (UPCB). Rauhiella
seehawerii (I.Bock) Toscano & Christenson: BRAZIL. Without locality:
In cultivation, Nov 2018. M. Klingelfuss 273 (UPCB). Thysanoglossa jor-
danensis Porto & Brade: BRAZIL. Without locality: In cultivation, Nov
2018. M. Klingelfuss 276 (UPCB). Zygostates aderaldoana Toscano, L.P.
SYSTEMATIC BOTANY10 [Volume 47
F
elix & Dornelas: BRAZIL. Para
ıba: Areia, Fazenda Pirauai, 31 Dec 2002,
L.P. Felix 9790 (RB); 4 Jan 1997, L.P. F
elix et al. sn. (HUEFS187340); in culti-
vation, Dec 2016, C.A. Royer et al. 159 (UPCB). Zygostates alleniana
Kraenzl.: ARGENTINA. Chaco: Fontana, Dec 1932, T. Meyer 840 (AMES).
Formosa: Guaycube, Dec 1918, P. Jorgensen 3050 (AMES). Jujuy: Capital,
26 Sep 1938, W.J. Eyerdam & A.A. Beetle s.n. (F1593988). Missiones: Apos-
toles, 16 Oct 1978, S.A. Renvoize et al 3157 (AMES). BRAZIL. Without local-
ity, in cultivation, 2 Oct 2015, C.A. Royer 54 (UPCB); in cultivation, 26 Oct
2015, C.A. Royer 56 (UPCB). Paran
a: Planaltina do Paran
a, 10 Nov 1952, G.
Hatschbach 2722 (HB). Pernambuco: Caruaru, 6 Mar 1966, G.M. Barroso
s.n. (HB40948). Rio Grande do Sul: Porto Alegre, 8 Dec 1963, G.F.J. Pabst
7401 (HB).SantaCatarina:Florian
opolis, 22 Jan 1969, R.M. Klein 8099
(FLOR). PARAGUAY. Caazapa, Tavai, 29 Oct 1988, I. Basualdo 1697 (MO).
Guaira: without locality, 19 Aug 1989, A. Aguayo 586 (MO). Paraguari:
Caapucu, 20 Nov 1956, T.M. Pedersen 4364 (F). Zygostates apiculata
(Lindl.) Toscano: GUYANA. Potaro-Siparuni, 25 Jun 2013, H.D. Clarke et al.
10137 (US). EQUADOR. Without locality, 29 Jan 2005, M. Whitten 2929
(FLAS). VENEZUELA. Without locality, 1 Jun 1964, Palmengarten Frankfurt
3141 (HEID). Zygostates bradei (Schltr.) Garay: BRAZIL. Without locality,
in cultivation, 9 Nov 2015, C.A. Royer 58 (UPCB). Pernambuco: Bonito, 14
Sep 2008, A.T. Brito et al. 2435 (HUEFS). Paran
a: Guaratuba, 11 Nov 1962,
G. Hatschbach 9820 (MBM). S~
ao Paulo: Iguape, Morro das Pedras, s.d.,
A.C. Brade s.n. (HB 57978). Zygostates cornuta Lindl.: BRASIL. Bahia:
Camacan, 13 Jan 2016, C.A. Royer 97 (UPCB); 27 Jan 2016, C.A. Royer 112
(UPCB); Jequi
e, 7 Dec 2004, G.E.L. Macedo & J.L. Paix~
ao 1431 (HUEFS).
Espirito Santo: Mimoso do Sul, 7 Jan 2005, D.R. Couto 228 (MBML). Minas
Gerais: Caratinga, 24 Nov 1984, P.M. Andrade & M. Lopes 573 (BHCB).
Paran
a: Paranagu
a, 30 Apr 1988, W.S. Sousa et al. 1282 (UPCB). Rio de
Janeiro: Nova Friburgo, 26 Feb 2004, C.A. Zaldini 26 (RB). Santa Catarina:
Without locality, 12 Feb 2016, C.A. Royer 126 (UPCB); Joinville: Estrada
Bonita, 10 Apr 2015, C.A. Royer & M. Bolson 32 (UPCB). S~
ao Paulo:
Canan
eia, 7 Mar 1985, F. Barros 1055 (SP). Zygostates dasyrhiza (Kraenzl.)
Schltr.: BRAZIL. Without locality, in cultivation, 17 Dec 2014, C.A. Royer
38 (UPCB). Paran
a: Tijucas do Sul, 4 Dec 2015, C.A. Royer & D.C. Imig 90
(UPCB). Rio Grande do Sul: S~
ao Francisco de Paula, 15 Dec 2008,
C.R. Buzatto 462 (ICN). Santa Catarina: Monte Castelo, BR 116, 21 Jan
2016, C.A. Royer 112 (UPCB). Zygostates densiflora (Senghas) Baptista:
BOLIVIA. Sapecho, in cultivation at Munich Botanical Garden, cod.
XI/1248, Feb 2008, s.col. (M). Caranavai, fin cultivation at Munich Botani-
cal Garden, s.d., s.col. (M). Zygostates grandiflora (Lindl.) Mansf.: BRAZIL.
Without locality: in cultivation, 17 Nov 2015, C.A. Royer 68 & Toscano de
Brito 3466 (UPCB). Rio de Janeiro: Teres
opolis, 5 Jul 1968, P.I.S. Braga 1732
(RB). Zygostates kuhlmannii Brade: BRAZIL. Without locality: in cultiva-
tion, 26 Oct 2015, C.A. Royer 57 (UPCB).Bahia:Vit
oria da Conquista, 24
Nov 1999, A.L.V. Toscano de Brito 2115 (RB). Espirito Santo: Colatina, Rio
Doce, 2 Dec 1943, J.G. Kuhlmann 6599 (RB). Pernambuco: Taquaratinga do
Norte, 13 Sep 2008, A.T. Brito 2433 (HUEFS). Zygostates linearisepala
(Senghas) Toscano: BRAZIL. Espirito Santo: Santa Teresa, 16 Jan 1989,
D. Lorenzoni 24 (MBML). Zygostates luerorum Toscano & R. V
asqu
ez:
BOLIVIA. Cochabamba, Cocapata, 5 Feb 1997, C. Luer, J. Luer and R.
V
asquez 18390 (SEL). Zygostates lunata Lindl.: BRAZIL. Espirito Santo:
Domingos Martins, in cultivation, 12 Dec 2016, C.A. Royer 162 (UPCB); 6
Feb 2016, C.A. Royer & W.C. Cardoso 164 (UPCB). Minas Gerais: Aiuroca,
17 Jan 2008, J.A.N. Batista 2423 (BHCB). Paran
a: Telem^
aco Borba, 18 Sep
2008, M. Kaehler 211 (UPCB). Rio de Janeiro: Cantagalo, 16 Apr 2009, R.
Borges 939 (RB). S~
ao Paulo: Ubatuba, 25 Dec 1998, R.B.Singer 98\142
(UEC). Zygostates multiflora (Rolfe) Schltr. BRAZIL. Paran
a: Morretes,
19 Jan 1971, G. Hatschbach 25991 (MBM). Rio de Janeiro: Itatiaia, 8 Feb
1942, A.C. Brade 17200 (RB). S~
ao Paulo: Santo Andr
e, 18 May 1961, G. Eiten
& L.T. Eiten 2767-A (US). Zygostates nectar
ıfera (Senghas) Toscano:
BOLIVIA. Without locality: in cultivation at Munich Botanical Garden,
cod. 2013_0222, Feb 2013, s. col. (M). Zygostates obliqua (Schnee) Toscano:
BOLIVIA. La Paz: Parque Nacional de Cotapata, 9 Sep 2000, T. Kromer &
C. Acebey 1496 (SEL). VENEZUELA. Without locality: in cultivation at
Munich Botanical Garden, Jul 2008, G. Gerlach 93/3021 (M); 15 Set. 1964,
Botanical Garden Mainz s.n. (HEID251301_spirit). Falcon: 28 Mar 1984, T.
Plowman et al s.n. (F1932097); in cultivation at Munich Botanical Garden,
s.d., G. Gerlach 93/3251 (M). Zygostates octavioreisii Porto & Brade. BRA-
ZIL. Without locality: Oct 1951, Brade s.n. (RB280648). Rio de Janeiro: Cabo
Frio, Jul 1932, C. Porto s.n. (RB26628). Zygostates ovatipetala (Brade) Tos-
cano. BRAZIL. Rio de Janeiro: Santo Ant^
onio do Imb
e, Jun 1932, A.C.
Brade & Santos Lima 11771 (R). Santa Maria Madalena, in cultivation, 18
Mar 2019, Toscano de Brito 3757 (UPCB). Zygostates pellucida Rchb.f.:
BRAZIL. Without locality: in cultivation, 14 Nov 2015, C.A. Royer 60 &
Toscano de Brito 3457 (UPCB), 3 Dec 2015, C.A. Royer 83 (UPCB); in cultiva-
tion, 25 Jan 2017, C.A. Royer 168 (UPCB). Rio Grande do Sul: Dom Pedro
de Alcantara, 22 Jan 2005, V.C. Souza & V.F. Kinupp 30564 (ESA). Rio de
Janeiro: Mariac
a, 3 Dec 2015, C.A. Royer 84 (UPCB). Santa Catarina: Bene-
dito Novo, 21 Jan 2016, C.A. Royer 111 (UPCB); Palhoc¸a, 8 Jan 2016, C.A.
Royer 95 (UPCB); 5 Feb 2016, C.A. Royer 125 (UPCB). S~
ao Paulo: Caragua-
tatuba, 13 Jan 2016, C.A. Royer 96 (UPCB). Zygostates pustulata (Kraenzl.)
Schltr. BRAZIL Without locality: in cultivation, 20 Mar 2018, C.A. Royer
172 (UPCB). Paran
a: Morretes, Serra da Prata, 7 May 2010, W. Mancinelli
& M.L. Brotto 1217A (JOI). Santa Catarina: Garuva, 29 Jan 2013, E. Barboza
et al. 3533 (MBM).
ROYER ET AL.: PHYLOGENETIC POSITION OF CENTROGLOSSA AND DUNSTERVILLEA 112022]
