Efficacy of Different Routes of Formalin-Killed Vaccine Administration on Immunity and Disease Resistance of Nile Tilapia (Oreochromis niloticus) Challenged with Streptococcus agalactiae

Abstract

Vaccines prepared from formalin-killed Streptococcus agalactiae were administered to Nile tilapia (Oreochromis niloticus) via three different routes: immersion in a water-based vaccine, injection with an oil-based vaccine, and as a water-based oral vaccine. All vaccination treatments increased lysozyme and peroxidase activity in skin mucus of Nile tilapia by 1.2- to 1.5-fold compared to their activities in unvaccinated control fish. Likewise, alternative complement, phagocytosis, and respiratory burst activities in the blood serum of the vaccinated fish were 1.2- to 1.5-times higher than in the unvaccinated fish. In addition, the expression transcripts of interleukin-1 (IL-1), interleukin-8 (IL-8), and lipopolysaccharide-binding protein (LBP) were 2.3- to 2.9-fold higher in the vaccinated fish compared to those in the unvaccinated control. The unvaccinated fish challenged with Streptococcus agalactiae had a survival rate of 25% compared to a survival rate of 78–85% for the vaccinated fish. The differences between the unvaccinated and vaccinated fish were all statistically significant, but there was no significant difference in any of the indicators of immunity between the three vaccinated groups. Collectively, these results confirm that vaccination with formalin-killed Streptococcus agalactiae significantly improved the resistance of Nile tilapia to infection by the pathogen. Overall, the efficacy of oral administration of the vaccine was comparable to that of vaccine administered via injection, indicating that oral vaccination is a viable cost-effective alternative to administering vaccines by injection.

Full text

Citation: Linh, N.V.; Dien, L.T.; Dong,
H.T.; Khongdee, N.; Hoseinifar, S.H.;
Musthafa, M.S.; Dawood, M.A.O.;
Van Doan, H. Efficacy of Different
Routes of Formalin-Killed Vaccine
Administration on Immunity and
Disease Resistance of Nile Tilapia
(Oreochromis niloticus) Challenged
with Streptococcus agalactiae.Fishes
2022,7, 398. https://doi.org/
10.3390/fishes7060398
Academic Editor: Eric Hallerman
Received: 13 November 2022
Accepted: 10 December 2022
Published: 19 December 2022
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
Copyright: © 2022 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
fishes
Article
Efficacy of Different Routes of Formalin-Killed Vaccine
Administration on Immunity and Disease Resistance of
Nile Tilapia (Oreochromis niloticus) Challenged with
Streptococcus agalactiae
Nguyen Vu Linh 1, 2, † , Le Thanh Dien 3, † , Ha Thanh Dong 4, Nuttapon Khongdee 2,5 ,
Seyed Hossein Hoseinifar 6, Mohamed Saiyad Musthafa 7, Mahmoud A. O. Dawood 8,9
and Hien Van Doan 1,*
1Department of Animal and Aquatic Sciences, Faculty of Agriculture, Chiang Mai University,
Chiang Mai 50200, Thailand
2Center of Excellence in Materials Science and Technology, Chiang Mai University, 239 Huay Kaew Road,
Chiang Mai 50200, Thailand
3Faculty of Applied Technology, Van Lang School of Technology, Van Lang University,
Ho Chi Minh City 71415, Vietnam
4Department of Food, Agriculture and Bioresources, School of Environment, Resources and Development,
Asian Institute of Technology, Pathum Thani 12120, Thailand
5
Department of Highland Agriculture and Natural Resources, Faculty of Agriculture, Chiang Mai University,
Chiang Mai 50200, Thailand
6Department of Fisheries, Gorgan University of Agricultural Sciences and Natural Resources,
Gorgan 49189-43464, Iran
7P.G. & Research Department of Zoology, Unit of Research in Radiation Biology & Environmental
Radioactivity (URRBER), The New College (Autonomous), Affiliated to University of Madras,
Chennai 600-014, India
8The Center for Applied Research on the Environment and Sustainability, The American University in Cairo,
Cairo 11835, Egypt
9
Department of Animal Production, Faculty of Agriculture, Kafrelsheikh University, Kafrelsheikh 33516, Egypt
*Correspondence: hien.d@cmu.ac.th
† The authors contributed equally to this work.
Abstract:
Vaccines prepared from formalin-killed Streptococcus agalactiae were administered to Nile
tilapia (Oreochromis niloticus) via three different routes: immersion in a water-based vaccine, injection
with an oil-based vaccine, and as a water-based oral vaccine. All vaccination treatments increased
lysozyme and peroxidase activity in skin mucus of Nile tilapia by 1.2- to 1.5-fold compared to
their activities in unvaccinated control fish. Likewise, alternative complement, phagocytosis, and
respiratory burst activities in the blood serum of the vaccinated fish were 1.2- to 1.5-times higher than
in the unvaccinated fish. In addition, the expression transcripts of interleukin-1 (IL-1), interleukin-8
(IL-8), and lipopolysaccharide-binding protein (LBP) were 2.3- to 2.9-fold higher in the vaccinated fish
compared to those in the unvaccinated control. The unvaccinated fish challenged with Streptococcus
agalactiae had a survival rate of 25% compared to a survival rate of 78–85% for the vaccinated fish.
The differences between the unvaccinated and vaccinated fish were all statistically significant, but
there was no significant difference in any of the indicators of immunity between the three vaccinated
groups. Collectively, these results confirm that vaccination with formalin-killed Streptococcus agalactiae
significantly improved the resistance of Nile tilapia to infection by the pathogen. Overall, the
efficacy of oral administration of the vaccine was comparable to that of vaccine administered via
injection, indicating that oral vaccination is a viable cost-effective alternative to administering vaccines
by injection.
Keywords:
vaccine administration; Oreochromis niloticus; immune response; Streptococcus agalactiae;
lipopolysaccharide binding protein
Fishes 2022,7, 398. https://doi.org/10.3390/fishes7060398 https://www.mdpi.com/journal/fishes

Fishes 2022,7, 398 2 of 13
1. Introduction
Nile tilapia is an increasingly popular species for aquaculture due to its adaptability
to a wide range of environmental conditions, and it now ranks second after the carp in
terms of global fish production from aquaculture [
1
]. In many countries, Nile tilapia
are reared in intensive cages in rivers and canals that are often polluted with drainage
water [
2
,
3
]. In such conditions, fish are likely to suffer from low water quality and infectious
pathogens [
4
], and farmed fish are frequently infected by pathogenic bacteria, such as
Streptococcus spp., Flavobacterium,Edwardsiella spp., Francisella spp., and Aeromonas spp.,
causing high mortality rates and substantial economic impacts [
5
–
12
]. Antibiotics and
traditional chemotherapies are usually applied to control infection and reduce mortality
during disease outbreaks [
4
,
13
]. However, the use of antibiotics impairs the natural immune
response of fish and promotes the development of strains of pathogenic bacteria that are
resistant to antibiotics, encouraging their use in even larger quantities [
14
,
15
]. This in
turn leads to the accumulation of high levels of antibiotics in the body of fish, reducing
food safety and indirectly affecting human health [
16
–
18
]. The use of antibiotics to control
infectious diseases also poses a serious risk to the living environment of fish [
19
,
20
]. Hence,
there is a need to find alternative strategies to combat the risk of bacterial infections in fish
cultures [21–23]. Vaccines can provide long-lasting protection against pathogenic bacteria
and viruses [
24
–
26
] and are now widely used to control infectious diseases in many aquatic
organisms [
4
,
27
]. A wide range of vaccines have been developed to protect Nile tilapia
against infectious diseases; these include live attenuated vaccines against Streptococcus
agalactiae [
15
,
28
], polyvalent vaccines against streptococcosis or lactococcosis [
29
], novel
chimeric multiepitope for streptococcosis [
30
], and vaccines based on formalin-killed
bacteria [
31
]. Vaccines can be administered in different ways, but the most common is by
immersion, orally as a feed additive, and direct injection. The method of administration
depends on fish size and stage of development as well as the nature of the pathogen being
vaccinated against [
7
,
32
,
33
]. Historically, vaccines have been administered via injection,
but this is time-consuming and difficult to deliver to young fish [
32
,
34
]. On the other hand,
while oral and immersion vaccines are simple to administer with minimum stress to the
fish, they often result in limited immune responses [
7
,
24
,
33
–
35
]. Improving immersion
vaccines would go a long way to reducing the incidence and severity of infectious diseases
on fish farms [
36
,
37
]. In this study, we compare the efficacy of vaccines prepared from
formalin-killed S. agalactiae that were administered via immersion, injection, and oral routes
on skin mucus and serum immune response, relative immune gene expression, and the
resistance of Nile tilapia to infection by S. agalactiae.
2. Materials and Methods
2.1. Vaccine Preparation
Streptococcus agalactiae strain 2809 used for this research was isolated from a disease
outbreak at a tilapia farm [
38
]. The isolate was recovered from the stock and purified
by culturing on tryptic soy agar (TSA, Becton, Dickinson, ND, USA) for 48 h at 28
◦
C.
The pure colony was then cultured in 15 mL of tryptic soy broth (TSB, Becton, Dickinson,
ND, USA) for 24 h at 28
◦
C and 150 rpm. One percent of S. agalactiae was added to fresh
TSB and cultured for 24 h at 28
◦
C and 150 rpm. The bacterial suspensions were then
inactivated with 3% formalin and incubated at 4
◦
C overnight. To verify the inactivation of
the bacteria, a volume of 0.1 mL of killed-bacterial suspension was plated on TSA and S.
agalactiae selective agar bases (HiMedia, India) and incubated for three days at 28
◦
C. The
inactivated bacterial suspension was washed with sterile 1
×
phosphate-buffered saline
(PBS) three times followed by centrifuging at 4500 rpm for 5 min at 4
◦
C. The pellet was
then resuspended in sterile 1
×
PBS for further use [
33
,
39
,
40
]. Following centrifugation, the
bacterial pellets were resuspended in PBS buffer and adjusted to OD
600nm
= 1.3 (equivalent
to 10
9
CFU mL
−1
) to provide the bacterial antigens for the vaccine formulation. This
suspension of formalin-killed bacteria in PBS (bacterial antigen) was used for the water-
based oral vaccine. For the oil-based injectable vaccine, the bacterial antigen was mixed with

Fishes 2022,7, 398 3 of 13
Montanide
TM
ISA 763A VG, a commercially available non-mineral oil adjuvant (Seppic),
at a ratio of 3:7 (v/v) and homogenized at 15,600 rpm for 3 min using an IKA T25 digital
ULTRA TURRAX homogenizer to form an oil-in-water vaccine with a final concentration
of ~1.7
×
10
7
CFU mL
−1
. For the immersion vaccine, the bacterial antigen was mixed with
Montanide
TM
ISA 1312 VG (Seppic) adjuvant at a ratio of 1:1 (v/v) and agitated at 250 rpm
for 10 min using a low-shear mixer with a 4-blade impeller (Onilab OS20-Pro). The control
was PBS without bacterial antigen. The formulated vaccines were stored at 4 ◦C until use.
2.2. Diet Preparation and Experimental Design
The approximate components and formulation of the experimental diets for the fish in
the current study are presented in Table 1. The experimental diet consisted of the basal diet
sprayed with PBS at a rate of 100 mL per kg feed; for the oral vaccine treatment, 100 mL of
water-based oral vaccine was sprayed onto 1 kg of basal diet. All diets were coated with
fish oil, dried for 15 min at 24 ◦C, and then stored at 4 ◦C until used.
Table 1. Approximate composition and formulation of the experimental diets (g kg−1).
Constituents Basal Diet
Soybean meal 390
Corn meal 200
Fish meal 150
Rice bran 150
Wheat flour 70
Cellulose 20
Premix 10
Vitamin C 98% 5
Soybean oil 5
Approximate component of dietary treatment (g kg−1dry matter basis)
Gross energy (Cal/g) 3892
Dry matter 991.83
Crude protein 322.28
Ash 84.90
Fiber 43.47
Crude lipid 38.56
2.3. Experimental Procedure
Healthy Nile tilapia were purchased from a commercial hatchery in Chiang Mai,
Thailand. The fish were fed commercial pellets (CP, 9950) for 60 days and then fed the
basal diet for 15 days. Prior to the experimental trial, 10 experimental fish were randomly
selected and tested for the presence of S. agalactiae. After confirming that the fish were free
of S. agalactiae, 320 fish (9.85
±
0.35 g) were distributed into 16 glass aquaria containing
100 L of water at a stocking density of 20 fish per tank. The feeding experiment lasted for
15 days and had four replicates of each treatment arranged in a completely randomized
design. There were four experimental treatments: an unvaccinated control (Treatment T1),
fish given the immersion vaccine (Treatment T2), fish injected with the oil-based vaccine
(Treatment T3), and fish given the oral vaccine (Treatment T4). The fish in the unvaccinated
control group (T1) were injected with 0.1 mL of PBS without vaccine. The fish receiving the
immersion vaccine (Treatment T2) were transferred to an identical tank with 100 L of aerated
water at the same temperature (28
◦
C) into which 2 L of vaccine (approx. 10
9
CFU mL
−1
)
was added to give a final concentration of approximately
107CFU mL−1
. After 30 min of
exposure to the immersion vaccine, the fish were returned to their vaccine-free culture tank.
Each fish in the injectable vaccine group (Treatment T3) received an intraperitoneal injection
of 0.1 mL of vaccine (approx. 1.7
×
10
7
CFU mL
−1
). For Treatment T4, the water-based oral
vaccine was administered to the fish as follows: days 1–5, feeding with oral vaccine; days
6–10, feeding without vaccine; days 11–15, feeding with oral vaccine [
41
]. The oral vaccine
treatments were given to the fish at 8:30 a.m. and 4:30 p.m. At each feeding time, a visual

Fishes 2022,7, 398 4 of 13
examination was conducted to confirm that all feed were eaten and nothing remained in
the tanks. Water temperature, pH, and dissolved oxygen were maintained at 28
±
0.23
◦
C,
7.91 ±0.31, and 5.32 ±0.11 mg L−1, respectively.
2.4. Serum, Leukocytes, and Mucus Preparation
A composite sample of fish blood from 4 fish per replicate was kept without anticoag-
ulant in 1.5 mL microtubes for 1 h at 24
◦
C and then at 4
◦
C for 4 h. The serum was then
extracted by centrifugation at 1500
×
gfor 5 min and frozen at
−
80
◦
C for further analysis.
Leukocytes were isolated from the fish blood according to protocols reported pre-
viously [
42
] and modified according to Van Doan et al. [
43
]. Skin mucus was collected
from the same fish following the procedures described previously. Briefly, the clove oil-
anesthetized fish were gently rubbed for 2 min in a plastic bag supplemented with 10 mL
of 50 mM NaCl. The mixture was immediately poured into a 15 mL sterile tube and
centrifuged. The supernatant was collected and stored at −80 ◦C.
2.5. Immunological Assays
The lysozyme activity of the mucus and serum was assayed following the protocols
previously described by [
44
], and the peroxidase activity was measured according to
protocols previously reported by [
45
,
46
]. The protocol of Yoshida and Kitao [
47
] was
used to assess the phagocytic activity. The blood leukocytes’ respiratory burst activity
was determined following the protocol of Secomebs [
42
], whereas ACH50 was assayed
according to Yanno [48].
2.6. Nonspecific Immune-Related Gene Expression Analysis
To investigate the mRNA transcript levels of three target genes, liver tissues (3 fish/
tank/treatment) were sampled for quantitative real-time PCR (RT-qPCR) after 15 days of
immunization. A total of 40–50 mg of liver tissue was used for total RNA isolation using the
TRIzol method. The quality and quantity of total RNA were measured using a NanoDrop
One (Thermo Scientific, USA) at an OD ratio of 260:280 nm. One
µ
g of total RNA was used
to synthesize the first-strand complementary DNA (cDNA). The primers used for RT-qPCR
analysis in this study are presented in Table 2. The RT-qPCR was performed in triplicate
using the CFX96
™
Real-Time System (Bio-Rad, USA) with 1
µ
L of cDNA, 10 mM of each
primer, and 2
×
iTaq Universal SYBR Green (Bio-Rad, USA). The mRNA transcript levels
were calculated using the 2
−∆∆Ct
method [
49
]. The primers used for qPCR were previously
reported by Linh et al. [33].
Table 2. Primers used for RT-qPCR analysis.
Primers Oligo Sequence (50-30) Genes Tm(◦C) Size (bp)
18S rRNA F: GTGCATGGCCGTTCTTAGTT
R: CTCAATCTCGTGTGGCTGAA 18S RNA 60 150
IL-1 F: GTCTGTCAAGGATAAGCGCTG
R: ACTCTGGAGCTGGATGTTGA IL-1 59 200
IL-8 F: CTGTGAAGGCATGGGTGTG
R: GATCACTTTCTTCACCCAGGG IL-8 59 196
LBP F: ACCAGAAACTGCGAGAAGGA
R: GATTGGTGGTCGGAGGTTTG LBP 59 200
F: forward, R: reverse, bp: base pair.
2.7. Challenge Experiment
S. agalactiae was isolated and thoroughly processed as previously reported [
38
]. Briefly,
5 mL of the stock solution was transferred into 50 mL of TSB and incubated for 24 h at
28
◦
C and 150 rpm. The sub-cultures were raised in duplicate with similar conditions for
the experiment. The optical density at 560 nm was used to determine growth followed by

Fishes 2022,7, 398 5 of 13
plate counting in TSA. At 15 days post-feeding, a total of 10 fish from each replicate was
intraperitoneally injected with 0.1 mL of S. agalactiae (approx. 10
7
CFU mL
−1
). The survival
rates were measured daily over a period of 15 days of the experimental challenge, and the
relative percentage of survival (RPS) was calculated as follows: RPS = (1
−
% mortality in
vaccinated/% mortality in control) ×100 [50].
2.8. Statistical Analysis
The Shapiro–Wilk test was used to assess the normality of the data. Statistix v.10.1
(Analytical Software, Tallahassee, FL, USA) was used to perform the statistical analyses.
The immunological responses and mRNA transcript levels of the innate immune-related
genes were all evaluated using a one-way analysis of variance, and the differences between
means were compared using the Least Significant Difference (LSD) test. The Kaplan–Meier
estimator was used to determine the cumulative survival in the experimental challenge,
and the log-rank test was used to compare statistically significant differences in survival
between the different treatments. The data are presented as means
±
SEM, and statistical
significance was determined at the 95% confidence level (p< 0.05).
3. Results
3.1. Mucosal Immune Response Analysis
Overall, vaccination increased the activity of lysozyme by approximately 1.3-fold and
peroxidase by approximately 1.6-fold in skin mucus compared to the unvaccinated control
group, and this was statistically significant (p< 0.05) (Figure 1). Skin mucus lysozyme
activity was marginally higher in the fish that were vaccinated by injection (1.56
µ
g mL
−1
)
than those vaccinated orally (1.53
µ
g mL
−1
) and a little lower (1.45
µ
g mL
−1
) in the fish that
were vaccinated by immersion (Figure 1), but the differences between the vaccination routes
were not significant (p> 0.05). Skin mucus peroxidase activity was similar (0.13 µg mL−1)
in the fish vaccinated by injection and via the oral pathway and a little lower (
0.12 µg mL−1
)
for those receiving the vaccine via immersion (Figure 1). There was no significant difference
(p> 0.05) in skin mucus peroxidase activity between any of the vaccination treatments
(Figure 1).
3.2. Immune Response Analysis in Serum
The fish in the vaccinated groups (T2, T3, and T4) had substantially greater levels
(
p< 0.05
) of serum lysozyme (ca. 1.3-fold) and peroxidase activity (ca. 1.3-fold), alternative
complement activity (ca. 1.4-fold), respiratory burst activity (ca. 1.5-fold), and phagocytosis
activity (ca. 1.2-fold) than the unvaccinated fish in T1, the control treatment (Figure 2).
Serum lysozyme (5.66
µ
g mL
−1
) and peroxidase activity (0.21
µ
g mL
−1
), alternative com-
plement activity (237
µ
g mL
−1
), and respiratory burst activity (0.13
µ
g mL
−1
) were all
marginally, but not significantly, higher in the fish vaccinated orally than those vaccinated
by immersion or injection (Figure 2). There was no significant difference in any of the
measured indices between the different methods of vaccine delivery (p> 0.05).
3.3. Immune Gene Expression Profiling
The relative transcript levels of the three target genes encoding IL-1 (interleukin-1),
IL-8 (interleukin-8), and LBP (lipopolysaccharide-binding protein) were 2.5- to 3-fold higher
(p< 0.05) in the liver tissues of the vaccinated fish compared to those in the unvaccinated
control (Figure 3). The relative transcript level for IL-1 was marginally higher in the fish
vaccinated orally than in the fish vaccinated via injection and, conversely, the relative
transcript levels of IL-8 and LPB were slightly higher in the fish vaccinated via injection
than in those vaccinated orally (Figure 3). For all three genes, the relative transcript levels
were lower in the immersion treatment (T2) than in the other two vaccination treatments (T3
and T4). However, the transcript levels for all three genes were not significantly different
between the three vaccination treatments (Figure 3).

Fishes 2022,7, 398 6 of 13
Fishes2022,7,xFORPEERREVIEW6of14




Figure1.Theactivity(μgmL−1)oflysozymeandperoxidaseinskinmucusofNiletilapia15dpost‐
vaccination.Treatment1(T1)—control,Treatment2(T2)—formalin‐killedS.agalactiaeimmersion
vaccine,Treatment3(T3)—formalin‐killedS.agalactiaeinjectableoil‐basedvaccine,Treatment4
(T4)—formalin‐killedS.agalactiaewater‐basedoralvaccine.Thepresenceofdifferentlettersineach
groupindicatesasignificantdifference(p<0.05).SMLA,skinmucuslysozymeactivity;SMPA,skin
mucusperoxidaseactivity.
3.2.ImmuneResponseAnalysisinSerum
Thefishinthevaccinatedgroups(T2,T3,andT4)hadsubstantiallygreaterlevels(p
<0.05)ofserumlysozyme(ca.1.3‐fold)andperoxidaseactivity(ca.1.3‐fold),alternative
complementactivity(ca.1.4‐fold),respiratoryburstactivity(ca.1.5‐fold),and
phagocytosisactivity(ca.1.2‐fold)thantheunvaccinatedfishinT1,thecontroltreatment
(Figure2).Serumlysozyme(5.66μgmL−1)andperoxidaseactivity(0.21μgmL−1),
alternativecomplementactivity(237μgmL−1),andrespiratoryburstactivity(0.13μg
mL−1)wereallmarginally,butnotsignificantly,higherinthefishvaccinatedorallythan
thosevaccinatedbyimmersionorinjection(Figure2).Therewasnosignificantdifference
inanyofthemeasuredindicesbetweenthedifferentmethodsofvaccinedelivery(p>
0.05).

Figure 1.
The activity (
µ
g mL
−1
) of lysozyme and peroxidase in skin mucus of Nile tilapia 15 d
post-vaccination. Treatment 1 (T1)—control, Treatment 2 (T2)—formalin-killed S. agalactiae immersion
vaccine, Treatment 3 (T3)—formalin-killed S. agalactiae injectable oil-based vaccine, Treatment 4
(T4)—formalin-killed S. agalactiae water-based oral vaccine. The presence of different letters in each
group indicates a significant difference (p< 0.05). SMLA, skin mucus lysozyme activity; SMPA, skin
mucus peroxidase activity.
Fishes2022,7,xFORPEERREVIEW6of14




Figure1.Theactivity(μgmL−1)oflysozymeandperoxidaseinskinmucusofNiletilapia15dpost‐
vaccination.Treatment1(T1)—control,Treatment2(T2)—formalin‐killedS.agalactiaeimmersion
vaccine,Treatment3(T3)—formalin‐killedS.agalactiaeinjectableoil‐basedvaccine,Treatment4
(T4)—formalin‐killedS.agalactiaewater‐basedoralvaccine.Thepresenceofdifferentlettersineach
groupindicatesasignificantdifference(p<0.05).SMLA,skinmucuslysozymeactivity;SMPA,skin
mucusperoxidaseactivity.
3.2.ImmuneResponseAnalysisinSerum
Thefishinthevaccinatedgroups(T2,T3,andT4)hadsubstantiallygreaterlevels(p
<0.05)ofserumlysozyme(ca.1.3‐fold)andperoxidaseactivity(ca.1.3‐fold),alternative
complementactivity(ca.1.4‐fold),respiratoryburstactivity(ca.1.5‐fold),and
phagocytosisactivity(ca.1.2‐fold)thantheunvaccinatedfishinT1,thecontroltreatment
(Figure2).Serumlysozyme(5.66μgmL−1)andperoxidaseactivity(0.21μgmL−1),
alternativecomplementactivity(237μgmL−1),andrespiratoryburstactivity(0.13μg
mL−1)wereallmarginally,butnotsignificantly,higherinthefishvaccinatedorallythan
thosevaccinatedbyimmersionorinjection(Figure2).Therewasnosignificantdifference
inanyofthemeasuredindicesbetweenthedifferentmethodsofvaccinedelivery(p>
0.05).

Figure 2.
Serum immunity parameters of Nile tilapia post-vaccination (
µ
g mL
−1
). Treatment 1
(T1)—control, Treatment 2 (T2)—formalin-killed S. agalactiae immersion vaccine, Treatment 3 (T3)—
formalin-killed S. agalactiae injectable oil-based vaccine, Treatment 4 (T4)—formalin-killed S. agalactiae
water-based oral vaccine. The presence of different letters in each group indicates a significant
difference (p< 0.05). SL, serum lysozyme activity; SP, serum peroxidase activity; ACH50, alternative
complement activity; RB, respiratory burst activity; PI, phagocytosis activity.

Fishes 2022,7, 398 7 of 13
Fishes2022,7,xFORPEERREVIEW7of14



Figure2.SerumimmunityparametersofNiletilapiapost‐vaccination(μgmL−1).Treatment1(T1)—
control,Treatment2(T2)—formalin‐killedS.agalactiaeimmersionvaccine,Treatment3(T3)—
formalin‐killedS.agalactiaeinjectableoil‐basedvaccine,Treatment4(T4)—formalin‐killedS.
agalactiaewater‐basedoralvaccine.Thepresenceofdifferentlettersineachgroupindicatesa
significantdifference(p<0.05).SL,serumlysozymeactivity;SP,serumperoxidaseactivity;ACH50,
alternativecomplementactivity;RB,respiratoryburstactivity;PI,phagocytosisactivity.
3.3.ImmuneGeneExpressionProfiling
TherelativetranscriptlevelsofthethreetargetgenesencodingIL‐1(interleukin‐1),
IL‐8(interleukin‐8),andLBP(lipopolysaccharide‐bindingprotein)were2.5‐ to3‐fold
higher(p<0.05)inthelivertissuesofthevaccinatedfishcomparedtothoseinthe
unvaccinatedcontrol(Figure3).TherelativetranscriptlevelforIL‐1wasmarginally
higherinthefishvaccinatedorallythaninthefishvaccinatedviainjectionand,
conversely,therelativetranscriptlevelsofIL‐8andLPBwereslightlyhigherinthefish
vaccinatedviainjectionthaninthosevaccinatedorally(Figure3).Forallthreegenes,the
relativetranscriptlevelswerelowerintheimmersiontreatment(T2)thanintheothertwo
vaccinationtreatments(T3andT4).However,thetranscriptlevelsforallthreegeneswere
notsignificantlydifferentbetweenthethreevaccinationtreatments(Figure3).

Figure3.ComparativemRNAtranscriptlevelsofthreeimmune‐relatedgenes(IL‐1,IL‐8,andLBP)
intheliversofthevaccinatedandcontrolfishpost‐immunization.The18SrRNAwasusedasan
internalcontrolgene.Significantdifferencesbetweenthetreatmentgroupsaredenotedbydifferent
letters(p<0.05).
3.4.FishSurvivalRateafterS.agalactiaeChallenge
FortheunvaccinatedfishintheT1treatmentgroup,mortalityoccurredonday4and
continueduntilday8,whereastheearliestincidenceoffishmortalitywasrecordedon
day5forthevaccinatedfishintheT2,T3,andT4treatmentgroups.After15daysof
challengewithS.agalactiae,therelativepercentsurvival(RPS)was66.67%forthe
vaccinatedfishintheT2treatmentgroupfollowedby80%forthevaccinatedfishinthe
T3treatmentgroupand71.67%forthevaccinatedfishintheT4treatmentgroup(Figure
4,Table3).Thefishthatperishedduringthechallengeexperimentdisplayedclinical
symptomstypicalofS.agalactiae.
Figure 3.
Comparative mRNA transcript levels of three immune-related genes (IL-1, IL-8, and LBP)
in the livers of the vaccinated and control fish post-immunization. The 18S rRNA was used as an
internal control gene. Significant differences between the treatment groups are denoted by different
letters (p< 0.05).
3.4. Fish Survival Rate after S. agalactiae Challenge
For the unvaccinated fish in the T1 treatment group, mortality occurred on day 4 and
continued until day 8, whereas the earliest incidence of fish mortality was recorded on day
5 for the vaccinated fish in the T2, T3, and T4 treatment groups. After 15 days of challenge
with S. agalactiae, the relative percent survival (RPS) was 66.67% for the vaccinated fish
in the T2 treatment group followed by 80% for the vaccinated fish in the T3 treatment
group and 71.67% for the vaccinated fish in the T4 treatment group (Figure 4, Table 3). The
fish that perished during the challenge experiment displayed clinical symptoms typical of
S. agalactiae.
Fishes2022,7,xFORPEERREVIEW8of14




Figure4.Kaplan–MeieranalysisofO.niloticus(n=10)challengedwithS.agalactiaeafter15daysof
immunization.Treatment1(T1)—control,Treatment2(T2)—formalin‐killedS.agalactiaeimmersion
vaccine,Treatment3(T3)—formalin‐killedS.agalactiaeinjectableoil‐basedvaccine,Treatment4
(T4)—formalin‐killedS.agalactiaewater‐basedoralvaccine.
Table3.Statisticalsignificanceamongdietarytreatmentgroupsusingalog‐ranktest.
TreatmentGroupsStatisticalAnalysis
T1T2T3
T20.000* 
T30.000*0.120ns
T40.000*0.624ns0.290ns
“*”indicatesastatisticalsignificance(p<0.05)and“ns”denotesnostatisticallysignificant
differences.
4.Discussion
Vaccineshavebeensuccessfullyappliedinfishaquaculturetoprotectagainst
bacterialinfections[7,37,51–53].Injectionisthetraditionalmethodofadministeringthese
vaccinations,andresearchhasshownthatitismoreefficientthanoraladministration[54].
However,injectablevaccinesinaquaculturenecessitateskilledvaccinatorpersonnel,
whichaddstothecostofproduction.Moreover,injectioninduceshandlingstress,
resultinginalowfeedintakeandlossofappetiteinfish[34,37].Followingtheinjection
ofavaccine,manyfisharekilled,andtheremainingfishmaylosesomeoftheirimmunity
andbecomemoresusceptibletodiseases[55,56].Therefore,formanyfish,injectable
vaccinationsarenotadvised[54].Niletilapiaisoneofthespeciesthatholdsthemost
promiseforvaccinedevelopment.Giventherecentextremelyintensivemethodutilized
inNiletilapiafarming,givingvaccinationsorallyisbetterthangivingthemviainjection
[7,27,34,37].Fishoralvaccineshavebeenthoroughlyexploredinrecentyearsasan
alternativetoinjectableimmunizations,includingNiletilapia[57–59].Eventhoughoral
vaccinationseemstobetheoptimalwayofadministration,therearemajorlimiting
factors,suchaslargervolumesofvaccine,temperatureandpressuretoleranceconditions,
vaccinedoses,orboostervaccinationforshortdurationsofimmunization[60,61].
Continuousresearchmightgreatlyresolvetheseissues,resultinginthecommercialization
ofeffectiveoralvaccinesforpathogenicdiseasesinaquaculture.Therefore,thepresent
trialaimedatassessinginjection,immersion,andoralvaccinationmethodsinNiletilapia.
Themetabolicindicatorsweusedtoassessimmunologicalresponseshaveallbeenused
Figure 4.
Kaplan–Meier analysis of O. niloticus (n= 10) challenged with S. agalactiae after 15 days of
immunization. Treatment 1 (T1)—control, Treatment 2 (T2)—formalin-killed S. agalactiae immersion
vaccine, Treatment 3 (T3)—formalin-killed S. agalactiae injectable oil-based vaccine, Treatment 4
(T4)—formalin-killed S. agalactiae water-based oral vaccine.

Fishes 2022,7, 398 8 of 13
Table 3. Statistical significance among dietary treatment groups using a log-rank test.
Treatment Groups Statistical Analysis
T1 T2 T3
T2 0.000 *
T3 0.000 * 0.120 ns
T4 0.000 * 0.624 ns 0.290 ns
“*” indicates a statistical significance (p< 0.05) and “ns” denotes no statistically significant differences.
4. Discussion
Vaccines have been successfully applied in fish aquaculture to protect against bac-
terial infections [
7
,
37
,
51
–
53
]. Injection is the traditional method of administering these
vaccinations, and research has shown that it is more efficient than oral administration [
54
].
However, injectable vaccines in aquaculture necessitate skilled vaccinator personnel, which
adds to the cost of production. Moreover, injection induces handling stress, resulting in
a low feed intake and loss of appetite in fish [
34
,
37
]. Following the injection of a vaccine,
many fish are killed, and the remaining fish may lose some of their immunity and become
more susceptible to diseases [
55
,
56
]. Therefore, for many fish, injectable vaccinations are
not advised [
54
]. Nile tilapia is one of the species that holds the most promise for vaccine
development. Given the recent extremely intensive method utilized in Nile tilapia farming,
giving vaccinations orally is better than giving them via injection [
7
,
27
,
34
,
37
]. Fish oral
vaccines have been thoroughly explored in recent years as an alternative to injectable im-
munizations, including Nile tilapia [
57
–
59
]. Even though oral vaccination seems to be the
optimal way of administration, there are major limiting factors, such as larger volumes of
vaccine, temperature and pressure tolerance conditions, vaccine doses, or booster vaccina-
tion for short durations of immunization [
60
,
61
]. Continuous research might greatly resolve
these issues, resulting in the commercialization of effective oral vaccines for pathogenic
diseases in aquaculture. Therefore, the present trial aimed at assessing injection, immersion,
and oral vaccination methods in Nile tilapia. The metabolic indicators we used to assess im-
munological responses have all been used widely in previous studies. The immunological
properties of skin mucus and blood serum provide a useful insight into the natural innate
capacity of fish to resist infection [
62
,
63
]. Lysozyme is a bacteriolytic enzyme generated
in the lysosome of phagocytic cells, and lysozyme activity is a crucial component of the
non-specific immunological response of fish. In this investigation, vaccination through
any of the three routes, immersion, injection, or oral administration, led to increased levels
of the enzyme lysozyme and the antioxidant peroxidase in blood serum and skin mucus.
Previously, on 7, 49 days post-vaccination and post-infection with A. hydrophila, lysozyme
activity was considerably greater in fish inoculated with the BF vaccine (mixed S. iniae and
A. hydrophila) compared to those vaccinated with the MA vaccine (monovalent S. iniae) [
64
].
Consequently, prior results indicated that, three weeks after vaccination, the lysozyme
activity of vaccinated tilapia was much greater than that of unvaccinated tilapia [
65
]. Ad-
ditionally, elevated phagocytosis, complement pathway, and respiratory burst activities
implied an enhanced ability of lymphocytes and leukocytes to attack invading bacteria and
increase fish survival in this study. The increase in leukocytes has a favorable effect on the
generation of antibodies, resulting in a body resistance response against the foreign sub-
stance [
66
]. Likewise, a greater leukocyte count was closely associated with an increase in
lysozyme [
67
]. These results suggest that the rising immunological response in vaccinated
tilapia may be associated with a rise in lysozyme activity.
Interleukins 1 and 8 (IL-1 and IL-8) are key pro-inflammatory cytokines associated
with the immune response in fish, especially against harmful pathogens [
68
–
70
]. The
results of this study display relatively high mRNA levels of IL-1 and IL-8 in the liver of Nile
tilapia after S. agalactiae vaccination compared to the non-vaccinated group. IL-1 and IL-8
in the liver of fish vaccinated through oral, injection, and immersion routes have similar
mRNA levels without significant differences. The results are in line with
Jun et al.
[
71
],

Fishes 2022,7, 398 9 of 13
who reported upregulation of pro-inflammatory genes in Japanese eel (Anguilla japonica)
treated with a S. agalactiae vaccine. The results are probably attributed to the potent
immunostimulant action by the S. agalactiae vaccine, which enhances Nile tilapia’s ability to
resist infection. Besides, the lipopolysaccharide-binding protein (LBP) gene is another key
protein involved in acute-phase immunity [
68
,
72
]. The precursor of LBP is also associated
with immune resistance during infection with bacterial infections [
73
,
74
]. In this study, the
more than two-fold higher levels of IL-1 and IL-8, and almost three-fold rise in relative LBP
transcript level in the vaccinated fish compared to the unvaccinated fish may have improved
the survival of fish in this experiment. Taken together, the significant enhancement of pro-
inflammatory gene expression in Nile tilapia is a result of vaccination, which has also been
observed in Japanese eel (Anguilla japonica) treated with the S. agalactiae vaccine.
Our results showed that vaccination with formalin-killed S. agalactiae via immersion,
injection, or orally stimulated a range of immune responses that enhanced the resistance
of Nile tilapia to this pathogen and increased the survival rate in exposed populations.
Whereas starch hydrogel-based oral vaccines produced a greater immune response than
injection and immersion vaccination methods [
75
], our results for vaccination of Nile tilapia
with antigen from formalin-killed S. agalactiae indicated that the immune response from
water-based oral vaccination was very similar to that from the injectable vaccine. Similar
benefits were investigated in Nile tilapia fed a live attenuated S. agalactiae vaccine [
76
];
polyvalent inactivated vaccine containing S. agalactiae,S. iniae,L. garvieae, and Enterococcus
faecalis [
29
]; novel chimeric multiepitope vaccine for S. agalactiae [
30
]; naturally attenu-
ated S. agalactiae live vaccine [
28
]; and inactivated S. agalactiae and S. iniae vaccines [
31
].
Nonetheless, the delivery of oral antigens has been reported to increase resistance in fish
intestines and suppress immunity. The results of this study indicated that water-based oral
vaccines can be used without reducing the pro-inflammatory immune response in Nile
tilapia during infections caused by S. agalactiae.
In addition, the destruction of antigens by stomach acid and proteolytic enzymes in
the digestive system is one of the most significant barriers to oral vaccines, which needs to
be tackled to improve vaccine efficacy [
59
]. Several techniques are being used to protect
antigens from the intestinal atmosphere for their immunogenic effects in an effort to address
this challenge. Among them, encapsulation techniques by poly-biodegradable nanoma-
terials, such as chitosan and poly D,L-lactic-co-glycolic acid (PLGA), have demonstrated
potential. The antigen is encapsulated by nanomaterials that can sustain the right epitope
until it reaches the immunological site and is released in the intestine, considerably improv-
ing the immune response [
77
]. Vaccines, on the other hand, switch on the immune system
to aid in disease resistance, and the use of these strategies to control infectious diseases
is gaining relevance. Perfecting the use of adjuvants, delivery methods, and innovative
technologies is needed to fulfill the demand of vaccines and ensure the safe supply of
healthy fish products. It is vital for the future of the fish farming industry that vaccines
can be an efficient tool for lowering the use of antibiotics in animals, therefore assisting the
fight against antimicrobial resistance. In our point of view, although the formalin-killed S.
agalactiae water-based oral vaccine shows potential in this study to improve the survival
rate and activate the immune system of experimental fish, oral nano-encapsulated vaccines
are promising and practical implications for aquaculture that can offer more benefits in
terms of protective efficacy, time, labor, simplicity, and cost efficiency.
5. Conclusions
This study suggests that the oral vaccination of Nile tilapia with formalin-killed S.
agalactiae stimulated the serum and skin mucus immunity and is just as effective as an
injectable vaccine. By using this kind of vaccine, farmers can save time, cut down on the
demand for highly skilled labor, and eliminate the stress and attendant mortality associated
with direct injection. However, a larger sample size, more replicates, and an analysis of a
wider range of target genes should be the focus of further studies.

Fishes 2022,7, 398 10 of 13
Author Contributions:
Writing—original draft preparation, investigation, methodology, data cura-
tion, N.V.L.; writing—review and editing, L.T.D.; writing—review and editing, validation, method-
ology, H.T.D.; software, data analysis, N.K.; supervision, S.H.H.; supervision, M.S.M.; supervision,
M.A.O.D.; conceptualization, project administration, funding acquisition, H.V.D. The published
version of the work has been reviewed and approved by all authors. All authors have read and
agreed to the published version of the manuscript.
Funding:
The research project was supported by the National Research Council of Thailand. This
research was partially supported by Chiang Mai University.
Institutional Review Board Statement:
All animal experiments comply with AAALAC guidelines
approved by the Chiang Mai University Committee (No. AQ006/2562[02/2562-09-16]).
Data Availability Statement:
The data presented in this study are available upon request from the
corresponding author.
Acknowledgments:
The authors would like to thank Christopher Secombes for his support regarding
the oral vaccine preparation technique.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
Shourbela, R.M.; Khatab, S.A.; Hassan, M.M.; Van Doan, H.; Dawood, M.A. The effect of stocking density and carbon sources on
the oxidative status, and nonspecific immunity of Nile tilapia (Oreochromis niloticus) reared under biofloc conditions. Animals
2021,11, 184. [CrossRef] [PubMed]
2. El-Sayed, A.-F.M. Tilapia Culture; CABI Publishing: Wallingford, UK, 2006.
3.
Subasinghe, R. World aquaculture 2015: A brief overview. In FAO Fisheries and Aquaculture Report; Food and Agriculture
Organization of the United Nations: Rome, Italy, 2017.
4.
Rico, A.; Oliveira, R.; McDonough, S.; Matser, A.; Khatikarn, J.; Satapornvanit, K.; Nogueira, A.J.; Soares, A.M.; Domingues, I.;
Van den Brink, P.J. Use, fate and ecological risks of antibiotics applied in tilapia cage farming in Thailand. Environ. Pollut.
2014
,
191, 8–16. [CrossRef]
5.
Sirimanapong, W.; Thompson, K.D.; Shinn, A.P.; Adams, A.; Withyachumnarnkul, B. Streptococcus agalactiae infection kills red
tilapia with chronic Francisella noatunensis infection more rapidly than the fish without the infection. Fish Shellfish. Immunol.
2018
,
81, 221–232. [CrossRef] [PubMed]
6.
Wamala, S.P.; Mugimba, K.K.; Mutoloki, S.; Evensen, Ø.; Mdegela, R.; Byarugaba, D.K.; Sørum, H. Occurrence and antibiotic
susceptibility of fish bacteria isolated from Oreochromis niloticus (Nile tilapia) and Clarias gariepinus (African catfish) in Uganda.
Fish. Aquat. Sci. 2018,21, 1–10. [CrossRef]
7.
Bøgwald, J.; Dalmo, R.A. Review on immersion vaccines for fish: An update 2019. Microorganisms
2019
,7, 627. [CrossRef]
[PubMed]
8.
Shahin, K.; Shinn, A.P.; Metselaar, M.; Ramirez-Paredes, J.G.; Monaghan, S.J.; Thompson, K.D.; Hoare, R.; Adams, A. Efficacy
of an inactivated whole-cell injection vaccine for nile tilapia, Oreochromis niloticus (L.), against multiple isolates of Francisella
noatunensis subsp. orientalis from diverse geographical regions. Fish Shellfish. Immunol.
2019
,89, 217–227. [CrossRef] [PubMed]
9.
Suphoronski, S.; Chideroli, R.; Facimoto, C.; Mainardi, R.; Souza, F.; Lopera-Barrero, N.; Jesus, G.; Martins, M.; Di Santis, G.; De
Oliveira, A. Effects of a phytogenic, alone and associated with potassium diformate, on tilapia growth, immunity, gut microbiome
and resistance against francisellosis. Sci. Rep. 2019,9, 6045. [CrossRef]
10.
Yun, S.; Giri, S.S.; Kim, H.J.; Kim, S.G.; Kim, S.W.; Kang, J.W.; Han, S.J.; Kwon, J.; Oh, W.T.; Chi, C. Enhanced bath immersion
vaccination through microbubble treatment in the cyprinid loach. Fish Shellfish. Immunol. 2019,91, 12–18. [CrossRef]
11.
Basri, L.; Nor, R.M.; Salleh, A.; Md. Yasin, I.S.; Saad, M.Z.; Abd. Rahaman, N.Y.; Barkham, T.; Amal, M.N.A. Co-infections of
tilapia lake virus, Aeromonas hydrophila and Streptococcus agalactiae in farmed red hybrid tilapia. Animals
2020
,10, 2141. [CrossRef]
12.
Oh, W.T.; Jun, J.W.; Kim, H.J.; Giri, S.S.; Yun, S.; Kim, S.G.; Kim, S.W.; Kang, J.W.; Han, S.J.; Kwon, J. Characterization and
pathological analysis of a virulent Edwardsiella anguillarum strain isolated from Nile tilapia (Oreochromis niloticus) in Korea. Front.
Vet. Sci. 2020,7, 14. [CrossRef]
13.
Rico, A.; Phu, T.M.; Satapornvanit, K.; Min, J.; Shahabuddin, A.; Henriksson, P.J.; Murray, F.J.; Little, D.C.; Dalsgaard, A.; Van den
Brink, P.J. Use of veterinary medicines, feed additives and probiotics in four major internationally traded aquaculture species
farmed in Asia. Aquaculture 2013,412, 231–243. [CrossRef]
14.
Kumar, S.B.; Arnipalli, S.R.; Ziouzenkova, O. Antibiotics in food chain: The consequences for antibiotic resistance. Antibiotics
2020,9, 688. [CrossRef] [PubMed]
15.
Yang, C.; Song, G.; Lim, W. A review of the toxicity in fish exposed to antibiotics. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol.
2020,237, 108840. [CrossRef] [PubMed]
16.
Sapkota, A.; Sapkota, A.R.; Kucharski, M.; Burke, J.; McKenzie, S.; Walker, P.; Lawrence, R. Aquaculture practices and potential
human health risks: Current knowledge and future priorities. Environ. Int. 2008,34, 1215–1226. [CrossRef] [PubMed]

Fishes 2022,7, 398 11 of 13
17.
Heuer, O.E.; Kruse, H.; Grave, K.; Collignon, P.; Karunasagar, I.; Angulo, F.J. Human health consequences of use of antimicrobial
agents in aquaculture. Clin. Infect. Dis. 2009,49, 1248–1253. [CrossRef]
18.
Henriksson, P.J.; Rico, A.; Troell, M.; Klinger, D.H.; Buschmann, A.H.; Saksida, S.; Chadag, M.V.; Zhang, W. Unpacking factors
influencing antimicrobial use in global aquaculture and their implication for management: A review from a systems perspective.
Sustain. Sci. 2018,13, 1105–1120. [CrossRef] [PubMed]
19.
Miranda, C.D.; Godoy, F.A.; Lee, M.R. Current status of the use of antibiotics and the antimicrobial resistance in the Chilean
salmon farms. Front. Microbiol. 2018,9, 1284. [CrossRef]
20.
Lulijwa, R.; Rupia, E.J.; Alfaro, A.C. Antibiotic use in aquaculture, policies and regulation, health and environmental risks: A
review of the top 15 major producers. Rev. Aquac. 2020,12, 640–663. [CrossRef]
21.
Gabriel, N.N.; Qiang, J.; He, J.; Ma, X.Y.; Kpundeh, M.D.; Xu, P. Dietary Aloe vera supplementation on growth performance, some
haemato-biochemical parameters and disease resistance against Streptococcus iniae in tilapia (GIFT). Fish Shellfish. Immunol.
2015
,
44, 504–514. [CrossRef]
22.
Dávila, M.S.; Latimer, M.F.; Dixon, B. Enhancing immune function and fish health in aquaculture. In Fish Physiology; Elsevier:
Amsterdam, The Netherlands, 2020; Volume 38, pp. 123–161.
23.
Paray, B.A.; El-Basuini, M.F.; Alagawany, M.; Albeshr, M.F.; Farah, M.A.; Dawood, M.A. Yucca schidigera usage for healthy
aquatic animals: Potential roles for sustainability. Animals 2021,11, 93. [CrossRef]
24.
Brandi, P.; Conejero, L.; Cueto, F.J.; Martínez-Cano, S.; Dunphy, G.; Gómez, M.J.; Relaño, C.; Saz-Leal, P.; Enamorado, M.; Quintas,
A. Trained immunity induction by the inactivated mucosal vaccine MV130 protects against experimental viral respiratory
infections. Cell Rep. 2022,38, 110184. [CrossRef] [PubMed]
25.
Lynn, D.J.; Benson, S.C.; Lynn, M.A.; Pulendran, B. Modulation of immune responses to vaccination by the microbiota: Implica-
tions and potential mechanisms. Nat. Rev. Immunol. 2022,22, 33–46. [CrossRef] [PubMed]
26.
Ziogas, A.; Netea, M.G. Trained immunity-related vaccines: Innate immune memory and heterologous protection against
infections. Trends Mol. Med. 2022,28, 497–512. [CrossRef] [PubMed]
27.
Montuori, E.; de Pascale, D.; Lauritano, C. Recent Discoveries on Marine Organism Immunomodulatory Activities. Mar. Drugs
2022,20, 422. [CrossRef]
28.
Mo, X.-B.; Wang, J.; Guo, S.; Li, A.-X. Potential of naturally attenuated Streptococcus agalactiae as a live vaccine in Nile tilapia
(Oreochromis niloticus). Aquaculture 2020,518, 734774. [CrossRef]
29.
Abu-Elala, N.M.; Samir, A.; Wasfy, M.; Elsayed, M. Efficacy of injectable and immersion polyvalent vaccine against streptococcal
infections in broodstock and offspring of Nile tilapia (Oreochromis niloticus). Fish Shellfish. Immunol.
2019
,88, 293–300. [CrossRef]
30.
Pumchan, A.; Krobthong, S.; Roytrakul, S.; Sawatdichaikul, O.; Kondo, H.; Hirono, I.; Areechon, N.; Unajak, S. Novel chimeric
multiepitope vaccine for streptococcosis disease in Nile tilapia (Oreochromis niloticus Linn.). Sci. Rep. 2020,10, 603. [CrossRef]
31.
Wang, Q.; Fu, T.; Li, X.; Luo, Q.; Huang, J.; Sun, Y.; Wang, X. Cross-immunity in Nile tilapia vaccinated with Streptococcus agalactiae
and Streptococcus iniae vaccines. Fish Shellfish. Immunol. 2020,97, 382–389. [CrossRef]
32.
Dien, L.T.; Ngo, T.P.H.; Nguyen, T.V.; Kayansamruaj, P.; Salin, K.R.; Mohan, C.V.; Rodkhum, C.; Dong, H.T. Non-antibiotic
approaches to combat motile Aeromonas infections in aquaculture: Current state of knowledge and future perspectives. Rev.
Aquac. 2023,15, 333–366. [CrossRef]
33.
Linh, N.V.; Dien, L.T.; Sangpo, P.; Senapin, S.; Thapinta, A.; Panphut, W.; St-Hilaire, S.; Rodkhum, C.; Dong, H.T. Pre-treatment
of Nile tilapia (Oreochromis niloticus) with ozone nanobubbles improve efficacy of heat-killed Streptococcus agalactiae immersion
vaccine. Fish Shellfish. Immunol. 2022,123, 229–237. [CrossRef]
34. Bedekar, M.K.; Kole, S. Fundamentals of fish vaccination. In Vaccine Design; Springer: New York, NY, USA, 2022; pp. 147–173.
35.
Dien, L.T.; Linh, N.V.; Mai, T.T.; Senapin, S.; St-Hilaire, S.; Rodkhum, C.; Dong, H.T. Impacts of oxygen and ozone nanobubbles on
bacteriophage in aquaculture system. Aquaculture 2022,551, 737894. [CrossRef]
36.
Novoa, B.; Pereiro, P. Editorial of Special Issue “The 2nd Edition: Vaccines for Aquaculture”. Vaccines
2022
,10, 1242. [CrossRef]
[PubMed]
37.
Vinay, T.; Jung, M.-H.; Patil, P.K.; Panigrahi, A.; Kallappa, G.S. Vaccines to Prevent Diseases in Aquaculture. Biotechnol. Adv.
Aquac. Health Manag. 2022,313, 313–323.
38.
Linh, N.V.; Panphut, W.; Thapinta, A.; Senapin, S.; St-Hilaire, S.; Rodkhum, C.; Dong, H.T. Ozone nanobubble modulates the
innate defense system of Nile tilapia (Oreochromis niloticus) against Streptococcus agalactiae.Fish Shellfish. Immunol.
2021
,112, 64–73.
[CrossRef]
39.
Thanh Dien, L.; Linh, N.V.; Sangpo, P.; Senapin, S.; St-Hilaire, S.; Rodkhum, C.; Dong, H.T. Ozone nanobubble treatments improve
survivability of Nile tilapia (Oreochromis niloticus) challenged with a pathogenic multi-drug-resistant Aeromonas hydrophila.J. Fish
Dis. 2021,44, 1435–1447. [CrossRef]
40.
Thu Lan, N.G.; Salin, K.R.; Longyant, S.; Senapin, S.; Dong, H.T. Systemic and mucosal antibody response of freshwater cultured
Asian seabass (Lates calcarifer) to monovalent and bivalent vaccines against Streptococcus agalactiae and Streptococcus iniae.Fish
Shellfish. Immunol. 2021,108, 7–13. [CrossRef]
41.
Attaya, A.; Veenstra, K.; Welsh, M.D.; Ahmed, M.; Torabi-Pour, N.; Saffie-Siebert, S.; Yoon, S.; Secombes, C.J.
In vitro
evaluation of
novel (nanoparticle) oral delivery systems allow selection of gut immunomodulatory formulations. Fish Shellfish. Immunol.
2021
,
113, 125–138. [CrossRef]

Fishes 2022,7, 398 12 of 13
42.
Chung, S.; Secombes, C.J. Analysis of events occurring within teleost macrophages during the respiratory burst. Comp. Biochem.
Physiol. Part B Comp. Biochem. 1988,89, 539–544. [CrossRef]
43.
Van Doan, H.; Hoseinifar, S.H.; Hung, T.Q.; Lumsangkul, C.; Jaturasitha, S.; Ehab, E.-H.; Paolucci, M. Dietary inclusion of chestnut
(Castanea sativa) polyphenols to Nile tilapia reared in biofloc technology: Impacts on growth, immunity, and disease resistance
against Streptococcus agalactiae.Fish Shellfish. Immunol. 2020,105, 319–326. [CrossRef]
44.
Parry Jr, R.M.; Chandan, R.C.; Shahani, K.M. A rapid and sensitive assay of muramidase. Proc. Soc. Exp. Biol. Med.
1965
,119,
384–386. [CrossRef]
45.
Quade, M.J.; Roth, J.A. A rapid, direct assay to measure degranulation of bovine neutrophil primary granules. Vet. Immunol.
Immunopathol. 1997,58, 239–248. [CrossRef] [PubMed]
46.
Cordero, H.; Cuesta, A.; Meseguer, J.; Esteban, M.Á. Changes in the levels of humoral immune activities after storage of gilthead
seabream (Sparus aurata) skin mucus. Fish Shellfish. Immunol. 2016,58, 500–507. [CrossRef] [PubMed]
47.
Yoshida, T.; Kitao, T. The Opsonic Effect of Specific Immune Serum on the Phagocytic and Chemiluminescent Response in
Rainbow Trout, Oncorhynchus mykiss Phagocytes. Fish Pathol. 1991,26, 29–33. [CrossRef]
48. Yano, T. Assays of hemolytic complement activity. Tech. Fish Immunol. 1992, 131–141.
49.
Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2
−∆∆
CT method.
Methods 2001,25, 402–408. [CrossRef]
50. Amend, D.F. Potency testing of fish vaccines. Fish Biol. Serodiagn. Vaccines 1981, 447–454.
51. Sommerset, I.; Krossøy, B.; Biering, E.; Frost, P. Vaccines for fish in aquaculture. Expert Rev. Vaccines 2005,4, 89–101. [CrossRef]
52. Plant, K.P.; LaPatra, S.E. Advances in fish vaccine delivery. Dev. Comp. Immunol. 2011,35, 1256–1262. [CrossRef]
53. Dhar, A.; Manna, S.; Thomas Allnutt, F. Viral vaccines for farmed finfish. Virus Dis. 2014,25, 1e17. [CrossRef]
54.
Ma, J.; Bruce, T.J.; Jones, E.M.; Cain, K.D. A Review of Fish Vaccine Development Strategies: Conventional Methods and Modern
Biotechnological Approaches. Microorganisms 2019,7, 569. [CrossRef]
55.
Li, B.; Chen, J.; Huang, P.; Weng, T.; Wen, Y.; Yang, H.; Liu, Y.; Xia, L. Induction of attenuated Nocardia seriolae and their use as
live vaccine trials against fish nocardiosis. Fish Shellfish. Immunol. 2022,131, 10–20. [CrossRef] [PubMed]
56.
Mondal, H.; Thomas, J. A review on the recent advances and application of vaccines against fish pathogens in aquaculture. Aquac.
Int. 2022,30, 1971–2000. [CrossRef] [PubMed]
57.
Hoare, R.; Leigh, W.; Limakom, T.; Wongwaradechkul, R.; Metselaar, M.; Shinn, A.P.; Ngo, T.P.H.; Thompson, K.D.; Adams, A.
Oral vaccination of Nile tilapia (Oreochromis niloticus) against francisellosis elevates specific antibody titres in serum and mucus.
Fish Shellfish. Immunol. 2021,113, 86–88. [CrossRef] [PubMed]
58.
Thangsunan, P.; Kitiyodom, S.; Srisapoome, P.; Pirarat, N.; Yata, T.; Thangsunan, P.; Boonrungsiman, S.; Bunnoy, A.; Rodkhum, C.
Novel development of cationic surfactant-based mucoadhesive nanovaccine for direct immersion vaccination against Francisella
noatunensis subsp. orientalis in red tilapia (Oreochromis sp.). Fish Shellfish. Immunol. 2022,127, 1051–1060. [CrossRef] [PubMed]
59.
Radhakrishnan, A.; Vaseeharan, B.; Ramasamy, P.; Jeyachandran, S. Oral vaccination for sustainable disease prevention in
aquaculture—An encapsulation approach. Aquac. Int. 2022, 1–25. [CrossRef] [PubMed]
60.
Embregts, C.W.E.; Forlenza, M. Oral vaccination of fish: Lessons from humans and veterinary species. Dev. Comp. Immunol.
2016
,
64, 118–137. [CrossRef]
61.
Sudheesh, P.S.; Cain, K.D. Prospects and challenges of developing and commercializing immersion vaccines for aquaculture. Int.
Biol. Rev. 2017,1, 1–20.
62.
Yu, Y.; Wang, Q.; Huang, Z.; Ding, L.; Xu, Z. Immunoglobulins, mucosal immunity and vaccination in teleost fish. Front. Immunol.
2020,11, 2597. [CrossRef]
63.
El Basuini, M.F.; Teiba, I.I.; Shahin, S.A.; Mourad, M.M.; Zaki, M.A.; Labib, E.M.; Azra, M.N.; Sewilam, H.; El-Dakroury, M.;
Dawood, M.A. Dietary Guduchi (Tinospora cordifolia) enhanced the growth performance, antioxidative capacity, immune response
and ameliorated stress-related markers induced by hypoxia stress in Nile tilapia (Oreochromis niloticus). Fish Shellfish. Immunol.
2022,120, 337–344. [CrossRef]
64.
Monir, M.S.; Yusoff, S.b.M.; Mohamad, A.; Ngoo, M.S.b.M.H.; Ina-Salwany, M.Y. Haemato-immunological responses and
effectiveness of feed-based bivalent vaccine against Streptococcus iniae and Aeromonas hydrophila infections in hybrid red tilapia
(Oreochromis mossambicus×O. niloticus). BMC Vet. Res. 2020,16, 226. [CrossRef]
65.
Sirimanapong, W.; Thompson, K.D.; Kledmanee, K.; Thaijongrak, P.; Collet, B.; Ooi, E.L.; Adams, A. Optimisation and standardis-
ation of functional immune assays for striped catfish (Pangasianodon hypophthalmus) to compare their immune response to live
and heat killed Aeromonas hydrophila as models of infection and vaccination. Fish Shellfish. Immunol.
2014
,40, 374–383. [CrossRef]
[PubMed]
66.
Ashfaq, H.; Soliman, H.; Saleh, M.; El-Matbouli, M. CD4: A vital player in the teleost fish immune system. Vet. Res.
2019
,50, 1–11.
[CrossRef] [PubMed]
67.
Silva, B.C.; Martins, M.L.; Jatobá, A.; Buglione Neto, C.C.; Vieira, F.N.; Pereira, G.V.; Jerônimo, G.T.; Seiffert, W.Q.; Mouriño, J.L.P.
Hematological and immunological responses of Nile tilapia after polyvalent vaccine administration by different routes. Pesqui.
Veterinária Bras. 2009,29, 874–880. [CrossRef]
68.
Engelsma, M.Y.; Huising, M.O.; Van Muiswinkel, W.B.; Flik, G.; Kwang, J.; Savelkoul, H.F.; Verburg-van Kemenade, B.L.
Neuroendocrine–immune interactions in fish: A role for interleukin-1. Vet. Immunol. Immunopathol.
2002
,87, 467–479. [CrossRef]
[PubMed]

Fishes 2022,7, 398 13 of 13
69. Zou, J.; Secombes, C.J. The function of fish cytokines. Biology 2016,5, 23. [CrossRef]
70. Kany, S.; Vollrath, J.T.; Relja, B. Cytokines in inflammatory disease. Int. J. Mol. Sci. 2019,20, 6008. [CrossRef]
71.
Jun, J.W.; Kang, J.W.; Giri, S.S.; Yun, S.; Kim, H.J.; Kim, S.G.; Kim, S.W.; Han, S.J.; Kwon, J.; Oh, W.T. Immunostimulation by starch
hydrogel-based oral vaccine using formalin-killed cells against edwardsiellosis in Japanese eel, Anguilla japonica.Vaccine
2020
,38,
3847–3853. [CrossRef]
72.
Weiss, J. Bactericidal/permeability-increasing protein (BPI) and lipopolysaccharide-binding protein (LBP): Structure, function
and regulation in host defence against Gram-negative bacteria. Biochem. Soc. Trans. 2003,31, 785–790. [CrossRef]
73.
Watson, J.; Riblet, R. Genetic Control of Responses to Bacterial Lipopolysaccharides in Mice: I. Evidence for a Single Gene that
Influences Mitogenic and Immunogenic Respones to Lipopolysaccharides. J. Exp. Med. 1974,140, 1147–1161. [CrossRef]
74.
Baba, T.; Imamura, J.; Izawa, K.; Ikeda, K. Immune protection in carp, Cyprinus carpio L., after immunization with Aeromonas
hydrophila crude lipopolysaccharide. J. Fish Dis. 1988,11, 237–244. [CrossRef]
75.
Zhang, D.; Gao, Y.; Li, Q.; Ke, X.; Liu, Z.; Lu, M.; Shi, C. An effective live attenuated vaccine against Streptococcus agalactiae
infection in farmed Nile tilapia (Oreochromis niloticus). Fish Shellfish. Immunol. 2020,98, 853–859. [CrossRef] [PubMed]
76.
Kim, D.; Beck, B.R.; Lee, S.M.; Jeon, J.; Lee, D.W.; Lee, J.I.; Song, S.K. Pellet feed adsorbed with the recombinant Lactococcus
lactis BFE920 expressing SiMA antigen induced strong recall vaccine effects against Streptococcus iniae infection in olive flounder
(Paralichthys olivaceus). Fish Shellfish. Immunol. 2016,55, 374–383. [CrossRef] [PubMed]
77.
Kole, S.; Qadiri, S.S.N.; Shin, S.-M.; Kim, W.-S.; Lee, J.; Jung, S.-J. Nanoencapsulation of inactivated-viral vaccine using chitosan
nanoparticles: Evaluation of its protective efficacy and immune modulatory effects in olive flounder (Paralichthys olivaceus) against
viral haemorrhagic septicaemia virus (VHSV) infection. Fish Shellfish. Immunol. 2019,91, 136–147. [CrossRef] [PubMed]