Access to this full-text is provided by PLOS.
Content available from PLOS One
This content is subject to copyright.
RESEARCH ARTICLE
Conjectures and refutations: Species diversity
and phylogeny of Australoheros from coastal
rivers of southern South America (Teleostei:
Cichlidae)
Carlos A. Santos de Lucena
1
, Sven KullanderID
2
*, Michael Nore
´nID
2
, Ba
´rbara Calegari
1,3
1Laborato
´rio de Ictiologia, Museu de Ciências e Tecnologia da Pontifı
´cia Universidade Cato
´lica dRio Grande
do Sul, Porto Alegre, Rio Grande do Sul, Brazil, 2Department of Zoology, Swedish Museum of Natural
History, Stockholm, Sweden, 3Department of Vertebrate Zoology, National Museum of Natural History,
Smithsonian Institution, Washington, DC, United States of America
*sven.kullander@svenkullander.se
Abstract
Morphological and genetic analyses of species of Australoheros focusing on those distrib-
uted in coastal rivers from the Rio de La Plata north to the Rio Buranhe
´m, support recogni-
tion of 17 valid species in the genus. Eight species are represented in coastal rivers: A
acaroides,A.facetus,A.ipatinguensis,A.oblongus,A.ribeirae, and A.sanguineus are vali-
dated from earlier descriptions. Australoheros mboapari is a new species from the Rio
Taquari in the Rio Jacuı
´drainage. Australoheros ricani is a new species from the upper Rio
Jacuı
´. Specimens from the Rio Yaguaro
´n and Rio Tacuary, affluents of Laguna Merı
´n, and
tributaries of the Rio Negro, tributary of the Rio Uruguay are assigned to A.minuano pending
critical data on specimens from the type locality of A.minuano.Australoheros taura is a
junior synonym of A.acaroides.Australoheros autrani,A.saquarema,A.capixaba,A.
macaensis,A.perdi, and A.muriae are junior synonyms of A.ipatinguensis.Heros autoch-
thon,A.mattosi,A.macacuensis,A.montanus,A.tavaresi,A.paraibae, and A.barbosae,
are junior synonyms of A.oblongus.Heros jenynsii is a junior synonym of A.facetus.
Introduction
About 530 species of the freshwater fish family Cichlidae have been recorded from the Neo-
tropical region, over 400 of them in South America, the remaining in Middle America. The
majority of the South American cichlid species pertain to the Amazon and Orinoco River
basins and other tropical rivers. Three genera, however, are exclusive to more southern rivers,
including the Rio Parana
´basin, and coastal rivers from the La Plata basin north to the Rio
São Francisco. Among those, Gymnogeophagus Miranda Riberio, 1918, with 18 species, is
restricted to the lower Parana
´, Paraguay, and Uruguay drainages, with a few species also occur-
ring in the Laguna dos Patos basin. ‘Geophagus’ brasiliensis (Quoy & Gaimard, 1824) repre-
sents a group of species in need of revision, distributed along the coast from the Laguna Merı
´n
PLOS ONE
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 1 / 122
a1111111111
a1111111111
a1111111111
a1111111111
a1111111111
OPEN ACCESS
Citation: Santos de Lucena CA, Kullander S, Nore
´n
M, Calegari B (2022) Conjectures and refutations:
Species diversity and phylogeny of Australoheros
from coastal rivers of southern South America
(Teleostei: Cichlidae). PLoS ONE 17(12):
e0261027. https://doi.org/10.1371/journal.
pone.0261027
Editor: Roberto E. Reis, Pontificia Universidade
Catolica do Rio Grande do Sul, BRAZIL
Received: May 24, 2021
Accepted: November 22, 2021
Published: December 9, 2022
Copyright: ©2022 Santos de Lucena et al. This is
an open access article distributed under the terms
of the Creative Commons Attribution License,
which permits unrestricted use, distribution, and
reproduction in any medium, provided the original
author and source are credited.
Data Availability Statement: All relevant data are
within the paper and its Supporting information
files. DNA sequences have already been published
with GenBank.
Funding: Financial support was provided to CAS by
The Coordenac¸ão de Aperfeic¸oamento de Pessoal
de Nı
´vel Superior(CAPES, https://www.gov.br/
capes/pt-br) ao Auxı
´lio financeiro to CASL,
including a grant as visiting scientist to SOK, Grant
number CSF-PVE-S 0751/2014 Processo:
drainage north to the Rio Coruripe at 9˚S, but also present in the upper Rio Uruguay and
some tributaries of the Rio Parana
´[1,2]. The third genus, subject of this paper, is Australo-
heros R
ˇı
´čan & Kullander, 2008. It comprises 31 nominal species with a combined distribution
in rivers and lagoons along the South American Atlantic coast from tributaries of the lower
Rio Parana
´and the Rio de La Plata north to the Rio Buranhe
´m at about 16˚S, but also present
in the Uruguay River basin and some tributaries of the major rivers Parana
´and São Francisco.
Most of the information about Australoheros is contained in the two seminal works by R
ˇı
´čan
and Kullander from 2006 [3] and 2008 [4], describing the genus and most of its southern spe-
cies, and outlining the intrageneric phylogeny. It was followed by several short species descrip-
tions and re-descriptions chiefly by Ottoni and collaborators, 2008–2013 [5–12], focusing on
species from the northern part of the distribution of the genus, but also R
ˇı
´čan et al. in 2011
[13].
Australoheros comprises medium-sized species with lengths only exceptionally exceeding
100 mm standard length (SL); the largest specimens recorded in the present study were about
140 mm SL. Ringuelet et al. [14] reported specimens of Australoheros facetus Jenyns, 1842,
with 161–162 mm SL at age 10 years, and larger specimens almost 180 mm SL that were not
aged. Species of Australoheros were predominantly recorded from small streams or vegetated
lentic habitats. Limited observations on food in various species suggest a diet based on small
fish and benthic invertebrates such as insect larvae, shrimps, and small crustaceans, supple-
mented with some vegetable matter [15–19]. Based on an analysis of swimming mode in A.
facetus, Go
´mez et al. [20] (concluded that A.facetus may be defined as ‘a specialist in maneu-
vering in structurally complex habitats, with certain capacity of acceleration to capture inverte-
brates and small fishes’. The majority of the species of Australoheros shares a general body
shape, moderately deep and laterally compressed, with short head and caudal peduncle, blunt
snout, small mouth with short teeth except for enlarged anterior teeth in the upper jaw, and a
long anal fin with 5–8 spines. All species share a colour pattern dominated by dark vertical
bars across the sides. Although some localities are close to the sea, there are no records of Aus-
traloheros from saline waters. Australoheros facetus was recorded as feral in rivers in the Ibe-
rian Peninsula in Europe [21–23] and in Chile [24]. Laboratory observations showed that A.
facetus is a territorial, biparental substrate brooder, commonly noted for its aggressive behav-
iour [25]. Similar behaviour was reported for other species of the genus based on aquarium
observations [26,27]. Reliable information on fecundity has not been reported; 300–1000 eggs
per spawning was reported for A.facetus in aquarium [28]. The combination of territoriality,
aggressivity, parental brood care, and generalist feeding were highlighted as factors facilitating
invasive progress of A.facetus at least in the Mediterranean region [17,18].
The taxonomic history of Australoheros started in 1842 with Jenyns’s [29] description of
Chromis facetus collected by Charles Darwin in Maldonado on the coast of Uruguay, followed
by Castelnau’s description in 1855 [30] of Chromys oblonga, stated to be from the from the Rio
Tocantins basin in Goia
´s, Brazil. In 1862, Gu¨nther [31] referred C.oblonga to Heros Heckel,
1840, a genus erected for Neotropical cichlids possessing more than four anal-fin spines [32].
Next to Heros oblongus, Gu¨nther described Heros autochthon based on specimens without pre-
cise locality but stated to be from Brazil and donated by Lord Stuart [31]. Better provenience
was introduced by Steindachner in 1869 [33], describing Heros Jenynsii from Montevideo in
Uruguay, and Hensel in 1870 [34], describing Heros acaroides from Porto Alegre and the Rio
Cadeia in the state of Rio Grande do Sul, Brazil.
With the exception of Chromys oblonga, the type of which was in a poor state of preserva-
tion already at the time of description [30], the descriptions of these species were very similar
and they were variously synonymised by later authors. In 1875, Steindachner [35], ignoring C.
oblonga, synonymised Heros with Acara Heckel, 1840 [32], and H.jenynsii and H.acaroides
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 2 / 122
88881.030373/2013-01. The funder had no role in
study design, data collection and analysis, decision
to publish, or preparation of the manuscript.
Competing interests: The authors have declared
that no competing interests exist.
with Chromis facetus. He referred to Acara faceta as a south Brazilian species and identified
specimens from southeastern Brazil as Acara autochthon.
In 1904, Pellegrin [36] synonymised Heros jenynsii and H.acaroides with Chromis facetus
in the genus Cichlasoma Swainson, 1839, but maintained Heros autochthon and Chromys
oblonga as valid species in Heros. He observed, however, that H.autochthon might differ from
C.facetum only in the absence of a lower lip frenum, and that Chromys oblonga might be the
same species as H.autochthon. In 1905, Regan [37] synonymised Heros under Cichlasoma (as
Cichlosoma, an unjustified emendation of Cichlasoma), and considered Heros autochthon,
Chromis facetus, and Chromys oblonga to be valid species of Cichlasoma, in which genus they
remained until 1983 when Kullander [38] separated Australoheros facetus from Cichlasoma–
but without proposing a new generic name or addressing other nominal species. By that time,
Haseman [39] had synonymised Heros autochthon and Chromys oblonga under Cichlasoma
facetum. Two species currently in Australoheros were described under the temporary genus
designation ‘Cichlasoma’, namely ‘Cichlasoma’ tembe Casciotta, Almiro
´n & Go
´mez, 1995, and
‘Cichlasoma’ scitulum R
ˇı
´čan & Kullander, 2003.
In their phylogenetic analysis of 2006 R
ˇı
´čan and Kullander [3] demonstrated an unexpected
high diversity of species in ‘Cichlasoma’ from southern South America. They named the new
genus Australoheros, with Chromis facetus as type species, but did not propose names for the
new species that they distinguished. Eventually, in 2008 R
ˇı
´čan and Kullander [4] revised the
genus and described nine species of Australoheros from the Rio Uruguay basin and tributaries
of the lower Rio Parana
´, four of which new: Australoheros forquilha,A.charrua,A.minuano,
and A.guarani. Two species from coastal rivers in eastern Uruguay were identified as A.face-
tus and A. cf. facetus, respectively. A putatively undescribed species from the Rio Jacuı
´basin in
Brazil was left with the interim name Australoheros sp.“Jacui”; Heros acaroides, from the same
river basin, was not mentioned.
In 2011 R
ˇı
´čan et al. [13] followed up with descriptions of another two species from the Uru-
guay and Iguac¸u drainages—Australoheros angiru R
ˇı
´čan, Pia
´lek, Almiro
´n & Casciotta, 2011
(misidentified in 2008 [4] as A.kaaygua), and A.ykeregua R
ˇı
´čan, Pia
´lek, Almiro
´n & Casciotta,
2011 –further exposing considerable richness of endemic species of Australoheros in the Rio
Uruguay basin. Meanwhile, Ottoni and Cheffe [7] described a new species, Australoheros
taura, from the upper Rio Taquari (Rio Jacuı
´basin) in the State of Rio Grande do Sul, Brazil.
That paper did not mention Heros acaroides, described from the same river basin; it was revali-
dated in 2010 by Schindler et al. [11], who designated and illustrated a lecotype and reported
Australoheros acaroides from a few localities in the Rio Jacuı
´basin, Laguna dos Patos, and
Lagoa Mirim in Rio Grande do Sul.
Ottoni et al. [5] described Australoheros ribeirae Ottoni, Oyakawa & Costa, 2008 from
the coastal Rio Ribeira de Iguape, followed by descriptions by Ottoni and Costa [6] in the
same year of another nine new species of Australoheros from localities in the Sudeste region
of Brazil, including tributaries of the Rio Paraı
´ba do Sul, short coastal rivers in the state of
Rio de Janeiro, and a distant location in the Rio Doce drainage (Australoheros autrani,A.
barbosae,A.ipatinguensis,A.macaensis,A.macacuensis,A.muriae,A.paraibae,A.robus-
tus, and A.saquarema). Chromys oblonga and Heros autochthon, described from the same
region, were not mentioned. Ottoni described Australoheros capixaba Ottoni, 2010 [80]
from coastal rivers in the State of Espı
´rito Santo, and Ottoni et al. [10] added Australoheros
perdi Ottoni, Lezama, Triques, Fragoso Moura, Lucas & Barbosa, 2011 from a lake in the
Rio Doce basin.
All coastal species of Australoheros share a colour pattern dominated by dark vertical bars
and are also moderately variable in meristic data and proportional measurements. Based on a
morphology-based phylogenetic analysis including data from Ottoni’s descriptions and
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 3 / 122
additional specimens from southeastern Brazil, R
ˇı
´čan et al. [13] concluded that all species
described by Ottoni and collaborators 2008–2010 [5–8] made up a monophyletic clade (single
species) sister to the Australoheros assemblage in the Uruguay and lower Parana
´drainage
basins. R
ˇı
´čan et al. [13] pointed out that all northern putative species apparently lacked autapo-
morphies and might represent a case of excessive splitting, as suggested also by R
ˇı
´čan et al.
[40] in a phylogenetic analysis of heroine cichlids. Ottoni [9] responded to Rican et al. [13]
with descriptions in 2012 of three additional species–Australoheros mattosi from the Rio São
Francisco basin, A.montanus from the Rio Paraı
´ba do Sul basin, and A.tavaresi from the Rio
Tietêbasin–and discarded R
ˇı
´čan et al.’s analysis [13] as it would not be ‘suitable to test the spe-
cies from the southeastern Brazil’. In the same paper, on the basis of photographs, he desig-
nated and figured as lectotype of Heros autochthon a putative syntype which he determined
was not a specimen of Australoheros. The three remaining syntypes were dismissed as not
‘allowing positioning’, probably meaning that they could not be identified to genus. Without
having examined the specimen, he stated that the holotype of Chromys oblonga would be in a
too bad state of preservation to allow identification as a species of Australoheros.Australoheros
sanguineus, described by Ottoni 2013 [12] from the Rio Cubatão in the state of Santa Catarina,
Brazil, is the most recently described species of Australoheros.
Meanwhile, several phylogenetic analyses were published that include species of Australo-
heros. Kullander [41] included ‘Cichlasoma’ facetum (actually, specimens of both A.facetus
and A.acaroides) in a morphological phylogenetic analysis of South American cichlids. The
analysis recovered ‘Cichlasoma’ facetum nested in a clade with other cichlid species with ele-
vated number of anal-fin spines. This clade, encompassing also the majority of the Middle
American cichlids, was recognised as the tribe Heroini within the subfamily Cichlasomatinae.
Cichlasomatinae Kullander,1998 postdates the tribe (with no subfamily) Therapsini Allgayer,
proposed in an aquarium society magazine in 1989 [42] but not used afterwards and rejected
by R
ˇı
´čan et al. [40]; thus, Cichlasomatinae takes priority over Therapsini A (cf. International
Commission of Zoological Nomenclature 1999: Article 35.59) [43], but Heroini is a junior sub-
jective synonym of Therapsini. Given the alternative classification of cichlids recognising only
a single subfamily in the neotropics–, Cichlinae–proposed by Smith et al. [44], Cichlasomati-
nae is adjusted to a tribe, and Heroini and Therapsini to subtribes with no change of relative
priority.
R
ˇı
´čan and Kullander [3], using large sets of morphological characters and mitochondrial
gene sequences from heroin cichlids–including five species of Australoheros–demonstrated the
monophyly of Australoheros and its position among heroin cichlids. The morphological analy-
sis was extended with the recognition of four distinct species groups, the forquilha group (A.
forquilha,A. sp. “Jacuı
´”, A.tembe), the scitulus group (A.scitulus,A.charrua), the kaaygua
group (A.kaaygua,A.minuano), and the facetus group (A.facetus,A. cf. facetus,A.guarani
[4]. That analysis was expanded on by R
ˇı
´čan et al. [13] in 2011 to include also the new species
A.ykeregua, and A.angiru (called A.kaaygua in that paper). R
ˇı
´čan et al.’s [40,45] phylogenetic
analyses of Middle American cichlids included only three species of Australoheros–A.angiru,
A.facetus, and A.scitulus–which were recovered as monophyletic among Middle American
Heroini, distant from South American Heroini. Other molecular phylogenetic studies also
recovered Australoheros nested among Middle American Heroini and not with other South
American Heroini [44,46].
Most recently, Ottoni et al. [47] presented a combined phylogenetic and species delimita-
tion analysis of species of Australoheros mainly from the Brazilian Sudeste region, based on a
fragment of the mt-cyb gene. The study concluded that the Sudeste region held nine or 11 spe-
cies, synonymising five of those considered valid by Ottoni up to 2013 [12]. The analysis
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 4 / 122
included only a few of the southern species of Australoheros, almost all represented only by
sequences available from GenBank.
Concerns have been raised [13] about the validity of the several species of Australoheros
proposed recently, particularly since the species diversity had gone up from three valid species
(A.facetus,A.tembe,A.scitulus) before the genus was named in 2006 [3], to 28 species in 2013
[12]. The genus was traditionally studied from two different geographical perspectives, encom-
passing either species from the Sudeste region of Brazil, or from the Uruguay and Parana
´
basins. This is most clearly seen in the available phylogenetic analyses which are focused on
either the southern species or the northern species. Furthermore, nomenclatural uncertainty
persists because type specimens of species described in the 19th Century have not been
matched against material collected recently.
Although this was never clearly expressed in taxonomic and phylogenetic papers dealing
with the genus, but obvious from the treatment in taxonomic and phylogenetic publications, a
hypothesis of evolution and speciation was implicitly proposed, namely that there is at least
significantly elevated endemic species diversity in the extreme northern and southern ranges
of the genus, and that the northern and southern species represent reciprocally separate phylo-
genetic lineages, similar to species flocks. This view was nevertheless never tested although it
might have significant implications for understanding of the biogeography, conservation and
evolution of the southern South American fish fauna.
To close the geographical gap in Australoheros taxonomy, and to investigate the conflicting
conclusions of R
ˇı
´čan et al. [13] and Ottoni et al. [47], we analysed a large and representative
number of specimens of coastal species of Australoheros with respect to traditional morpholog-
ical characters, and performed a molecular phylogenetic analysis based on mitochondrial
genes. The focus group consists of samples from coastal regions, primarily coastal streams in
Uruguay, the Laguna dos Patos basin in Brazil, and rivers along the Brazilian coast to the Rio
Itau
´nas basin, representing taxa that were never before analysed in the same context but which
were already indicated as distinct from the species in tributaries of the middle and upper Rio
Uruguay. Supplemented with the mitochondrial cytochrome b, the analysis was based on the
mitochondrial cytochrome c oxidase subunit I gene, the ‘DNA barcode gene’, which was very
little used in cichlid systematics so far but which has proven efficient in species delimitation
analyses of teleosts and for which there is a huge and growing body of knowledge for its appli-
cation in species delimitation and phylogenetic analysis [48,49]. The analysis also gave us rea-
son to address the application of the Unified Species Concept of de Queiroz [50] and to
remark on the difference between a formal description of a species in a nomenclatural context,
and the actual demonstration of species status.
Material and methods
Most specimens examined were already part of museum collections. Complementary speci-
mens were collected in Brazil in the states of Rio Grande do Sul, Santa Catarina, Rio de Janeiro,
and Minas Gerais under permit ICMBio numbers 44694–2 to 5. In the field, individuals were
euthanised in an overdose of clove oil following protocols and recommendations of Lucena
et al. [51] and Use of Fishes in Research Committee [52]. Muscle samples for molecular analy-
sis were preserved in 98–99% ethanol and stored in freezer at about -20 ˚C; voucher specimens
were fixed in 10% formalin, and eventually transferred to 70% ethanol for long term storage.
Sampling sites are shown in Fig 1.
Specimens examined are specified under each species account, and are catalogued in the
following institutions:
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 5 / 122
BMNH The Natural History Museum, London;
CIMC Divisão de Fauna, Grupo Especial de Estudo e Protec¸ão do Ambiente acua
´tico do Rio
Grande do Sul, Pelotas;
CZNC Divisão Ictiolo
´gica da Colec¸ão Zoolo
´gica Norte Capixaba, Universidade Federal do
Espı
´rito Santo, São Mateus;
LBP Laborato
´rio de Biologia de Peixes, Universidade Estadual Paulista, Instituto de Biociên-
cias, Campus de Botucatu
´, Botucatu
´;
MCP Museu de Ciências e Tecnologia da Pontifı
´cia Universidade Cato
´lica do Rio Grande do
Sul, Porto Alegre;
MNHN Muse
´um national d’Histoire naturelle, Paris;
MHNG Muse
´um d’Histoire naturelle, Genève;
MNHN Museo Nacional de Historia Natural, Montevideo;
MNRJ Museu Nacional, Rio de Janeiro;
NMW Naturhistorisches Museum, Wien;
MUHNAC Museu Nacional de Histo
´ria Natural e da Ciência, Universidade de Lisboa, Lisboa;
MZUSP Museu de Zoologia da Universidade de São Paulo, São Paulo;
NRM Swedish Museum of Natural History, Stockholm;
Fig 1. Sampling sites of coastal species of Australoheros.A symbol may cover more than one sampling site.
https://doi.org/10.1371/journal.pone.0261027.g001
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 6 / 122
NUP Colec¸ão Ictiolo
´gica do Nu
´cleo de Pesquisas em Limnologia, Ictiologia e Aquicultura da
Universidade Estadual de Maringa
´, Maringa
´
NPM Instituto de Biodiversidade e Sustentabilidade, Universidade Federal d Rio de Janeiro,
Macae
´;
Universidade Estadual de Maringa
´, Maringa
´;
STRI Smithsonian Tropical Research Institute, Panama
´;
UFBA Museu de Zoologia, Universidade Federal da Bahia, Salvador;
UFRGS Colec¸ão de Peixes, Universidade Federal do Rio Grande do Sul, Porto Alegre;
UNICTIO Laborato
´rio de Ictiologia, Universidade do Vale do Rio dos Sinos, São Leopoldo;
UVN Universidade Federal de Vic¸osa, Vic¸osa,;
ZFMK Zoologisches Forschungsinstitut und Museum Alexander Koenig, Bonn;
ZMB Museum fu¨r Naturkunde, Berlin.
ZSM Zoologische Staatssammlung, Mu¨nchen
Other institutional repositories mentioned:
DZUFMG Departamento de Zoologia da Universidade Federal de Minas Gerais, Belo
Horisonte;
MACN-ict Coleccio
´n Nacional de Ictiologı
´a, Museo Argentino de Ciencias Naturales Bernar-
dino Rivadavia, Buenos Aires;
MLP Museo de La Plata, La Plata;
MTD Senckenberg Naturhistorische Sammlungen Dresden, Dresden;
UFRJ Instituto de Biologia, Universidade Federal de Rio de Janeiro, Rio de Janeiro;
UMZC University Museum of Zoology, Cambridge.
Species concept
Under the Unified Species Concept [50], species are concepts (or hypotheses) recognised from
evidence of lineage separation. We explored specimens for such evidence using morphological
characters, DNA-based phylogenies, and coalescence analysis.
Morphology
Measurements and counts were obtained as described by Kullander [53] except that snout and
head lengths represent point to point measurements. Projected measurements as used by
R
ˇı
´čan Kullander [4] and Kullander [53] may be preferable for small species and specimens, on
which the calliper tip adds considerably to the measurement, but are time-consuming and not
likely more accurate in large preserved specimens which usually are slightly asymmetric due to
post-mortem pressure in holding containers or museum jars. Projected measurements give
slightly shorter values, more so in specimens with a deep lachrymal bone.
Distance measurements were analysed with the statistics program SYSTAT, v.13 [54]
(descriptive statistics, regression analysis, Mann-Whitney U Test, ANCOVA, plots). Sheared
Principal Component Analysis was performed with log-transformed data [55]. The first
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 7 / 122
component was identified as multivariate size, and the following components identified as rep-
resenting distance vectors insofar as variance was >1. In the two-dimensional plots of PCA
scores, ellipses only facilitate identification of species samples; ellipses are centered on sample
means of the two component axes; the major axes reflect the standard deviations of the x and y
values, and the orientation reflects the sample covariance between each x and y value. The size
of the ellipse reflects a probability set to the default 0.6827, ensuring that the ellipse fits into the
diagram. Enclosing hull instead of ellipse was used when required for clarity.
The count of scales along the side was made in the horizontal row immediately above that
containing the lower lateral line, and excluded the scale on the cleithrum as well as any scale
inserted on the caudal-fin base. The count of scales in the lower lateral line excluded any scale
on the caudal fin, but included the last scale on the caudal peduncle although it may extend
over the caudal-fin base. The count of scales on the cheek was made along an imaginary line
down from the middle of the orbit. The count of predorsal scales was made along the midline
of the occiput and was approximate as those scales are irregularly arranged and often embed-
ded without free margins. Scale rows around the caudal peduncle were counted on the middle
of the caudal peduncle.
Vertebrae were counted on X-radiographs and reported as precaudal+caudal; the first cau-
dal vertebra is that with the haemal spine inserted behind the anteriormost anal-fin pterygio-
phores [56,57]. This convention, used by R
ˇı
´čan et al. [13] and R
ˇı
´čan and Kullander [4]
typically gave 13 precaudal vertebrae in Australoheros. The X-radiograph published by Ottoni
[12] shows the next vertebra labelled as the first caudal vertebra. As checked on cleared and
stained specimens, our first caudal vertebra had a complete haemal arch, and may also have
short parapophyses.
The posteriormost dorsal- and anal-fin soft ray was commonly composed of two rays shar-
ing the same distal radial. In intact specimens, it could be difficult to decide if the last ray was
integer or composite, whereas the condition was shown clearly in X-radiographs. Variation in
count of soft-fin rays may reflect variation in the determination of the posteriormost ray, but
as a rule the last compound ray was registered as composed of two rays also in specimens not
X-radiographed.
Proximal radials of the dorsal- and anal-fin rays were reported by R
ˇı
´čan and Kullander [4]
and Ottoni and collaborators [5–12]. Proximal radials are those elements of the fin ray support
that are proximal to and articulating with the distal radials to which the fin rays attach. In cich-
lids the first two anal-fin spines articulate on the same compound proximal radial. The last two
soft rays may share the same proximal+distal radial or not. The number of anal rays should
match the number of proximal radials plus one, but it may be difficult to identify the posterior
proximal radials on X-radiographs, and a count of fin-rays may be more accurate. The number
of proximal radials supporting the dorsal fin corresponds to the number of spines+soft fin
rays, except that the last two rays may share proximal radial. Counting radials may be purpose-
ful when spines and soft fin rays are lost or damaged.
The terms isognathous, prognathous, and retrognathous refer to the relative projection of
the lower jaw (without lips) when the mouth is closed, describing the condition respectively
where the upper and lower jaw bite at the same anterior extension; the lower jaw projects
slightly anterior of the upper jaw; and the upper jaw projects slightly anterior of the lower jaw.
In cichlids, jaws are typically isognathous, as in Australoheros. Prognathous jaws are found in
many piscivorous cichlids (e.g. species of Crenicichla Heckel, 1840, Petenia splendida (Gu¨n-
ther, 1862). Retrognathous lower jaw must be very rare in cichlids, as we did not find any
record of this condition. Prognathous jaws were recorded but not confirmed in several
descriptions of species of Australoheros, e.g. R
ˇı
´čan and Kullander [4], and Ottoni and Costa,
[6], and seems rather to refer to the inclination of the lower jaw. In very large specimens of A.
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 8 / 122
facetus and A.acaroides, the lower jaw was relatively thick and angled, and closed slightly
before the upper jaw. In all other Australoheros, the jaws were equal in anterior extension or
the upper jaw closing slightly in advance of the lower. Retrognathous jaws reported in Austra-
loheros taura [7] apparently refers to the extension of the upper lip and not to a short lower
jaw.
Gill-rakers counted were those externally (laterally) on the first gill arch, where they were
present on the epibranchial and ceratobranchial portions, and there was usually also one situ-
ated in the joint between the epibranchial and ceratobranchial. The epibranchial gill rakers
were two or three in number and occasionally difficult to count in poorly preserved or very
rigid specimens. Thus, only the ceratobranchial number was tabulated. Gill rakers on the
medial side were difficult to examine on whole specimens without lifting the gill cover and
first gill-arch to the extent that either potentially suffered damage.
Ottoni and collaborators used the same description for the gill-raker count, but provided
three numbers. Ottoni et al. [10] provided an explanation in the description of Australoheros
perdi: ‘Gill rakers (25) from the first gill arch are in two series, one in the inner side and the
other in the outer side, all of whom may fall out of the specimen easily under manipulation
and can only be correctly studied in cleared, stained and dissected specimens; the count is
expressed as a formula (x + y; where x refers to the ceratobranchial rakers and y those from the
epibranchial together with possible rakers from the intermediary cartilage); inner and outer
rakers from each bone are added and expressed by a single number.’ In their table however,
they report ‘Gill-rakers on first ceratobranchial 15(2)– 16(3) + 5(1)– 6(2)– 7(2)’. It corresponds
to 15–16 medial, and 5, 6, or 7 lateral. Gill rakers were not mentioned elsewhere in that paper.
Sex was determined in adult specimens by the shape of the genital papilla which was conical
or spindle-shaped in males, tipped by several short filaments and with a narrow terminal open-
ing; in females a short thick-walled tube with a transverse or v-shaped wide aperture.
The colour pattern terminology followed R
ˇı
´čan et al. [58]. The vertical dark bar on the cau-
dal peduncle and the dark blotch at the base of the caudal fin were considered to be expressions
of the same marking (anterior and posterior divisions of Bar 1, Bar 1 a and 1p, respectively).
The remaining bars were numbered in succession from posterior to anterior as in R
ˇı
´čan et al.
fig. 1 [58]; (Fig 2).
Bars 2–5 were expressed as narrow dark bars extending from the dorsum to the lower side,
and were present in all species of Australoheros; Bars 4–6 were located in succession between
the head and the anal fin, and called abdominal bars. Bar 5 was either entire, as one of three
abdominal bars; or split vertically, resulting in four abdominal bars. Bar 7 was usually obsolete,
expressed as a dark patch close to the gill opening, and two, divergent stripes, one crossing the
head well above the orbit; the other extending to the dorsal-fin base. We distinguished between
the portion of the dark bars that extended down for most of the side, which were vertically ori-
ented and which usually were clearly formed by black or brown pigment restricted by scale
borders; and the dorsal portion which was uniformly grey-brown or brown and mostly slant-
ing slightly caudad from the rest of the bar, although this portion of Bars 4–6 could also have a
rostrad inclination. The two portions corresponded to the intersegmental dorsal blotches rec-
ognised by R
ˇı
´čan et al. [58]). When the dorsal part of Bar 6 slanted caudad from the dorsal-fin
base to the rostrad slanting upper portion of Bar 5 (or, rarely, Bar 5 and Bar 4) they combined
to form a Y mark). Similarly, it was bar portions that formed ring-like marks enclosing a ligh-
ter area immediately below the anterior dorsal-fin base. Interbars are the light bars between
the dark bars, and were numbered from 0 (between Bar 1a and Bar 1p) to 5 (between Bars 5
and 6).
Live colours have been advocated as critical for determination of species of Australoheros
[13,59]. Because of fragmentary data, live colours are not given extensive consideration here.
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 9 / 122
The popular English name chameleon cichlid applied on Australoheros facetus indicates that
colouration may be variable in individuals of A.facetus at least. The name may, however,
reflect mainly the melanophore pattern as described by Bade in 1923 [60]: ‘Ko¨rperfarbe wech-
selnd, in der Regel braungelb oder gru¨nlich, bald mit hellen, bald bunteren breiten Binden
geziert, die sich auch auf die Flossen ausdehnen. Diese Binden ko¨nnen oft ganz verblassen, es
zeigt sich dann nur eine schwarze Mittellinie oder oft nur einige bunte Flecke’. Live Australo-
heros may be just black (A.facetus), or with a reflecting green or blue body with minute
patches of red or orange all over, or sides red; and caudal fin pale or deep red in its entirety, or
along all or part of the margin of the caudal fin. The breeding colour is typically yellow with
contrasting black markings and yellow or red eye [13,27,59,61,62]. Available information by
species is almost exclusively anecdotal; that is, colour terminology was not standardised, does
not relate to behaviour or sex, and concerns specimens in aquaria, stressed in a small photo
tank, handheld in air, or dropped on the ground. Photos in aquarium journals may appear in
different hues.
Photographs of whole specimens were made of specimens immersed in alcohol in photo
aquaria, under variable light conditions and with different cameras and depicting specimens
in different states of preservation and with various post-mortem deformations. Narrow
unsharp mask was applied and the background set to black, eliminating scratches, dirt, and
reflections in areas outside of specimens. Images are representative of specimen habitus and
melanophore colour pattern, but other colours are affected by preservation and lightning.
Osteological preparations of whole specimens cleared and stained with Alizarin Red S and
Alcian Blue using the method of Taylor and Van Dyke [63] were available as follows: A.acar-
oides, NRM 37035, 56.2 mm SL; NRM 37037, 63.4 mm SL.—A.minuano: NRM 51079, pt.,
69.7 mm SL.—Australoheros angiru NRM 49159, 65.1 mm SL; ZSM 23060, pt., 52.2 mm SL.—
A.facetus, NRM 37040, 61.1 mm SL.—A.scitulus: NRM 49899 pt., 53.8 mm SL.—A.ykeregua:
Fig 2. Map of numbering of vertical dark lateral bars in in Australoheros.
https://doi.org/10.1371/journal.pone.0261027.g002
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 10 / 122
ZSM 23060 pt., 48.4 mm SL; ZSM 23482, 73.3 mm SL.—A. sp. “Jacuı
´”: MZUSP 30411 (P), 60.8
mm SL; MZUSP 30411(L), 70.6 mm SL.
DNA processing
For the genetic analysis, a 654 basepair (bp) fragment of the 50end of the mitochondrial cyto-
chrome c oxidase subunit I gene (mt-co1) and the complete or nearly complete mitochondrial
cytochrome b gene (mt-cyb) was sequenced from morphologically identified specimens. At
NRM, DNA was extracted, and mt-co1 sequences obtained as described by Kullander et al.
[49]. mt-cyb was amplified using the primers CYTB_GlufishF (AACCACCGTTGTTATTCAAC
TACAA) and CYTB_TrucCytb (CCGACTTCCGGATTACAAGACCG), with the PCR cycling: 94
˚C for 4 min; 40 �(94 ˚C for 30s; 52 ˚C for 30s; 72 ˚C for 60s); 72 ˚C for 8 min. The PCR prod-
ucts were processed as described by Kullander et al. [49].
At MCP, total genomic DNA was isolated using the DNeasy Blood & Tissues Kit (Qia-
gen). All polymerase chain reactions (PCR) were performed in 25 μL reactions using 1.25 μL
of 10 μM of each primer, 12.5 μL of water, 8 μL of HotStarTaq Master Mix Kit (Qiagen; 3 μM
MgCl
2
buffer and 400 μM of each dNTP) and 2 μL (10–50 ng) of DNA extract. The gene mt-
co1 was amplified using the primers FISH-F1 (50TCAACCAACCACAAAGACATTGGCAC 30)
and FISH-R1 (50TAGACTTCTGGGTGGCCAAAGAATCA 30) designed by Ward et al. [64],
with a PCR temperature protocol, as follows: initial denaturation at 95 ˚C for 15 min; 35 rep-
etitions of the cycle of 95 ˚C for 30 s, 49 ˚C, 52 ˚C, 54 ˚C for 20 s each, and 72 ˚C for 60 s;
with a final extension at 72 ˚C for 10 min. Whenever amplifications failed, a touchdown
annealing temperature protocol was used by 40 repetitions of the cycle of 94 ˚C for 30 s, 52
˚C for 20 s, 50 ˚C for 10 s, 48 ˚C for 10 s, 46 ˚C for 10 s, 44 ˚C for 20 s, and 72 ˚C for 60 s; and
final extension at 72 ˚C for 10 min. The gene mt-cyb was amplified using the primers Fish-
cytbF (5’ ACCACCGTTGTTATTCAACTACAAGAAC 3’) and CYTB_TrucCytb (50CCG
ACTTCCGGATTACAAGACCG 30) [65], with a touchdown PCR temperature protocol as fol-
lows: initial denaturation at 95 ˚C for 15 min; 35 repetitions of the cycle of 95 ˚C for 30 s, 58
˚C, 56 ˚C, 54 ˚C for 20 s each, and 72 ˚C for 90 s; with a final extension at 72 ˚C for 10 min.
Whenever amplifications failed, a second touchdown annealing temperature protocol was
used at 57 ˚C, 55 ˚C, 53 ˚C for 20 s each. To test PCR results, the amplicons were stained
with a mix of Blue Juice (diluted at 1:2 in Milli-Qwater) plus gel red (1 μL diluted to 1 mL of
the prepared Blue Juice mix), and then tested by horizontal gel electrophoresis on a 4% aga-
rose gel. Results of the amplicons were visualised and registered by photography with an
ultraviolet camera. The amplicons were purified and sequenced in both directions using two
distinct sequencing services: Macrogen Europe Inc. (Amsterdam, The Netherlands; for
NRM samples) and Functional Biosciences, Inc. (Madison, Wisconsin, USA; for South
American museum samples).
The obtained mt-coI sequences were aligned with all 600 bp or longer corresponding
sequences of Australoheros available from GenBank [66] and BOLD [67], for a total of 118
sequences. The obtained mt-cyb sequences were aligned with all corresponding 950 bp or lon-
ger sequences of Australoheros available from GenBank for a total of 136 sequences. The
sequences were aligned using Geneious [68] with the MAFFT plug-in [69], and ends were
manually trimmed to a total alignment length of 652 bp for mt-coI and 1144 bp for mt-cyb.
New nucleotide sequences were uploaded to GenBank; GenBank accession numbers and
voucher metadata for all new sequences are given in Table 1; for downloaded sequences in S1
Table in S1 File. Gene names and symbols follow the Zebrafish Information Network [70]
nomenclature conventions.
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 11 / 122
Table 1. New sequences of Australoheros and Cichlasoma generated, with GenBank accession numbers, collection identifiers, and collection site.
GB mt-
cyb
GB mt-coI Collection Cat.no. Tissue
no.
Species Country/
state
Municipality Locality Lat. Long. Basin
OK020110 MZ969503 NRM 52247 3321 A.scitulus U-AR Rinco
´n de
Pacheco
Rinco
´n de Pacheco,
1 km from estancia
buildings, cañada
tributary to Rı
´o
Cuareim
-30.67267 -56.18095 Cuareim
OK020102 MZ969505 NRM 54196 3911 A.minuano U-YCL Centurio
´n Stream crossing
Ruta 26 Melo-
Tacuarembo
´, about
km 389, tributary to
Rı
´o Negro
-32.33807 -54.63249 Negro
OK020096 MZ969506 NRM 52565 3927 A.facetus UY-AR Artigas Arroyo Catala
´n
Grande, tributary
to Rio Quaraı
´,
below bridge on
road 30
-30.84183 -56.23881 Cuareim
OK020097 MZ969507 NRM 52591 3950 A.facetus UY-CA El Pinar El Pinar, isolated
pool
-34.79812 -55.88403 Laguna del
Diario
OK020100 MZ969508 NRM 54147 3972 A.minuano UY-CL Centurio
´n Centurio
´n, Arroyo
Ceibal down from
bridge
-32.15172 -53.78197 Yaguaro
´n
OK020101 MZ969509 NRM 54147 3973 A.minuano UY-CL Centurio
´n Centurio
´n, Arroyo
Ceibal down from
bridge
-32.15172 -53.78197 Yaguaro
´n
OK020103 MZ969510 NRM 55067 4014 A.minuano UY-CL Chuy Small stream
crossing Ruta 26,
near Posta del Chuy
-32.41394 -53.87114 Tacuary
OK020104 MZ969511 NRM 55068 4015 A.minuano UY-CL Centurio
´n Centurio
´n, Arroyo
Ceibal down from
bridge
-32.15172 -53.78197 Yaguaro
´n
OK020105 MZ969513 NRM 55152 4079 A.minuano UY-CL Ramo
´n Trigo stream tributary to
Rio Negro crossing
Ruta 26 Melo–
Tacuarembo
´, at
about km 389
-32.33807 -54.63249 Negro
OK020098 MZ969514 NRM 55720 4514 A.facetus UY-MA Maldonado Laguna del Dia
´rio -34.90479 -55.00810 Laguna del
Diario
OK020111 MZ969515 NRM 55338 4858 A.scitulus UY-AR San Luis Arroyo Catala
´n
Grande, tributary
to Rio Quaraı
´,
below bridge on
road 30
-30.84183 -56.23881 Cuareim
OK020107 MZ969518 NRM 61526 8106 A.minuano UY-CL Centurio
´n Paso del Centurio
´n,
southern end of
small lake slightly
east of Rı
´o
Yaguaro
´n
-32.14265 -53.72955 Yaguaro
´n
OK020106 — NRM 61397 8123 A.minuano UY-CL Centurio
´n small stream
crossing Ruta 7 ca
15 km from Paso
del Centurio
´n
-32.18462 -53.90626 Yaguaro
´n
OK020133 — NRM 61491 8179 A.acaroides UY-RV Rocha Vela
´zquez -34.09770 -54.26470 Cebollatı
´
OK020094 MZ969519 NRM 61491 8180 A.acaroides UY-RV Rocha Vela
´zquez -34.09770 -54.26470 Cebollatı
´
OK020093 MZ969520 NRM 61427 8187 A.acaroides UY-RV7TT Rinco
´n de
Gutie
´rrez
Tributary to Arroyo
de las Averı
´as at
Estancia El Ytay
close to rroyo de las
Pavas
-33.24110 -54.84550 Olimar
(Continued)
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 12 / 122
Table 1. (Continued)
GB mt-
cyb
GB mt-coI Collection Cat.no. Tissue
no.
Species Country/
state
Municipality Locality Lat. Long. Basin
OK020099 — NRM 70180 12623 A.acaroides UY-TT Vergara Tributary to Arroyo
del Parao under
bridge, Ruta 18, W
of Vergara
-32.91998 53.92171 Olimar
OK020095 — NRM 70181 12786 A.acaroides UY-TT Vergara Tributary to Arroyo
del Parao under
bridge, Ruta 18, W
of Vergara
-32.91998 53.92171 Rio Olimar
Grande
OK020122 MZ969522 UFRGS 19072 CIC125 A.ipatinguensis BR-MG Pingo d’A
´qua Lagoa Juiz de Fora -19.69929 -42.48242 Doce
OK020121 MZ969523 UFRGS 19062 CIC126 A.ipatinguensis BR-MG Pingo d’A
´qua Lagoa Tiririca, left
margin
-19.74719 -42.44560 Doce
OK020120 MZ969525 UFRGS 18879 CIC128 A.ipatinguensis BR-RJ Silva Jardim Rampart on road
between Gaviões
and Japuı
´ba
-22.57583 -42.56083 São João
OK020131 MZ969526 UFRGS 19024 CIC130 A.ipatinguensis BR-ES Conceic¸ão da
Barra
co
´rrego on local
road to ES-416,
near border with
Bahia
-18.29639 -39.79444 Itau
´nas
OK020118 MZ969531 CZNC 1099 CIC162 A.ipatinguensis BR-ES Cristal do
Norte
Rio Itau
´nas NO
DATA
NO
DATA
Itau
´nas
OK020112 MZ969540 LBP 14581 CIC186 A.acaroides BR-RS Ju
´lio de
Castilhos
Stream without
name
-29.31878 -53.63311 Soturno
OK020128 MZ969543 LBP 2133 CIC189 A.ribeirae BR-SP Pedro de
Toledo
Rio do Peixe -24.27653 -47.22589 do Peixe
OK020119 MZ969550 MNRJ 47279 CIC283 A.ipatinguensis BR-RJ Macae
´Rio dos Quarenta at
BR-101 bridge,
about 500 m from
the interchange
with highway RJ107
-22.21833 -41.75889 Macae
´
OK020124 MZ969551 MNRJ 47247 CIC285 A.oblonga BR-RJ Cachoeiras
do Macacu
Rio Macacu, at
mouth of Rio
Branco, Japuı
´ba
-22.55528 -42.69472 Macacu
OK020125 MZ969561 MNRJ 47336 CIC295 A.oblongus MR-MG Mar de
Espanha
Dammed tributary
of Co
´rrego
Cachoeirinha, in
Fazenda Jardim
-21.92528 -42.97722 Paraı
´ba do
Sul
OK020132 MZ969562 MNRJ 47336 CIC296 A.oblongus MR-MG Mar de
Espanha
Dammed tributary
of Co
´rrego
Cachoeirinha, in
Fazenda Jardim
-21.92528 -42.97722 Paraı
´ba do
Sul
OK020126 MZ969567 MNRJ 47365 CIC301 A.oblongus MR-MG Juiz de Fora tributary of Rio do
Peixe, between
Toledo and
Torreões
-21.82361 -43.58806 do Peixe
OK020127 MZ969568 MNRJ 47365 CIC302 A.oblongus BR-MG Juiz de Fora Tributary of Rio do
Peixe, between
Toledo and
Torreões
-21.82361 -43.58806 do Peixe
OK020123 MZ969575 MCP 49295 CIC309 A.oblongus BR-MG Jaboticatubas Rio Cipo
´, tributary
of Rio das Velhas
-19.28250 -43.72972 São
Francisco
OK020114 MZ969578 MCP 49695 CIC311 A.acaroides BR-RS Bom Jesus Rio Manoel Leão
on road Silveira-
Rondinha
-28.63556 -50.07853 Pelotas
(Continued)
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 13 / 122
Table 1. (Continued)
GB mt-
cyb
GB mt-coI Collection Cat.no. Tissue
no.
Species Country/
state
Municipality Locality Lat. Long. Basin
OK020116 MZ969583 MCP 50424 CIC321 A.acaroides BR-RS Faxinal do
Soturno
Rio Soturno, bridge
close to road
between Nova
Roma and Faxinal
do Soturno
-29.53525 -53.48061 Soturno
OK020117 MZ969584 MCP 50425_F5 CIC322 A.acaroides BR-RS Ju
´lio de
Castilhos
Arroio Felicio, road
between Parque das
Esculturas and Ju
´lio
de Castilhos
-29.31844 -53.63272 Soturno
OK020130 MZ969585 MCP 50427_F9 CIC323 A.ricani BR-RS Espumoso Rio Morcego, local
road beteen
Espumoso and
Soledade
-28.89861 -52.81806 Jacuı
´
OK020115 MZ969587 MCP 5042_5_F6 CIC325 A.acaroides BR-RS Ju
´lio de
Castilhos
Arroio Felicio, road
between Parque das
Esculturas and Ju
´lio
de Castilhos
-29.31844 -53.63272 Jacuı
´
OK020129 MZ969588 MCP 50427_F10 CIC326 A.ricani BR-RS Espumoso Rio Morcego, local
road beteen
Espumoso and
Soledade
-28.89861 -52.81806 Jacuı
´
OK020113 MZ969594 MCP 48688 CIC34 A.acaroides BR-RS Bom Jesus Rio dos Touros on
road Rondinha-
Pascoal, next to
Usina Hidrele
´trica
Rio dos Touros
-28.64556 -50.28500 Pelotas
OK020108 MZ969603 MCP 40635_E6 E6 A.sanguineus BR-SC Joinville Rio Cubatão Norte
on road Quiriri de
Baixo
-26.14250 -48.99583 Cubatão
OK020109 MZ969604 MCP 40635_E7 E7 A.sanguineus BR-SC Joinville Rio Cubatão Norte
on road Quiriri de
Baixo
-26.14250 -48.99583 Cubatão
— MZ969502 NRM 36435 121 A.scitulus UY-CO Rosario Arroyo Rosario
drainage: Aroyo
Colla, 500 m
upstream mouth
into Arroyo
Rosario
-34.31861 -57.33694 Rı
´o de la
Plata
— MZ969504 NRM 52219 3322 A. sp. “Arapey” UY-SA Valentin 10 km from
Valentin, below
road 31 bridge,
small stream within
Rio Arapey
drainage
-31.27546 -57.15563 Arapey
— MZ969512 NRM 55104 4051 A.scitulus UY-TA Las Toscas Arroyo Caraguata
´
at Los Talas, under
bridge
-32.15788 -55.02453 Negro
— MZ969516 NRM 56420 4957 A.facetus UY-MA Maldonado Laguna del Dia
´rio -34.90479 -55.00810 Laguna del
Diario
— MZ969517 NRM 56421 4958 A.facetus UY-MA Maldonado Laguna del Dia
´rio -34.90479 -55.00810 Laguna del
Diario
— MZ969521 MCP 53174_C10 C10 A.acaroides BR-RS Bom Jesus Rio dos Touros,
below barrage on
road Rondinha São
Joaquim
-28.64583 -50.28556 Pelotas
(Continued)
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 14 / 122
Table 1. (Continued)
GB mt-
cyb
GB mt-coI Collection Cat.no. Tissue
no.
Species Country/
state
Municipality Locality Lat. Long. Basin
— MZ969524 UFRGS 19037 CIC127 A.ipatinguensis BR-ES Pedro
Cana
´rio
Co
´rrego do Engano
on road between
Pedro Cana
´rio and
Montanha
-18.20806 -40.04528 Itau
´nas
— MZ969527 UFRGS 18937 CIC131 A.ipatinguensis BR-ES Vargem Alta Rio Novo, on local
road to road
between Vargem
Alta and Iconha
-20.66000 -40.96528 Novo
— MZ969528 UFRGS 12591 CIC132 C.portalegrense BR-SC Meleiros Sanga do Engenho
on road between
Meleiro and
Forquilhinha
-28.78750 -49.54556 Ararangua
´
— MZ969529 UFRGS 19912 CIC160 A.acaroides BR-SC Sidero
´polis Rio Jordão,
upstream of
Cachoeira
Bianchini
-28.58658 -49.52350 Jordão
— MZ969530 CZNC 1027 CIC161 A.ipatinguensis BR-ES São Mateus Co
´rrego Canivete NO
DATA
NO
DATA
São Mateus
— MZ984107 MCP 48666 CIC169 A.acaroides BR-RS Sao Francisco
de Paula
Arroio Ribeirao on
road RS 453 (Rota
do sol), tributary of
Rio Tainhas
-29.23278 50.37472
— MZ969532 MCP 48666A CIC170 A.acaroides BR-RS São Francisco
de Paula
Arroio Ribeirão on
road RS 453 (Rota
do sol), tributary of
Rio Tainhas
-29.23278 -50.37472 Antas
— MZ969533 MCP 48666 CIC171 A.acaroides BR-RS São Francisco
de Paula
Arroio Ribeirão on
road RS 453 (Ruta
do sol), tributary of
Rio das Antas
-29.23278 -50.37472 Jacuı
´
— MZ969534 MCP 48666 CIC174 A.acaroides BR-RS São Francisco
de Paula
Arroio Ribeirão on
road RS 453 (Ruta
do sol), tributary of
Rio das Antas
-29.23278 -50.37472 Jacuı
´
— MZ969535 MCP 48688 CIC176 A.acaroides BR-RS Bom Jesus Rio dos Touros on
road Rondinha-
Pascoal, next to
Usina Hidrele
´trica
Rio dos Touros
-28.64556 -50.28500 Uruguay
— MZ984108 MCP 48666 CIC177 A.acaroides BR-RS Sao Francisco
de Paula
Arroio Ribeirao on
road RS 453 (Rota
do sol), tributary of
Rio Tainhas
-29.23278 50.37472
— MZ969536 MCP 48688 CIC178 A.acaroides BR-RS Bom Jesus Rio dos Touros on
road Rondinha-
Pascoal, next to
Usina Hidrele
´trica
Rio dos Touros
-28.64556 -50.28500 Uruguai
— MZ969537 MCP 49007 CIC179 A.oblongus BR-MG Jaboticatubas Stream on road
Jaboticatubas-
Cardeal Mota, Rio
Cipo
´drainage
-19.31917 -43.67944 São
Francisco
— MZ969538 MCP 49007 CIC180 A.oblongus BR-MG Jaboticatubas Stream on road
Jaboticatubas-
Cardeal Mota, Rio
Cipo
´drainage
-19.31917 -43.67944 São
Francisco
(Continued)
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 15 / 122
Table 1. (Continued)
GB mt-
cyb
GB mt-coI Collection Cat.no. Tissue
no.
Species Country/
state
Municipality Locality Lat. Long. Basin
— MZ969539 LBP 14564 CIC185 A.acaroides BR-RS Agudo Stream without
name
-29.60092 -53.28067 Jacuı
´
— MZ969541 LBP 14463 CIC187 A.acaroides BR-RS Caraa
´Stream without
name
-29.77614 -50.44281 dos Sinos
— MZ969542 LBP 14389 CIC188 A.oblongus BR-SP Ubatuba Rio Escuro -23.48440 -45.17042 Escuro
— MZ969544 LBP 1050 CIC198 A.sanguineus BR-SC Papanduva Tributary of Rio
São João
-26.36748 -50.11915 São João
— MZ969545 LBP 6527 CIC199 A.oblongus MG Jaboticatubas Tributary of Rio
Cipo
´
-19.46119 -43.72031 São
Francisco
— MZ969546 LBP 9105 CIC200 A.ipatinguensis BR-RJ Campos dos
Goytacazes
Lagoa do Brejo
Grande
-21.67333 -41.28306 Paraı
´ba do
Sul
— MZ969547 LBP 11171 CIC202 A.ipatinguensis BR-RJ Campos dos
Goytacazes
Lagoa Brejo Grande -21.67850 -41.28008 Paraı
´ba do
Sul
— MZ969548 NPM 5307 CIC274 A.ipatinguensis BR-RJ Macae
´Parque Nacional
Restinga de
Jurubatiba Lagoa
Cabiunas, Lagoa de
Jurubatiba
-22.30139 -41.69333 Cabiunas
— MZ969549 MNRJ 47279 CIC282 A.ipatinguensis BR-RJ Macae
´Rio dos Quarenta at
BR-101 bridge,
about 500 m from
the interchange
with highway RJ106
-22.21833 -41.75889 Macae
´
— MZ969552 MNRJ 47291 CIC286 A.ipatinguensis BR-RJ São Jose
´de
Uba
Co
´rrego São
Domingos at bridge
of RJ198, 200 m
from crossing with
BR393
-21.31556 -41.86611 Muriae
´
— MZ969553 MNRJ 47307 CIC287 A.ipatinguensis BR-RJ Itaperuna Bridge over
Co
´rrego São
Domingos, on road
in direction of
Fazenda São
Domingos
-21.26222 -41.79639 Muriae
´
— MZ969554 MNRJ 47307 CIC288 A.ipatinguensis BR-RJ Itaperuna Bridge over
Co
´rrego São
Domingos, on road
in direction of
Fazenda São
Domingos
-21.26222 -41.79639 Muriae
´
— MZ969555 MNRJ 47307 CIC289 A.ipatinguensis BR-RJ Itaperuna Bridge over
Co
´rrego São
Domingos, on road
in direction of
Fazenda São
Domingos
-21.26222 -41.79639 Muriae
´
— MZ969556 MNRJ 47346 CIC290 A.ipatinguensis BR-MG Santa Rita de
Jacutinga
Bridge in tributary
of Co
´rrego da
Lagoa, road Passa
Vinte-Santa Rita do
Jacutinga
-22.16722 -44.13000 Bananal
— MZ969557 MNRJ 47346 CIC291 A.oblongus BR-MG Santa Rita de
Jacutinga
Bridge in tributary
of Co
´rrego da
Lagoa, road Passa
Vinte-Santa Rita do
Jacutinga
-22.16722 -44.13000 Bananal
(Continued)
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 16 / 122
Table 1. (Continued)
GB mt-
cyb
GB mt-coI Collection Cat.no. Tissue
no.
Species Country/
state
Municipality Locality Lat. Long. Basin
— MZ969558 MNRJ 47346 CIC292 A.oblongus BR-MG Santa Rita de
Jacutinga
Bridge in tributary
of Co
´rrego da
Lagoa, road Passa
Vinte-Santa Rita do
Jacutinga
-22.16722 -44.13000 Bananal
— MZ969559 MNRJ 47346 CIC293 A.oblongus BR-MG Santa Rita de
Jacutinga
Bridge in tributary
of Co
´rrego da
Lagoa, road Passa
Vinte-Santa Rita do
Jacutinga
-22.16722 -44.13000 Bananal
— MZ969560 MNRJ 47346 CIC294 A.oblongus BR-MG Santa Rita de
Jacutinga
Bridge in tributary
of Co
´rrego da
Lagoa, road Passa
Vinte-Santa Rita do
Jacutinga
-22.16722 -44.13000 Bananal
— MZ969563 MNRJ 47336 CIC297 A.oblongus BR-MG Mar de
Espanha
Dammed tributary
of Co
´rrego
Cachoeirinha, in
Fazenda Jardim
-21.92528 -42.97722 Paraı
´ba do
Sul
— MZ969564 MNRJ 47336 CIC298 A.oblongus BR-MG Mar de
Espanha
Dammed tributary
of Co
´rrego
Cachoeirinha, in
Fazenda Jardim
-21.92528 -42.97722 Paraı
´ba do
Sul
— MZ969565 MNRJ 47336 CIC299 A.oblongus BR-MG Mar de
Espanha
Dammed tributary
of Co
´rrego
Cachoeirinha, in
Fazenda Jardim
-21.92528 -42.97722 Paraı
´ba do
Sul
— MZ969566 MNRJ 47365 CIC300 A.oblongus BR-MG Juiz de Fora tributary of Rio do
Peixe, between
Toledo and
Torreões
-21.82361 -43.58806 do Peixe
— MZ969569 MNRJ 47367 CIC303 A.oblongus BR-RJ Sapucaia Co
´rrego Santa Rita
in Santa Rita
-22.03417 -42.79667 Paquequer
— MZ969570 MNRJ 47367 CIC304 A.oblongus BR-RJ Sapucaia Co
´rrego Santa Rita
in Santa Rita
-22.03417 -42.79667 Paquequer
— MZ969571 MNRJ 47367 CIC305 A.oblongus BR-RJ Sapucaia Co
´rrego Santa Rita
in Santa Rita
-22.03417 -42.79667 Paquequer
— MZ969572 MNRJ 47367 CIC306 A.oblongus BR-RJ Sapucaia Co
´rrego Santa Rita
in Santa Rita
-22.03417 -42.79667 Paquequer
— MZ969573 MNRJ 47367 CIC307 A.oblongus BR-RJ Sapucaia Co
´rrego Santa Rita
in Santa Rita
-22.03417 -42.79667 Paquequer
— MZ969574 MCP 48652 CIC308 C.portalegrense BR-RS Maquine
´Arroio Carvão -29.53806 -50.24558 Tramandaı
´
— MZ969576 MCP 21272 CIC31 A.acaroides BR-RS Ibarama Stream tributary of
Arroio Caidinho
-29.37722 -53.09889 Jacuı
´
— MZ969577 MCP 49694 CIC310 A.acaroides BR-RS Bom Jesus Stream tributary of
Rio dos Touros ca 4
km NE of BR 285
(secundary road)
-28.68500 -50.21417 Pelotas
— MZ969579 MCP 49984 CIC312 A.acaroides BR-RS Bom Jesus Rio Manoel Leão
on roadSilveira-
Rondinha
-28.63556 -50.07853 Pelotas
— MZ969580 MCP 48993 CIC313 A.acaroides BR-RS Bom Jesus Rio dos Touros on
road Rondinha-
Pascoal, next to
Usina Hidrele
´trica
Rio dos Touros
-28.64556 -50.28500 Pelotas
(Continued)
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 17 / 122
Table 1. (Continued)
GB mt-
cyb
GB mt-coI Collection Cat.no. Tissue
no.
Species Country/
state
Municipality Locality Lat. Long. Basin
— MZ969581 MCP 50385 CIC318 A.acaroides BR-SC Timbe
´do Sul Rio Amola Faca,
tributary of Rio
Itoupava
-28.83986 -49.80000 Ararangua
´
— MZ969582 MCP 42383 CIC32 A.oblongus BR-MG Taquaruc¸u de
Minas
Small stream on
road between
Taquaruc¸u de
Minas and
Jabuticabas
-19.64000 -43.69806 São
Francisco
— MZ969586 MCP 50385_E1 CIC324 A.acaroides BR-SC Timbe
´do Sul Rio Amola Faca,
tributary of Rio
Itoupava
-28.83972 -49.80000 Ararangua
´
— MZ969589 MCP 51163_A CIC327 A.acaroides BR-RS CotiporãRio das Antas on
road Faria Lemos-
Cotiporãbelow
Arroio Pedrinho
-29.08922 -51.63864 Antas
— MZ969590 MCP 51163_B CIC328 A.acaroides BR-RS CotiporãRio das Antas on
road Faria Lemos-
Cotiporãbelow
Arroio Pedrinho
-29.08922 -51.63864 Antas
— MZ969591 MCP 51163_4 CIC329 A.acaroides BR-RS CotiporãRio das Antas on
road Faria Lemos-
Cotiporãbelow
Arroio Pedrinho
-29.08922 -51.63864 Antas
— MZ969592 MCP 48464 CIC33 A.acaroides BR-RS Jaquirana Parque Estadual
Tainhas
-29.08478 -50.36603 Tainhas
— MZ969593 MCP 51293_
(36)
CIC330 A.angiru BR-SC ArabutãRio Jacutinga at
camping
MEC-SETTE near
Arabutã(right
margin)
-27.16122 -52.14833 Uruguay
— MZ969595 MCP 48671 CIC35 A.acaroides BR-RS Bom Jesus Rio das Antas at
mouth of Arroio
Moraes on road to
Bom Jesus
-28.79833 -50.42889 Antas
— MZ969596 MCP 48687 CIC36 A.acaroides BR-RS Bom Jesus Rio das Antas at
mouth of Rio
Camisas on road
Jaquirana-São Jose
´
dos Ausentes
-28.84167 -50.30000 Antas
— MZ969597 MCP 48666 CIC37 A.acaroides BR-RS São Francisco
de Paula
Arroio Ribeirão on
road RS 453 (Ruta
do sol), tributary of
Rio das Antas
-29.23278 -50.37472 Jacuı
´
— MZ969598 UNV 1261 CIC85 A.ipatinguensis BR-MG Pingo d’A
´qua Lagoa Cristal,
Pingo d’A
´gua
-19.61736 -42.79599 Doce
— MZ969599 UNV 1306 CIC86 A.ipatinguensis BR-MG Pingo d’A
´qua Lagoa Cristal,
Pingo d’A
´gua
-19.61736 -42.79599 Doce
— MZ969600 UNV 1312 CIC87 A.ipatinguensis BR-MG Pingo d’A
´qua Lagoa Cristal,
Pingo d’A
´gua
-19.61736 -42.79599 Doce
— MZ969601 DZSJR 1306 CIC93 A.ipatinguensis BR-MG Pingo d’A
´qua Pingo d’A
´qua -19.72786 -42.40840 Doce
— MZ969602 MCP 53174_D1 D1 A.acaroides BR-RS Bom Jesus Rio dos Touros,
below barrage on
road Rondinha São
Joaquim
-28.64583 -50.28556 Pelotas
https://doi.org/10.1371/journal.pone.0261027.t001
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 18 / 122
Species delimitation methods
Species delimitation was tested with two methods. Geneious with the plug-in Species Delimita-
tion [71] was used to obtain uncorrected pairwise genetic distances (p-distances), as recom-
mended by Srivatsan and Meier [72]; Bayesian Poisson Tree Processes (bPTP) [73] was run via
the bPTP web server (https://species.h-its.org/ptp/). MrBayes ‘-allcompat’ option was used to
create fully resolved trees for analysis with bPTP.
Phylogeny reconstruction
Phylogenetic analysis was performed with the parallel-computing version of MrBayes v3.3 [74,
75]. Cichlasoma portalegrense (Hensel, 1870) was designated outgroup in the mt-coI analyses;
Amphilophus citrinellus (Gu¨nther, 1864) and Neetroplus nematopus Gu¨nther, 1867 in the mt-
cyb analyses. Data was partitioned according to codon position (first, second, third) and
parameters estimated separately for each partition. The GTR + Γ+ I model was used as sug-
gested by ModelTest2 [76]. Samples were taken every 1000 generations, and the first 25% of
samples were discarded as ‘burn-in,. The analysis was run for ten million generations. Conver-
gence was confirmed with MrBayes and Tracer v1.6 [77].
Map and toponomy
Geographic coordinates for our own collecting sites were recorded in decimal degrees (DD),
but were converted to degrees minutes seconds (DMS) for presentation in material lists. Coor-
dinates from other collectors may have been in DD or DMS, or even decimal minutes (DM),
and were converted for uniform presentation. The distribution maps were constructed with
DD coordinates in QGis (https://qgis.org/) using free shape and raster files available from
databases of ANA (Agência Nacional de A
´guas, Brazil: http://www.snirh.gov.br/hidroweb).
Some rivers are shared between Brazil and Argentina, or Brazil and Uruguay. We use the
standard English names for basins and countries (Argentina, Paraguay, Uruguay, Parana
´), but
local names for shared rivers based on collecting site. The Rio Iguac¸u is known as Iguazu
´in
Argentina and Paraguay. Brazil has a political subdivision in regions and states. The regions
and states concerned here are the Sul (Rio Grande do Sul, Santa Catarina, Parana
´) Sudeste
(São Paulo, Espı
´rito Santo, Minas Gerais, Rio de Janeiro), and Nordeste (Bahia and other
states). Ottoni and collaborators, e.g. Ottoni and Costa 2008 [6] consistently refer to southeast-
ern Brazil in the sense of the Sudeste region. For that region, we use the name Sudeste to
emphasise that it is an administrative unit. To simplify reference to two major geographical
groups of species of Australoheros, we distinguish between the southern group (Sul region),
and the northern group (Sudeste and Nordeste regions).
Results
Distinguishing characters of Australoheros
All species of Australoheros shared the following plesiomorphic character states at supragene-
ric levels: pelvic-fin rays I.5 (Acanthopterygii), circumpeduncular scales 16 (7 above and below
lateral lines; most Cichlasomatinae and many other Cichlidae), principal caudal-fin rays 16
(Cichlidae, with rare exceptions); presence of six dark vertical bars on side (Bars 1a–6), stripes
or blotches on the head and anterior side homologous with bars 7–9, and dark blotch on the
caudal-fin base (Bar 1p) (Cichlasomatinae) [41,58].
The morphological parsimony analysis by Kullander (1998 [41] recovered Australoheros (as
‘Cichlasoma facetum’ (actually based on specimens of both A.acaroides and A.facetus) in a
clade of other South American heroine genera, but did not yield autapomorphies for the
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 19 / 122
genus. Synapomorphies included the long and co-ossified hypurapophyses; the uncinate pro-
cess of the first epibranchial wider than the anterior arm; and the lachrymal bone extensively
overlapping the next infraorbital bone; none of those character states are unique for the genus.
R
ˇı
´čan and Kullander [3] characterised Australoheros as distinct from other heroin cichlids by
lower number of scales (modally less than 25 scales in the E1 row); lower vertebral count (13
+13 or 13+14); chest scales nearly as large as flank scales, and two autapomorphies: (1) juve-
niles with unique xanthophore patch dorsally and ventrally on the caudal-fin base and (2) a
unique breeding colour element: abdominal vertical bars (Bars 5 and 6) interrupted by a light
horizontal area along the upper side. The latter colour characteristic is also expressed in non-
breeding individuals. To those characteristics we add here the short skin projections from the
genital papilla in mature males, a unique character among Neotropical cichlids. Tasseled male
genital papilla was described by Trewavas [78] from some species of the African cichlid genus
Oreochromis Gu¨nther, 1862.
Nomenclature
The oldest name for a species in the genus Australoheros is Chromis facetus Jenyns, 1840.
There is a recorded single preserved specimen representing the material used by Jenyns for the
description of C.facetus in the collections of the Museum of Zoology, University of Cam-
bridge, UMZC No F.6640. We were not successful in obtaining a photograph or X-radiograph
of that specimen. Nevertheless, with precise provenance, it is uncontested as the holotype of A.
facetus, which is the type species of Australoheros, fixed by R
ˇı
´čan and Kullander [3].
Ottoni et al. [47] suggested conditional synonymisation among species of Australoheros
described by Ottoni and collaborators [5,6,8–10] from the Sudeste region. One analysis recog-
nised A.autrani,A.barbosae,A.muriae, and A.robustus as valid species incorporating nomi-
nal species A.robustus,A.mattosi,A.muriae,A.paraibae, and A.saquarema. This clade is
specified in their phylogram, fig. 2, which shows clades formed by A.tavaresi,A.paraibae, and
A.barbosae;A.mattosi, and A.robustus; and A.saquarema and A.autrani. A second analysis
recognised A.autrani,A.barbosae,A.ipatinguensis, and A.robustus as valid species incorpo-
rating nominal species A.mattosi,A.muriae,A.perdi,A.paraibae,A.saquarema, and A.
tavaresi. The analysis illustrated with a bPTP tree (their fig. 3), in which A.paraibae and A.
tavaresi are nested with A.barbosae;A.ipatinguensis, with A.perdi;A.saquarema with A.
autrani; and A.robustus with A.mattosi. There is no explicit statement concerning relative pri-
ority, and for both analyses, the selected species name for each analysis is explained with
respect to ‘following chronological priority for zoological names. . . hereafter called A.autrani,
A.barbosae, and A.robustus [first analysis]/A.autrani,A.ipatinguensis, and A.robustus’[se-
cond analysis].
Among recently described nominal species of Australoheros from the Sudeste, the species
described by Ottoni and Costa in 2008 [6] and Ottoni in 2010 [8] have priority over any later
described species, and the option of first reviser action on precedence among simultaneous
synonyms is restricted to the 2008 and [6] 2012 [9] names. Because Ottoni et al. [47] (a) pro-
vided two scenarios for possible fixation of precedence of names, and used the expression
‘hereafter called . . .’ and (b) on p. 57 proposed a hybrid delimitation (‘congruence of these spe-
cies delimitation methods (bPTP, WP, CBB. . .’), there is ambiguity in what taxa they were
considering. To overcome this ambiguity, we select here A.paraibae to have priority over A.
barbosae whenever the two are considered to be the same species; A.autrani to have priority
over A.saquarema whenever the two are considered to be the same species; A.ipatinguensis to
have priority over A.autrani whenever the two are considered to be the same species; A.ipa-
tinguensis to have priority over A.muriae whenever the two are considered to be the same
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 20 / 122
species; A.tavaresi to have priority over A.montanus whenever the two are considered to be
the same species; and A.montanus to have priority over A.mattosi whenever the two are con-
sidered to be the same species. Our analysis confirmed only three species for the Sudeste
region, of which one represents A.oblongus. The other species are A.ipatinguensis and A.
ribeirae.
Species diversity
Based on the morphological and genetic analysis reported below, we recognise 18 valid, for-
mally named species in Australoheros, nine of which pertain to coastal rivers (A.acaroides,A.
facetus,A.ipatinguensis,A.minuano,A.oblongus,A.ribeirae,A.sanguineus,and two species
formally named herein). The remaining nine species, presented in S2 File are entirely or pri-
marily restricted to the middle and upper Rio Uruguay and tributaries of the lower Rio Parana
´.
Author and suggested synonymy are listed in Table 2. In addition, we recognise distinctive
units that may represent distinct species, but for which supporting evidence was insufficient.
Those include A. sp. “Jacuı
´”, already distinguished as A. sp. jacui by R
ˇı
´čan and Kullander [3]
and as A. sp. “Jacui” by R
ˇı
´čan and Kullander [4]; a genetically distinct sample of A.minuano or
A.facetus, here referred to as Australoheros. “Arapey”; and samples probably representing A.
sanguineus, but then only based on the distribution records, and referred to as Australoheros
sp. cf. sanguineus.
Meristics
Meristic frequency data for most of the species of Australoheros are presented in Tables 3–9.
The modal number of vertebrae was 13+13, and a modal total of 26 in most species
(Table 3). Higher numbers prevailed in A.scitulus,A.tembe,A.ykeregua,A.charrua, and A.
forquilha, typically with 14 or 15 caudal vertebrae. Only one observation was made on A.
mboapari. Vertebral data were not available for A.ribeirae.
The number of scales along the middle of the side (E1 row scales) (Table 4) was relatively
constant, with a common modal number of 24 scales, some species with a short range; but
only A.mboapari standing out with 25–27 scales. The lowest numbers were obtained from
very small specimens, and may reflect a systematic error. Australoheros scitulus,A.tembe,A.
ricani, and A.forquilha had more than 24 E1 scales. Most of the specimens of A. sp “Jacuı
´” had
24 E1 scales, contrasting with 25–26 in the sympatric A.ricani specimens. Low numbers in A.
ipatinguensis distinguished it from A.oblongus (Mann-Whitney U test, p = 0.001), but in speci-
mens over 40 mm SL, the difference was reduced (p = 0.051).
The number of lateral line scales was were generally between 16 and 20 (average 17) in the
upper lateral line and 6–10 (average 8) in the lower lateral line (Table 5).
The number of dorsal-fin rays (Table 6) were modally XVI.10. Australoheros sp. “Jacuı
´” was
exceptional in having modally XV.10, and only four out of 18 specimens with 16 spines. In A.
ipatinguensis 39% of the specimens had XV.10, making for an almost bimodal distribution in
A.ipatinguensis, with XVI.10 the most frequent number, shared with A.oblongus A.tembe,A.
sanguineus,A.minuano,A.mboapari,A.guarani, and A.facetus. In A.acaroides, XVI.9 and
XVI.10 were almost equally frequent. Although with distinct modal of XV.10, A.ipatinguensis
and A.oblongus showed very wide variation in scattered counts. Several species had 17 dorsal-
fin spines but the count was frequent only in A.oblongus and A.scitulus, the latter with mod-
ally XVII.9, representing the greatest number of dorsal-fin rays for the genus.
The number of anal-fin rays (Table 7) showed mainly within-species variation. Well-repre-
sented species had modals VII.8 (A.acaroides and A.ipatinguensis). Only four species are rep-
resented by specimens with 5 anal-fin spines, the remainder typically 6–7. Australoheros sp.
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 21 / 122
Jacuı
´” was outstanding with a high frequency of 5 anal-fin spines, whereas 5 spines was an
exceptional number in A.facetus and A.ykeregua.Australoheros mboapari and A.tembe had
exclusively or modally 6 anal-fin spines (one specimen of A.tembe with 7). Eight anal-fin
spines were relatively frequent in A.oblongus,ipatinguensis,A.ribeirae, and A.sanguineus,
and prevalent in A.scitulus, which was the only species in the genus with frequently 9 anal-fin
spines. Australoheros ipatinguensis and A.oblongus had the same mode (7) but different fre-
quencies of anal-fin spines (predominantly 6–7, and 7–8, respectively).
The number of pectoral-fin rays (Table 8) showed a clear mode of 13 in all species.
Table 2. Nominal species of Australoheros in order of description, and recommended synonymy.
Current name Original name Author Year of description Current combination
Australoheros facetus Chromis facetus Jenyns 1842 Australoheros facetus
Australoheros facetus Chromys oblonga Castelnau 1855 Australoheros oblongus
Australoheros facetus Heros autochthon Gu¨ nther 1862 Australoheros oblongus
Australoheros facetus Heros Jenynsii Steindachner 1869 Australoheros facetus
Australoheros facetus Heros acaroides Hensel 1870 Australoheros acaroides
Australoheros tembe ’Cichlasoma’ tembe Casciotta, Go
´mez & Toresani 1995 Australoheros tembe
Australoheros scitulus ’Cichlasoma’ scitulum R
ˇı
´čan & Kullander 2003 Australoheros scitulus
Australoheros kaaygua Australoheros kaaygua Casciotta, Almiro
´n & Go
´mez 2006 Australoheros kaaygua
Australoheros forquilha Australoheros forquilha R
ˇı
´čan & Kullander 2008 Australoheros forquilha
Australoheros charrua Australoheros charrua R
ˇı
´čan & Kullander 2008 Australoheros charrua
Australoheros minuano Australoheros minuano R
ˇı
´čan & Kullander 2008 Australoheros minuano
Australoheros guarani Australoheros guarani R
ˇı
´čan & Kullander 2008 Australoheros guarani
Australoheros ribeirae Australoheros ribeirae Ottoni, Oyakawa & Costa 2008 Australoheros ribeirae
Australoheros autrani Australoheros autrani Ottoni & Costa 2008 Australoheros
ipatinguensis
Australoheros barbosae Australoheros barbosae Ottoni & Costa 2008 Australoheros oblongus
Australoheros
ipatinguensis
Australoheros
ipatinguensis
Ottoni & Costa 2008 Australoheros
ipatinguensis
Australoheros macacuensis Australoheros macacuensis Ottoni & Costa 2008 Australoheros oblongus
Australoheros macaensis Australoheros macaensis Ottoni & Costa 2008 Australoheros
ipatinguensis
Australoheros muriae Australoheros muriae Ottoni & Costa 2008 Australoheros
ipatinguensis
Australoheros paraibae Australoheros paraibae Ottoni & Costa 2008 Australoheros oblongus
Australoheros robustus Australoheros robustus Ottoni & Costa 2008 Australoheros oblongus
Australoheros saquarema Australoheros saquarema Ottoni & Costa 2008 Australoheros
ipatinguensis
Australoheros capixaba Australoheros taura Ottoni & Cheffe 2009 Australoheros acaroides
Australoheros capixaba Australoheros acaroides Ottoni 2010 Australoheros
ipatinguensis
Australoheros perdi Australoheros perdi Ottoni, Lezama, Triques, Fragoso-Moura, Lucas &
Barbosa
2011 Australoheros
ipatinguensis
Australoheros ykeregua Australoheros ykeregua R
ˇı
´čan, Pia
´lek, Almiro
´n & Casciotta 2011 Australoheros ykeregua
Australoheros angiru Australoheros angiru R
ˇı
´čan, Pia
´lek, Almiro
´n & Casciotta 2011 Australoheros angiru
Australoheros mattosi Australoheros mattosi Ottoni 2012 Australoheros oblongus
Australoheros montanus Australoheros montanus Ottoni 2012 Australoheros oblongus
Australoheros tavaresi Australoheros tavaresi Ottoni 2012 Australoheros oblongus
Australoheros sanguineus Australoheros sanguineus Ottoni 2013 Australoheros sanguineus
Australoheros ricani — Present paper 2022 Australoheros ricani
Australoheros mboapari — Present paper 2022 Australoheros mboapari
https://doi.org/10.1371/journal.pone.0261027.t002
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 22 / 122
Table 3. Number of vertebrae in species of Australoheros.
Vertebrae 12+13 12+14 12+15 13+12 13+13 13+14 13+15 14+12 14+13 14+14
A.acaroides 120 4
A.angiru 221 1
Heros autochthon (ST) 3
A.minuano (Uruguay) 2 1 1 65
A.acaroides (Pinares) 45 2
A.charrua 1 1 3 1
A.facetus 23 6
A.forquilha 42
A.guarani 6
A.ipatinguensis 319
A.kaaygua 1
A.mboapari 1
A.minuano (Brazil) 1 1 8
A.oblongus (HT) 1
A.oblongus 2 2 28 2
A. sp. “Jacuı
´” 2 16
A.sanguineus 25
Modal frequencies marked in bold for samples with N>5. HT = Holotype; ST = Syntypes.
https://doi.org/10.1371/journal.pone.0261027.t003
Table 4. Number of scales along the middle of the side (E1 row scales) in species of Australoheros.
23 24 25 26 27 Total
A.facetus (Portugal) 1 8 9
A.acaroides 374 41 122
A.angiru 113 4 18
Heros.autochthon 33
A.minuano (Uruguay) 1 10 12 1 24
A.“Arapey”21 3
A. cf. sanguineus 44
A.acaroides (Pinares) 1 24 16 1 42
A.charrua 62 8
A.facetus 31 15 1 47
A.forquilha 99
A.guarani 88
A.ipatinguensis 21 42 64
A.kaaygua 1 1 1 3
A.mboapari 717 4 28
A.minuano (Brazil) 41 5
A.oblongus 11
A.oblongus 10 69 2 81
A.ribeirae 235
A. sp. “Jacuı
´”10 3
A.ricani 76 13
A.sanguineus 216 1 19
A.scitulus 628 3 37
A.tembe 66
Modal frequencies marked in bold for samples with N>5. HT = Holotype; ST = Syntypes.
https://doi.org/10.1371/journal.pone.0261027.t004
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 23 / 122
Gill raker counts (Table 9) showed little variation, predominantly 6 or 7. R
ˇı
´čan and Kullan-
der [4] considered variation in gill-raker numbers as useful for delimiting species, but the con-
siderable overlap in our data did not meet that expectation.
Counts of predorsal scales, teeth and rows of scales on the cheek are presented in the spe-
cies accounts only, as no comparative statistics was attempted for those. The count of predor-
sal scales had limited reproducibility; the scales were slightly irregularly arranged and usually
it would have been necessary to remove the skin to expose the scales properly, and this was
not done. In many specimens the cheek scales were exposed and easy to count, but often the
scales were covered beneath a thin skin layer, and defied confirmation of a correct count.
Large specimens had more rows of cheek scales than small specimens, but no reliable data is
available for analysis as we deemed it more valuable to leave the skin layer intact than to sacri-
fice it for scale counts. No variation species specific condition was found in the count of teeth;
the number varied with specimen size, and in specimens with jaws well fixed, it was difficult
or not recommended to open the mouth with force to observe the teeth. All specimens exam-
ined had 16 circumpeduncular scales.
Morphometrics
Distance measurements are reported for each species in Tables 10–19. Linear regression on
standard length was established for all measurements with sample N>5). Biplots of each
Table 5. Number of lateral line scale in species of Australoheros.
upper 12 13 14 15 16 17 18 19 20
lower 8 8 9 7 8 9 10 6 7 8 9 10 5 6 7 8 9 10 12 5 6 7 8 9 10 6 7 8 9 10 11 7 8 9 10 13 9 10
A.acaroides 1 2 1 2 4 8 3 1 3 7 14 6 1 4 18 18 5 4 5 1
A.acaroides (Pinares) 2 1 1 2 5 3 1 2 6 7 1 1 4 3 2 1
A.angiru 1 1 1 2 1 3
A. cf. sanguineus 1 3
A.charrua 3 2 1 1 1
A.facetus 1 1 1 1 3 8 2 2 6 6 4 5 1 1 1 1 1 1
A.facetus (Portugal) 3 1 2 2 1
A.forquilha 1 1 3 1 1 1 1
A.guarani 1 1 1 3 1
A.ipatinguensis 1 1 1 1 1 8 10 3 1 1 1 4 5 1 4 2
A.kaaygua 1 1 1
A.mboapari 1 2 2 1 5 6 1 3 4 1
A.minuano (Brazil) 1 2 1 1
A.minuano
(Uruguay)
1 1 1 2 5 4 1 1 1 1 1 1 3 1
A.oblongus 1 2 3 11 15 4 1 3 14 9 1 1 7 2 1 1
A.oblongus HT
A.ribeirae 1 2 1
A.ricani 1 1 3 4 1 2 4 1
A.sanguineus 1 1 1 2 1 2 1 3 1 1 2 1
A.scitulus 1 2 2 1 1 1 3 7 4 2 2 5 3 1 1
A. sp. "Jacuı
´" 2 1 1 1 1 3 2 1
A.tembe 1 2 1 1
H.autochthon ST 1 1 1
Modal frequencies marked in bold for samples with N>5. HT = Holotype; ST = Syntypes.
https://doi.org/10.1371/journal.pone.0261027.t005
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 24 / 122
measurement against standard length did not show any variation suggesting different species.
In general, the biplot scatters showed more variation among larger specimens than smaller
specimens, suggesting that larger specimens had been more exposed to factors affecting body
shape over time, or that there was a shift in relative allometry in larger specimens, e.g. reduced
growth along the long axis.
Tables 10–19 show proportional measurements without adjustment for allometry. Limiting
the size range to the shared size range 40.2–84.2 mm SL–with A.ribeirae excluded on account
of too limited size range and A. sp. “Jacuı
´” out of range–showed considerable overlap, but also
tentative differences between the species S3 File.Australoheros mboapari had a smaller orbit
and tended to shorter head than the other species, but also A.ricani had a small orbit; A.ricani
and A.mbapoari both had deeper preorbital than the other species, but overlapping each
other; A.mbapoari and A.minuano tended to shorter lower jaw than the other species.
Box plots S4 File were influenced by actual size range and sample size for a species. Austra-
loheros oblongus and A.ipatinguensis showed identity or complete overlap for all characters;
comparison of Tables 11 and 15 shows that values were the same or very close.
Proportional measurements apparently had some resolving power only for the species that
also were confidently identified by other characters.
Table 6. Number of dorsal-fin rays in species of Australoheros.
Spines XIV XIV XIV XV XV XV XV XV XV XVI XVI XVI XVI XVI XVII XVII XVII XVII XVII XVII
Soft rays 9 11 12 8 9 10 11 12 13 5 7 8 9 10 11 7 8 9 10 11
A. "Arapey" 1 1 1
A.acaroides 1 4 12 3 1 3 42 45 4 4 9 3
A.acaroides (Pinares) 2 1 16 17 2 1 9 2
A.angiru 1 1 1 20 9 1 1
A.cf.sanguineus 1 1 1 1
A.charrua 1 3 1 2
A.facetus 1 1 1 2 5 36 4 1
A.facetus (Portugal) 3 2 3 1
A.forquilha 1 3 6
A.guarani 1 5 2
A.ipatinguensis 1 1 4 18 7 1 2 7 28 2
A.kaaygua 1 1 1
A.mboapari 312 9 2 2
A.minuano (Brazil) 2 1 6 1
A.minuano (Uruguay) 1 1 3 3 1 13 2
A.oblongus 1 5 1 1 2 25 39 8 1 9 15 2
A.oblongus HT 1
A.ribeirae 1 1 1 1 1
A.ricani 1 3 4 4 1
A.sanguineus 4 2 1 2 4 6
A.scitulus 4 2 1 6 32 4
A. sp. “Jacuı
´” 1 2 14 1 1
A.tembe 15
A.ykeregua 1 2 1 1 75 1
H.autochthon ST 1 2
Modal frequencies marked in bold for samples with N>5. HT = Holotype; ST = Syntypes.
https://doi.org/10.1371/journal.pone.0261027.t006
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 25 / 122
The subset of specimens from the Sudeste assigned to nominal species based on locality
and/or type status had some limitations as some samples were small (<6 specimens). The
remaining samples showed variation in medians, but also wide standard length ranges. Adjust-
ing the data set to samples with more than five specimens, and a shared SL range length from
33 to 86 mm, only three samples remained, representing the nominal species A.capixaba,A.
mattosi, and A.tavaresi, which all overlapped on all measurements, except that the A.capixaba
sample was marginal with a range and discrete median for the length of the last dorsal-fin
spine at 21–22% (Fig 3). This may support the recognition of two species in the Sudeste region,
as A.capixaba falls under A.ipatinguensis whereas A.mattosi and A.tavaresi fall under A.
oblongus but it could also be an artefact due to the small size of the A.capixaba specimens.
The Principal Component Analysis of distance measurements in all coastal species (Fig 4)
suggested limited differentiation, with three well represented species (A.facetus,A.acaroides,
and A.ipatinguensis) covering a large part of the total variation. Components 2 and 3
explained up to 98.3% of the variance and had high loadings on preorbital depth, pectoral-fin
length, caudal-peduncle length, pelvic-fin length, and length of last dorsal-fin spine.
Pelvic-fin length was expected to be sexually dimorphic, with longer pelvic fin in males.
Only samples of A.acaroides (38 females, 53 males), A.facetus (18 females, 24 males), A.ipa-
tinguensis (21 females, 17 males) and, A.oblongus (23 females, 49 males) have good
Table 7. Number of anal-fin rays in species of Australoheros.
Spines V V V V V VI VI VI VI VI VII VII VII VII VII VIII VIII VIII VIII IX IX IX
Soft rays 6 7 8 9 10 6 7 8 9 10 6 7 8 9 10 6 7 8 9 6 7 8
A. “Arapey” 1 1
A.acaroides 1 1 15 14 2 1 20 58 9 4 5 1
A.acaroides (Pinares) 3 3 12 22 2 2 2 3 1
A.angiru 2 4 12 14 1
A. cf. sanguineus 1 1 2
A.charrua 3 5
A.facetus 2 3 11 6 4
A.facetus (Portugal) 1 3 5
A.forquilha 6 2 2
A.guarani 6 1 1
A.ipatinguensis 1 1 4 14 1 1 12 25 4 1 4 2
A.kaaygua 1 1 1
A.mboapari 2 1 1 2 18 3 1
A.minuano (Brazil) 2 3 1 1
A.minuano (Uruguay) 6 17 1
A.oblongus 1 1 3 1 14 45 10 3 18 9 3
A.oblongus HT 1
A.ribeirae 1 3 1
A.ricani 3 1 54
A.sanguineus 594
A.scitulus 14 10 1 6 18 1
A. sp. “Jacuı
´” 4 9 1 3
A.tembe 5 1
A.ykeregua 1 7 8
H.autochthon ST 2 1
Modal frequencies marked in bold for samples with N>5. HT = Holotype; ST = Syntypes.
https://doi.org/10.1371/journal.pone.0261027.t007
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 26 / 122
representation of both sexes. There were no obvious sex differences in relative pelvic-fin length
in A.facetus,A.minuano,A.ricani,A.mboapari,A. sp. “Jacuı
´”, or A.oblongus (ANOVA,
p>0.05). In A.acaroides there was significant effect of sex on the relative length of the pelvic
fin (ANOVA, p = 0, F = 15.991). In each species, except A.oblongus, the largest females and
males were similar in size. In A.oblongus the largest male was 113.0 mm SL, and the largest
female 81.4 mm SL. The pelvic fin was often incomplete, with broken tip or individual rays,
complicating interpretation of this measurement, but being paired, opposite side fins could
substitute for each other if one was damaged. The caudal peduncle-length was a very short
measurement which showed considerable variation over a span from 1.7 to 13.2 mm. For both
SL and caudal-peduncle length measurements it was difficult to properly align the base of the
caudal fin/posterior end of the caudal peduncle because the region was covered with dark pig-
mentation. For standard length, slightly bending the caudal fin exposed the crease marking the
root of the caudal fin/posterior point of the standard length measurement. A minor error in
the measurement of the standard length should not affect the measurement precision signifi-
cantly. A small miss on the caudal peduncle length, however, would be significant on this short
measurement. The length of the caudal peduncle may be better evaluated by counting the con-
tained vertebrae on X-radiographs. Further PCAs were made without the pelvic-fin and cau-
dal-peduncle lengths. The pectoral fin was also frequently damaged, but not to the extent of
the pelvic fin. Most of the well-preserved specimens in this study dated to the last century,
whereas recently collected specimens typically had damaged fins and twisted body. The last
dorsal-fin spine was often broken near the apex and the location of the base required locating
Table 8. Number of pectoral-fin rays in species of Australoheros.
11 12 13 14 15
A.facetus (Portugal) 1 2 6
A.acaroides 21 84 6
A.angiru 5 5
Heros autochthon ST 1 3
A.minuano (Uruguay) 3 21
A. “Arapey” 3
A. cf. sanguineus 22
A.acaroides (Pinares) 6 33 3
A.charrua 1 7
A.facetus 318 15 11
A.forquilha 63
A.guarani 17
A.ipatinguensis 1 15 42 3
A.kaaygua 12
A.mboapari 116 11
A.minuano (Brazil) 2 3
A.oblongus 10 57 12
A.ribeirae 14
A. sp.” Jacuı
´” 3 13 9
A.ricani 39
A.sanguineus 115
A.scitulus 226 9
A.tembe 42
Modal frequencies marked in bold for samples with N>5. ST = Syntypes.
https://doi.org/10.1371/journal.pone.0261027.t008
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 27 / 122
the distal radial under the basal scale cover of the dorsal fin without actually observing it, but
the measurement had good reproducibility and may indicate aspects of evolution of the spines
of the dorsal fin as predator deterrent or holder for various colour marks as in Australoheros
and many other cichlids.
A smaller measurement set Table S4.2 in S4 File (without pelvic-fin length and caudal-
peduncle length) highlighted snout length, preorbital depth, upper and lower jaw lengths, and
length of last dorsal-fin spine (Fig 5). This suggests that variation may be strongest at the ante-
rior end of the body. Notably, none of the width-related characters (head width and interor-
bital width) had much weight. That could mean that the analysis mainly measured changes in
anteroposterior direction, characterising young specimens [79]. Species morphospaces were
for the most part overlapping, but with distinct groupings of A.mboapari, and A.ricani.Aus-
traloheros facetus,A.acaroides, and A.minuano were mainly overlapping, like A.sanguineus,
A.ipatinguensis, and A.oblongus.
To reduce effects of ontogenetic variability, a PCA was run on specimens with size con-
strained to 60–80 mm SL (Table S4.3 in S4 File). The result was similar to that from the larger
sample. Pelvic-fin length and caudal-peduncle length dominated when included; when
excluded, highest loadings were obtained from snout length, preorbital depth, lower jaw
length, upper jaw length, and last dorsal-fin spine.
Separating the major geographical groups S4 File gave only little improved resolution. PCA
of only the Sudeste species showed A.ipatinguensis and A.oblongus broadly overlapping, with
Table 9. Counts of ceratobranchial gill rakers in species of Australoheros.
5 6 7 8 9
A. “Arapey” 1 2
A.acaroides (Pinares)12 16
A.acaroides 1 13 75 17
A.angiru 181
A. cf. sanguineus 1 3
A.charrua 152
A.facetus 1 20 26
A.facetus (Portugal) 1 1 52
A.forquilha 4 5
A.guarani 7
A.ipatinguensis 625 15 1
A.kaaygua 1 1
A.mbapoari 324 1
A.minuano (Brazil) 1 6 1
A.minuano (Uruguay) 1 2 15
A.oblongus 756 18
A.oblongus HT 1
A.ribeirae 1 3
A.ricani 571
A.sanguineus 64
A.scitulus 425 6
A. sp. "Jacuı
´” 6 2 5
A.tembe 1 2 1 1
H.autochthon ST 1 1 1
Modal frequencies marked in bold. HT = Holotype; ST = Syntypes.
https://doi.org/10.1371/journal.pone.0261027.t009
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 28 / 122
higher loadings on orbit, and upper and lower jaws (Fig 6, Table S4.4 in S4 File). The regres-
sion on standard length for these measurements was the same, however (ANCOVA, p >0.05).
Breaking up the Sudeste species into samples representing type localities of nominal species
described by Ottoni et al. (2008–2012), resulted in very small samples of some species, e.g. one
specimen for A.perdi, and three for A.ipatinguensis. Only A.tavaresi and A.mattosi were well
represented, by 17 specimens each. The PCA of the pooled subdivided Sudeste sample (Fig
S4.5 in S4 File) and a further reduced sample (Fig 7, Table S4.6 in S4 File) of nominal species
samples with minimum five specimens showed considerable overlap and no pattern indicating
separation of nominal species.
We did not test specifically the species compositions presented by Ottoni et al. [47] for mor-
phological validation, as those were based only on molecular data, but see comments on
Table 10. Australoheros facetus.Proportional measurements (per cent of SL) and linear regression parameters.
N Min Max Mean SD r a b
SL (mm) 47 23.8 147.4 89.9 30.0
Head length 47 33.2 38.6 35.6 1.5 0.99 0.271 0.352
Snout length 47 9.9 15.3 12.9 1.3 0.99 -2.240 0.158
Body depth 47 45.1 54.0 49.3 2.5 0.99 -3.770 0.534
Orbital diameter 47 8.0 14.3 10.4 1.3 0.97 2.034 0.078
Head width 47 17.2 21.7 18.8 1.0 0.99 -1.100 0.202
Interorbital width 47 9.7 15.1 12.3 1.3 0.99 -2.809 0.150
Preorbital depth 47 4.6 8.7 7.0 1.0 0.99 -1.759 0.092
Upper jaw length 47 9.5 13.2 11.1 0.9 0.99 -1.768 0.133
Lower jaw length 47 13.1 17.3 15.1 1.1 0.98 -0.894 0.162
Caudal-peduncle depth 47 16.5 21.0 18.7 1.1 0.99 -1.393 0.205
Caudal-peduncle length 47 5.4 11.1 8.0 1.1 0.92 0.120 0.078
Pectoral-fin length 46 22.3 37.4 30.1 2.6 0.97 -2.240 0.013
Pelvic-fin length 47 26.5 42.6 33.8 4.7 0.98 -8.723 0.449
Last dorsal-fin spine length 44 14.3 21.4 18.0 1.6 0.96 -0.460 0.187
https://doi.org/10.1371/journal.pone.0261027.t010
Table 11. Australoheros oblongus.Proportional measurements (per cent of SL) and linear regression parameters.
N Min Max Mean SD r a b
SL (mm) 78 38.3 113.0 64.5 15.6
Head length 78 33.8 40.0 37.0 1.4 0.99 1.787 0.341
Snout length 78 10.2 16.0 12.2 1.0 0.97 -1.694 0.149
Body depth 78 41.7 53.6 46.9 2.6 0.98 -3.256 0.522
Orbital diameter 78 9.7 15.3 12.3 1.2 0.92 2.694 0.079
Head width 78 17.3 20.9 19.0 0.8 0.99 -0.532 0.199
Interorbital width 78 10.3 14.6 12.2 0.9 0.98 -1.851 0.152
Preorbital depth 78 4.6 7.6 5.8 0.6 0.97 -1.381 0.080
Upper jaw length 78 9.4 12.9 11.3 0.7 0.98 -0.833 0.127
Lower jaw length 78 14.1 18.1 15.9 0.9 0.97 -0.133 0.161
Caudal-peduncle depth 78 15.7 21.3 18.3 1.1 0.98 -1.569 0.208
Caudal-peduncle length 78 5.0 9.4 6.6 0.8 0.86 0.509 0.058
Pectoral-fin length 78 26.2 36.8 31.0 1.8 0.97 -0.864 0.324
Pelvic-fin length 77 28.2 54.3 38.9 5.9 0.94 10.126 0.555
Last dorsal-fin spine length 76 16.0 22.8 19.2 1.4 0.97 -1.526 0.217
https://doi.org/10.1371/journal.pone.0261027.t011
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 29 / 122
particular species, below. The separate PCA of southern species (Fig 8, Table S4.7, Fig S4.8 and
Table S4.8 in S4 File) showed a distinct aggregate of specimens of A.mboapari, but did not sep-
arate A.ricani,A.acaroides,A. sp. “Jacuı
´”, A.minuano, or A.facetus from each other. Speci-
mens of A.acaroides also overlapped with A.ricani. The PCA supported recognition of A.
mboapari as a distinct species, but was otherwise uninformative for species delimitation.
Delimitation of A.ricani and A. sp. “Jacuı
´” remains problematic. Both OTUs are known
only from the Rio Jacuı
´-mirim and shared derived characters such as the black soft dorsal fin
in females and the long row of minute scales along the base of the dorsal fin. The only sample
of A. sp. “Jacuı
´”, from Três Passos, was characterised by overall low meristic data, distinguish-
ing not only from A.ricani, but also from all other species of Australoheros. By contrast, the
morphometric analysis did not support species status.
Table 12. Australoheros acaroides.Size (SL), proportional measurements (per cent of SL), and linear regression parameters.
N Min Max Mean SD r a b
SL (mm) 105 30.1 114.4 68.9 18.9
Head length 105 32.5 40.0 35.7 1.3 0.99 1.794 0.289
Snout length 105 8.7 16.5 12.9 1.4 0.97 -2.05 0.161
Body depth 107 35.2 54.2 45.9 2.9 0.98 -1.061 0.476
Orbital diameter 105 7.9 14.4 11.0 1.2 0.95 2.247 0.002
Head width 105 16.1 20.7 18.2 1.0 0.98 0.191 0.179
Interorbital width 105 9.2 14.3 11.6 1.1 0.97 -1.591 0.141
Preorbital depth 105 4.1 9.1 6.9 1.0 0.98 -1.843 0.098
Upper jaw length 104 8.6 13.0 10.8 0.8 0.98 -0.8 0.121
Lower jaw length 104 12.7 16.4 14.8 0.8 0.98 2.96 0.143
Caudal-peduncle depth 105 15.5 19.9 17.4 0.9 0.99 -1.093 0.191
Caudal-peduncle length 105 6.4 10.8 8.6 0.9 0.95 -0.957 0.101
Pectoral-fin length 105 20.3 31.6 27.6 1.8 0.97 0.588 0.266
Pelvic-fin length 105 25.0 36.2 29.6 2.3 0.97 -1.732 0.232
Last dorsal-fin spine length 104 12.7 20.4 17.2 1.6 0.92 0.355 0.167
https://doi.org/10.1371/journal.pone.0261027.t012
Table 13. Australoheros minuano from Uruguay. Size (SL), proportional measurements (per cent of SL), and linear regression parameters.
N Min Max Mean SD r a b
SL (mm) 18 36.8 92.9 56.2 19.1
Head length 18 34.0 37.7 35.3 1.0 1.00 0.734 0.339
Snout length 18 9.9 14.0 11.6 1.2 0.99 -1.745 0.150
Body depth 18 42.7 47.0 44.7 1.3 1.00 -0.091 0.448
Orbital diameter 18 9.7 13.4 11.6 1.1 0.98 1.814 0.081
Head width 18 17.0 19.4 18.1 0.6 1.00 0.014 0.181
Interorbital width 18 9.8 12.6 11.0 0.8 0.99 -1.283 0.135
Preorbital depth 18 4.9 7.9 6.0 1.0 0.99 -1.712 0.093
Upper jaw length 18 8.6 11.2 9.7 0.8 1.00 -1.37 0.100
Lower jaw length 18 12.4 14.6 13.2 0.7 0.99 -0.073 0.133
Caudal-peduncle depth 18 15.3 18.2 16.9 0.7 0.99 -0.279 0.174
Caudal-peduncle length 18 7.9 10.3 9.2 0.8 0.98 -0.417 0.100
Pectoral-fin length 18 24.5 30.0 27.9 1.4 1.00 -0.971 0.299
Pelvic-fin length 18 25.8 29.8 27.3 1.1 1.00 -1.45 0.301
Last dorsal-fin spine length 18 15.2 18.8 16.6 0.9 0.98 -0.497 0.176
https://doi.org/10.1371/journal.pone.0261027.t013
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 30 / 122
The PCA of exclusively Rio Jacuı
´basin species (Fig 9, Table S4.9 in S4 File) attested to dis-
tinct species morphospaces and almost support for distinctness of the samples of Australoheros
mboapari and A. sp. “Jacuı
´”.
Regression analysis distinguished. Australoheros sp. “Jacuı
´” from A.ricani by significantly
different slopes in preorbital depth (p
H0
= 0.009) and caudal-peduncle depth (p
H0
= 0.019),
and different intercepts (p
H0
<0.05) in body depth, orbital diameter, head width, interorbital
width, pelvic-fin length, and length of last dorsal-fin spine. Given the small samples, the differ-
ences in conservation and SL ranges (84.0–115.2, average 95.9 mm SL, in the Três Passos sam-
ple; 56.9–109.9, average78.5 mm SL in the remainder) call for caution in interpretation of the
differences. Apparently, morphometry does not allow separation of A.acaroides and A.ricani;
or A. sp. “Jacuı
´” from A.ricani. On the other hand, mitochondrial DNA, squamation, and
Table 14. Australoheros ribeirae.Size (SL) and proportional measurements (per cent of SL).
N Min Max Mean SD
SL (mm) 4 63.4 79.9 70.3 6.9
Head length 4 35.3 36.4 35.9 0.5
Snout length 4 11.2 14.5 12.7 1.3
Body depth 4 45.3 49.6 47.6 2.2
Orbital diameter 4 10.8 12.0 11.3 0.5
Head width 4 18.8 19.6 19.1 0.4
Interorbital width 4 12.5 13.0 12.9 0.2
Preorbital depth 4 6.4 7.0 6.7 0.2
Upper jaw length 4 9.5 12.4 11.0 1.2
Lower jaw length 4 10.9 15.7 14.2 2.2
Caudal-peduncle depth 4 17.7 19.2 18.4 0.8
Caudal-peduncle length 4 7.1 8.5 7.6 0.6
Pectoral-fin length 4 26.1 30.8 28.5 2.0
Pelvic-fin length 4 28.5 36.0 33.4 3.4
Last dorsal-fin spine length 4 16.2 19.9 17.6 1.6
https://doi.org/10.1371/journal.pone.0261027.t014
Table 15. Australoheros ipatinguensis.Size (SL), proportional measurements (per cent of SL), and linear regression parameters.
N Min Max Mean SD r a B
SL (mm) 52 26.8 97.8 56.0 17.6
Head length 52 34.2 41.4 37.5 1.3 0.99 1.098 0.132
Snout length 52 9.0 13.6 11.8 1.0 0.98 -0.720 0.132
Body depth 52 44.7 53.1 48.9 2.2 0.99 -2.063 0.530
Orbital diameter 52 10.1 15.9 13.0 1.3 0.97 2.019 0.090
Head width 52 17.4 21.3 18.9 0.8 0.99 -0.819 0.205
Interorbital width 52 10.4 14.7 12.0 0.9 0.99 -1.337 0.146
Preorbital depth 52 3.5 7.4 5.5 0.8 0.98 -1.179 0.078
Upper jaw length 52 9.0 12.4 10.7 0.7 0.99 -1.096 0.126
Lower jaw length 52 13.5 17.3 15.4 0.7 0.99 -0.630 0.155
Caudal-peduncle depth 52 17.2 20.4 18.7 0.8 0.99 0.429 0.061
Caudal-peduncle length 52 5.3 8.8 7.0 0.9 0.91 -0.146 0.341
Pectoral-fin length 50 28.5 34.4 31.2 1.4 0.99 -1.456 0.341
Pelvic-fin length 52 29.9 52.0 36.1 5.0 0.97 -7.655 0.510
Last dorsal-fin spine length 52 16.4 22.7 20.3 1.2 0.98 -0.639 0.217
https://doi.org/10.1371/journal.pone.0261027.t015
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 31 / 122
colour pattern clearly separated A.ricani from A.acaroides; and A. sp. “Jacuı
´” was distinct
from them both in meristic data.
The samples available of Australoheros ribeirae and A.sanguineus were too small to be
informative; A.ribeirae was represented by only four specimens, not permitting statistical
analysis. The scattered representation on PCA plots accorded with the heterogeneous origin of
the material of A.sanguineus, from the Parana
´basin as well as different coastal rivers. There
was nevertheless no indication that the sample would have included more than one species.
In conclusion, the Principal Component Analysis of traditional measurements provided
support for recognition of A.mboapari as an entity different from all other species of
Table 16. Australoheros sanguineus.Size (SL), proportional measurements (per cent of SL), and linear regression parameters.
N Min Max Mean SD r a b
SL 16 40.2 84.2 62.0 14.6
Head length 16 34.8 41.3 37.1 1.9 0.98 3.187 0.316
Snout length 16 9.7 14.0 12.5 1.2 0.98 -1.446 0.150
Body depth 16 45.4 55.0 50.3 2.8 0.99 -3.671 0.565
Orbital diameter 16 10.2 14.2 12.0 1.4 0.90 2.366 0.080
Head width 16 18.0 21.3 19.4 0.9 0.98 0.790 0.180
Interorbital width 16 11.8 15.6 13.2 1.0 0.97 -0.638 0.143
Preorbital depth 16 5.1 7.5 6.5 0.7 0.97 -1.013 0.083
Upper jaw length 16 9.7 14.1 11.3 1.0 0.93 0.685 0.102
Lower jaw length 16 13.6 17.6 15.2 1.0 0.96 1.148 0.010
Caudal-peduncle depth 16 18.0 20.5 19.2 0.8 0.98 0.184 0.189
Caudal-peduncle length 15 5.8 8.9 6.8 0.8 0.90 -0.563 0.078
Pectoral-fin length 16 28.0 34.3 31.1 1.9 0.95 1.161 0.291
Pelvic-fin length 15 30.9 42.7 35.8 4.0 0.95 -5.144 0.447
Last dorsal-fin spine length 15 17.5 22.5 19.5 1.4 0.95 0.977 0.179
https://doi.org/10.1371/journal.pone.0261027.t016
Table 17. Australoheros mboapari.Size (SL), proportional measurements (per cent of SL) and linear regression parameters.
HT N Min Max Mean SD r a b
SL 101.7 16 62.1 107.9 85.3 14.6
Head length 32.7 16 32.0 34.5 33.3 0.6 1.00 -0.4070 0.338
Snout length 16.3 16 13.5 16.3 15.0 0.9 0.99 -3.6250 0.194
Body depth 43.6 16 40.7 45.8 43.9 1.4 0.99 -4.8930 0.498
Orbital diameter 8.8 16 8.7 9.8 9.3 0.4 0.96 1.062 0.080
Head width 16.8 16 15.6 18.0 17.1 0.6 0.98 -1.574 0.190
Interorbital width 11.6 16 9.3 12.7 11.1 0.9 0.98 -3.485 0.153
Preorbital depth 9.1 16 7.4 9.7 8.8 0.8 0.97 -2.571 0.119
Upper jaw length 9.7 16 8.8 10.9 9.8 0.6 0.97 -1.655 0.118
Lower jaw length 12.4 16 11.7 14.2 13.0 0.7 0.96 2.432 0.101
Caudal-peduncle depth 16.4 16 15.5 18.0 16.9 0.7 0.98 -1.009 0.182
Caudal-peduncle length 10.7 16 7.7 11.2 9.3 1.0 0.89 -1.527 0.111
Pectoral-fin length 24.2 16 23.7 28.7 26.4 1.6 0.96 -3.71 0.309
Pelvic-fin length 30.2 16 24.5 34.8 29.9 3.4 0.97 -12.323 0.448
Last dorsal-fin spine length 13.4 15 13.4 17.5 15.3 1.1 0.90 1.584 0.134
HT = Holotype.
https://doi.org/10.1371/journal.pone.0261027.t017
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 32 / 122
Australoheros examined here. This was not supported by traditional ratio data, however, in
which all species overlapped (Tables 10–19). Large samples showed wide ranges representing
aberrant specimens or samples of reduced breeder sizes. Australoheros sanguineus was distin-
guished with somewhat deeper body than the rest, and A.ricani and A.mboapari had more
elongate body, longer snout and deeper preorbital than remaining species. Regression analysis
of the distance measurements on SL failed the hypothesis of a common slope in all of them
(p = 0–0.0212). Variation, however, may have been influenced by different size ranges in spe-
cies samples, and increased variability among large specimens, irrespective of species. Body
depth, indicated as distinguishing A.mboapari in the PCA, had the same slope as in A.min-
uano and A.ricani when these three species were analysed alone.
Table 18. Australoheros ricani.Size (SL), proportional measurements (per cent of SL) and linear regression parameters.
HT N Min Max Mean SD r a b
SL (mm) 75.5 13 56.9 109.9 78.5 15.1
Head length 34.7 13 33.3 36.5 34.7 1.0 0.99 1.789 0.323
Snout length 13.5 13 12.5 15.0 13.8 0.8 1.00 -2.895 0.176
Body depth 44.9 13 40.5 44.9 42.0 1.4 0.99 1.903 0.395
Orbital diameter 10.2 13 8.7 10.7 9.9 0.6 0.97 2.478 0.067
Head width 16.8 13 15.7 17.4 16.4 0.5 0.99 0.274 0.161
Interorbital width 9.5 13 8.6 10.8 9.7 0.6 0.98 -1.812 0.127
Preorbital depth 7.0 13 6.9 8.6 7.6 0.6 0.99 -2.329 0.361
Upper jaw length 10.9 13 10.2 11.5 10.9 0.4 0.99 0.373 0.114
Lower jaw length 14.3 13 13.3 15.7 14.3 0.6 0.98 0.771 0.133
Caudal-peduncle depth 17.4 13 15.2 17.5 16.2 0.7 0.98 1.099 0.177
Caudal-peduncle length 11.8 13 8.0 11.8 10.5 0.9 0.91 0.119 0.103
Pectoral-fin length 25.8 13 22.5 28.4 26.9 1.8 0.94 2.240 0.239
Pelvic-fin length 28.1 13 22.1 31.0 26.6 2.0 0.92 -0.133 0.267
Last dorsal-fin spine length 15.6 13 14.7 17.4 15.7 0.7 0.97 1.532 0.137
HT = Holotype.
https://doi.org/10.1371/journal.pone.0261027.t018
Table 19. Australoheros sp. “Jacuı
´”. Size (SL), proportional measurements (per cent of SL), and linear regression parameters.
N Min Max Mean SD r a b
SL (mm) 10 84.0 115.2 95.9 10.9
Head length 10 33.0 36.3 34.6 1.3 0.95 6.828 0.274
Snout length 10 13.4 15.5 14.6 0.6 0.95 -1.674 0.164
Body depth 10 44.2 48.2 45.9 1.5 0.96 5.660 0.400
Orbital diameter 10 8.7 10.4 9.7 0.5 0.94 3.923 0.055
Head width 10 16.7 18.3 17.4 0.5 0.96 0.594 0.168
Interorbital width 10 10.4 12.0 11.6 0.5 0.98 -2.498 0.143
Preorbital depth 10 8.1 8.6 8.3 0.2 0.98 0.088 0.084
Upper jaw length 10 10.4 11.4 11.0 0.3 0.98 -0.139 0.111
Lower jaw length 10 13.1 14.6 13.7 0.5 0.95 -0.351 0.141
Caudal-peduncle depth 10 15.6 18.0 16.7 0.7 0.94 4.117 0.124
Caudal-peduncle length 10 8.8 12.1 10.2 0.9 0.75 0.298 0.099
Pectoral-fin length 10 25.9 27.9 27.0 0.7 0.99 4.877 0.219
Pelvic-fin length 10 29.0 33.1 31.1 1.3 0.94 -1.090 0.322
Last dorsal-fin spine length 10 14.8 18.1 16.5 1.0 0.89 0.298 0.162
https://doi.org/10.1371/journal.pone.0261027.t019
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 33 / 122
Altogether the morphometric analysis suggested that all species are relatively variable, and
did not show any species diagnostic character state. Northern and southern species formed
broadly overlapping clusters, and within-group analysis failed to recover distinct species. Nev-
ertheless, A.ricani and A.mboapari, each formed distinct clusters, although not distinct from
the very variable A.acaroides. The analysis may be impacted by wide size span of the total sam-
ple, different preservation states, and the inclusion of precocious specimens. Precocious speci-
mens were observed in A.acaroides, but may be more common.
Qualitative morphology
Two morphological characters separated nominal species now contained in A.oblongus from
those in A.ipatinguensis.Australoheros oblongus was slightly more elongate, and usually had
an indentation in the frontal contour, reflecting slightly inflated frontal tissue immediately
anterior to the dorsal-fin base. It was also characterised by a large caudal spot spanning the
middle of the caudal-fin base. By contrast, A.ipatinguensis was slightly more deep-bodied and
smaller specimens had a characteristic steep frontal contour without conspicuous indentation;
Fig 3. Box and whisker plot of last dorsal-fin spine length in per cent of SL in nominal speciesAustraloheros
capixaba,A.A.mattosi, and A.tavaresi.
https://doi.org/10.1371/journal.pone.0261027.g003
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 34 / 122
the caudal spot was concentrated to the upper lobe of the caudal fin, although dark pigment
was present on the adjacent lower lobe in in some specimens. The presence of an indentation
in the frontal contour of A.ipatinguensis was related to the collapse of the tissue in the recess
for the ascending processes of the premaxilla, but might also have reflected a slight difference
in orientation of the recess, which was not further investigated. Very large specimens of A.ipa-
tinguensis showed a frontal indentation, but could be recognised by the characteristic caudal
spot. The frontal indentation recalled Chakrabarty’s [80] character 68, ‘Dorsal head profile:
interorbital concavity’, which reflects a protruding premaxillary pedicel (cf. Barel et al. [81]).
Chakrabarty coded the state in ‘C’.facetum as absent or weak, with the alternative present and
deep. The species identity of Chakrabarty’s ‘C’.facetum was not verified.
In 1898 Jordan and Evermann [82] separated the genera Cichlasoma and Heros on the pres-
ence of a frenum in the former, absent in the latter. This distinction was criticised and consid-
ered as artificial by Pellegrin in 1904 [36], but nevertheless adopted by him, placing Chromys
facetus in Cichlasoma, and Heros autochthon and Chromys oblonga in Heros. Judging from Pel-
legrin’s fig. 37, he distinguished between a state where the lower lip fold is continuous, versus a
state where the lower lip fold is discontinuous (absent symphysially). In 1905, Regan [37] dis-
tinguished Cichlasoma facetum with ‘fold of the lower lip not continuous’ and Chromys
oblonga and Heros autochthon with ‘fold of the lower lip continuous’. According to our obser-
vations all species of Australoheros possess a continuous lower lip fold, but also a frenum,
which is a short median membrane attaching to the very root of the lip fold and not exposed
Fig 4. Plot of specimen scores of PC II on PC III from PCA of 15 distance measurements from pooled coastal species of Australoheros, and A.
“Jacuı
´.” (Table S4.1 in S4 File).
https://doi.org/10.1371/journal.pone.0261027.g004
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 35 / 122
externally. This frenum, however is not the same as the lip fold in cichlid species and which
may be interrupted by a smooth median surface.
The lower pharyngeal tooth plate in cichlids shows variation in shape and tooth shape cor-
responding to diet [79,81] and was figured for species of Australoheros by Casciotta et al. [83,
84] and R
ˇı
´čan and Kullander [4,85]. As far as studied and illustrated, variation in bone and
tooth shape is limited, and there are no studies of ontogenetic series or even larger samples,
enabling a phylogenetic analysis. Lower pharyngeal tooth plates are reported here under the
respective species.
R
ˇı
´čan and Kullander [4] and R
ˇı
´čan et al. [13] distinguished species of Australoheros from
the Uruguay and Parana
´drainages by combinations of scale and colour characters. Southern
species except A.facetus, but including A.sanguineus, shared a distinctive colour pattern,
expressed in a lateral band consisting of dark scale margins or blotches on scale rows 0 and E1,
ending with Bar 4. As the dark markings interdigitate, the lateral band has a remote likeness to
a zipper, and consequently it is referred to here as a zipper band. In A.facetus, juveniles had a
distinct broad lateral band, lost in large adults, but the zipper marking was absent at all sizes.
The zipper marking was present also in the species from the Uruguay and lower Parana
´basins,
and the same or similar marking was recorded in A.oblongus. In the breeding colour pattern
the scale blotches merge to form a single continuous lateral band indistinguishable from the
lateral band in adult A.facetus and A.ipatinguensis and A.oblongus. The presence of four
rather than three abdominal bars occurred in low frequency in A.facetus, and A.acaroides,
Fig 5. Plot of scores of PC II on PC III from PCA of 13 distance measurements from pooled coastal species of Australoheros, and A. “Jacuı
´.”
(Table S4.2 in S4 File).
https://doi.org/10.1371/journal.pone.0261027.g005
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 36 / 122
and A.minuano among southern the species, but was very rare in A.oblongus and A.ipatin-
guensis. The fourth bar represented a split Bar 5 (R
ˇı
´čan et al. [58]).
R
ˇı
´čan and Kullander (figs 8A, 9A–C) [4] and R
ˇı
´čan et al. [13] described a scale pattern
unique among cichlids, consisting of a row of minute scales paralleling the dorsal-fin base
cephalad to the anterior dorsal-fin insertion, close to which the row may be doubled. This
scale character state was reported from Australoheros forquilha,A.tembe,A.ykeregua, and A.
sp. “Jacuı
´”. We found it also in A.mbapoari and A.ricani. In remaining species of Australo-
heros the minute scales were present, but reached only to the middle of the dorsal fin-base or
shorter as illustrated by R
ˇı
´čan and Kullander, figs. 8b D–I [4]. Because A.tembe did not group
with A.ykeregua+A forquilha in the mt-cyb tree or the morphological parsimony tree pre-
sented by R
ˇı
´čan et al. [13], the condition cannot be a synapomorphy of A.tembe A.forquilha,
A.ykeregua and A. sp. “Jacuı
´”–the forquilha group of R
ˇı
´čan and Kullander [4]–but may relate
to the inferred or observed rheophily of those species–A. sp. “Jacuı
´”, A.ricani, and A.
mboapari.
Ottoni et al. [5] and Ottoni and Costa [6] introduced five osteological characters in north-
ern species and A.facetus, namely the length of the anterior arm of epibranchial 1, with states
long (all Sudeste species) or short (A.facetus only); process on second vertebra [neurapophysis
of preural 2], with states truncate (A.ribeirae only) or pointed; ectopterygoid width, with states
slender (A.ribeirae only in Ottoni et al. [5]; also A.ipatinguensis in Ottoni and Costa [6] or
wide; and epibranchial 2 processes with the two states: long [epiphyseal]processes [one at each
end] (A.autrani,A.macacuensis,A.macaensis,A.muriae, and A.saquarema) or two short
processes [one at each end] (A.barbosae,A.facetus,A.ipatinguensis,A.paraibae, and A.
Fig 6. Plot of scores of PC II on PC III from PCA of 13 distance measurements from pooled samples of Australoheros ipatinguensis and A.
oblongus.
https://doi.org/10.1371/journal.pone.0261027.g006
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 37 / 122
robustus). In later papers by Ottoni and collaborators the reference to the preural 2 neurapo-
physis was dropped, and osteological data were absent from the descriptions of A.taura and
A,sanguineus. The only species with ‘short anterior arm’ was A.facetus and A.ipatinguensis
(sensu Ottoni and Costa 2008 [6]); the only species with narrow ectopterygoid were A.ribeirae
and A.ipatinguensis (sensu Ottoni and Costa 2008 [6]).
It is not obvious what ‘anterior arm long’ refers to. The relative length of the anterior arm
and uncinate process of epibranchial 1 has phylogenetic significance. Casciotta and Arratia
[86] (character 28) found that an uncinate process and anterior arm of the first epibranchial of
equal length or the uncinate process slightly the longer to be the state in the majority of Ameri-
can cichlids including their material identified as A.facetus. The alternative state of a much
longer uncinate process in comparison with the anterior arm was found in some chaetobran-
chines, crenicichlines, and geophagines. In our cleared and stained specimens of A.minuano,
A.acaroides,A.angiru,A.facetus,A.scitulus,A,ykeregua, and A.sp. “Jacuı
´” the anterior arm
and uncinate process are equal in length, as also shown by Ottoni and Costa (fig. 4) [6]. This
character, and the length of the epiphyseal processes of the second epibranchial, where it also
is not clear if how long–a relative measure–is defined. In our cleared and stained specimen of
A.facetus the separation of the anterior arm and uncinate process was relatively shorter than
in specimens of A.acaroides,A.angiru,A.minuano,A.scitulus,A.ykeregua, and A. “Jacuı
´” in
which the anterior arm and uncinate process branch at the middle or only slightly more distad
on the curved bone observed in situ in dorsal view, a condition illustrated also by Casciotta
Fig 7. Plot of scores of P C III on PC II from PCA of 15 distance measurements of northern species of Australoheros, assigned to nominal species
based on locality and/or species status, represented by minimum five specimens. (Table S4.6 in S4 File).
https://doi.org/10.1371/journal.pone.0261027.g007
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 38 / 122
(figs 30 and 34) [86]. We take this condition to be ‘short anterior arm’. The body of epibran-
chial 2 showed variation in width, possibly explaining the variation in the relative length of the
epiphysial ends. Among our cleared and stained specimens, slender epiphysial projections
were observed in A.angiru,A.acaroides, and A.ykeregua, interpreted as ‘long projections’.
The ectopterygoid was of the same shape in our cleared and stained specimens of Australo-
heros.minuano,A.acaroides,A.facetus,A.scitulus,A.ykeregua, and A. sp. “Jacuı
´”, corre-
sponding to the wide state of Ottoni and Costa (fig.3) [6]), as illustrated by Casciotta (fig. 24)
[86]. The figure of a narrow ectopterygoid in Ottoni et al. (fig. 5) [5] and Ottoni and Costa (fig.
3) [6] suggests a teratological condition.
In our cleared and stained specimens the preural 2 neurapophysis varied slightly in shape.
In lateral aspect it typically had a tulip-shaped or beaker-shaped outline with a broad proximal
‘stalk’ and a wider distal portion with an emarginate apex opposed to epural 2. In one of our
cleared and stained specimens of Australoheros acaroides it was very short, with a narrow,
pointed apex; in our cleared and stained specimen of A.facetus it was relatively narrow, with a
pointed apex similar to one of our specimens of A.ykeregua and the A.facetus specimen illus-
trated by Casciotta (fig. 47) [87]). In the specimen of A.scitulus it had a broad arrow-shaped
tip and truncate apex. In one of the specimens of A.angiru it was broad, short and truncate
apically.
Given that the only osteological variation recorded seems to be in the epiphyses of the
endochondral pharyngobranchials 1 and 2, that those are subject to continuous growth,
Fig 8. Plot of scores of PC III on PC II from PCA of 15 distance measurements from pooled southern coastal species of Australoheros (A.
acaroides,A.minuano,A.facetus,A.mbapoari,A.ricani,A.sanguineus), and A. sp. “Jacuı
´.”.
https://doi.org/10.1371/journal.pone.0261027.g008
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 39 / 122
potentially varying with specimen size, and that specimen size was not documented, the osteo-
logical characters described by Ottoni et al. [5] and Ottoni and Costa [6] do not demonstrate
strong evidence of species differentiation.
Molecular species delimitation: mt-coI
The bPTP analysis of mt-coI suggested species units with bPTP-specific support values ranging
from 0.2 to 1 (Fig 10). Clades with few species had strongest support (Australoheros tembe,A.
sanguineus,A.ribeirae, putative A.autrani, and A. “Arapey”.) Australoheros angiru and A.sci-
tulus were paired in one unit. Remaining units recognised A.acaroides,A.facetus,A.ricani,A.
ribeirae,A.sanguineus,A.oblongus A.ipatinguensis, and A.minuano.
Uncorrected p-distances (Table 20,S1 Table) separated the coastal species from the Uru-
guay and Parana
´basin species (A.angiru,A.scitulus, and A.tembe) by more than 4% mini-
mum p-distance. The Sudeste and the southern coastal species separated by 3–4% minimum
p-distance (3.07 in A.facetus to 4.14% in A.ricani) but only 2.76% in A.sanguineus, and the
two groups could be analysed separately: (non-zero p-distance only).
Minimum p-distance between A.oblongus and A.ipatinguensis was 1.69, much less than
the separation from A.ribeirae (3.07). The internal p-distance in A.oblongus was 0.31–0.77%;
in A.ipatinguensis 0.77–1.23%. The large internal span in A.ipatinguensis marked the influ-
ence of the Silva Jardim specimen, without which the internal p-distance would be 0.15–
0.92%, The rest of the samples showed minimum p-distances compatible with a species
Fig 9. Plot of scores of PC II on PC III from PCA of 13 distance measurements from pooled specimens of Australoheros from the Rio Jacuı
´basin
(A.acaroides,A.facetus,A.mboapari,A.ricani, and A. sp. “Jacuı
´.”.
https://doi.org/10.1371/journal.pone.0261027.g009
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 40 / 122
Fig 10. Delimitation of species of Australoheros based on bPTP analysis of mt-coI sequences. Blue lines lead to suggested species; red lines combine
within-species branches. Node numbers are percentage support values generated by bPTP. OTU names are as those considered as valid species;
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 41 / 122
divergence threshold of 2–3%. The wide internal divergence demonstrates the wide geographi-
cal distribution of A.ipatinguensis by specimens representing terminals in the distribution
from the Rio Paraı
´ba do Sul to the middle Rio Doce.
Among the southern species, two sequences stood out: the UFRGS 19207 sequence–from a
tributary to the Lagoa dos Barros, very seaward in the Laguna dos Patos basin–which was most
similar to sequences of A.acaroides but still very different from the rest; and MCP 50424 from
the Rio Soturno, which was very different from all other A.acaroides sequences. Distances
reported below excluded those two specimens, but they were included in S1 Table. Internal
non-zero variation was lower than external divergence, which exceeded 2% for all species, in
A.ricani by more than 4%.
Australoheros minuano had an internal p-distance of 0.15–0.46%. The only specimen of A.
“Arapey” was most similar to A.minuano, but 0.92–1.07% different. Australoheros minuano
and A.facetus differed by only 2.3–2.6%, indicating close phylogenetic relationship.
Only one sequence of A.ribeirae and two of A.sanguineus were available. The A.sanguineus
sequences were identical and differed from that of A.ribeirae by only 1.99%, calling for further
analysis of the validity of A.sanguineus.
The Bayesian phylogenetic tree based on mt-coI (Fig 11) has distinct clades (bpp = 0.99–1)
for A.tembe,A.scitulus,A.angiru,A.ricani,A.facetus,A.acaroides,A.ribeirae,A.sanguineus,
A. oblongus, and A.ipatinguensis. In the A.minuano+A. “Arapey” clade, the Arapey specimen
was distinct, reducing bpp to 0.88.
Molecular species delimitation: mt-cyb
The bPTP analysis of mt-cyb (Fig 12) suggested 22 ingroup species of Australoheros with sup-
port values from 0.28 to 1. The analysis may have overdone splitting as it found two units of A.
ykeregua from the same provider, and two units of A.acaroides,A.tembe, and A.minuano.
nominal species identified by locality are indicated by codes inserted within parentheses: AU = A.autrani; BB = A.barbosae, CP = A.capixaba; MA =
A.macaensis, MC = A.macacuensis; MU = A.muriae; PB = A.paraibae.
https://doi.org/10.1371/journal.pone.0261027.g010
Table 20. Uncorrected p-distances in mt-coI between MOTUs of Australoheros.
A.acaroides acaroides oblongus ipatinguensis ricani "Arapey" canterai facetus sanguineus ribeirae tembe scitulus angiru
A.oblongus 3.83 1.53 4.14 3.99 3.99 3.07 2.76 3.07 7.98 5.67 8.9
A.ipatinguensis 3.83 1.69 4.14 3.83 4.29 3.07 2.76 3.07 7.82 5.37 8.9
A.ricani 3.83 4.14 4.14 3.53 3.83 3.07 3.53 3.83 7.21 6.6 9.66
A."Arapey"3.22 3.99 3.83 3.53 0.92 1.99 3.07 3.37 7.06 5.37 8.44
A.canterai 3.53 3.99 4.29 3.83 0.92 1.99 3.37 3.53 7.06 5.06 8.13
A.facetus 2.61 3.07 2.76 3.07 1.99 1.99 2.61 2.3 6.29 5.21 8.59
A.sanguineus 3.37 2.76 2.76 3.53 3.07 3.37 3.07 1.99 7.21 5.52 8.9
A.ribeirae 3.83 3.07 3.07 3.83 3.37 3.53 2.3 1.99 7.82 6.44 9.82
A.tembe 6.6 7.98 7.82 7.21 7.06 7.06 6.29 7.21 7.82 5.52 3.68
A.scitulus 5.67 5.67 5.37 6.6 5.37 5.06 5.21 5.52 6.44 5.52 3.68
A.angiru 9.2 8.9 8.9 9.66 8.44 8.13 8.59 8.9 9.82 8.74 3.68
Cichlasoma portalegrense serves as outgroup measure. Species names are those considered valid in this study. Nominal northern species based on locality are identified
by codes in parenthesis: AU = A.autrani; BB = A.barbosae, CP = A.capixaba; IP = A.ipatinguensis; MA = A.macaensis; MC = A.macacuensis; MN = A.montanus; MT
=A.mattosi; MU = A.muriae; PB = A.paraibae; RB = A.robustus. Each entry in the first column has an abbreviated locality indicated; Specimen identifiers refer to
NRM tissue numbers (numeric only), MCP tissue numbers (CIC numbers); and Genbank or BOLD identifiers. Refer to Table 1 and S1 File for full metadata.
https://doi.org/10.1371/journal.pone.0261027.t020
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 42 / 122
Fig 11. Phylogenetic tree of species of Australoheros based on Bayesian inference of sequences of mt-coI.Coloured
rectangles and names to the right cover valid species; names of nominal species identified by locality contained within
rectangles.
https://doi.org/10.1371/journal.pone.0261027.g011
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 43 / 122
Sudeste samples were grouped in six species, among which the two Macacu samples ended up
as separate species.
The Bayesian phylogenetic tree of mt-cyb (Fig 13) showed very little divergence, recognising
clades A.ykeregua,A.forquilha,A.scitulus,A.tembe,A.kaaygua,A.facetus,A.minuano,A.
acaroides,A.ricani,A.sanguineus,A.ribeirae,A.oblongus and A.ipatinguensis. Posterior
probabilities provided credibility to the clades A.forquilha,A.ykeregua,A.scitulus,A.kaaygua,
Fig 12. Delimitation of species of Australoheros based on bPTP analysis of mt-cyb sequences. Blue lines lead to suggested species; red lines combine
within-species branches. Node numbers are percentage support values generated by bPTP. OTU names are as those considered as valid species;
nominal species identified by locality are indicated by codes inserted within parentheses: AU = A.autrani; BB = A.barbosae, CP = A.capixaba; MA =
A.macaensis, MC = A.macacuensis; MU = A.muriae; PB = A.paraibae.
https://doi.org/10.1371/journal.pone.0261027.g012
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 44 / 122
A.minuano,A.acaroides,A.ricani,A.ribeirae,A.sanguineus,A.ipatinguensis and A.oblongus
(bpp 0.94–1); only A.facetus (bpp 0.84) appeared contestable.
Mitochondrial mt-cyb sequences published by R
ˇı
´čan and Kullander [3] and R
ˇı
´čan et al. [13]
were included in the Bayesian phylogenetic analysis (Fig 13). that analysis, fig. 2, and that of
R
ˇı
´čan and Kullander (fig. 1) [3], AY998659 (A. sp. uruguai from Salto, here called A.min-
uano), and AY998658 (A. sp. jacutinga from the Rio Iguac¸u basin; here called A.angiru),
were sister taxa. In our tree, AY998659 (A. sp. uruguai) ended up inside A.acaroides, and
AY998658 (A. sp. jacutinga) clustered with A.sanguineus, calling into question the locality
information for AY998658 and AY998659.
Phylogenetic interrelationships
The mt-cyb and mt-co1 trees (Figs 11 and 13) showed the same branching pattern as far as taxa
overlap. The Sudeste specimens minus A.ribeirae formed two clades, each with only minimal
branch lengths.
Fig 13. Phylogenetic tree of species of Australoheros based on Bayesian inference of mt-cyb sequences. Coloured
rectangles and names to the right cover valid species; names of nominal species identified by locality contained within
rectangles.
https://doi.org/10.1371/journal.pone.0261027.g013
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 45 / 122
Australoheros ribeirae and A.sanguineus were sister species. The A.ribeirae+A.sanguineus
clade made up one branch in a trichotomy with the southern and Sudeste clades. The bpp
value for this node was relatively low in the mt-cyb tree (Fig 13: 0.63); but higher in the mt-coI
tree (Fig 11: 0.94). Among southern species, the ingroup had A.ricani as sister clade to the
rest. Australoheros facetus and A.minuano were sister species, and this clade was sister to a
trichotomy of A.acaroides, the A.ribeirae+sanguineus clade, and the Sudeste clade with two
species.
The concatenated Bayesian tree of mt-cyb and mt-coI sequences S5 File suffered from the
unequal, samples and also short length of many of the mt-cyb samples. In general it followed
the pattern of the single-gene trees but with A.tembe non-monophyletic (different clades for
mt-coIand mt-cyb).
There was a very clear separation of southern and northern species, and restricted overlap
in distribution pointing to mainly allopatric speciation. Nevertheless, several species were
recorded from more than one river drainage, e.g. Australoheros oblongus in the Doce, Macacu,
Parana
´, Paraı
´ba do Sul and São Francisco basins; A.facetus in the Uruguay and Parana
´basins,
and A.acaroides in the Uruguay and Jacuı
´basins; A.ipatinguensis present in several coastal
rivers and lagunar affluents, and A.sanguineus in the Iguac¸u and Cubatão basins. Sympatry of
A.oblongus and A.ipatinguensis in the Paraı
´ba do Sul drainage, suggested relatively recent dis-
persal. Australoheros ipatinguensis was widespread in near-coast areas, extending far north,
beyond the Rio Doce drainage, whereas A.oblongus was mainly montane. In the south, the
Salto de Jacuı
´was probably a barrier separating A.ricani and A.acaroides.Australoheros acar-
oides was parapatric with A.mboapari in the Rio Taquarı
´.
Species accounts
Here we summarise information on nominal species and discriminating characters of valid
species. The species accounts are ordered chronologically by year of original description.
Species from more interior localities in the Parana
´and Uruguay River basins are presented in
S2 File.
Australoheros facetus (Jenyns, 1842). Chromis facetus Jenyns, 1842 [29]: 104 (holotype
UMZC FF6640, not seen; type locality Maldonado, in a lake of fresh water).
Heros Jenynsii Steindachner, 1869 [33]: 149 (syntypes NMW 17324–27 (4), 58722 (1); type
locality Montevideo; full description in Steindachner, 1870 [88]: 202, pl. II).
Definition. Based on the position in the mt-cyb and mt-coI trees and minimum uncorrected
p-distance in mt-coI exceeding 2% from all other species of the genus, Australoheros facetus is
a distinct evolutionary lineage. Specimens of A.facetus can be distinguished from congenerics
by colour pattern and scale cover: uniform dark lateral band present in young specimens, lost
in adults; Y mark absent, minute scales below spinous dorsal-fin base absent.
Description of sample. Based on specimens from the type locality (NRM, 54218, 55720,
56035). Proportional measurements are given in Table 10, meristic data in Tables 3–9. Refer to
Fig 14 for general aspect of adults.
Adults (Fig 14), about 50 mm SL, and larger, moderately elongate, dorsum slightly elevated
matching ventral profile: laterally compressed, more so caudad. Frontal contour ascending at
about 40˚, straight, slightly curved close to dorsal-fin base, which straight or slightly curved,
gently descending at base of soft dorsal fin. Caudal peduncle margins straight, about parallel,
or slightly sloping. Very slight indentation in frontal contour anterior to orbit. Nuchal protu-
berance absent. Prepelvic contour straight or nearly so, descending at about 20˚; abdominal
contour straight horizontal; anal-fin base slightly ascending. Orbit lateral, removed from
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 46 / 122
frontal contour, in anterior half head, slightly dorsal to midaxis level of body. Gill cover with
distinct indentation at dorsal junction of opercle and subopercle.
Mouth terminal, below level of orbit; tip of maxilla exposed, not reaching to vertical from
anterior margin of orbit. Jaws isognathous; tooth band of lower jaw closing opposite or poste-
rior to upper tooth band. Lips moderately thick, both lip folds interrupted symphysially. Jaw
teeth in 2–3 rows, in juveniles only one row. Six anterior teeth in outer row in both jaws slightly
Fig 14. Australoheros facetus. A. adult male, 145.4 mm SL; NRM 55720. Badult female, 108.8 mm SL; NRM 55720. C. young female, 55.4 mm SL;
NRM 55720. All from Uruguay: Maldonado: Laguna del Diario.
https://doi.org/10.1371/journal.pone.0261027.g014
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 47 / 122
larger than rest, pointed, slightly recurved; small second cusp present lingually, second row
teeth much smaller than outer teeth, caniniform, at least some teeth with small second cusp
lingually; teeth in third row, if present, minute, caniniform. Teeth in outer hemiseries 8–14 in
each jaw. Abraded teeth absent. Lower pharyngeal tooth plate (Fig 15) relatively slender, length
70.2% of width; dentigerous area length 39% of dentigerous area width. Anterior teeth subconi-
cal, slightly retrorse; 9 wide teeth in anteroposterior row along median suture, apex tuberculate
on middle teeth, posterior teeth slightly compressed, bicuspid with antrorse distal cusp; laterad
and posterolaterad on bone plate, teeth gradually smaller and compressed; about 19 teeth in
posterior row. Microbranchiospines present externally on ceratobranchials 2–4.
Fig 15. Australoheros facetus, NRM 55720, 100.5 mm SL; lower pharyngeal tooth plate in occlusal.
https://doi.org/10.1371/journal.pone.0261027.g015
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 48 / 122
Predorsal scales irregular, exposed distally, about 11–14 along midline. Scale rows on cheek
3–4; cheek naked next to rictus. Scales between dorsal fin and upper lateral line 2 large and
one small anteriorly; one large and a pair of small scales posteriorly. Dorsal fin anterior inser-
tion at vertical from insertion of pectoral-fin base; first dorsal-fin spine about ½–3/5 length of
last spine, length increase gradually from first to last spine, subequal from fifth or sixth spine.
Soft dorsal fin with broad or slightly elongated pointed tip, rays 5 and 6 longest, extending to
about vertical through middle of caudal fin or slightly further. Anal-fin spines increasing
slightly in length from first to last; soft dorsal fin with broad tip, soft rays 4 and 5 forming
broad or elongated tip, reaching at most to slightly beyond vertical through middle of caudal
fin. Caudal fin with rounded or subtruncate posterior margin.
Pectoral fin inserted slightly anterior to pelvic-fin insertion, at a distance from pelvic-fin
spine corresponding to 1½length of pelvic–fin base. Pectoral-fin tip rounded; reaching nearly
to vertical from genital papilla or to anterior insertion of anal fin. Pelvic fin long, pointed, first
soft ray longest, reaching to base of third anal-fin spine, or first soft ray with filamentous tip
reaching slightly longer. Small specimens with more rounded vertical fins, pelvic fin with
rounded tip, reaching to anal-fin insertion or slightly shorter (Fig 16).
Bases of dorsal, anal, and caudal fins scaled: in adults, dorsal-fin base with basal scales from
9th, 10
th
, 13
th
or 14
th
spine, and narrow band with rows of up to five from small interradial
scales from next spine in row; soft portion with slightly wider thick basal scale layer, with up to
seven scales in a row and basally one or two2 rows. Specimens 27.1–45.2 mm SL (NRM 54218)
show gradual development of dorsal-fin squamation from single row of embedded scales close
to dorsal-fin base but no scales on fin, to adult condition; 32.4 mm specimen smallest with
basal scales from, 14th spine, and single interradial scales posteriorly. Anal fin in adults
with single row of basal scales, on soft portion added a dense layer of basal scales, up to four
between two rays; exposed anal-fin scales absent in juveniles, present in specimen 45.2 mm SL.
Caudal fin with dense layer of scales basally, rows of small interradial scales reaching to middle
of fin; in juveniles under 50 mm SL caudal fin scaled only basally.
Colouration in preservative. Adult specimens (Fig 14) overall dark with dark beige or brown
ground colour, not contrasting with darker vertical bars. Cheek and gill cover dark brown,
shading to black ventrally; abdomen, underside of head, black, prepelvic area dark or light
grey. Unpaired fins black or dark brown; caudal fin progressively lighter apically, and with
approximately round black blotch at base of fin, immediately dorsal to lateral line, or caudal
blotch extending across caudal-.fin base, but paler below lateral line. Pectoral fin pale grey,
semitransparent. Pelvic fin dark grey to black.
Vertical bars black, slightly wider than Interbars; Bar 1a slightly curved, convex anteriad,
between dorsal and ventral margins of caudal peduncle; Bar 2 slightly curved, between poste-
rior bases of dorsal an anal fin; Bar 3 straight, from about middle of base of anal fin dorsally to
base of caudal fin; Bar 4 straight, from bases of anterior three spines of anal fin dorsally to base
of dorsal fin, but may be interrupted where crossing upper lateral line; Bars 5 and 6 extending
dorsally only to E1 scale row or slightly more dorsad; Bar 7 represented by dark pigment close
to gill opening, in E 0 and E1 scale rows, and present at occiput as two dark transverse stripes;
Bar 9 as two dark parallel stripes crossing snout. A slightly lighter zone along the upper lateral
line may form the dorsal limit of ventral sections of bars 5–6; dorsally, bars represented as
blotches close to dorsal-fin base. Indistinct narrow black or brown horizontal band on E1 row
scales from head to Bar 2; band variably discontinuous or not across Interbars. Black blotch
absent from Bar 4 in adults.
Young and juveniles (Fig 16) nearly uniform pale brown with indistinct markings. Vertical
bars on side brown; Bars 5–6 not clearly defined, but present from the smallest, about 10–14
mm SL, and in four juvenile specimens four abdominal bars are indicated. An indistinct,
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 49 / 122
Fig 16. Australoheros facetus, ontogenetic series; from bottom to top 23.8–45.3 mm SL; NRM 54218; Uruguay;
Maldonado: Laguna del Diario.
https://doi.org/10.1371/journal.pone.0261027.g016
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 50 / 122
irregular dark band along middle of side, and in some specimens an indistinct brown blotch in
Bar 4 where crossing band; fins lighter than in adults, and vertical bars extended as blotches
onto the base of the dorsal fin in some specimens; Bar 1p at middle of base of caudal fin in
smallest specimens.
view.
Geographical distribution (Fig 1). Rio Uruguay basin in the Rio Cuareim, lower Rio Parana
´
in Argentina; short coastal rivers along the coast of Uruguay from Maldonado to Montevideo.
Comments. R
ˇı
´čan and Kullander [3,4] distinguished two species of Australoheros in coastal
areas of Uruguay east of Montevideo. One was identified as A.facetus, characterised by mod-
ally 6 anal-fin spines and 4 abdominal bars, but with abdominal bars incompletely separated in
their dorsal portion in 80–90% of the specimens. The other species, characterised by 7 anal-fin
spines and 4 abdominal bars in 88% of the specimens, was referred to as A. cf. facetus. The lat-
ter species was represented mainly by a single sample of 74 specimens with stated locality El
Pinar in Canelones (NRM 48074, 48078, 47999). Almost all specimens in this sample were
juveniles or precocious breeders, elongate and with contrasting melanophore pattern (Fig
17A). All other specimens available from El Pinar were deep-bodied like the type series (Fig
17B), and none of those showed a definite breeding colouration.
Revision of the A. cf. facetus sample suggested that it mainly represented A.acaroides, as
supported by the anal-fin spine count (Table 7: modally 6 in A.facetus, modally 7 in A.acar-
oides and the ‘El Pinar’ sample), and that the locality information may not be correct.
The El Pinar sample was collected by Felipe Cantera in November 2000. The handwritten
label accompanying the specimens said ‘Pinares Laguna’, which indicates the name of a
lagoon, or a lagoon in a place called Pinares; but does not point clearly to the city of El Pinar
east of Montevideo, In the city of Maldonado, there is a quarter with the name Pinares, not far
from Laguna del Sauce and Laguna del Diario. The ‘ Pinares’ sample included also one speci-
men of A.scitulus, and one specimen with the non-breeding colour pattern of A.acaroides. At
the time, Cantera was travelling widely in Uruguay, collecting fishes and reptiles or guiding
tourists. His home in Salinas served as holding compound for live fishes destined for the
aquarium trade, shipped principally to Europe. We excluded measurements from the A. cf.
facetus sample from the present analysis because it was possible, even probable, that it was not
correctly labelled, and it was not known how long it was maintained in captivity. It may have
been collected in Pinares but neither A.acaroides, nor A.scitulus, would be expected from
either the Laguna del Sauce or Laguna del Diario, in or near Maldonado. The sample more
likely came from Valentines, which was an important collecting site for Cantera. The A.scitu-
lus specimen may be a contamination in a holding tank. Cantera referred to small inland lakes
as lagunas (Kullander, pers. comm. with Felipe Cantera), suggesting that the Pinares locality
was not necessarily a coastal lagoon. R
ˇı
´čan and Kullander [4] listed the sample on page 5 both
in the material list for A.facetus along with other samples of A.facetus (top of the page), and
separately in the description of A. cf. facetus (bottom of the page). Their map, fig. 1 [4],) has a
symbol for A. cf. facetus both near Montevideo and Valentines, suggesting that some of the
material listed at the top of page 5 includes A.acaroides. The meristic data for A. cf. facetus in
table 7 [4]), however, seems to have been taken only from the ‘Pinares’ sample.
The greater Montevideo area was represented by samples of Australoheros facetus from El
Pinar, San Jose
´de Carrasco, and the lower Rio Pando. NRM 39509, from Laguna del Tronco,
also close to Montevideo, consisted of young adults, relatively deep-bodied, with relatively
light ground colour and contrasting light brown vertical bars, except for one female specimen
in breeding colour pattern which was relatively slender and with intense black markings and
chest. Two specimens in this sample had irregular bars resulting in a count of four abdominal
bars. Out of 14 Argentinian specimens 4 abdominal bars were recorded in four specimens. By
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 51 / 122
contrast all other specimens from Montevideo, including El Pinar, Arroyo Pando, and San
Jose
´de Carrasco, were similar to the specimens from Maldonado being relatively deep bodied,
and overall dark without strong contrast between vertical bars and ground colour, and all pos-
sess 3 abdominal bars, except that four out of 25 juveniles (NRM 56035, 25, 11–14 mm SL)
from the type locality possessed 4 abdominal bars. The contrasting colouration and 4 abdomi-
nal bars prevalent in the ‘El Pinar’ specimens may reflect local conditions of growth and early
breeding influencing body development and correlated pigment pattern. Similar small-size
breeding specimens were observed also in A.acaroides from the Rio Jacuı
´basin.
Samples of Australoheros from the Rio Uruguay basin in Argentina, Rio Arapey, and
tributaries to the Rio Cuareim corresponded in colour and body shape to recently collected
specimens from Montevideo and Maldonado.
Australoheros facetus occurs in several distinct drainage basins in Uruguay. There is no con-
nection between the Rio Pando and the Laguna del Diario. It seems equally unlikely that there
Fig 17. A. Australoheros acaroides, adult female, 49.1 mm SL; NRM 4799: Uruguay: ‘Pinares Laguna’. B. Australoheros facetus, young male, 83.5 mm
SL: NRM 5441; Canelones: El Pinar: El Pinar, isolated pool.
https://doi.org/10.1371/journal.pone.0261027.g017
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 52 / 122
would be any dispersal of Australoheros along the extensive shallow sandy playas extending
from Montevideo to Maldonado. Maldonado and Laguna del Diario are located at the south-
ern tip of the Cuchilla Grande range which forms the divide between rivers draining to the Rio
Negro and ultimately the Rio Uruguay, or to the Rio Santa Lucı
´a, and rivers draining to the
Laguna Merı
´n (Yaguaro
´n, Cebollatı
´, India Muerta, Olimar).
There are no records of A.facetus from Uruguay between the southeastern localities and
the Cuareim localities. This may be a sampling artifact, but it was notable that in Argentina,
the species was reported mainly from Buenos Aires and the Parana
´basin, with few records
from Argentinian tributaries of the Rio Uruguay [86]. Three specimens from the Rio Arapey
basin are discussed here under Australoheros minuano. They were identified as A.facetus
based on morphology, but one of them had a distinct mt-coI haplotype. According to Casciotta
[86], A.facetus is also present in Paraguay, but he did not provide any metadata. R
ˇı
´čan et al.
[13] reported two mt-cyb sequences of A.facetus from Itapu
´a (27˚05’26.26’’S, 55˚,53’13.2’’W)
but did not comment on this record. The coordinates point to Arroyo San Roque, a tributary
of the Rio Parana
´near Encarnacio
´n, Paraguay. The mt-cyb sequence grouped with those of A.
facetus from Argentina and Uruguay (Fig 13).
Steindachner [33,88] reported on specimens of Australoheros from the vicinity of Montevi-
deo. Six specimens (NMW 17383–17385, 17389–17390) were identified as Heros facetus, and
one of these was illustrated [88]. The drawing shows a specimen with wide open gape and
decoloured caudal fin suggesting that it may have died from suffocation and was preserved
after death. An unspecified number of specimens formed basis for the description of a new
species, Heros Jenynsii, illustrated by Steindachner [88]) with a well-preserved specimen with
distinct vertical bars, conforming in scale pattern, colouration, and habitus to Australoheros
facetus as defined here. The illustration shows the mouth closed and the jaws isognathous.
R
ˇı
´čan Kullander [4] used Steindachner’s description of Heros facetus as a diagnosis for A.
facetus, emphasising the upwards directed mouth and projecting lower jaw, while still includ-
ing Heros jenynsii in the synonymy of A.facetus. R
ˇı
´čan and Kullander [4] characterised A.face-
tus in a wide sense by unique prognathous lower jaw, usually four abdominal bars, and unique
reduced scale cover on the dorsal and anal fins.
R
ˇı
´čan and Kullander [4] did not have access to fresh material of A.facetus from the type
locality. The present material included that of R
ˇı
´čan and Kullander, excluding the ‘El Pinar’
sample, but with addition of more specimens from additional localities, most important of
which are large specimens from El Pinar and San Jose
´de Carrasco, and a series of specimens
from the Laguna del Diario.
Eleven of the 12 measured specimens from Laguna del Diario had 6 anal-fin spines, and
only one had 7 spines; among the 25 juvenile specimens not measured, 17 had 6 spines, and
eight had 7 spines. Whereas there evidently were differences in the modal number of anal-fin
spines between different geographical areas, count ranges overlapped, and consequently did
not support recognition of different species in Uruguayan coastal rivers. Jenyns [29] counted 6
anal-fin spines in the holotype of A.facetus. Steindachner (1870) reported 6 anal-fin spines in
his material from near from Montevideo. Argentinian specimens, however, showed more vari-
ation (six with 7, five with 6, as did specimens from the Rio Cuareim (one with 5, four with 6
and two with 7). While the vast majority of Uruguayan Australoheros acaroides possessed 7
anal-fin spines, rarely 6 or 8, anal-fin spine number is indicative of species, but not unique for
either species.
Australoheros facetus is one of the earliest tropical fish species to have been kept and raised
in Aquarium. It was imported from ‘La Plata’ to Germany in 1894, and reproduced in the
same year [28]. There was apparently an earlier importation, to France in 1889 [28], but in that
case, the geographical origin was not reported and the species identity remains uncertain. In
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 53 / 122
the aquarium hobby in the United States and Europe, A.facetus was known as chanchito, a
Latin American Spanish word meaning piglet. The earliest use of the name chanchito in aquar-
ium literature may be traced to Du¨rigen in 1894 [89], who explained the name as referring to
the compressed body and high arched (‘hochgewo¨lbten’) back, reminding of a swineback
ridge. In 1955, Axelrod and Schultz [90], with an illustration showing Amatitlania nigrofas-
ciata (Gu¨nther, 1867), used the English name Chameleon cichlid (in limited use in German as
Chama¨leonsfisch employed by Geyer [91] in 1896 and perhaps earlier), instead of chanchito,
and this name replaced chanchito in English literature.
The vernacular names chanchito, chanchita, as well as castañeta, are confirmed for Argen-
tina [14,92]), but only castañeta for Uruguay [93]. It seems more likely that the name refers to
the sound emitted by specimens being handled than to suine morphology. Based on the ver-
nacular name, the first individuals reaching the German ornamental fish market came from
Argentina although Brazil was also noted as origin of late 19th Century imports to Germany
[91]. No particular vernacular name seems to be recorded for species of Australoheros in Bra-
zil, where cichlids are addressed with the general acara
´or cara
´. Malabarba et al. [94] used cara
´
amarelo for A.acaroides, but it looks like a recent construction. Santos [95] used Acara
´-cas-
cudo for Cichlasoma facetum], but this name has been applied also on species of Cichlasoma
[96].
Material examined. NMW 17383 (1), 17384–17385 (2), 17389 (1), 17390 (1); Montevideo,
registered March 1869.–NMW 17324–17325 (2), 17324 (1), 58722 (1), 17326 (1); Montevideo;
registered March 1869; syntypes of Heros Jenynsii.—Argentina: Rio de la Plata coastal streams:
NRM 33035, 2, 96.6–108.3 mm SL; Buenos Aires: Rio de la Reconquista, 100 m downstream of
Represa La Reja, 3 km S of village La Reja; 34˚41’S 58˚50’57’’W; S. Ko¨rber 18 Mar 2008.–NRM
33033, 3, 78.2–108.6 mm SL; Aquarium, originally from Buenos Aires: Rı
´o de la Reconquista,
La Reja, below dam; S. Ko¨rber, unknown date.—Argentina: Rio Parana
´basin: ZFMK 39750–
39751, 2, 97.5–106.2 mm SL; Santa Fe
´: Lago del Sur in Santa Fe
´, 31˚6.5’S 60˚7.5’W [31˚
39’52.6"S 60˚42’47.9"W]; S. Koerber et al., 18 Jan 2000.—ZFMK 39781, 3, 109.1–114.6 mm SL.
—Argentina: Rio Uruguay basin: NRM 33050, 1, 40.6 mm SL; Entre Rı
´os: Gualeguaychu
´:
Arroyo El N
˜ancay, where crossing RN14, 33˚22’51’’S 58˚44’14’’W; S. Ko¨rber, 28 Sep 1995.—
ZFMK 39517–39518, 2, 83.0–85.1 mm SL: Entre Rı
´os: Colo
´n: Ubayay: Estancia Los Monigotes
on road to harbour, 31˚49.64’S, 58˚10.74’W. Koerber, R. Filiberto, J.O. Fernandez Santos, 2
Feb 2002.—ZFMK 39771–72, 1,95.9 mm SL; Entre Rı
´os: Colo
´n: Ubayay: Estancia Los Moni-
gotes downstream of ZFMK 39517–39518, 31˚49’64’S, 58˚10.74’’W; S. Koerber, R. Filiberto, J.
O. Fernandez Santos, 2 Feb 2002.—Uruguay, Rio Uruguay basin: NRM 51073, 1, 24.7 mm SL:
Artigas: Rio Cuareim basin: Escuela Piedra Pintada [about 30˚30’2"S 56˚26’28"W]; P. Laurino
et al.,16 Aug 2003.—NRM 52237, 4, 125.2–147.4 mm SL: Artigas: Rinco
´n de Pacheco, 1 km
from estancia buildings, cañada tributary of the Rio Cuareim, 30˚40’22"S 56˚10’51"W; S. Kul-
lander et al., 9 Oct 2004.—NRM 52565, 2, 8.6–101.7 mm SL; Artigas: Arroyo Catala
´n Grande,
tributary of the Rio Cuareim, below bridge on road 30, 0˚50’30.6"S 56˚14’20"W; S. Kullander
et al., et al. 11 Oct 2004.—NRM 52635, 1, 102.5 mm SL; Rio Cuareim basin: tributary of the
Arroyo Macedo, about 17 km on dirt road from road 30 to Rinco
´n de Pacheco, 30˚39’15"S 56˚
18’43"W; S. Kullander et al., 8 Oct 2004.—NRM 70401, 35 juveniles; Artigas: Arroyo Falso
Mandiyu, Ruta 3, Km 589.850, below bridge, 30˚33’06"S 57˚40’06"W; S. Kullander et al., 15
Feb 2007.—Uruguay, Rio de La Plata coastal streams: NRM 54218, 5: 23.8–45.3 mm SL; NRM
56598, 1, tissue NRM 56606, 1, tissue; NRM 56607, 1, tissue; Maldonado: Laguna del Diario,
34˚54’19"S 55˚00’29"W; S. Kullander et al., 31 Oct 2005.—NRM 55720, 7, 55.4–145.4 mm SL;
NRM 56035, 25, 11–14 mm SL; NRM 56430–56446, 26, not measured; Maldonado: Laguna del
Diario, 34˚54’17S 55˚00’29"W; S. Kullander et al., 21 Oct 2007.—NRM 37036, 1, c&s; NRM
37038; 1, c&s [macerated]; NRM 37039, 1, c&s [macerated]; NRM 37040, 1, c&s; NRM 39509,
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 54 / 122
14, 58.2–98.1 mm SL; Canelones: Arroyo Pando basin; Laguna del Tronco at Salinas, 3.7 km
from Montevideo on Ruta Nacional 1 to Atla
´ntida, 500 m off road toward Pando, 34˚46’00"S
55˚54’00"W; F. Cantera et al., 20 Jan 1997.—NRM 39552, 1, 102.9 mm SL; Canelones: Laguna
Arenera de Carrasco at San Jose
´de Carrasco, 18 km on road Montevideo-Atla
´ntida, 200 m off
Ruta Nacional 1, 34˚51"S 56˚01’0"W; F. Cantera et al., 15 Jan 1997.—NRM 43453, 6, 13.7–26.9
mm SL; Canelones: Salinas, Arroyo Tropa Vieja, about 34˚47’232"S 55˚52’1.6"W; F. Cantera,
18 Dec 1997.—NRM 43485, 1, 143.5 mm SL; Canelones, San Jose
´de Carrasco, easternmost
pond, 34˚50’08"S 55˚59’16.0"W; F. Cantera, 29 Nov 1997.—NRM 50997, 1, juv.; Canelones:
Arroyo Caracoles, on road 8, Km 59, at margin of Soca village, under bridge; S. Kullander et al.
15 Oct 2004.—NRM 51068, 5, 30.3–37.9 mm SL; Canelones: Arroyo Pando, side arm; P. Laur-
ino et al., 23 Mar 2003.—NRM 51069, 2, 48.2–54.1 mm SL; Canelones: Arroyo Pando, stream;
P. Laurino et al., 23 Mar 2003.—NRM 52238, 8, 24.9–64.4 mm SL; Canelones: Arroyo Sarandı
´
on Highway 18, Km 54, under bridge, 34˚45’02"S 55˚40’04"W; S. Kullander et al., 15 Oct 2004.
—NRM 52591, 2, 76.0–95.2 mm SL; 54412, 2, 83.5–103.1 mm SL; Canelones: El Pinar: El
Pinar, isolated pool; 34˚47’53"S 55˚53’03"W; S. Kullander et al., 13 Oct 2004.—Portugal: Rio
Guadiana basin: MUHNAC uncat., 1, 107.6 mm SL; Algarve: Ribeirão Odeleite alto at Vila
Real; J. Nadeira, J. Alves and E. Santos.—MUHNAC uncat., 1, 93.6 mm SL; Alto Alentejo:
E
´vora harbour; F. Barroso, G. Texeira and V. Ferreira, 31 Jan 1981.—MUHNAC uncat., 76.1
mm SL; Baixo Alentejo: Rio Ardila at Santo Amador; 25 Jul 1985.—MUHNAC uncat. 6, 8.33–
115.8 mm SL; Alto Alentejo: Rio Degebe at Amieiera; 5 Jun 1980; G. Teixeira and V. Ferreira.
Australoheros oblongus (Castelnau, 1855). Chromys oblonga Castelnau, 1855 [30]: 14
(holotype MNHN 9485; type locality le Tocantins (Province de Goyaz).
Heros autochthon Gu¨nther, 1862 [31]: 299 (syntypes BMNH 1961.7.7.2–4, one syntype not
found; type locality Brazil).
Australoheros barbosae Ottoni & Costa, 2008 [6]:213, (holotype, UFRJ 7558; type locality
Brazil: Estado de Minas Gerais: between Municı
´pio de Passa Vinte and Santa Rita da Jacutinga:
tributary from [sic] Rio Bananal, rio Preto basin, 24 km from Passa Vinte, street between Passa
Vinte and Santa Rita da Jacutinga).
Australoheros paraibae Ottoni & Costa, 2008: 222 [6], fig. 11 (holotype UFRJ 7559; type
locality Brasil: Estado de Minas Gerais: Municı
´pio de Juiz de Fora: stream tributary to rio do
Peixe, between Toledo and Torreões).
Australoheros robustus Ottoni & Costa, 2008: 224, fig. 12 [6] (holotype MNRJ 32180; type
locality Minas Gerais: Mar de Espanha: stream Cachoeirinha, tributary from [sic] co
´rrego do
Areia, rio Paraı
´ba do Sul basin; spelled A.rostrunrobustus on p. 212).
Australoheros macacuensis Ottoni & Costa, 2008: 216, fig. 8 [6] (holotype UFRJ 7254; type
locality Brazil: Estado do Rio de Janeiro: Municı
´pio de Cachoeiras de Macacu: rio Japuı
´ba).
Australoheros mattosi Ottoni, 2012:85, fig. 1 [6] (holotype UFRJ 0752; type locality Brazil,
Minas Gerais state: tributary of rio das Velhas, between Santana do Pirapama and Jequitiba
´,
rio São Francisco basin).
Australoheros montanus Ottoni, 2012 [9]: 86, fig. 3 (Holotype MNRJ 32555; type locality
Brazil: Rio de Janeiro state: Carmo, co
´rrego Tanque, tributary of the rio Paraı
´ba do Sul, locality
of Passa Três (21˚49’S/42˚32’W).
Australoheros mattosi Ottoni, 2012 [9]:85, fig. 1 (holotype UFRJ 0752; type locality Brazil,
Minas Gerais state: tributary of rio das Velhas, between Santana do Pirapama and Jequitiba
´,
rio São Francisco basin).
Australoheros tavaresi Ottoni 2012 [9]: 92, fig. 7 (holotype MZUSP 50675 A; type locality
Brazil: São Paulo state: Guarulhos, lagoon on the margin of the rio Tietê).
Definition. Based on the position in the mt-cyb and mt-coI trees and minimum uncorrected
p-distance in mt-coI exceeding 2% from all other species of the genus, Australoheros oblongus
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 55 / 122
is a distinct evolutionary lineage. No morphological autapomorphy was detected; however, A.
oblongus is geographically isolated from all other species of Australoheros except A.ipainguen-
sis from which large adults can be distinguished by a steep frontal contour with a slight inden-
tation at level of orbits; only exceptionally presence of Y bar; caudal spot at middle of caudal-
fin base instead of usually entirely or predominantly located on upper lobe of caudal fin; lateral
band typically irregular and narrow, but may be represented by dark blotches similar to the
zipper band in southern species of Australoheros.
Description of sample. Meristic data are given in Tables 3–9proportional measurements in
Table 11. For variation in body shape, see Fig 18.
Sexes isomorphic except for vertical and pelvic fins slightly longer in some large males than
in large females, and genital papilla in males slender, conical, in females wider, blunt. Moder-
ately elongate, dorsal and ventral contours approximately equal in curvature; frontal contour
ascending slightly curved or straight, continuous with slightly curved dorsal-fin base contour;
some large specimens with straight dorsal-fin base contour and steep frontal contour raising
to sharp bend anterior to origin of dorsal-fin base; but nuchal protuberance not observed;
slight indentation in frontal contour at level of orbit present or absent. Prepelvic contour
slightly curved, similar to predorsal contour. Caudal peduncle contours slightly curved or
straight. Abdominal contour straight horizontal, except slightly convex in females. Anal-fin
base slightly convex, ascending. Head short, laterally compressed. Snout short, blunt, subtrian-
gular in lateral aspect, narrowly rounded in dorsal aspect. Mouth terminal, forward directed,
at level of lower margin of orbit or slightly more dorsal on specimens with large eyes. Lips
moderately thick. Jaws equal in anterior extension; maxilla and premaxilla not reaching to ver-
tical from anterior margin of orbit. Orbit removed from frontal contour, in middle of head
length, in upper half of head. Teeth in outer hemiseries in upper/lower jaw 9–14/10–18. Inner
teeth in 2 rows, exceptionally 3 rows in lower jaw. Bicuspid teeth observed in holotype only.
Gill rakers externally on first gill-arch 2–3 epibranchial, one in angle and 5–7 ceratobranchial.
Microbranchiospines present externally on 2nd to 4th gill-arch.
Scales on body finely ctenoid. Predorsal midline scales about 10–14, about half size of flank
scales, covered by skin, only part with exposed margin, irregularly arranged, weakly ctenoid.
Cheek scales in 3–4 (rarely 2) rows, cycloid, covered by skin. Opercular scales cycloid, covered
by skin or margin partly exposed. Accessory lateral line scales absent from caudal fin. Between
first upper lateral line scale and dorsal-fin origin 3 large scales. Between last upper lateral line
scale and dorsal fin one large and one small scale. Prepelvic scales about half size of flank
scales, embedded in skin, without free margin. Lateral chest scales ctenoid, with exposed mar-
gin, about 2/3 size of flank scales. Fin scales ctenoid. Row of minute scales along dorsal-fin
base from 9th–13th spine, interradial scales from between 11th to 15th spine caudad, on soft
fin in one or two rows with up to 7 scales between two soft rays, scales present also on last two
interradial membranes. Anal fin with narrow basal scale layer from 4th to 6th spine, on soft-
rayed portion up to 5 scales in interradial row.
Dorsal–fin spines increasing in length to 6th from which subequal, last spine longest, soft
dorsal-fin rounded or subacuminate in young; in large adults with long pointed tip, 4th or fifth
ray longest, reaching to end of caudal fin or slightly longer. Soft anal fin rounded or subacumi-
nate in young; in adults with long pointed tip, 4th or fifth ray longest, reaching to end posterior
1/4th of caudal fin. Pectoral fin rounded, 4th or 5th ray longest, reaching to vertical from geni-
tal papilla or base of first or second anal-fin spine. Pelvic fin pointed, first ray longest; in young
reaching to base of 3rd anal-fin spine; in adults produced, at most to soft anal fin-fin base. Cau-
dal fin rounded.
Colouration in preservative. Ground colour fawn or pale grey. Bars 1(a, p) to 6 present, dark
brown or dark grey, 2–3 scales wide; Bar 6 absent above lateral band or extending only short
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 56 / 122
Fig 18. Australoheros oblongus. A. Adult male, 78.6 mm SL; MCP 287195; Brazil: Minas Gerais: Abadia dos
Dourados: Rio Grande drainage: Rio Preto on road Palmito–Abadia dos Dourados. B. Adult female, 76.9 mm SL; MCP
49007; Brazil: Minas Gerais: Cardeal Mota: Rio Cipo
´drainage, arroio on road Jaboticatubas to Cardeal Mota. C. Adult
male, 84.0 mm SL; LBP 17525; Brazil: Minas Gerais: Bom Jardin de Minas: Rio Paraı
´ba do Sul drainage: Cachoeira do
Pacau, Ribeirão da Bom Jardim de Minas, reversed. D. Adult male, 67.4 mm SL; MCP 31877; Brazil: Minas Gerais:
Ouro Preto: upper Rio Doce basin: Lagoa do Manso in Parque Estadual de Itacolomi, reversed.
https://doi.org/10.1371/journal.pone.0261027.g018
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 57 / 122
distance above it; Interbars 1–2 scales wide; lateral band on E1 scale row extending from gill
cleft caudad to Interbar 4; Bar 5 integer, extending dorsally at most to dorsal-fin base. Bars ver-
tical or dorsal and ventral portions of bars 2–4 slightly caudally inclined. Bars 5 and 6 excep-
tionally forming Y-mark dorsally. Dorsal portions of Bar 7 present, expressed as short rostrad
inclined brown or grey bars crossing anterior dorsal-fin base and occiput, respectively. Midlat-
eral black or dark brown blotch present in Bar 4 on E1 scales and parts of adjacent scales; cor-
responding portions of bars 2 and 3 may be slightly widened or more intensely pigmented but
distinct spots absent from bars 2 and 3. Bars 2–4 extending dorsad onto base of dorsal fin. In
Bars 2–6, vertical black stripe may be present at middle or posterior margin of scales below
scale row 0. Caudal spot (Bar 1p) distinct, forming vertical bar across middle of caudal-fin
base. Vertical fins pale grey, semitranslucent. Pelvic fin dark grey distally, lighter medially.
Geographical distribution (Fig 1). Small streams in the Rio Paraı
´ba do Sul basin; Rio Tietê
and other basins of the Rio Grande (headwaters of the Rio Parana
´); tributaries of the upper
Rio São Francisco and upper Rio Doce; Rio Guandi and Rio Macacu basins.
Comments. The holotype of Australoheros oblongus, 96.9 mm SL, was in a very bad state of
preservation. The general habitus, conforming to Australoheros, was well preserved but the
body was soft and completely decoloured. Almost all scales were lost; many fin rays were bro-
ken and several were detached from their pterygiophores. Scale pockets showed scales to have
been proportionally large, about 24 along the middle of the side, predorsal scales 10 or 11,
cheek scale rows 4. Dorsal-fin rays XV.10. Anal-fin rays VII.8. Vertebrae 13+13 = 26. The ante-
rior jaw teeth were slightly enlarged, and in the upper jaw also bearing a minute secondary
cusp.
According to Castelnau [30] the single specimen basis for the description of Chromys
oblonga was in a bad state of preservation already at the time of description, lacking scales and
pectoral fins. It was possibly for that reason that Castelnau did not provide an illustration. The
holotype is clearly a specimen of Australoheros, and the only record of Australoheros from the
RioTocantins basin. Both Pellegrin [36], who had access to the holotype, and Regan [37] noted
the similarity to Heros autochthon.
Three heroine cichlid genera, Pterophyllum Heckel, 1840, Hypselecara Kullander, 1986, and
Mesonauta Gu¨nther, 1862, were recorded from the Araguaia and Tocantins rivers. Among
them, Pterophyllum is distinguished by its very small scales and rounded body shape, and very
long dorsal, anal, and pelvic fins [53]. Species of Mesonauta are very different in body shape
from the holotype of A.oblongus, being deep-bodied, strongly compressed, with pointed snout
and about straight predorsal contour; also possessing very long pelvic fin [97]. Hypselecara
temporalis (Gu¨nther, 1862), the only species of that genus recorded from the Rio Tocantins,
redescribed by Kullander [53], is similar in fin-ray counts to the holotype of A.oblongus, and
other species of Australoheros (dorsal-fin rays XVI–XVII.10–12; anal-fin rays. VI–VIII.8–10;
[53]. It has relatively large scales but still slightly more than in most species of Australoheros
(25–28 [53] vs 23–26; 27 in A.mboapari; about 24 in the holotype of A.oblongus); and more
vertebrae (13+14, 14+13, 14+14 [53] vs usually 13+13 as in the holotype of A.oblongus). Hyps-
elecara temporalis differs in body shape and colour pattern from all species of Australoheros.
Juveniles are elongate, with markedly pointed snout; adults are moderately to conspicuously
deep-bodied, with gently rounded dorsal and ventral contours, with a straight ascending,
steep, and only slightly indented frontal contour. The body depth range 45.5–58% SL is higher
than in any species of Australoheros, and in the holotype of A.oblongus (about 25%). The col-
our pattern includes a large dark blotch on the middle of the side, a horizontal lateral band,
and only indistinct vertical bars. The colour pattern of the holotype of A.oblongus, however, is
unknown. Bicuspid teeth, present in the holotype of A.oblongus were recorded from species of
Mesonauta and Pterophyllum, but not from Hypselecara [53,97].
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 58 / 122
The overall shape of the holotype of A.oblongus, the markedly concave frontal contour, the
relatively large scales, large symphysial teeth, bicuspid upper jaw teeth, and fin-ray counts alto-
gether suggest that it represents a species of Australoheros. The expedition during which it was
collected started from Rio de Janeiro and went north by way of Mage
´, Mariana, Ouro Preto,
Belo Horizonte, and Catalãbefore reaching Goia
´s and the Rio Tocantins basin [98,99]. It thus
passed the Rio Paraı
´ba do Sul, tributaries of the Rio Doce, the Rio São Francisco, and the Rio
Paranaı
´ba (Rio Parana
´basin). It remains possible that the specimen of A.oblongus was col-
lected on some other occasion and erroneously attributed to a collection made in the Rio
Tocantins, or that Castelnau’s observations in the Tocantins basin were made on some other
cichlid species obtained in the Rio Tocantins, e.g. Hypselecara temporalis, mistakenly confused
with an Australoheros specimen from another collection site. No other specimens of Australo-
heros have been reported from the Rio Tocantins or Amazon basins, supporting the hypothesis
that the holotype of Chromys oblonga was not collected in the Rio Tocantins basin. The possi-
bility of mislabelling must also be considered; despite Castelnau’s (1855: 14) claim ‘remarqable
par la forme très allonge
´e de son corps’, MNHN 9484 is not conspicuously elongate. The body
proportions (97 mm SL; approximately 120 mm TL; body depth 38 mm), however, agreed
with Castelnau’s description (length12½cm, body depth 4 cm). The meristic data were also
similar or identical. Counts and measurements did not refute the identification of the speci-
men as the holotype of A.oblongus.
Gu¨nther [31] described Heros autochthon in quite some detail, indicating that the descrip-
tion was based on four specimens (listed as a,b,c,d), presented by Lord Stuart. Regan [37]
referred H.autochthon to Cichlosoma and listed three specimens of Cichlosoma autochthon
with Brazil, Lord Stuart as provenance. To this he added one specimen without data, two from
Theresopolis [state of Rio de Janeiro], collected by Go¨ldi, and one from Porto Real ((state of
Rio de Janeiro), collected by Hardy du Dre
´neuf. In the rest of the paper, type specimens were
clearly indicated, but types were not mentioned in the entry for Cichlosoma autochthon. The
significance of Regan’s list is that in 1905 only three specimens marked as donated by Lord
Stuart were identified in the BMNH collection. These were most likely BMNH 1961.7.7.2–4,
which were registered by M. Hudson and Humphry Greenwood in 1961. Greenwood left a
note with that object that ‘The original description lists 4 types. The fourth specimen listed in
Regan’s catalogue has been examined and no justification found for including it.’ ‘Regan’s cat-
alogue’ refers to a catalogue maintained by Regan separate from the museum register, and into
which he pasted cataloguing data from his publications. The fourth specimen was probably
BMNH 1961.7.7.6, which was not registered on that date, but later. It was still not registered in
1992, when SK examined the specimen. The specimens in BMNH 1961.7.7.2–4 were some-
what soft and had lost much of the dark pigmentation, but were otherwise in good condition,
and clearly represent a species of Australoheros. BMNH 1961.7.7.6 was in a poor state of con-
servation. It was full of encrustations and decalcified as a consequence of having been stored in
zinc chloride. It represents a species of Australoheros, but because of the difference in preserva-
tion, its status as syntype may be doubted. Throughout its catalogue record it has been sepa-
rated from the three specimens reasonably certain to be syntypes of H.autochthon.
Based only on photographs of the specimens in the type series of A.autochthon, Ottoni [9]
stated that three of the specimens did not allow ‘positioning’, probably means identification at
genus level)] on account of the state of preservation, and declared that the fourth specimen
‘does not belong to the genus Australoheros, not possessing interruptions of trunk bars 6–7,
probably, even not belonging to the tribe Heroini.’ Nonetheless, Ottoni declared the fourth
specimen as lectotype of Heros authochthon. This supposedly resulted in a lectotype for a non-
heroin cichlid species which was not identified; an awkward situation not covered by the Inter-
national Code of Zoological Nomenclature [43]. Australoheros. Ottoni also claimed that the
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 59 / 122
likely type locality of Heros autochthon–Rio de Janeiro–based on the fact that Lord Stuart was
based there, is unjustified, but did not present an alternative. Rejection of both the locality and
the generic identification would remove the need to include A.autochthon in assessing the
validity of the many nominal species meanwhile described from the Sudeste. As obvious from
our examination of the syntypes, the three specimens in BMNH 1961.7.7.2–4, were in rela-
tively good condition considering their age, and represent a species of Australoheros. The spec-
imen selected as lectotype by Ottoni, was in a poor state of conservation, but still recognised
as representing a species of Australoheros. There is, however, no evidence that the proposed
lectotype was ever part of the type series. Consequently, Ottoni’s lectotype designation was a
suboptimal choice because of the poor state of preservation and unproven type status of the
specimen. It was also an unnecessary act because it did not resolve any taxonomic problem,
but rather could have created a problem if indeed the selected specimen were of a different spe-
cies. In the absence of any contrary evidence, and given the species identity, metadata stating
that the syntypes were donated by Lord Stuart, with locality Brazil makes it most plausible that
the type series was indeed acquired by Lord Stuart in Rio de Janeiro.
Charles Stuart, Lord Stuart de Rothesay (1791–1845) was a British diplomat, for some time
Envoy to Portugal and Brazil. He visited Rio de Janeiro in July 1825 to negotiate the indepen-
dency of Brazil on behalf of the King of Portugal. We have no information about later visits to
Brazil. The BMNH collection is in possession of one more fish specimen (Sargus unimacula-
tus) and several bird specimens [100]. Gray [101]) listed 21bird objects in BMNH donated by
Lord Stuart, each with 1–2 specimens. Seventeen of them had Brazil as locality, the other four
South America. These records show that Lord Stuart possessed a sizeable collection of speci-
mens from Brazil, not just some odd fish specimens. It is not documented exactly when he
acquired these specimens, when they were acquired by the BMNH, or whether they were
obtained by Stuart in Brazil or given to him by some other person before or after his visit to
Brazil. There is, however, no better explanation, based on the scant metadata and species con-
cerned, than that at least those with Brazil as locality were acquired in connection with Lord
Stuart’s brief visit to Rio de Janeiro in 1825.
Examination and X-radiographs of all three syntypes of H.autochthon supported the identi-
fication as specimens of Australoheros. Whereas live colours are not known, fin-ray, scale, and
vertebral counts fall within the ranges of Australoheros. There are no character states known
that separate Heros autochthon from Chromys oblonga. Both type series were collected in
southeastern Brazil, an area from where two species of Australoheros are recorded. The type
specimens are relatively elongate, similar to Australoheros in general, and present a steep,
slightly indented frontal contour, present also in some specimens from inland localities in the
Sudeste and different from the generally more rounded profile and steep, straight frontal con-
tour of A.ipatinguensis. Shape variation within Australoheros was extensive, however, so that
reliable distinguishing characters could not be established based on body contours or propor-
tions. Nonetheless, we synonymise here Heros autochthon with Chromys oblonga for want of
any indication of species distinctness. To this synonymy we add A.barbosae,A.macacuensis,
A.mattosi,A.paraibae,A.robustus, and A.tavaresi.
Table 21 summarises a selection of characters taken from the species diagnoses in the origi-
nal descriptions of nominal species that list differences among Sudeste species [5,6,8–11].
The diagnoses are complex, e.g., more than 100 words in one sentence for A.sanguineus,
incorporating author citation and external references; consequently mainly numerical charac-
ters were added to the table, and where explicit comparison with a taxon was lacking–primar-
ily A.ribeirae, the first in the suite–data was added from the description of that species. Ottoni
et al. never presented a morphology-based phylogenetic analysis. In their molecular analysis
[47], it is also absent. Ottoni et al. [47] did not adjust the morphological definitions according
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 60 / 122
Table 21. Comparative matrix of character states based on a semi-random subset of data in diagnoses of nominal species from the Sudeste with emphasis on species 12–19 as numbered here.
Nominal
species
D
SPINES
D
RAYS
A
SPINES
A
RAYS
RIBS P
RAYS
EPIB 1 EPIB 2 D
RADIALS
A
RADIALS
E1
SCALES
ECTOPT CPLEN LOWER
JAW
SNOUT BAR 7
WIDTH
BODY
DEPTH
A
SPINE
MOUTH PREORB A
SCALES
LAST D
SPINE
A.
ipatinguensis
15 10–11 7 9 10 14 LONG Short 24–25 13 25–26 Narrow 6.6–8.0 17.0–19.2 Common Same
width
47.3–
51.2
14.3–
15.6
Isognath 56.6–60.3 From
spine 6
14.2–
16.6
A.macaensis 16 10–11 7–8 8–9 11 14 Long Long 25 13–14 25–28 Wide 7.6–
10.8
20.0–22.9 Common same
width
44.0–
48.2
13.6–
17.1
Isognath 55.0–58.8 From
spine 6
12.8–
16.4
A.muriae 15 11–12 6–8 9–10 10–11 14–15 LONG Long 24–25 N/A 27–29 Wide 7.1–8.9 19.4–27.6 Common Same
width
43.8–
50.1
14.3–
17.0
Isognath 56.3–72.7 From
spine 6
14.0–
17.3
A.autrani 15–16 10–12 7–8 9–10 10 14 LONG Long 25–26 13–14 25–28 Wide 10.2–
11.2
18.0–20.6 Common same
width
45.7–
50.9
15.9–
17.1
Isognath 54.9–60.8 From
spine 6
A.
saquarema
16 10–11 7 9 10 14 LONG Long 25–26 14–15 25–27 Wide 6.7–9.0 20.0–21.9 Common Same
width
44.0–
48.2%
15.9–
17.1
Isognath 66.0–69.1 From
spine 6
13.9–
16.9
A.capixaba 15–16 10–11 6–7 8 10–11 14 LONG Long 23–25 12–13 26–28 Wide 9.6–
11.4
16.8–22.2 Common Same
width
42.6–
50.3
14.0–
17.2
Isognath 54.1–68.8 From
spine 6
13.0–
18.1
A.perdi 14–16 9–11 6–8 8–10 11 11–13 LONG Long 22–24 13 25–27 Wide 9.3–
11.6
19.6–28.4 Common same
width
40.0–
56.0
14.4–
20.8
Isognath 61.8–84.0 From
spine 6
13.3–
20.4
Total
variation
14–16 10–12 6–8 8–10 10–11 11–15 Long 22–26 12–15 25–29 6.6–
11.6
16.8–28.4 40.0–
56.0
14.0–
20.8
54.1–85.8 13.3–
20.4
A.barbosae 16 10–11 7–8 9–10 11 14–15 LONG Short 24–26 13–14 25–28 Wide 5.5–
8.7%
17.3–23.3 Common same
width
44.6–
49.0%
13.8–
15.9
Isognath 60.5–65.3 From
spine 6
13.4–
15.8%
A.
macacuensis
16 10–11 7–8 8–9 10–11 14 LONG LONG 24–25 13 25–28 Wide 5.1–
7.9%
20.3–
22.9%
Common Posterior
wider
46.6–
49.8%
13.8–
16.5%
Isognath 62.2–
65.4%SL
From
spine 6
12.6–
15.9%
A.paraibae 15–16 10 7–8 8–9 10 13–14 LONG Short 25 13–14 26–128 Wide 6.4–
8.1%
19.8–21.9 Common Same
width
42.6–
46.1%
12.2–
13.3%
Isognath 60.4–
65.2%SL
From
spine 6
11.9–
13.5%
A.tavaresi 16–17 10–11 7–8 8–9 11 14–15 Long Short 26 13 27–29 Wide 9.8–
11.6%
19.6–21.7 Common same
width
39.0–
42.2%
14.1–
16.4
Prognath 51.2–
60.0%SL
From
spine 6
13.5–
15.8%
A.montanus 15–17 9–10 6–8 8–9 10–11 13–14 LONG Short 24–25 13 25–28 Wide 10.1–
11.9%
19.3–25.7 Common Posterior
wider
41.1–
48.9%
12.4–
17.0%
Isognath From
spine 6
12.2–
17.1%
A.robustus 17 8–9 7–8 7–8 9–10 13–14 LONG Short 24 N/A 26–28 Wide 7.4–
9.2%
20.0–
25.2%
Robust Same
width
43.7–
46.0%
13.3–
15.6%
Isognath 53.3–
68.7%
From
spine 6
13.1–
15.6%
A.mattosi 16–17 9–10 6–8 8–9 11 14 N/A N/A 24–25 12 25–29 Wide 7.6–
10.8
17.7–
25.4%
Common same
width
41.5–
45.2%
13.5–
17.3%
Isognath 56.7–64.0 From
spine 3
13.2–
15.4%
A.ribeirae 16 9–10 6–7 8 11 14 long Long N/A N/A 24–26 Narrow 6.6–9.1 17.7–23.1 Common Same
width
47.4–
51.3%
N/A Isognath 64.2–
73.3%
N/A 16.0–
16.8%
Total
variation
15–17 8–11 6–8 7–10 9–11 13–15 24–26 12; 13–14 24–29 5.5–
11.9%
19.3–
25.7%
39.0–
51.3%
12.2–
17.3
51.2–73.3 11.9–
17.1%
The upper half represents Australoheros ipatinguensis, the lower part A.oblongus and A.ribeirae. Within each part, pink cells mark absence of differences between nominal species; green boxes
mark unique character states, i.e., potential autapomorphies; yellow boxes mark the complement of green boxes, i.e., potential synapomorphies, but more likely symplesiomorphies. Data include
ratios (body depth per cent of SL; preorbital depth percent of head length, caudal-peduncle length per cent of SL; length of last dorsal-fin spine per cent of SL; length of last anal-fin spine per cent of
SL), colour pattern (relative width of Bar 7), meristic data (dorsal-fin spines, anal-fin spines, dorsal-fin soft rays, anal-fin soft rays, ribs, pectoral-fin rays, E1 scales, distal radials supporting dorsal
fin, distal radials supporting anal fin), osteology (length of epibranchial 2 epiphyses, length of epibranchial 1 arm, width of ectopterygoid), qualitative characters (shape of snout robust or not robust;
relative length of lower jaw; position of most anterior scale on anal-fin base).
https://doi.org/10.1371/journal.pone.0261027.t021
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 61 / 122
to the novel MOTUs, or explain why some samples could not be identified to species; our
review thus is based on the original diagnoses, but may then not reflect the conclusions of the
molecular analysis.
The tabulated proportional measurements show series of overlaps between nominal species,
i.e. there were no unique character states in those characters. Two character states in A.mattosi
appear to be diagnostic: the 12 anal-fin radials (pterygiophores) and the anal-fin squamation
starting at the third anal-fin spine. Carmo and Triques [102] listed 12–13 radials in A.mattosi;
13 radials is a common count recorded in nominal species of Australoheros. They described
the anal fin-squamation as ‘scales originating from 4th spine to 1
st
ray’ which gives a range up
to the eight spine. The anal-fin scale character state was also not confirmed in our specimens
from the Rio São Francisco basin.
All diagnoses listed a few differences specific for a compared species. Although this was not
stated, and comparisons typically were made between two or more species at a time, these mul-
tiple comparisons resulted in a unique combination of character states for each nominal taxon.
Comparisons with Uruguayan species were uncontroversial (except the vertebral count made
with different methods) and mostly invariant. Osteological characters were discussed above,
p.00.
Ottoni and Costa [5,6] recognised two character states in the vertical bars among their
Sudeste species of Australoheros: presence of a forked Bar 5 in A.ipatinguensis and A.paraibae;
absent in A.autrani,A.saquarema,A.macacuensis,A.macaensis,A.barbosae,A.muriae, and
A.robustus. It is uncertain what forked bar 5 refers to. It may not refer to the Y mark as their
figs 1, captioned as A.autrani), 9 ((captioned as A.macaensis), and 13 (labeled as A.saquar-
ema), show the Y mark. If it refers to the vertically split ventral portion of Bar 5, none of their
images shows that condition.
The type series of Australoheros barbosae consists of the holotype, 59.3 mm SL, and 17 para-
types, 24.9–96.2 mm SL, from the Rio Preto, a tributary of the lower Rio Paraı
´ba do Sul. The
diagnosis refers to multiple species comparisons, mainly concerning fin-ray counts differing
from one or another nominal species No autapomorphic character was indicated.
Australoheros paraibae was based on the holotype, 50.9 mm SL, and 11 paratypes, 22.1–61.1
mm SL, all from the Rio do Peixe, a tributary of the middle Rio Paraı
´ba do Sul. The diagnosis
is very long and exclusively based on multiple species comparisons, including meristic data,
and various proportions involving preorbital length, body depth, and dorsal fin-spine length,
differing from one or another nominal species According to the to the description A.paraibae
has a dark spot in the ‘caudal peduncle zone’, but on fig. 11 in the original description [6],
there is a blotch at the base of the caudal fin and only a faint vertical bar covering the lateral
extent of the caudal peduncle.
Australoheros robustus was described based on the holotype 74.5 mm SL), and 68 paratypes,
17.3–74.5 mm SL, from the Co
´rrego da Areia, a tributary of the upper Rio Paraı
´ba do Sul. The
diagnosis is mainly based on multiple comparisons of meristic data distinguishing from one
or another species, but also robust snout. The criterion of ‘robust’ was not specified in the
description, but may reflect stoutness or sturdiness in distinction from something compara-
tively delicate. The image, fig. 2 [6] of the ventral aspect of the anterior part of the head of a
paratype each of A.Robustus and A.muriae does not have an annotation as to what to look for.
Australoheros macacuensis was described based on the holotype, 67.0 mm SL, and 22 para-
types, 17.3–83.2 mm SL, all from the Rio Macacu basin, south of the Rio Paraı
´ba do Sul, drain-
ing to the Baı
´a de Guanabara. The diagnosis was based on multiple two-species comparison
character states in combination, including a large number of meristic data, proportional mea-
surements, colour details, and osteology, all of which shared by one or more congeneric nomi-
nal taxon. A.macacuensis was, however explicitly distinguished from congeneric species in the
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 62 / 122
Sudeste as having the posterior leg of Bar 7 wider than the anterior versus both legs equal in
width. The individual on fig. 8 in the original description has Bars 6, 7 (both legs), and 9
(upper) conspicuously wide. In our specimens, the pigmentation in that area is less contrasted,
and indecisive concerning the state of the character. Ottoni [13]) attributed the same character
state to A.montanus, and we confirmed this in MNRJ 47367 from near the type locality of A.
montanus, but we observed this also in a specimen from the type locality of A.muriae, MNRJ
47291.
Australoheros montanus was described based on the holotype, 78.9 mm SL, and 38 para-
types, 19.4–102.5 mm SL, all from the Rio Paquequer basin, a tributary of the Rio Paraı
´ba do
Sul. The diagnosis mentions posterior arm of trunk Bar 7 wider than anterior one (shared with
A.macacuensis); complete red bar on posterior margin of caudal fin; caudal peduncle length
10.1–11.9% SL; not having depression on snout; 22–24 teeth along posterior margin of cerato-
branchial 5; trunk bars usually forked ventrally; anal-fin base squamation beginning at the
sixth anal-fin spine; mouth isognathous. No autapomorphy was provided.
Australoheros mattosi was described based on the holotype, 80.4 mm SL, and 8 paratypes,
43.0–92.6 mm SL, from tributaries to the Rio São Francisco. The diagnosis made special refer-
ence to the anal-fin base squamation beginning at the third anal-fin spine (vs at the sixth spine
in other autrani group species; 12 proximal anal-fin radials, isognathous mouth, and last dor-
sal-fin spine length 13.2–15.4% of SL. In our specimens of A.oblongus, scales on the base of
the anal fin were typically present from the fifth or sixth anal-fin spine, but in at least one spec-
imen from the São Francisco basin they were present from the fourth spine. See also remarks
above. Specimens of A.oblongus from the upper Rio São Francisco may present small dark
spots on the caudal fin, but were not mentioned in the original description of A.mattosi.
Carmo and Triques [102] studied the morphology of specimens identified as Australoheros
mattosi from tributaries of the Rio das Velhas and the Rio Cipo
´and noted several differences
from the original description in colour and body shape, but did not challenge the species
identification.
Australoheros tavaresi was based on the holotype, MZUSP 50675A, 46.6 mm SL, and 12
paratypes, 28.8–65.8 mm SL, from the Rio Tietêand tributaries. The diagnosis is very long and
detailed, chiefly comparing proportional measurements with most other species in the genus,
but also stating that A.tavaresi differs from all congeneric species except A.facetus by having
prognathous mouth (vs. isognathous), with reference to fig. 8 for illustration. Fig 7 and in the
original description 8 show specimens in poor state of preservation, with mouth slightly open
and jaws definitely isognathous. On the image of the holotype (fig. 7) it looks like it is in very
bad condition, decoloured, and with trashed fins. Specimens of Australoheros from the Tietê
examined by us had isognathous jaws. We note that the image of the holotype of A.tavaresi
(fig. 7) shows only a vestige of caudal spot, and it was also relatively small in our specimens
from the Tietê, whereas according to the original description [8]. A.tavaresi should have a
‘conspicuous rounded caudal-fin base spot’, also expressed as ‘spot on caudal-fin peduncle
(well developed round spot)’.
Specimens examined. All from Brazil. MNHN 9485, 1, holotype of Chromys oblonga. 96.9
mm SL. le Tocantins (Province de Goyaz).—BMNH 1961.7.72–4, 3, syntypes of Heros autoch-
thon, 82.1–89.2 mm SL. Brazil, Lord Stuart.—MCP 31877, 6, 49.1–67.4 mm SL; Minas Gerais:
Ouro Preto: upper Rio Doce basin; Lagoa do Manso in Parque Estadual de Itacolomi, 20˚
22’30’’S, 43˚32’30’’W; A.L.B. Magalhães, 10 Jul 2002.—NUP 15340, 9, 49.1–72.5 mm SL; Minas
Gerais: Mariana: Rio Doce basin: Co
´rrego Frazão, tributary of the Rio Piracicaba, 20˚16’27"S,
43˚29’18’’W. G.N. Salvador, 14 Aug 2012.—MNRJ 47418, 8, 31.4–80.8 mm SL; Rio de Janeiro:
Miguel Pereira; Rio Guandu basin: confluence of the Rio Santana with the Rio Pocão, below
bridge on the road Marcos da Costa, between center of Miguel Pereira and Paty; 22˚29’14’’S
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 63 / 122
43˚26’53’’W; M.R. Britto, C.R. Moreira and D.F. Moraes Jr., 7 Jun 2016.—LBP 14389, 3, 40.2–
78.3 mm SL; São Paulo: Ubatuba: Rio Escuro at Folha Seca, 23˚29’03.8"S 45˚10’13.5"W; G.J.C.
Silva, J.M. Henriques, J.C.P. Alves, B. Belo and R. Devide
´, 7 Feb 2011.
Assigned to nominal species: [Australoheros barbosae]: LBP 17525. 1, 84.0 mm SL; Minas
Gerais: Bom Jardin de Minas: Rio Paraı
´ba do Sul basin: Cachoeira do Pacau, Ribeirão da Bom
Jardim de Minas, 22˚02’27’’S, 44˚09’43’’W; J.C. Oliveira, A.L. Alves and L.R. Sato, 14 Oct
2001).—MCP 42368, 2, paratypes of A.barbosae, 38.3–58.3 mm SL; Minas Gerais: Passa Vinte:
between municipios of Passa Vinte and Santa Rita da Jacutinga, tributary of the Rio Bananal,
tributary of the Rio Preto, 22˚’00 ’00’’S 44˚00’00’’W; C. Moreira, 2 May 2007.—MNRJ 47346,
8, 35.1–82.8 mm SL; Minas Gerais: Santa Rita de Jacutinga: Rio Paraı
´ba do Sul basin, ridge
over tributary of the Co
´rrego da Lagoa (tributary of the Rio Bananal), on the side of the gate of
Fazenda do Ronco on the road between Passa Vinte and Santa Rita de Jacutinga, 22˚10’2’’S 44˚
7’48’’W; D.F. Moraes Jr., E.B. Neuhaus and V. Brito, 12 May 2016.Topotypical specimens of A.
barbosae).—MNRJ 47353, 2, 17.1–58.9 mm SL; Minas Gerais: Santa Rita de Jacutinga: Rio
Paraı
´ba do Sul basin: Co
´rrego da Lagoa (tributary of the Rio Bananal), on road between Passa
Vinte and Santa Rita de Jacutinga, 22˚9’59’’S 44˚7’44’’W; D.F. Moraes Jr., E.B. Neuhaus and V.
Brito, 12 May 2016. Topotypical specimens of A.barbosae.—[Australoheros paraibae]: MCP
42367, 2, paratypes of Australoheros paraibae, 50.1–50.2 mm SL; Minas Gerais: Juiz de Fora:
Rio Monte Verde, tributary of the Rio do Peixe, near Monte Verde, about 21˚52’29.6’’S 43˚
31’27.5"W; W. Costa and G. Souza, 20 Aug 1991.—MCP 44194, 2, 39.6–42.6 mm SL; Rio de
Janeiro: Petro
´polis: Rio Paraı
´ba do Sul basin: artificial lake with water from the Rio dos Araras,
tributary of the Rio Itaipava, 22˚26’03’’S 43˚15’20’’W; J. F. Pezzi da Silva, 8 Apr 2003.—MNRJ
47365, 4, 52.4–64.5 mm SL; Juiz de Fora: tributary of the Rio do Peixe between Toledo and
Torreões, 21˚49’25’’S 43˚35’17’’W; D.F. Moraes Jr., E.B. Neuhaus and V. Brito, 12 May 2016.—
[Australoheros robustus]: MCP 42583, 2 paratypes, 39.3–41.2 mm SL; Minas Gerais: Mar de
Espanha: Co
´rrego Cachoeirinha, tributary of the Co
´rrego da Areia near Fazenda Cachoeirinha,
12˚55’00’’S 42˚57’00’’W; D.F. Moraes Jr., J. H. Gomes and T. Aguiaro, 3 Mar 1990.—MNRJ
47336, 21, 20.4–69.4 mm SL; Minas Gerais: Mar de Espanha: Rio Paraı
´ba do Sul basin:
dammed tributary of the Co
´rrego Cachoeirinha on Fazenda Jardim, 21˚55’31’’S 42˚58’38’’W;
D.F. Moraes, Jr., E.B. Neuhaus and V. Brito, 11 May 2016.—[Australoheros macacuensis]:
MCP 42365, 1, paratype of A.macacuensis, 55.7 mm SL; Rio de Janeiro: Cachoeiras de Macacu:
tributary of Rio Guapi-Ac¸u, 3 km from RJ-112 22˚28’00.0"S 42˚37’00.0"W; M. Britto, C. Mor-
eira, F. Pupo and D. Almeida, 29 Jan 1998.—MCP 26135, 5, 23.0–57.0 mm SL; Rio de Janeiro:
Cachoeirinha de Macacu: Rio Batatal, tributary of the Rio Macacu in Farao
´, 22˚28’00’’S 42˚
39’22’’W; C.S.R.F. Bizerril,10 Jul 1989.—MNRJ 47247, 2, 55.4–65.7 mm SL; Rio de Janeiro:
Cachoeiras de Macacu: Rio Macacu basin: Rio Macacu at mouth of the Rio Branco, Japuı
´ba,
22˚33’19S 42˚41’41’’W; P.A. Buckup, M.R. Britto, C. R. Moreira, D.F. Moraes, Jr., S.A. Santos
and G.S. Araujo, 28 Apr 2016. Topotypical specimens of A.macacuensis.—[Australoheros
montanus]: MCP 43130, juvenile, paratype of A.montanus; Rio de Janeiro: Carmo: Co
´rrego
Glo
´ria, right bank tributary of the Rio Paquequer between Co
´rrego Pedra Branca and Co
´rrego
São Jose
´; 21˚55’0"S 42˚35’0’’W; D.F. Moraes Jr., H. São Tiago and E.P. Caramaschi, 2 Aug
1990.—MNRJ 47367, 5, 27.3–72.5 mm SL. Rio de Janeiro: Sapucaia: Rio Paraı
´ba do Sul Basin:
Co
´rrego Santa Rita at Santa Rita, 22˚2’3’’S 42˚47’48’’W; D.F. Moraes, Jr., E.B. Neuhaus and V.
Brito, 12 May 2016. Close to type locality of A.montanus.—[Australoheros mattosi]: LBP 6527,
1, 57.1 mm SL. Minas Gerais: Jaboticatubas: Rio São Francisco basin: tributary of Rio Cipo
´,
19˚27’40.3’’S, 43˚43’13.1’’W; R.A.S. Teixeira, G.J.C. Silva, A.T. Ferreira and J.M. Henriques, 18
Jun 2008.—MCP 42383, 1, 67.4 mm SL. Minas Gerais: Taquaruc¸u de Minas: small stream on
road between Taquaruc¸u de Minas and Jabuticatubas, 19˚38’24’’S 43˚41’53’’W; T.P. Carvalho,
F.C. Jerep and C.A. Cramer, 10 Jan 2008.—MCP 49295, 1, 40.2 mm SL; Minas Gerais:
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 64 / 122
Jabuticatubas: Rio Cipo
´, tributary of the Rio das Velhas, 19˚16’57.0"S 43˚43’47.0"W; R.E. Reis,
P. Lehmann and E. Pereira, 25 Jul 2005.—MCP 42942, 1, 88.3 mm SL; Minas Gerais: Jabutica-
tubas: stream on road between Jabuticatubas and MG-010 in direction of Serra do Cipo
´, 19˚
27’38’’S 43˚43’1’’S; T.P. Carvalho, F. C. Jerep and C.A. Cramer, 10 Jan 2008.—MCP 47231, 1,
70.7 mm SL; Minas Gerais: Carmo do Paranaı
´ba. Co
´rrego do Ba
´lsamo, 10 km on São Bento
asphalt road, 18˚53’12’’S 46˚13’33’’W; R. E. Reis et al., 22 Jan 2012.—MCP 49007, 2, 43.0–76.9
mm SL. Minas Gerais: Cardeal Mota: Rio Cipo
´basin, arroio on road Jaboticatubas and Cardeal
Mota, 19˚19’9’’S 43˚40’46’’; R.E. Reis, P. Lehmann and E. Pereira, 25 July 2015.—MZUSP
16176, 4, 56.9–81.4 mm SL; Minas Gerais: Esmeraldas: Rio São Francisco basin: Ribeirão
Macacos, Fazenda Paraı
´so; D.S. Rocha, 3–8 Apr 1977.—MCP 49008, 2, 43.7–57.9 mm SL.
Minas Gerais: Cardeal Mota: Rio Cipo
´, tributary of the Rio das Velhas, 19˚16’57’’S 43˚43’47’’
W; R. E. Reis, P. Lehmann and E. Pereira, 25 Jul 2015.—MZUSP 37923, 5, 58.1–86.7 mm SL;
Minas Gerais: Lagoa da Prata: Rio São Francisco upstream from Três Marias dam, [19˚
59’51.6"S 45˚31’40.3"W]; COVEVASF, Aug 1982.—[Australoheros tavaresi]: LBP 847, 1, 71.7
mm SL; São Paulo: Embu Guac¸u; Ribeirão Santa Rita (Represa Billings), 23˚55.594’S 46˚
53.336’W; C. Oliveira and O.T. Oyakawa, Oct 2000.—LBP 6172, 1, 64.2 mm SL; Minas Gerais:
Rio Grande basin: Muzambinho: Co
´rrego da Prata, 21˚21’41.9’’S, 46˚34’36’’W; G. Costa-Silva,
R. Devide
´, F. Roxo, L. H G. Pereira, K.T. Abe and J.M. Henriques, 16 Apr 2008. Anterior dor-
sal spines lost; spine deformity.—LBP 6547, 1, 58.6 mm SL; Minas Gerais: Ouro Fino: Rio da
Prata, tributary of the Rio Grande, 22˚11’36.6’’S 46˚22’44.5’’W; R.A.S. Teixeira, G.J.C. Silva, A.
T. Ferreira, J.M. Henriques, 20 Jun 2008.—MCP 17842, 1, 53.5 mm SL; Minas Gerais: Caran-
daı
´: Rio Carandaı
´(tributary of the Rio Grande), above Carandaı
´, 20˚57’17.0"S 43˚46’41.0"W;
R.E. Reis, S.A. Schaefer, W.G. Saul, 17 Jan 1995.—MCP 20193, 1, 87.7 mm SL; São Paulo:
Mogi das Cruzes: stream on road from Mogi das Cruzes to Saleso
´polis, about 8 km from Mogi
das Cruzes, 23˚34’13.0"S 46˚05’54.0"W; R.E. Reis, J. Pezzi, E. Pereira and J. Montoya, 13 Jan
1997.—MCP 28715, 4, 26.8–78.6 mm SL; Minas Gerais: Abadia dos Dourados: Rio Preto on
road Palmito–Abadia dos Dourados, 18˚06’15.0"S 47˚41’35.0"W; C. Lucena, J. Pezzi, E.H.L.
Pereira and A. Cardoso, 23 Jan 2001.—MCP 37166, 2, 50.1–65.0 mm SL; Minas Gerais: Caran-
daı
´: Rio Carandaı
´at Haras Carandaı
´, 20˚58’04.0"S 43˚47’15.0"W; R.E. Reis, P. Lehmann and E.
L. Pereira, 8 Oct 2004.—NUP 10785, 8, 39.2–113.0 mm SL; São Paulo: Saleso
´polis: Rio Parai-
tinguinha, tributary of the Rio Tietê, 23˚30’25.6’’S 45˚51’11.8’’W; A.P. Marceniuk, Sep 2009.
Australoheros acaroides Hensel, 1870. Heros acaroides Hensel, 1870: 54 [34] (type local-
ity Bei Porto Alegre in stagnirenden Gewa¨ssern, 14 syntypes, ZMB7454, 7455, 25109, 25179;
lectotype designated by Schindler et al., 2010 [11], ZMB 7455; type locality Rio Cadea.)
Australoheros taura Ottoni & Cheffe, 2009 [7]: 155, fig. 1 (holotype UFRJ 7574; type locality
Brazil: Estado do Rio Grande do Sul: Municı
´pio de Bom Jesus: near arroio Barreiro (28˚48’S
50˚30’W).
Definition. Based on the position in the phylogenetic trees based on mt-cyb and mt-coI, and
minimum uncorrected p-distance in mt-coI exceeding 2% from all other species of the genus,
Australoheros acaroides is a distinct evolutionary lineage. No morphological autapomorphy
was detected. Australoheros acaroides is similar only to A.angiru,A.kaaygua mbapoari,A.
minuano A.ricani,A.sanguineus,A. and A.scitulus in presence of a zipper band along the
middle of the side, which, however, shows as a solid lateral band in sexually active specimens.
It differs from A.minuano in absence of contrasting small dark spots on lower sides; from A.
ricani and A. mboapari by row of minute scales not reaching cephalad beyond the middle of
the dorsal-fin base, vs reaching to almost anterior insertion of dorsal fin; absence of black
blotch on soft dorsal fin vs presence; from Australoheros sanguineus, by presence of regular
alternating light and dark stripes on lower part of body, vs such stripes absent; in sexually
active specimens this stripe pattern may be obsolete or absent.
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 65 / 122
Description of sample. Meristic data is given in Tables 3–9, proportional measurements in
Table 12. Refer to Fig 19 for variation in general aspect.
Sexes isomorphic except vertical and pelvic fins slightly longer in some large males than in
large females. Moderately elongate to deep-bodied, laterally compressed. Predorsal contour
straight ascending or with slight indentation anterior to orbits, curved anterior to dorsal fin
origin. Nuchal elevation absent in both sexes. Dorsal profile curved, slightly descending to end
of dorsal-fin base Caudal peduncle slightly tapering, contours straight. Prepelvic contour
slightly curved, straight, or slightly concave anteriorly, convex posteriorly. Abdominal contour
straight horizontal, except occasionally slightly convex in females. Anal-fin base contour
straight ascending. Head short, laterally compressed. Snout short, blunt, subtriangular in lat-
eral aspect, rounded in dorsal aspect. Mouth terminal, forward directed, close to horizontal
line from lower margin of orbit in small specimens, slightly more ventral in large specimens.
Lips moderately thick, lip folds interrupted or subcontinuous anteriorly. Jaws equal in anterior
extension; maxilla and premaxilla not reaching to vertical from anterior margin of orbit. Orbit
removed from frontal contour, in middle of head length, in upper half of head. Teeth in both
jaws caniniform, slightly recurved, in outer row slender, increasing in size toward symphysis.
No bicuspid teeth observed. Teeth in outer hemiseries in upper/lower jaw 7–13/101–17. Inner
teeth in two rows, exceptionally one or three rows in both jaws. Gill rakers externally on first
gill-arch 1–2 epibranchial, one in angle and 5–7 (7–8 in Pinares sample) ceratobranchial.
Microbranchiospines present externally on 2nd to 4th gill-arch.
Dorsal-fin spines increasing in length to about 6th or 7th, from which subequal, last spine
longest, soft dorsal-fin rounded in young, in adults with broad pointed tip, third, fourth or
fifth soft fin-ray longest, reaching to about middle or 4/5 of caudal fin. Soft anal fin rounded in
young, in adults with a short point formed by fourth soft fin-ray, reaching to about middle or
4/5 of caudal fin. Pectoral fin rounded, fourth or fifth ray longest, reaching to vertical from
anal orifice or first anal-fin spine. Pelvic fin pointed, first soft ray longest, reaching to or
slightly beyond anal-fin origin. Caudal fin rounded.
Scales on body finely ctenoid. Predorsal midline scales about 11–15, slightly smaller than
flank scales, covered by skin, only part with exposed margin, irregularly arranged, mixed
cycloid and weakly ctenoid. Chest scales ctenoid, almost size of flank scales. Cheek scales
cycloid, in 4–5 series, covered by skin. Opercular scales cycloid, covered by skin. between first
upper lateral line scale and dorsal-fin origin 3 large scales. Accessory lateral line scales absent
from caudal fin. One large and one small scale separating last scale of upper lateral line from
dorsal-fin base. Prepelvic scales anteriorly small, cycloid and without free margin, remaining
scales only slightly smaller than flank scales, weakly ctenoid and with free margin. Fin scales
ctenoid. Row of minute scales along dorsal fin base from spine X or XII, basal squamation
gradually expanded, interradial scales in single series, from spine XII–XVI, on soft fin up to
nine scales between two soft rays, scales absent from last two interradial membranes. Soft anal
fin with narrow basal scale layer, up to nine scales in interradial row.
Lower pharyngeal tooth plate examined in two specimens (Fig 20).
Colouration in preservative (Figs 19 and 21). Adults, about 60 mm and larger with ground
colour beige, fawn, or off-white. Bars 1(a, p) to 6 present, 2–3 scales wide; bar 6 absent below
lateral band; Interbars 2–3 scales white, except Interbar 1 usually narrower than one scale
width; lateral band extending from gill cleft caudad to Interbar 4 or bar 4 composed of dark
blotches on scales in rows 0 and E1, forming a pattern reminding of a zipper; dark scale spots
on posterior scales may extend the band to include Bar 2; Bar 5 terminating dorsally in lateral
band or extending dorsally at most to dorsal-fin base. Bar 5 entire except in a few specimens
from the Rio Maquine
´(UNICTIO1591), in which split vertically below lateral band. Bars gen-
erally vertical, dorsal portions of bars 2–4 usually slightly caudally inclined. Dorsal portions of
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 66 / 122
Fig 19. Australoheros acaroides. A. Adult male, 73.6 mm SL; MCP 18658; Brazil: Cachoeira do Sul: on road between
Candela
´ria and Cachoeira do Sul. B. adult female, 92.8 mm SL; MCP 9221; Brazil: Rio Grande do Sul; Restinga Seca:
va
´rzea of Rio Jacuı
´on road Santa Maria–Vera Cruz. C. Adult female, 58.5 mm SL; MCP 26548; Brazil: Rio Grande do
Sul: Nova Palma: Rio Jacuı
´basin: Arroio Caembora
´close to Caembora
´, reversed. D. Adult female, 77.2 mm SL.; MCP
49694; Brazil: Rio Grande do Sul: Bom Jesus: Rio Pelotas basin: stream tributary of the Rio dos Touros ca 4 km NE of
BR 285 (secondary road). E. Adult male, 88.5 mm SL; MCP 26772; Brazil: Rio Grande do Sul: São Francisco de Paula:
Rio Tainhas basin: Arroio Ribeirão.
https://doi.org/10.1371/journal.pone.0261027.g019
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 67 / 122
Fig 20. Australoheros acaroides. SEM image of the lower pharyngeal tooth plate. A. occlusal, approximately lateral
and posterior aspect from MCP 9812, 63.3 mm SL., 63.3 mm SL; Rio Grande do Sul: Tramandai: Terra de Areia: Rio
Sanga Funda on road BR 101; B. occlusal, latero-occlusal and caudal aspect from MCP 26548, 67.0 mm; Brazil: Rio
Grande do Sul: Nova Palma: Rio Jacuı
´drainage: Arroio Caembora
´close to Caembora
´. MCP 26548, 67.0 mm.; In
Tramandai specimen width 54% of length; dentigerous area width 84% of dentigerous area length. Anterior teeth
subconical, slightly retrorse; 5–5 wide teeth in anteroposterior row along median suture, apex tuberculate with a minor
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 68 / 122
any combination of Bars 4, 5, and 6 commonly forming a Y mark. Dorsal portions of Bars 5
and 6 otherwise expressed as independent irregular light brownish blotches or combined in
various ways. Dorsal portions of bars 7 and 8 present, expressed as short rostrad inclined bars
crossing anterior dorsal-fin base and occiput, respectively: occasionally dorsal portions of bars
7 and 8 combined to form a circular marking. Vertical bars may occasionally be doubled, bro-
ken, or forming an inverted Y dorsally. Midlateral black blotch present in Bar 4 on E1 scales
and parts of adjacent scales; corresponding portions of bars 2 and 3 may be slightly widened or
more intensely pigmented but distinct spots absent from bars 2 and 3. Caudal blotch (Bar1p)
dark brown or black, present at caudal-fin base immediately dorsal to lower lateral line, com-
monly expanded ventrad to form a vertical midbasal bar or oval blotch. Brown spot close to
margin of scales below level of midlateral band form distinct narrow lines on abdominal side,
gradually weaker and disappearing ventrad. Horizontal band formed by dark brown or black
spots in E1 and 0 scales, extending to Interbar 4, continued from Bar 4 to caudal-fin base, usu-
ally more distinct anteriorly, and reduced to one scale row posteriorly. Black blotch usually
present at anterior end of horizontal band and at upper base of pectoral fin. Dorsal fin translu-
cent or pale grey, with grey, dark grey or black blotches at base, continuous with or slightly
separate from bars 2 to 6 and/or 7. Colour pattern in sexually active specimens variable. In
Jacuı
´and Taquari specimens, vertical bars 1–4, in females also dorsal-fin blotches, promi-
nently black. In Pelotas, Tubarão and Maquine
´samples, females also with abdomen, chest,
and lower part of head dark brown or black. Juveniles with nearly uniform sides, vertical bars
not contracted; dark spots in two rows making up lateral band, indistinct; large distinct brown
or black blotch in bar 4. Caudal-fin blotch absent or distinct, dark brown and midbasal.
The sample from the Rio Tubarão included two strongly pigmented precocious gravid
females with deep black spots in the dorsal fin, 37.0 and 37.5 mm SL. The sample MCP 26548
from near Nova Palma showed considerable variation in colour pattern and morphology. Two
relatively small females, 47.5 and 48.0 mm SL. in MCP 26995 were the smallest specimens
examined with breeding colouration expressed in dorsal-fin blotches (Fig 21). Two small
males were unusual in presenting an elevated nape and steep frontal contour (Fig 21).
Geographical distribution (Fig 1). Laguna dos Patos basin in the Rio Jacuı
´drainage basin
downstream of Saltos de Jacuı
´; Rio Taquari, with tributaries Antas and Tainhas; tributaries of
the Rio Ararangua
´, Maquine
´, Tramandaı
´, Tubarão, dos Sinos, and Cadeia; Rios Olimar
Grande, Cebollatı
´, and Piratini, draining to the Laguna Mirı
´m.
Comments. The colour pattern is variable within A.acaroides. There was individual varia-
tion in markings, including the shape and intensity of vertical bars and interbars, as well as in
the shape and intensity of the midlateral and caudal spot, and the two sides of a specimen may
be different. In summary, however, A.acaroides was similar to most other species of Australo-
heros in possession of a distinct caudal spot, 3 postabdominal vertical bars, 3 (exceptionally 4)
abdominal bars below the horizontal band; a midlateral spot; a horizontal band composed of
spots on two scale rows; pale brown spots from dorsal portions of bars 5 to 8 in the light area
above the horizontal band; and dark spots on the base of the dorsal fin. The breeding colour
central cusp on middle teeth, posterior teeth slightly compressed, bicuspid with antrorse distal cusp; laterad and
posterolaterad on plate teeth gradually smaller and compressed; about 20 teeth in posterior row. In Caembora
´
specimen tooth plate relatively slender; width 76% of length; dentigerous area width 66% of dentigerous area length.
Anterior teeth subconical, slightly retrorse; 8–9 wide teeth in anteroposterior row along median suture, apex
tuberculate with a minor central cusp on middle teeth, posterior teeth slightly compressed, bicuspid with antrorse
distal cusp; laterad and posterolaterad on plate teeth gradually smaller and compressed; about 19 teeth in posterior
row. With antrorse distal cusp; laterad and posterolaterad on plate, teeth gradually smaller and compressed; about 20
teeth in posterior row.
https://doi.org/10.1371/journal.pone.0261027.g020
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 69 / 122
Fig 21. Australoheros acaroides. A. juvenile, 32.5 mm SL; MCP 18317 Brazil: São Francisco de Paula: Rio das Antas
on road Jaquirana–Bom Jesus. B. Adult female, 57.7 mm SL; MCP 26548 Brazil: Rio Grande do Sul: Nova Palma: Rio
Jacuı
´drainage: Arroio Caembora
´close to Caembora
´.C. Adult male, 66.1 mm SL; MCP 26548 Brazil: Rio Grande do
Sul: Nova Palma: Rio Jacuı
´drainage: Arroio Caembora
´close to Caembora
´.D. Paratype of Australoheros taura, young,
43.6 mm SL; MCP 42363; Brazil: Rio Grande do Sul: Bom Jesus: Rio Taquari drainage: near Arroio Barreiro, tributary
of the Rio das Antas. E. Paratype of Australoheros taura, adult male, 142.0 mm SL; CICMC12102; Brazil: Rio Grande
do Sul: São Francisco de Paula: Rio Taquari drainage: Rio das Antas at PCH Passo do Meio dam.
https://doi.org/10.1371/journal.pone.0261027.g021
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 70 / 122
was expressed in darkening—to black—of the abdomen, chest and lower head, and intensified
black vertical bars, contrasting with highlighted light interbars and the light area above the
anterior portion of the horizontal band. The two tooth plates examined Fig 20, were very dif-
ferent, although the specimens were of about the same standard length. The specimen from
Tramandaı
´(Fig 20A) was similar to A.facetus, slender, with many small teeth, whereas the
specimen from Nova Palma had a broader tooth plate with fewer teeth (Fig 20B).
Australoheros acaroides was represented in our material by samples from lowland tributar-
ies to the Laguna dos Patos basin, including the Rio dos Sinos, lower Rio Jacuı
´, lower Rio
Camaqua
´, Rio Piratini, Rio São Lourenc¸o, and northern coastal rivers (Tramandaı
´, Maquine
´,
Forqueta, Tubarão) to Lagoa do Imarui at Imbatuba. Adult Australoheros acaroides from the
Laguna Mirim were indistinguishable from those from the Patos watershed, but small speci-
mens, and specimens from the upper Rio Camaquãlacked the horizontal stripes and had
somewhat broader vertical bars.
The original description of Heros acaroides [34] was brief and not accompanied by an illus-
tration. Hensel stated that among four specimens, the largest was 73 mm SL, suggesting that
the main part of the and description, and the locality information (‘Bei Porto Alegre in stag-
nierenden Gewa¨ssern‘) was based on these four. He also described the colour pattern of ‘Eine
Anzahl junger Individuen (ohne die Schwanzflosse) nicht u¨ber 20 Mm. lang.’ Under a separate
heading ‘Heros sp.?’, he briefly described a more elongate specimen from the Rio Cadea, simi-
lar to the H.acaroides in colour, but more elongate and in a poor state of preservation.
Heros acaroides was sunk into the synonymy of Australoheros facetus by Steindachner [35].
Schindler et al. [11] provided a re-description of A.acaroides, purporting to revalidate the spe-
cies. In so doing, they did not compare with specimens of A.facetus, but relied on R
ˇı
´čan and
Kullander [3,4] for data. Essentially, they restricted A.acaroides to the Laguna dos Patos
basin, with the diagnosis’. . . differs from all the species of the A.forquilha,A.scitulus and A.
kaaygua groups by having a well developed caudal-fin base spot (vs. spot absent or weakly
developed as a pigmented narrow bar); from A.minuano and all the species of the A.facetus
group by having well developed longitudinal stripe (vs. weakly developed) and three abdomi-
nal bars versus four (except in A.guarani); from all the species from the A.kaaygua group by
having more pectoral rays (14 vs. 12–13); from A.facetus by having a [sic] isognathous jaw (vs.
prognathous) and from A.facetus and A.guarani by having modally 5 cheek scales rows [sic]
(vs. three in A.facetus and four in A.guarani).’ Our observations show that in A.acaroides the
expression of Bar 1p is variable; the count of 14 pectoral fin-rays is rare and 13 rays dominant
as in congeneric species (Table 8), all species of Australoheros are isognath, and that the pres-
ence of four abdominal bars is the common state in the genus a; fifth bar occurs at low fre-
quency in all coastal species.
Schindler et al. [11] reported 14 syntypes of A.acaroides: ZMB 7455 (2, 34.4–71.2 mm SL,
from Rio Cadea), ZMB 7454 (3, 16.3–18.2 mm SL from Porto Alegre); ZMB 25109 (2, 34.2–
62.6 mm SL, Rio Cadea), ZMB 25179, 7[sic, should be 8] (<18 mm SL, no locality given [Porto
Alegre]). Schindler et al. [11] fixed ‘the larger specimen’ in ZMB 7455 as lectotype of Heros
acaroides. Their fig. 1 shows a specimen with the caption ‘Lectotype of Australoheros acaroides,
ZMB 7455’. They reported that on the jars containing ZMB 7455 and 25109, the locality is
stated as Rio ‘Cadea’, and accepted Rio Cadea as type locality. Apparently, ZMB 25109 was at
some time in its curatorial history split from ZMB 7455 and together they represent the four
specimens mentioned by Hensel as coming from stagnant water at Porto Alegre; and ZMB
25179 was split from ZMB 7454, and represents the number of young specimens mentioned
by Hensel. Whether the specimens came from Porto Alegre or the Rio Cadeia, may not be of
critical concern, as the Rio Cadea [= Rio Cadeia] is located less than 50 km north of Porto Ale-
gre, and runs to the Rio Caı
´, with mouth in the Rio Jacuı
´near Porto Alegre. There are no
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 71 / 122
recent collections of Australoheros from the Rio Cadeia. Hensel lived in São Leopoldo, north
of Porto Alegre, 1863–1866 [103], and his collections were apparently shipped back to Ger-
many in at least two shipments up to 1868 [103–105]. Paepke and Schindler [106] listed the
syntypes, but some objects with different catalogue numbers: The paralectotype in ZMB 755 is
now ZMB 34506; ZMB 25109 is now ZMB 34502; ZMB 25179 is now ZMB 34501 and listed
with the correct number of specimens (8).
Australoheros taura was described based on the holotype, 65.4 mm SL, from Bom Jesus, Rio
Grande do Sul, figured by Ottoni and Cheffe, fig. 1 [7], and 34 paratypes, 20.6–124 mm SL
from the Rio das Antas and tributaries. We examined five paratypes (MCP 4263, Fig 21D;
CICMC 12102, Fig 21E) and several non-types specimens of Australoheros from the Rio das
Antas and Rio Tainhas. The five CIMC paratypes, 73.0–124.5 mm SL, could not be located but
a specimen from the same locality, CICM 12203, 86.8 mm SL was examined.
Ottoni and Cheffe [7] distinguished A.taura by a set of characters in combination, includ-
ing vertebral count, various proportions, projecting upper jaw, live colours, and melanophore
colour pattern. The holotype, as figured by Ottoni and Cheffe, fig. 1 [7]) displays the character-
istic zipper-like lateral band present in A.acaroides and this pattern was also present, but indis-
tinct in the small MCP paratypes and the CICM 12203 specimen. The caudal blotch, said to be
narrow in the type series, varied from almost obsolete (as shown on Ottoni and Cheffe’s fig. 1
[7], and Fig 21 herein) to black, but expressed only as a dark spot on the upper lobe, and a
fainter spot on the ventral lobe. The jaws were isognathous. The mt-coI sequences of tissue
samples from the Rio das Antas, and the Rio Tainhas were nested in a clade also including
specimens identified as A.acaroides from the Rio Jacuı
´and Rio Taquari, and other drainages
in Rio Grande do Sul. Based on the genetic and morphological data, A.taura is a synonym of
A.acaroides. It seems that A.taura was proposed because A.acaroides was at the time not rec-
ognised as a valid species, and the comparative material included almost only A.ribeirae and
data from literature, but no specimens from the rest of the Rio Jacuı
´drainage.
No autapomorphy was mentioned by Ottoni & Cheffe [7] for A.taura. The diagnosis was
based largely on measurement ratios without compensation for size allometry. Outstanding
characters such as ‘lower jaw slightly in front of the upper jaw shorter than upper one (vs
lower jaw projecting in front of the upper jaw (not verifiable on the photo, fig. 1, but lengths
shown in their table), 6–7 epibranchial plus 15–16 ceratobranchial gill-rakers, and 22 caudal-
fin rays were not commented on. In species of Australoheros, jaws are isognathous in anterior
extension, but the lower jaw (distance dentary symphysis to retroarticular) may be slightly
shorter than the upper jaw (distance premaxilla to posterior tip of maxilla).
The paratypes and topotypical specimens examined all had 7 or 8 ceratobranchial gill-rak-
ers. (See Material and methods for comments on gill-raker counts). Except for a few small-
sized species with 14, all cichlid species have 16 principal caudal-fin rays, including the exam-
ined paratypes of A.taura.
The image of the holotype shows a specimen with a broad horizontal stripe containing the
midlateral spot, and faint vertical bars, but no further markings. The most conspicuous charac-
ter on the photo is the very large eye, suggesting a juvenile, although the specimen is said to be
65.4 mm SL. The MCP paratypes also had proportionally very large eye and tapering body. We
suggest that this condition reflects under-nourishment in aquaria or fishponds. The juvenile
MCP paratypes did not possess a caudal blotch; it was present in all other specimens of A.acar-
oides from the upper Rio Taquari drainage. All specimens possessed a midlateral blotch and
the lateral band was variously expressed but present in most specimens.
The description of A.sanguineus [12] (included a live colour photo labeled A.sanguineus.
According to the legend the specimen was not preserved. The colour pattern shown is similar
to that of both A.sanguineus and A.acaroides. In the same paper another photo (fig. 3) of a
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 72 / 122
living fish is labeled as an adult A.acaroides and with Morevy Cheffe as photographer, but it is
actually the same specimen as illustrated by Calviño [62]: fig. 3), only reversed and with darker
colour, and according to Calviño) showing a juvenile topotype, 55 mm SL, of A.facetus. The
latter identification seems more reliable as the photo was taken by Calviño of a specimen he
himself had collected from the type locality: unless also Calviño had mixed up his photos. Cal-
viño’s fig. 3 and Ottoni’s fig. 3 undoubtedly show the same specimen with the same posture
and with the same background, but not necessarily the same exposure as the light spot close to
the upper middle portion of the image is above the fish in Calviño’s photograph, and partly
covered by the dorsal fin in Ottoni’s version, which is also reversed and darker.
Material examined. All from Brazil unless otherwise stated.
ZMB 7455, lectotype of Heros acaroides, 72.5 mm SL. Brazil, Rio Grande do Sul, Rio Cadea
[= Rio Cadeia. R. Hensel, [1863–1866].
ZMB 7455, paralectotype of Heros acaroides, 1, 35.0 mm SL. Same data as lectotype.
ZMB 25109, paralectotypes of Heros acaroides, 2, about 40.0–63.0 mm SL. Same data as
lectotype.
ZMB 7454, paralectotypes of Heros acaroides, 3 juveniles, not measured. Brazil, Rio Grande
do Sul, Porto Alegre. R. Hensel, [1863–1866].
ZMB 25179, paralectotypes of Heros acaroides, 8 juveniles, not measured. Same data as
ZMB 7454.—Rio Grande do Sul: Rio Jacuı
´basin: Rio Soturno basin: LBP 14575, 1, 77.1 mm
SL; LBP 14581, 1 (of 2), 25.5 mm SL: Ju
´lio de Castilhos: stream, without name, 29˚19’07.6"S
53˚37’59.2"W; F. Roxo et al., 26 Sep 2011.—LBP 14564, 2, 30.0–42.3 mm SL; Agudo: stream
without name, 29˚36’03.3’’S 53˚16’50.4’’W; F. Roxo et al., 26 Sep 2011.—MCP 22729, 11, 22.7–
94.8 mm SL; Nova Palma: Arroio do Tigre, about 3 km S of Nova Palma, 29˚29’25.0"S 53˚
28’45.0"W; R. E. Reis, E.H.L. Pereira and V.A. Bertaco, 1 Apr 1999.—MCP 22706, 3, 21.4–80.6
mm SL; Ju
´lio de Castilhos: Arroio Felicio, about 10 km SSE of Ju
´lio de Castilhos, 29˚19’6’’S 53˚
37059’’W; R. E. Reis, E.H.L. Pereira and V.A. Bertaco, 1 Apr 1999.–MCP 22726, 6, 28.8–50.9
mm SL; Faxinal do Soturno: stream tributary of the Rio Soturno about 4 km NNW of Soturno,
29˚32’55’’S 53˚27’53’’W; R.E. Reis, E.H.L. Pereira and V.A. Bertaco, 1 Apr 1999.—MCP 50425,
3, 27.5–99.7 mm SL; Ju
´lio de Castilhos: Arroio Felicio, on road between Parque das Esculturas
and Ju
´lio de Castilhos, 29˚19’6.400’’S 53˚37’57.800’’W; T Carvalho, R. Angrizani and J. Chuc-
taya, 11 Oct 2016.—MCP 50424, 1, 95.6 mm SL; Faxinal do Soturno: Rio Soturno at bridge
close to road between Nova Roma and Faxinal do Soturno, 29˚32’6.900’’S 53˚28’50.200’’W; T.
Carvalho, R. Angrizani and J. Chuctaya, 11 Oct 2016.–Lower Rio Jacuı
´basin: MCP 21486, 1,
54.4 mm SL; Pinhal Grande: Rio Ferreira between Pinhal Grande and Itauba, 29˚16’37’’S 53˚
14’53’’W; R.E. Reis, J.F. Pezzi and E.H.L. Pereira, 11 Oct 1998.—MCP 21272, 4, 32.7–51.4 mm
SL; Ibarama: stream tributary of the Arroio Caidinho, 29˚22’38’’S 53˚05’56’’W; R.E. Reis, J.F.
Pezzi and V.A. Bertaco, 23 Aug 1998.—MCP 23753, 6, 32.3–53.5 mm SL; Agudo: Lageado do
Gringo about 2 km from UHE Dona Francisca, 29˚26’49.0"S 53˚15’36.0"W; R.E. Reis, J.F.
Pezzi and V.A. Bertaco, 11 Jul 1999.––MCP 25465, 2, 58.8–76.4 mm SL; Agudo: Lageado do
Gringo, about 2km from UHE Dona Francisca, 29˚26’49’’S 53˚15’36’’W; R.E. Reis, J.F. Pezzi,
V.A. Bertaco and E.H.L Pereira, 10 Jan 2000.—MCP 25720, 1, 60.8 mm SL; Agudo; Lageado
do Gringo about 2 km from UHE Dona Francisca, 29˚26’49’’S 53˚15’36’’W; R.E. Reis, J.F.
Pezzi and V.A. Bertaco, 8 Apr 2000.—MCP 26224, 2, 54.5–56.4 mm SL; Ibarama: stream tribu-
tary of the Rio Jacuı
´at about 3 km from ferry across Rio Jacuı
´in direction to Dona Francisca
dam, 29˚25’35’’S 53˚14’44’’W; V.A. Bertaco, E. H.L. Pereira and A.R. Cardoso, 25 Aug 2000.––
Arroio Corupa
´to Rio Jacui: MCP 26995, 5, 47.5–62.0 mm SL; Agudo: Arroio Corupa
´on road
between Agudo and UHE Dona Francisca, 29˚33’54’’S 53˚17’9’’W; R.E. Reis, V.A. Bertaco and
E.H.L. Pereira, 1 Feb 2001.—MCP 28984, 1, 68.6 mm SL; Agudo: Arroio Corupa
´, 29˚33’54’’S
53˚17’9’’W; R.E. Reis, E.H.L Pereira and V.A. Bertaco, 15 Nov 2001.—Rio Vacacai Mirim to
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 73 / 122
Rio Jacuı
´: MCP 26548, 13, 33.7–87.2 mm SL; Nova Palma: Arroio Caembora
´close to Caem-
bora
´, 29˚50’’28’S 53˚17’50W; V.A. Bertaco, A. Cardoso, C. Kaefer and J. Silva, 11 Nov 2000.—
Rio Jacuizinho: Espumoso, 28˚58’02.9’’S 52˚47’20.3’’W: UFRGS 22014, 1, 73.6 mm SL; K.O.
Bonato and J. Ferrer, 22 Feb 2013.—UFRGS 22030, 1, 19.5 mm SL; K. Bonato N. Bertier and
A. Hirschmann, 19 Dec 2012.—UFRGS 22031, 1, 22.6 mm SL; K.O. Bonato, A. Hirschmann,
A. Hartmann and A. Langoni, 20 Apr 2013. [determination tentative].—MCP 9221, 5, 46.6–
92.8 mmSL; Restinga Seca: va
´rzea of Rio Jacuı
´on road Santa Maria–Vera Cruz, 29˚48’0"S, 53˚
17’0"W; C.A.S. Lucena, L.R. Malabarba and R.E. Reis, 16 Sep 1983.—Rio Ingaı
´to Rio Jacuı
´:
MCP2 1520, 2, 57.5–82.0 mm SL; Rio Grande do Sul: Fortaleza dos Valos: Rio Jacuı
´basin,
stream tributary of the Rio Ingaı
´about 300 m SW of Fazenda Colorados, 28˚54’29’’S 53˚
17’8’’W; R.E. Reis, J.F. Pezzi da Silva and E.H.L. Pereira, 11 Oct 1998.—Lageado Pelado to Rio
Jacuı
´: UFRGS 18223, 4, 97.7–114.4 mm SL; Salto de Jacuı
´: Lageado Pelado, 29˚03’00.7"S 53˚
15’48.6"W; A.P. Dufech and J.L Santos, 4 Nov 2013.—Rio Vacacaı
´basin to Rio Jacui: MCP
16292, 3;90.7–101.3 mm SL Cac¸apava do Sul: Arroio Pessegueiro in Passo do Megate
´rio, 30˚
28’0"S, 53˚36’59"W; A. Ramires, 15 Apr 1993.—Rio Pardo basin to Rio Jacuı
´: MCP 18658, 1,
Cachoeira do Sul: on road between Candela
´ria and Cachoeira do Sul, 29˚43’0"S, 52˚45’0"W; L.
R. Malabarba, J.R. Burns, J.F. Pezzi, 21 Jan 1996.—Rio Grande do Sul: Rio Taquarı
´basin:
CIMC 12203. 1, paratype of Australoheros taura, 86.8 mm SL; Bom Jesus: Arroio Barreiro,
tributary of the Rio das Antas [probably 28˚48’S 50˚30’W]; M. Cheffe and L. Rosa, 5 Feb 2005.
—CIMC 12102, 1, 142.0 mm SL; São Francisco de Paula: Rio das Antas at PCH Passo do Meio
dam, [Approx. 28˚48’S 50˚36’W];M. Cheffe, L. Rosa and R. Baltar, 12 Nov 2004.—MCP 18317,
6 (1, 73.2 mm SL; 5, 15.4–32.5 mm SL)—MCP 20504, 2, 27.5–32.5 mm SL; São Francisco de
Paula: Rio das Antas on road Jaquirana–Bom Jesus, 25˚48’0’’S, 50˚26’0’’W; A. Ramires, 18 Nov
1995.—MCP 26772, 1, 88.5 mm SL. São Francisco de Paula: Rio Tainhas basin: Arroio
Ribeirão, 29˚12’0’’S, 50˚21’0’’W; W. Bruschi, Jr. and L. Daros, 19 Dec 2000.—MCP 32400, 1,
26.4 mm SL; Bom Jesus: Arroio Barreiro about 150 m from its mouth into the Rio das Antas,
28˚47’50’’S, 50˚25’36’’W; A.R. Cardoso and V.A. Bertaco, 15 Feb 2003.—MCP 32419, 2, 16.7–
23.3 mm SL. São Francisco de Paula: Rio Tainhas basin: Rio Tainhas between municipalities of
São Francisco de Paula and Tainhas. A.R. Cardoso and V.A. Bertaco, 14 Feb 2003. 28˚52’06’’S,
50˚27’33’’W.—MCP 42363, 4, paratypes of Australoheros taura, 36.0–43.6 mm SL. Bom Jesus:
Rio Taquari basin: near Arroio Barreiro, tributary of the Rio das Antas. M. Cheffe and L. Rosa,
6 Apr 2004. 28˚48’S, 50˚30’W.—MCP 41156, 4, 41.8–68.2 mm SL: Nova Roma do Sul: Rio
Taquari basin: Arroio Cansan 2, Rio das Antas basin. J.C. Latini, V.A. Capatti and S. Rodri-
gues, May 2006. 28˚59’59’’S, 51˚22’2’’W.—MCP 48464, 1, 25.6 mm SL. Cambara
´do Sul: Rio
Tainhas basin: Parque Estadual Tainhas. P. Lehmann, 29˚5’5.200’’S 50˚21’57.7’’W.—MCP
48666, 10, 22.4–58.6 mm SL. São Francisco de Paula: Rio Tainhas basin: Arroio Ribeirão on
RS-453 (Ruta do sol), 29˚13’58’’S, 50˚22’29’’W; J. Silva, D. Arau
´jo, R. Angrizani, 11 Mar 2015.
—MCP 48671, 1, 41.0 mm SL; Jaquirana: Rio das Antas basin: Rio das Antas at mouth of
Arroio Moraes on road to Bom Jesus, 28˚47’54’’S, 50˚25’44’’W; J. Silva, D. Arau
´jo and R.
Angrizani, 11 Mar 2015.—MCP 48687. 14, 22.5–28.6 mm SL; Jaquirana: Rio das Antas basin:
Rio das Antas at mouth of the Rio Camisas on road Jaquirana-São Francisco de Paula. J.
Silva, D. Arau
´jo and R. Angrizani, 11 Mar 2015. 28˚50’30’’S, 50˚18’0’’W.—UFRGS 9256. 2,
31.9–32.9 mm SL. São Jose
´dos Ausentes: Rio das Antas after fish & pay pond. 28˚47’08.0"S 49˚
58’55.0"W; collector not recorded, 17 March 2001.—UFRGS 9261. 1, 41.4 mm SL. São Jose
´dos
Ausentes: Rio das Antas, 28˚47’07.0"S 49˚58’55.0"W; J. Anza, J. Bastos, D. Gelain, T. Dias
and T. Hasper, 30 Jul 2001. 28˚47’07.0"S 49˚58’55.0"W.—UFRGS 21917, 1, 52.8 mm SL. São
Jose
´dos Ausentes: Arroio São Gonc¸alo,—tributary of the Rio das Antas, 28˚52’09.0"S 50˚
01’14.0"W; L.R. Malabarba, J. Ferrer, T. Carvalho, R. Angrizani andand E. Wendt, 29 Apr
2016.—Rio Grande do Sul: Rio Maquine
´basin: UNICTIO 1358, 2, 40.5–6.7 mm SL; Maquine
´:
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 74 / 122
affluent of Rio Maquine
´, 29˚39´57.3’’S 50˚11´14.4’’W; M. Ibere, P. Brites, C. Bartzos, 19 Jan
2013.—UNICTIO 1479, 1, 56.6 mm SL; Arroio Forqueta, 29˚32’18.4’’S 50˚14’45.6’’W; P. Leh-
mann and students, 18 Dec 2013.—UNICTIO 1580, 2, 61.9–62.0 mm SL; Maquine
´: tributary
of Rio Forqueta, 29˚32´18.6’’S 50˚14’45.4’’W; P. Lehmann, 22 Jan 2014.—UNICTIO 1591. 6,
21.0–91.1 mm SL; Maquine
´: left bank tributary of Rio Maquine
´, 29˚32’18.1’’S, 50˚14’45.6’’W;
P. Lehmann et al., 14 Mar 2014.—UNICTIO 1627. 10, 37.4–86.5 mm SL. Arroio Carvão, tribu-
tary of the Arroio Forqueta, 29˚32’17’’S 50˚14’44.1’’W; P. Lehmann and students, 15 Mar
2014.—UNICTIO 1670, 2, 50.5–80.0 mm SL. Maquine
´: Arroio Carvão; P. Lehmann, L.
Schaumbach et al., 4 Apr 2014. 29˚32’18.3’’S, 50˚13’45.7’’W.—Rio Grande do Sul: Rio Piratini
basin UNICTIO 641, 1, 68.3 mm SL; Pedro Oso
´rio: Arroio Passo dos Negros, 31˚48’41.4’’S,
52˚48’23.2’’W; P. Brites, C. Bartzos and E. Cavalet, 6 Sep 2012.—UNICTIO 414. 1, 93.0 mm.:
Pedro Oso
´rio, 31˚53´17.4’’S, 52˚43’18’’W. P. Brites, C. Bartzos and P. Peixoto, 22 Apr 2012.—
UNICTIO 461, 6, 31.5–57.4 mm SL. Pedro Oso
´rio, 32˚00’41’’S 52˚55’13.400W; 22 Apr 2012, P.
Brites, C. Bartzos and P. Peixoto, 22 Apr 2012.—UNICTIO 555, 11, 26.2–39.8 mm SL; Fazenda
Pedro Oso
´rio, 31˚50’40.3’’S 52˚51’58’’W; P. Brites, 30 Apr 2002.—UNICTIO 696, 4, 27.0–40.8
mm SL; Cerrito: Rio Piratini, 31˚43’09.6’’S 52˚53’59.9’’W; P. Brites, C. Bartzos, P. Peixoto and
E. Cavalet, 7 Jun 2012.
—Rio Grande do Sul: Rio dos Sinos basin: UNICTIO 1251. 2, 52.1–77.2 mm SL; Igrejinha:
Arroio Solitario. U. Schultz, 6 Apr 2013. 29˚33’46.60’’S, 50˚60’12.28’’W.—UNICTIO 1343, 1,
74.0 mm SL; Igrejinha: Arroio Solitario, 29˚33’46.60’S 50˚60’12.2800W; U. Schultz, 6 Apr 2013.
—MCP 17628, 3, 107.3 mm SL; Caraa
´: Rio dos Sinos, bridge 7 km north of Caraa
´, road to
Fundo Quente, 29˚47’0"S, 50˚19’0"W; L.R. Malabarba, P.A. Buckup, A. Cardoso and G. Gua-
zeli, 12 Jan 1995.—
Rio Grande do Sul: Rio Caı
´basin: MCP 11558, 38, 17.8–49.5 mm SL (3 measured and
counted, 44.1–49.5 mm SL); Gramado: Arroio Linha Bonita, 29˚22’00.0"S, 50˚52’00.0"W; L.
Mardini, 17 Jun 1987.—Rio Grande do Sul: Tramandai: MCP 9812, 4, 1 measured, 63.3 mm
SL, Tramandai: Terra de Areia: Rio Sanga Funda on road BR 101, 29˚37’00.0"S 50˚07’00.0"W,
27 Jan1983, C.A.S. Lucena and Z.M. Lucena.—Rio Grande do Sul: Rio Camaquãbasin: MCP
25787, 19, 63.8–66.0 mm SL; Cac¸apava do Sul: Arroio do Banhado on BR-153 to Minas do
Camaquã, about 8 km NW of Minas do Camaquã, 30˚51’48"S 53˚29’50"W; C.A.S. Lucena, J.F.
Pezzi and V.A. Bertaco, 27 Apr 2000.—
Rio Grande do Sul: Lagoa Mirim: MCP 43212, 1, SantaVito
´ria do Palmar; Lagoa Mirim,
coordinates for Lagoa Mirim near Santa Vito
´ria do Palmar, 33˚30’20.8"S 53˚26’34.8"W; Mario
V. Candine, 1 Dec 2004.—MCP 43213, 1, Santa Vito
´ria do Palmar: Lagoa Mangueira, coordi-
nates for Lagoa Mirim near Vito
´ria do Palmar, 33˚30’20.8"S 53˚26’34.8"W; Mario V. Candine,
1 Oct 2004.—
Santa Catarina: Rio Ararangua
´basin: MCP 50385, 4, 64.9–81.4 mm SL, 64.9–81.4 mm SL;
Timbe
´do Sul: Rio Amola Fac¸a, tributary of Rio Itoupava, 28˚50’2300S 4948’000W; G. Depra
´, J.
Dourdall and G. Aguilera, 18 Dec 2015.—UFRGS 19912, 3, 58.6–100.4 mm SL; Santa Catarina:
Sidero
´polis: Rio Jordão upstream of Cachoeira Bianchini, 28˚35’11.7"S 49˚31’24.6"W; R.
Angrizani, L.R Malabarba, M.C. Malabarba, 21 Feb 2015.—UFRGS 12548, 1, 74.3 mm SL;
Santa Catarina: Nova Veneza: Jordão Alto [São Bento Alto]: Rio São Bento, tributary of the
Rio Ararangua
´, 28˚39’29.1"S 49˚32’35.7"W; Ferrer, Thomas, Vogel and Weiss, 29 Mar 210.
Lagoa Imaruı
´: MCP 8426, 1, 68.7 mm SL. Imbituba: Lagoa do Imarui, 28˚16’00.0"S 48˚
43’00.0"W; C.R. Poli and L.
Borsato, 22 Jan 1971. Rio Tubarão basin: MCP 11057. 1, 56.1 mm SL; Tubarão: Rio Tubarão
basin. Canal linking the Rio Tubãro with Lagoa Santa Marta, including pools and lateral
canals, 28˚31’0"S, 48˚49’0"W; J.J. Bertoletti and E.P. Lerner, 18 Dec 1986.—MCP 13587. 7,
35.7–107.0 mm SL. Santa Catarina: Tubarão: Rio Tubarão basin. Rio Tubarão and lateral
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 75 / 122
canals near Campo Verde, 28˚31’0’’S, 48˚49’W; MCP team, 28 Nov 1986.—Rio Grande do Sul:
Rio Pelotas basin: MCP 49694, 21, 15.1–77.2 mm SL; Bom Jesus: Arroio tributary of Rio dos
Touros ca 4 km NE of BR 285 (secondary road), 28˚41’06.0"S 50˚12’51.0"W; Jose
´Silva, 12 Feb
2016.—MCP 48688, 7 18.9–56.4 mm SL; MCP 48993, 42, 41.1–45.5mm SL; Bom Jesus: Rio dos
Touros, on road Rondinha-Pascoal, next to Usina Hidreletrica, 28˚38’44.0"S 50˚17’06.0"W;
Jose
´Silva, 11 Mar 2015.—MCP 53174, 3, 64.4 mm SL; Bom Jesus: Rio dos Touros, below bar-
rage on road Rondinha to São Joaquim, 28˚38’45.0"S 50˚17’08.0"W; R. E. Reis, E. H.L. Pereira,
P. Fagundes, 5 Jan 2018.—UFRGS 21893, 1, 81.0 mm SL; São Jose
´dos Ausentes, Rio da Divisa,
tributary of Rio Pelotas, 28˚40´16.8˝S 49˚57´56.2˝W; L.R. Malabarba, J. Ferrer, T.P Carvalho,
R. Angrizani, 29 Apr 2016.—MCP 14387, 16, 46.7–94.1 mm SL; Bom Jesus: tributary of Rio
dos Touros, tributary of Rio Pelotas on road Silveira-Rondinha; 28˚39’18.0"S 50˚18’25.0"W; C.
Lucena, P. Azevedo and E.H.L. Pereira, 14 Jan 1989.—Santa Catarina: Rio Pelotas basin: MCP
14359, 1, 72.1 mm SL; São Joaquim: Arroio da Velha Sı
´lvia on road Bom Jesus to São Joaquim,
tributary of Rio São Mateus, tributary of Rio Pelotas, 28˚20’0"S 49˚57’0’W. C.A.S. Lucena, P.
Azevedo and E.H.L. Pereira, 15 Jan 1989.—MCP 22439, 2, 32.2–68.9 mm SL; Bom Jardim da
Serra: Rio Cachoeira on road from Bom Jardim da Serra to Santa Barbara, ca. 5.1 km N of
Bom Jardim da Serra, 28˚18’26"S 49˚37’02"W; R.E. Reis, A.R. Cardoso, P.A. Buckup and F.
Melo, 18 Dec 1988.—MCP 22438, 5, 35.7–47.0 mm SL; Bom Jardim da Serra: Rio Capivaras
on road from Silveira to Bom Jardim da Serra, 28˚24’21"S 49˚38’26"W; R.E. Reis, A.R. Car-
doso, P.A. Buckup, F. Melo, 17 Dec 1998.—Uruguay: Rio Cebollatı
´basin: NRM 36495, 2,
45.2–63.5 mm SL; NRM 36774,2; 53.2–56 mm SL; NRM 36848, 330.6–35.8 mm; Arroyo Local
at margin of Valentines, 33˚15’11"S 55˚05’59"W; F. Cantera and S. Kullander, 20 Nov 1997.—
NRM 39527,13,42.9–72 mm SL; NRM 37035, 1 C&S; 37037,1C&S; 37036,1, c&s; Treinta y
Tres: Arroyo Local at Valentines, 33˚16’0"S 55˚40"W; F. Cantera et al., 17 Jan 1997.—NRM
61491, 7; Rocha: Vela
´zquez: Arroyo de la India Muerta at Paso Santiago, 8 km from Vela
´zquez,
2 km from km 77 on Ruta 15m 34˚05’52"S 54˚15’53"W; S. Kullander et al., Mar 2011.—NRM
43943, 2, Treinta y Tres: Valentines, 33˚16’00"S 55˚04’00"W; F. Cantera, Dec 1997.—Uruguay:
Rio Olimar Grande basin: NRM 39546, 2 juvs, Treinta y Tres: Arroyo Averı
´as at Las Pavas, 30
km from Valentines and 8 km from Ruta Nacional, 19 33˚12"S 54˚43’59.9"W; F. Cantera, 24
Nov 1996.—NRM 61383, 3, juvs; NRM; 70180, 1, juv.; 70181,1, 28.4 mm SL; Treinta y Tres:
Vergara; Tributary of the Arroyo del Parao under bridge, Ruta 18, W of Vergara, 32˚55’12"S
53˚55’18.1"W; S. Kullander et al., 1 Mar 2011.—NRM 61427,1, juv.; Rocha: Tributary of the
Arroyo de las Averı
´as at Estancia El Ytay close to junction with Arroyo de las Pavas, 33˚
14’28"S 54˚50’44"W; S. Kullander et al., 4 Mar 2011.
Australoheros minuano Říčan & Kullander, 2008. Australoheros minuano R
ˇı
´čan & Kul-
lander, 2008 [4]: 35, fig. 15; holotype MCP 12710; Brazil, Rio Grande do Sul, Arroyo Canoin,
Rio Uruguay basin, road from Pirapo to São Nicolau).
Definition. Based on the position in the phylogenetic trees based on mt-cyb and mt-coI, and
minimum uncorrected p-distance in mt-coI exceeding 2% from all other species of the genus,
Australoheros minuano is a distinct evolutionary lineage. Australoheros minuano is similar
only to A.angiru,A.kaaygua mboapari,A.acaroides A.ricani,A.sanguineus,A. and A.scitulus
in presence of a zipper band along the middle of the side, and distinguished from all of those
species by contrasting pattern of rows of small black spots on lateral scales.
Description of sample from Uruguay. Meristic data are given in Tables 3–9, proportional
measurements in Table 13. See Figs 22 and 23 for general shape.
Adults, about 50 mm SL and larger, moderately elongate, laterally compressed. Frontal con-
tour ascending at about 30˚, straight, slightly curved close to dorsal-fin base, which straight or
slightly curved, steeply descending at base of soft dorsal fin. Caudal peduncle margins straight,
parallel. Very slight indentation in frontal contour anterior to orbit; only one specimen
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 76 / 122
Fig 22. Australoheros minuano. A. adult female, 83.3 mm SL; Uruguay NRM 54147: Cerro Largo: Centurio
´n: Paso del
Centurio
´n: Cañada Vigia, tributary to Rio Yaguaro
´n about 2 km W of Rio Yaguaro
´n. B. Adult female 87.8 mm SL;
NRM 6140; Uruguay: Cerro Largo: Centurio
´n: Paso del Centurio
´n: Cañada Vigia, 2 km W of Rio Yaguaro
´n. C. Adult
female, 65.3 mm SL; NRM 54147; Uruguay; Cerro Largo: Centurio
´n: Arroyo Ceibal down from bridge. D. NRM
54141, 42.2 mm SL mm SL; Lower pharyngeal tooth-plate in occlusal view. E. Australoheros minuano, young, 42.2 mm
SL; NRM 54147, Uruguay; Cerro Largo: Centurio
´n: Arroyo Ceibal down from bridge.
https://doi.org/10.1371/journal.pone.0261027.g022
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 77 / 122
Fig 23. A.Australoheros sp., “Arapey”, adult female, 138.0 mm SL; NRM 52219; Uruguay: Salto: Rio Uruguay
drainage,10 km from Valentin, below road 31 bridge, small stream within the Rio Arapey drainage. B Australoheros
minuano, holotype, adult, not sexed, 70.8 mm SL; MCP 12710; Brazil, Rio Grande do Sul, Arroyo Canoin, Rio Uruguay
drainage, road from Pirapo to São Nicolau. C. Australoheros minuano, paratype, adult, not sexed, 83.9 mm SL. MCP
46757; Brazil, Rio Grande do Sul, Arroyo Canoin, Rio Uruguay drainage, road from Pirapo to São Nicolau. D.
Australoheros ribeirae, adult male, 63.4 mm SL; NUP 5514; Brazil: São Paulo: Tapiraı
´: Rio Ribeira de Iguape basin:
Ribeirão do Prumo, tributary of Rio Verde, Sı
´tio União, bairro doCha
´.
https://doi.org/10.1371/journal.pone.0261027.g023
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 78 / 122
observed with indication of nuchal protuberance and marked frontal indentation (Fig 23C).
Subadults and juveniles with gently curved dorsal and ventral contours, approaching ovoid or
rounded outline; frontal contour straight, frontal indentation absent. Gill cover with distinct
indentation at dorsal junction of opercle and subopercle.
Mouth terminal, below level of orbit; tip of maxilla exposed, not reaching to vertical from
anterior margin of orbit, jaws isognathous, but tooth band of lower lip closing opposite or pos-
terior to upper tooth band. Lips moderately thick, both lip folds interrupted symphysially. Jaw
teeth in 2–3 rows; in both jaws anterior 6 teeth in outer row slightly larger than the rest,
pointed, slightly recurved; small second cusp present lingually. Teeth in outer hemiseries 6–13
in upper jaw, 10–17 in lower; 1–2 inner rows of smaller caniniform teeth in both jaws (about
half height of anterior outer teeth, slightly smaller in posterior sequence). Abraded teeth not
present.
Anterior insertion of dorsal fin at vertical from insertion of pectoral-fin base; first dorsal-
fin spine about 1/3 length of last spine, length increase gradual from first to last spine. Soft dor-
sal fin with broad pointed tip, rays 4+5 longest, extending to about vertical through middle of
caudal fin or slightly shorter. Anal-fin spines increasing slightly in length from first to last; soft
dorsal fin with broad tip formed by rays 3+4, reaching at most to vertical through middle of
caudal fin. Caudal fin rounded.
Pectoral fin inserted slightly anterior to pelvic-fin insertion, at distance from pelvic-fin
spine corresponding to length of pelvic-fin base. Pectoral-fin tip rounded; pectoral fin reaching
nearly to vertical from genital papilla. Pelvic fin long, pointed, first soft ray longest, reaching to
genital papilla. Small specimens with more rounded vertical fins, pelvic fin with rounded tip,
reaching to anal-fin insertion or slightly shorter.
Bases of dorsal, anal, and caudal fins scaled. Dorsal-fin base with basal scales from 7th
spine, rows of interradial scales from12th, 13th or 15th spine, at most 6 slightly elongated scales
between two spines, scale layer covering proximal half of fin; soft portion with thick basal scale
layer, scales slightly more rounded than on spinous portion. Specimens smaller than 40 mm
SL with scales basally on soft dorsal fin only. Anal fin with single row of basal scales, on soft
portion added a dense layer of basal scales, up to for between two rays. Caudal fin with dense
layer of scales basally, rows of small interradial scales reaching to middle of fin.
Colouration in preservative. Ground colour beige; markings dark brown or black. Cheeks
pale brown, front and nape grey. Abdomen beige, may be grey along midline. Chest greyish
brown or beige. Bar 1a posteriorly on caudal peduncle, brown, not extending onto caudal-
peduncle margins. Bar 2 brown, straight vertical or slightly curved, extending between poste-
rior insertions of dorsal- and anal- fins. Bar 3 brown, straight vertical or slightly curved,
extending between dorsal-fin base and middle of anal-fin base. Bar 4 brown, straight vertical
or slightly curved, extending from anterior insertion of anal fin up to dorsal-fin base, but may
be forked or caudad inclined above upper lateral line. Bars 5–6 integer, brown or pale brown,
straight vertical, extending from lower abdominal side, dorsally to dorsal-fin base, but may be
paler or interrupted in pale zone along upper lateral line, and bar 5 may be forked above upper
lateral line. Dark brown blotch immediately below first lateral lines scale, representing bar 7.
Two dark brown bands representing bar 7 crossing nape. Bar 8 represented by dark brown
blotch between orbit and upper end of preopercle. Bar 9 represented by two indistinct grey
stripes between orbits. Vertical bars on side formed by uniform vertically extended pigmenta-
tion, overlain by dark scale bases in scale rows E1, 0, H1–4. Dark brown scale bases forming
irregular horizontal lines in scale rows E1–2, 0, H1–3/4, separated by indistinct light inter-
stripes. Continuous lateral band absent. Intensified dark scale bases in scale rows 0 and E1
may be contiguous and form two parallel stripes, intensified where crossing vertical bars. Mid-
lateral blotch small, confined to bar 4, on E1 scale, may extend onto E2 scale, round or
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 79 / 122
rectangular, indistinct or absorbed by bar 4. Similar, smaller blotch may be present in Bar 3
and/or Bar 5.
Dorsal-fin base black, rest of fin grey, interradial membranes black, dark grey or brown
depending on preservation; vertical bars may be extended onto scaled dorsal fin base, but not
forming prominent extension onto the dorsal fin. Anal fin pale grey, interradial membranes
area darker grey, black or brown depending on presentation. Caudal fin brown basally, pro-
gressively lighter distally, interradial membranes grey, distal margin grey. Pelvic fin pale grey,
brown or black. Caudal spot (bar 1p) round, square, or vertically narrowly elliptic, in most
specimens present at base immediately dorsal to lower lateral line level, crossing 7 caudal-fin
rays, but may extend as midbasal short vertical bar, or show as small blotches, one above and
one below lateral line.
Small specimens, less than 50 mm SL, similar to adults in colouration, but vertical bars less
contrasted, and not forked on dorsum. Prominent pattern of small dark brown spots formed
from dark scale bases. Soft unpaired fins hyaline. Abdominal bars 3 (12), or 4 (6) in NRM
54147, 6397, 61408, and 61526.
Specimens examined.Uruguay: NRM 54123, 6, 32.6–47.5 mm SL; NRM 55067, 1, 24.5 mm
SL; Cerro Largo: Rio Tacuari basin: small stream crossing Ruta 26, near Posta del Chuy, 32˚
24’50’’S 53˚52’16’’W; 25 Oct 2005. S. Kullander et al.—NRM 54147, 13, 38–83.3 mm SL; Cerro
Largo: Centurio
´n: Arroyo Ceibal down from bridge, 32˚9’6’’S 53˚46’55’’W. 26 Oct 2005; S.
Kullander et al.
NRM 55152, 1, 40.8 mm SL; NRM 54196, 4, 36.0–96.1 mm SL; Cerro Largo: Ramo
´n Trigo:
stream tributary of the Rio Negro crossing Ruta 26 Melo–Tacuarembo
´, at about km 389, 32˚
20’17’’S 54˚37’57’’W; 27 Oct 2005; S. Kullander. et al.—NRM 61397, 2; 56.4–83.6 mm SL;
Cerro Largo: Centurio
´n: small stream crossing Ruta 7 ca 15 km from Paso del Centurio
´n, 32˚
11’5’’S 53˚54’23’’W; S. Kullander, F. Cantera, P. Lasnier, 28 Feb 2011.—NRM 61408, 2, 87.8–
92.9 mm SL; Cerro Largo: Centurio
´n: Paso del Centurio
´n: Cañada Vigia, tributary of the Rio
Yaguaro
´n about 2 km W of Rio Yaguaro
´n, 32˚8’23’’S, 53˚45’18’’W; S. Kullander, F. Cantera, P.
Lasnier, 27 Feb 2011..—NRM 61526, 1, 41.3 mm SL; Cerro Largo: Paso del Centurio
´n, south-
ern end of small lake slightly east of Rio Yaguaro
´n, 32˚8’34’’S 53˚43’46’’W; 27 Feb 2011. S. Kul-
lander et al.—NRM 51079, 9, 7.4–74.7 mm SL; Tacuarembo
´: Ruta 31, km 196, Cañada de los
Peña, 31˚23’27.2"S 56˚07’23.5"W, P. Laurino et al., 16 Mar 2003.—NRM 52769, 1 juv.; Rivera:
Rio Tacuarembo
´basin: Arroyo Rubio Chico, at km 239.4 on road 30, under bridge; S. Kullan-
der et al., 11 Oct 2004.—Brazil: Rio Grande do Sul: MCP 16196, 1, 64.7 mm SL; São Luiz Gon-
zaga: Rio Piratini basin: Arroio Ximbocuzinho on road São Luiz Gonzaga to Bocoroca, 4 km
from São Luiz Gonzaga, 28˚27’00.0"S 54˚58’00.0"W; P.H.Wimberger, R.E.Reis, J.F.Pezzi da
Silva et al., 11 Dec 1992.—MCP12724, 1, 75.3 mm SL, paratype: MCP 12724, 42, Brazil, Rio
Grande do Sul, Arroyo Paso do Alto, Rio Uruguai basin, 5 Nov 1988. C.AS. Lucena, L. Berg-
mann, E. H.L. Pereira, P. Azevedo and A. Ramı
´rez.—MCP 11227, 24 paratypes, Arroyo
Garupa, divisa Quarai /Alegrete, Rio Uruguai basin, C.A.S. Lucena, L. Bergmann and P. Aze-
vedo,12 Nov.1988.
Australoheros “Arapey”: NRM 52121, 1, 99.6 mm SL; Salto: ponded stream, tributary of the
Rio Arapey Grande, at ca km 100 on road 4, 31˚31’59.9"S 57˚01’49.8"W; S. Kullander et al., 7
Oct 2004.—NRM 52219, 1,138.0 mm SL; NRM 52222, 1, 55.5 mm SL; Salto: 10 km from
Valentin, below road 31 bridge, small stream within Rio Arapey basin, 31˚16’31.7"S 57˚
09’20.3"W; S. Kullander et al., 7 Oct 2004.
Geographical distribution (Fig 1). In Uruguay, upper Rio Yaguaro
´n, upper Rio Tacuarı
´,
both draining to Laguna Merı
´n; and headwaters of the Rio Negro (Rio Tacuarembo
´); else-
where, in the Rio Piratini basin in Brazil. Localities near Centurio
´n were recorded as within
the Yaguaro
´n basin, but most likely include tributaries of the Rio Negro.
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 80 / 122
Comments. Three specimens of Australoheros from the lower Rio Arapey could not be
assigned to species with certainty, and are here referred to as Australoheros “Arapey”. Two of
the specimens had a colour pattern similar to A.facetus, i.e. without distinct dark spots in the
vertical bars and without horizontal stripes; one of those had an mt-co1 sequence similar to
but distinct from that of other A.minuano (Fig 23A). DNA samples were not available from
the other two Arapey specimens, but one of them had the lateral stripe pattern found in A.
minuano and A.acaroides.
Australoheros minuano was described based on four samples from tributaries of the Rios
Piratini the and Quaraı
´in the Rio Uruguay basin in Brazil [4]. The type locality, the Arroio
Canoin in the lower Piratini basin, is the same as for Australoheros charrua. The paratypes
from the Quaraı
´basin were of small size, and the identification may have to be revised. Only
one new record is known from the Rio Piratini basin, from the Rio Ximbocuzinho far south of
the earlier records.
Our material from southeastern Uruguay was identified as A.minuano with reservation.
Available evidence is compatible with species identity despite considerable separation of the
Brazilian and Uruguayan localities, but the Uruguayan specimens agree with A.minuano from
the type locality by relative slender shape, all meristic data, and the melanophore colour pat-
tern with double blotches in the rande do Sul, Arroyo Canoin, Rio Uruguay basin, road from
Pirapo to São Nicolau.
The “Cichlasoma” sp. “Tacuarembo
´” reported by Litz et al. [107] was identified as A.min-
uano by R
ˇı
´čan and Kullander [4]. Specimens from the same locality were available at NRM
(NRM 51079) but for some reason not recognised as such in the collection and consequently
not included in the original description. The live colour description given by R
ˇı
´čan and Kul-
lander [4] was based on the publication by Litz et al. [107], and has not been confirmed for the
Arroio Canoin sample.
In addition to A.charrua and A.minuano from Arroio Canoin, two specimens were identi-
fied by R
ˇı
´čan and Kullander [4] as A.kaaygua (actually A.angiru) which is otherwise restricted
to the upper Uruguay basin. The records from Centurio
´n were recorded as from the Rio
Yaguaro
´n, but more likely pertain to small streams headwaters of the Rio Negro basin, close to
the Rio Yaguaro
´n.
Recognition of A.minuano was based on the distinct mitogenome. No morphological char-
acters were found to discriminate between A.acaroides and A.minuano. Both were character-
ised by the colour pattern, with scale margins forming irregular lateral stripes. The
accentuated black spots on the scale bases were unique for A.minuano, but the rest of the col-
our pattern variation fell within that of A.acaroides. Colour pattern distinguished A.minuano
and A.acaroides from A.facetus, in which lateral stripes were absent.
Uruguayan A.minuano had a slightly shorter lower jaw than A.acaroides. The slope on SL
was identical, and the intercepts were significantly different (F = 35.060, P = 0.000), but the
size range for A.minuano was smaller. In general aspect adult A minuano was strikingly elon-
gate, with gently curved frontal contour, contrasting with most congeneric species, which are
deep-bodied with straight descending frontal contour, often with a slight frontal indentation.
No freshly collected specimens or DNA was available of Australoheros minuano from the
type locality. Australoheros minuano was distinguished mainly based on the colour pattern,
including a lateral band described by R
ˇı
´čan and Kullander [4] as shifting one scale up along
the side. This, however, is the pattern of dark stripes along the middle of the side present in
most southern species, most distinct in in A.ricani,A.acaroides, and A.kaaygua. A similar
colour pattern is present in A.charrua, sharing type locality with A.minuano.Australoheros
minuano and A.charrua were separated mainly on the colour pattern, A.charrua with a larger
midlateral blotch, and slight differences in the shape of the head [4].
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 81 / 122
Australoheros ribeirae Ottoni, Oyakawa & Costa, 2008. Australoheros ribeirae Ottoni,
Oyakawa & Costa, 2008 [5]: 76, fig. 1 (holotype MZUSP 4228; type locality Brasil: Estado de
São Paulo; Municı
´pio de Sete Barras: lagon [sic] near the Sr. Celso farm, road Sete Barras-EL
Dorado [sic]).
Definition. Based on the position in the mt-cyb and mt-coI trees and minimum uncorrected
p-distance in mt-coI at 2% or more from all other species of the genus, Australoheros ribeirae is
a distinct evolutionary lineage. Specimens of A.ribeirae can be distinguished from southern
species of Australoheros by absence of zipper band, but no morphological autapomorphy was
registered.
Description of sample. Meristic data are given in Tables 3–9, proportional measurements in
Table 14.Fig 23(D) Shows general aspect.
Moderately elongate to deep-bodied, laterally compressed. Predorsal contour straight
ascending or with slight indentation anterior to orbit, curved anterior to dorsal-fin origin.
Nuchal elevation absent in both sexes. Dorsal profile curved, slightly descending to end of dor-
sal-fin base Caudal peduncle slightly tapering, contours straight. Prepelvic contour slightly
curved or straight. Abdominal contour straight or slightly convex. Anal-fin base contour
straight ascending. Head short, laterally compressed. Snout short, blunt, subtriangular in lat-
eral aspect, rounded in dorsal aspect. Mouth terminal, forward directed, close to horizontal
line from lower margin of orbit. Lips moderately thick, lower lip fold continuous anteriorly.
Jaws equal in anterior extension; maxilla and premaxilla not reaching to vertical from anterior
margin of orbit. Orbit removed from frontal contour, in middle of head length, in upper half
of head. Teeth in both jaws caniniform, slightly recurved, in outer row slender, increasing in
size toward symphysis. Bicuspid teeth not observed. Teeth in outer hemiseries in upper/lower
jaw 12–14/15–16. Inner teeth in two rows. Gill rakers externally on first gill-arch 2 epibran-
chial, one in angle and 6–8 ceratobranchial. Microbranchiospines present externally on second
to fourth gill-arch.
Dorsal-fin spines increasing in length to about 6th, from which subequal, last spine longest,
soft dorsal-fin rounded, fifth soft fin-ray longest, reaching to about middle of caudal fin. Soft
anal fin rounded, with short point formed by fifth soft fin-ray, reaching to about middle of
caudal fin. Pectoral fin rounded, fifth ray longest, reaching to vertical from anal orifice. Pelvic
fin pointed, first soft ray longest, reaching to base of fourth anal-fin spine. Caudal fin rounded.
Scales on body finely ctenoid. Predorsal midline scales about 11–12, slightly smaller than
flank scales, covered by skin, only part with exposed margin, irregularly arranged, mixed
cycloid and weakly ctenoid. Chest scales ctenoid, almost size of flank scales. Cheek scales in
3–4 series, covered by skin. Opercular scales cycloid, covered by skin. Between first upper lat-
eral line scale and dorsal-fin origin 3 scales Accessory lateral line scales absent from caudal fin.
One large and one small scale separating last scale of upper lateral line from dorsal-fin base.
Prepelvic scales anteriorly small, cycloid and without free margin, remaining scales only
slightly smaller than flank scales, weakly ctenoid and with free margin. Fin scales ctenoid. Row
of minute scales along dorsal-fin base from 9th spine, basal squamation gradually expanded,
interradial scales in single series, from 13
th
spine, on soft fin up to 4 scales between two soft
rays, scales absent from last one or two interradial membranes. Soft anal fin with narrow basal
scale layer.
Colouration in preservative. Adults, about 40 mm and larger with ground colour fawn or
pale grey. Bars 1(a, p) to 6 present, dark brown, 2–3 scales wide; Bar 6 absent above lateral
band; Interbars 1–3 scales wide. Lateral band on E1 scale row extending from gill cleft caudad
to Interbar 4. Bar 5 integer, terminating dorsally in lateral band or extending dorsally at most
to dorsal-fin base. Bars vertical or dorsal and ventral portions of Bars 2–4 slightly caudally
inclined. Bars 5 and 6 forming Y-marking. Dorsal branches of bar 7 present, expressed as
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 82 / 122
short rostrad inclined light brown or grey bars crossing anterior dorsal-fin base and occiput,
respectively. Midlateral blotch round, black or dark brown present in Bar 4 on E1 scales and
parts of adjacent scales, barely exceeding Bar 4 in width; corresponding portions of bars 2 and
3 may be slightly widened or more intensely pigmented but distinct spots absent from bars 2
and 3. Bar 5 split in one specimen, resulting in 4 abdominal bars. Bars 2–4 extending dorsad
onto base of dorsal fin. In Bars 2–6 ventral to scale row 0, small black spot at middle of poste-
rior margin of each scale. Caudal blotch (Bar 1b) indistinct, minimal, or distinct, light or dark
brown, darker on or restricted to upper lobe, or forming vertical bar across middle of caudal-
fin base. Vertical fins pale grey, translucent. Pelvic fin dark grey distally, lighter medially.
Geographical distribution (Fig 1). Available records were restricted to tributaries of the Rio
Juquia
´and the lower Rio Ribeira de Iguape.
Material examined. All from Brazil: São Paulo: Rio Ribeira de Iguape basin.
LBP 6739, 1, 79.9 mm SL; Apiai: stream near Apiai; C. Oliveira et al., 12 May 1997.—
LBP 16839, 1, 68.5 mm SL; Miracatu: Rio Fau, 24˚12’26.5’’S, 47˚28’36.9’’W; R. Devide
´, 14
Aug 2012.—LBP 2133, 2, 27.8–69.4 mm SL; Pedro de Toledo: Rio do Peixe, 24˚16’35.5’’S, 47˚
13’33.2’’W; M.C. Chiachio, R. Devide
´and D.C. Ferreira, 12 Mar 2003.—NUP 5514, 1, 63.4
mm SL; Tapiraı
´: Ribeirão do Prumo, tributary of the Rio Verde, Sı
´tio União, bairro do Cha
´,
24˚ 1’ 42.71"S; 47˚36’50.08"W; A. Nogueira Bozza, 14 Feb 2008.
Comments.Australoheros ribeirae was described [5] based on the holotype, 43.7 mm SL,
and 43 paratypes, 12.3–75.5 mm SL from the lower Rio Ribeira de Iguape and its tributaries,
the Rio Juquia
´and the Rio Pariquera Mirim. The diagnosis exclusively referred to a unique
combination of characters, including 9–10 dorsal-fin rays, 6–7 anal-fin spines, 8 anal-fin rays,
14 precaudal and 12 caudal vertebrae, 24–26 scales in longitudinal series, 16–18 scales in upper
lateral line, ratios of head depth, last dorsal-fin spine, predorsal length, preorbital depth, head
width; narrow ectopterygoid, truncate process of second vertebrae, epibranchial 2 with two
long processes, anterior arm of epibranchial 1 long; variation in the vertical bars, absence of
spots on the head, and sides usually red. Comparative illustrations emphasise absence of
forked vertical bar in comparison with A.facetus (fig. 2), and differences from A.facetus in in
the shape of pharyngobranchials and epibranchials (fig. 4). There are two figures labelled Fig 5.
One of them, referred to as fig. 6 in the text, shows a narrower ectopterygoid in A.ribeirae
than in A.facetus and the ‘new species of Rio de Janeiro’, but the caption to fig. 5 (= fig. 6)
refers to the type locality of Dicrossus gladicauda, and consequently is not informative con-
cerning which species is illustrated with a wider ectopterygoid. The other fig. 5 shows the cau-
dal skeleton of A.ribeirae and ‘New species of Rio de Janeiro‘. The text refers to fig. 5 as
showing ‘process of second vertebra truncate [in ‘New species of Rio de Janeiro‘] vs pointed.
The process is probably the neurapophysis of preural 2. No voucher data or specimen lengths
were provided for the osteological drawings; but they were used again by Ottoni & Costa [6]
and are commented on above. The comparative drawing of colour pattern in A.ribeirae and
A.facetus shows a strange pattern in the illustration of A.facetus, with multiple bifurcations,
and a very large triangular Bar 1, that we have not observed in A.facetus.
Too few specimens were available to permit a full morphological description of A.ribeirae;
DNA data, however, confirmed the presence of a distinct species of Australoheros in the Rio
Ribeira de Iguape basin. None of the specimens had the unique combination of characters that
made up the diagnosis of the species; for instance, none of them had the required body depth
51.3% of SL. The narrow ectopterygoid remains a synapomorphy shared only with A.ipatin-
guensis, but could not be verified. Table 21 shows that counts and proportional measurements
overlap with other species from the Sudeste.
In the phylogenetic analysis (Figs 12 and 14), Australoheros ribeirae and A.sanguineus were
rerecovered as a clade in a trichotomy with the northern and southern species and they are
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 83 / 122
distributed in separate but adjacent river basins. Only few specimens were available of each
species, and collecting localities were restricted to small areas, but the phylogenetic position
suggested that they represent two successive isolated speciation events.
Australoheros ribeirae was similar to A.sanguineus in meristic data and proportional mea-
surements. The major difference may be in the colour pattern. In A.ribeirae, there were small
black spots at the bases of the scales of the lower sides, absent in A.sanguineus, but similar to
the ventral spots in A.minuano; the lateral band had irregular margins but did not show the
zipper pattern characteristic of southern species of Australoheros.
Australoheros ipatinguensis Ottoni & Costa, 2008. Australoheros ipatinguensis Ottoni &
Costa, 2008 [6]: 214, fig. 7]6]; spelt ipatiguensis on p. 216. (holotype UFRJ 7553; type locality
Brazil: Estado de Minas Gerais: Municı
´pio de Ipatinga: co
´rrego Brau
´na, rio Doce basin; cor-
rected by Ottoni et al. (2020) [108], to Brazil: Estado de Minas Gerais: Municipio de Belo
Oriente: Co
´rrego Brau
´na, a tributary of Rio Santo Anto
ˆnio, Rio Doce Basin, nearby[sic] a sec-
ondary road to the MG-232 road between Santana do Paraı
´so and Belo Oriente, between coor-
dinates 19˚16’10’’S 42˚30’48’’W and 19˚17’09’’ S 42˚31’26’’W.
Australoheros autrani Ottoni & Costa, 200 [6]: 209: fig. 1 (holotype UFRJ 7256; type locality
Brazil: Estado do Rio Janeiro: Municı
´pio de Silva Jardim: rio Aldeia Velha, BR-101, rio São
João basin).
Australoheros muriae Ottoni & Costa, 2008 [6]: 220, fig. 10 (holotype MNRJ 32181; type
locality Rio de Janeiro: Itaperuna: rio São Domingos, tributary from [sic] rio Muriae
´, rio Para-
ı
´ba do Sul basin)
Australoheros saquarema Ottoni & Costa, 2008 [6]:225, fig. 13 (holotype UFRJ 7255, type
locality Brazil: Estado de Rio de Janeiro: Municı
´pio de Saquarema: rio Burac¸ão)
Australoheros macaensis Ottoni & Costa 2008 [6]: 218, fig. 9 Holotype UFRJ 7573, 66.8 mm
SL; type locality Brazil: Estado do Rio de Janeiro: Municı
´pio de Macae
´: rio dos Quarenta, BR-
101 (S 22˚ 13,3‘/W41˚,45,580‘).
Australoheros capixaba Ottoni, 2010 [8]: 20, fig. 1. (holotype UFRJ 7725; type locality Brazil:
Estado do Espı
´rito Santo stream under a bridge in a ES street, between Municı
´pio de Jaguare
´
and Municı
´pio de São Mateus (S 18˚34,953’ e WO 4026,115’).
Australoheros perdi Ottoni, Lezama, Triques, Freagoso.Moura, Lucas & Barbosa, 2011 [10]:
140, fig. 2 (holotype DZUFMG 071; type locality Brazil, Minas Gerais state, Marlie
´ria munici-
pality, lacustrine region of the middle Doce River basin, Doce River Valley, Parque Estadual
do Rio Doce, Lagoa Gambazinho, 19˚47’10.6’’S, 42˚34’48.3’’W).
Definition. Based on the position in the mt-cyb and mt-coI trees and minimum p-distance
in mt-coI exceeding 2% from all other species of the genus, Australoheros ipatinguensis is a
distinct evolutionary lineage. No morphological autapomorphy was registered. Specimens of
A.ipatinguensis can be distinguished from most congeneric species by colour pattern and
scale cover: zipper band absent (present in A.acaroides,A kaaygua,A.minuano,A.sangui-
neuus,A.mboapari, and A.ricani), absence of brown or blue iridescent markings on sides of
head (present in A.scitulus,A.forquilha and A.ykeregua); similar to A oblongus in adults with
long middle dorsal and anal fin rays reaching end of caudal fin or beyond, and pelvic fin
reaching to middle of anal-fin base fin (anal dorsal and anal fins reaching at most to middle of
caudal fin; pelvic fin reaching at most bases of anterior anal-fin spines in all other species of
Australoheros); adults distinguished from A.oblongus by subovoid lateral contour with
smoothly descending frontal contour and slight or absent indentation at level of upper margin
of orbit; bar 1p situated at middle of caudal-fin base vs mainly confined to the dorsal half of
the caudal-fin base, and Y mark almost omnipresent vs typically absent.
Description of sample. Meristic data are given in Tables 3–9, proportional measurements in
Table 15.Fig 24 shows representative specimens for variation in general shape and colour pattern.
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 84 / 122
Fig 24. Australoheros ipatinguensis. A. young male, 54.5 mm SL; MCP 36657; Brazil: Rio de Janeiro: São Francisco
de Itabapoana: Rio Guaxindiba on Fazenda Santa Cruz, near Maniva. B. Adult male, 83.3 mm SL; MNRJ 47307; Brazil:
Rio de Janeiro: Itaperuna: bridge over the Co
´rrego São Domingos, on road toward Fazenda São Domingos. C. Adult
female, MZUSP 16178, 77.3 mm SL; Brazil: Rio de Janeiro: Rio Paraı
´ba do Sul at São João da Barra. D. Adult male, 60.6
mm SL; UFBA 4995; Espı
´rito Santo: Pedro Cana
´rio: Rio da Samambaia, on BR.
https://doi.org/10.1371/journal.pone.0261027.g024
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 85 / 122
Sexes isomorphic except vertical and pelvic fins slightly longer in some large males than in
large females, and genital papilla in males slender, conical, in females wider, blunt. Moderately
elongate to deep-bodied; frontal contour straight ascending or with minor curvature, continu-
ous with curved dorsal-fin base contour; only large specimens with indication of nuchal swell-
ing and minor indentation in frontal contour at level of orbit. Prepelvic contour straight, less
inclined than frontal contour. Caudal peduncle contours contour slightly curved or straight.
Abdominal contour straight horizontal, except slightly convex in females. Anal-fin base
slightly convex, ascending. Head short, laterally compressed. Snout short, blunt, subtriangular
in lateral aspect, narrowly rounded in dorsal aspect. Mouth terminal, forward directed, at level
of lower margin of orbit or slightly more dorsal. Lips moderately thick, Jaws equal in anterior
extension; maxilla and premaxilla not reaching to vertical from anterior margin of orbit. Orbit
removed from frontal contour, in middle of head length, in upper half of head. Teeth in outer
hemiseries in upper/lower jaw 9–14/13–20. Inner teeth in 2 rows, in both jaws. Gill rakers
externally on first gill-arch 1–2 epibranchial, one in angle and 5–7 ceratobranchial. Microbran-
chiospines present externally on 2nd to 4th gill-arch.
Scales on body finely ctenoid. Predorsal midline scales about 11–14, about half size of flank
scales, covered by skin, only part with exposed margin, irregularly arranged, weakly ctenoid.
Cheek scales in 3(rarely 4 or 5) rows, cycloid, covered by skin. Opercular scales mixed cycloid
and ctenoid, covered by skin or margin partly exposed. Accessory lateral-line scales observed
in three specimens, with tube between 3rd and 4th dorsal ray and 4th and 5th ventral rays; 2nd
and 3rd dorsal rays; and 4th and 5th ventral rays, respectively. Between first upper lateral line
scale and dorsal-fin origin 3 or 4 large or 3 large and one small scale. Between last upper lateral
line scale and dorsal fin one large or one large and one small scale. Prepelvic scales about half
size of flank scales, embedded in skin, without free margin. Lateral chest scales ctenoid, with
exposed margin, about 2/3 size of flank scales. Fin scales ctenoid. Row of minute scales along
dorsal-fin base from
12th
or 13
th
spine, interradial scales from between 15th to 16th spine cau-
dad, on soft fin in one or two rows with up to 7 scales between two soft rays, scales present also
on last two interradial membranes. Anal fin with narrow basal scale layer from 4th spine, on
soft-rayed portion up to 6 scales in interradial row.
Dorsal–fin spines increasing in length to 7th from which subequal, last spine longest, soft
dorsal-fin rounded or subacuminate in young; in large adults with pointed tip, 5th ray longest,
at most reaching to end of caudal fin or slightly longer. Soft anal fin rounded or subacuminate
in young; in adults with pointed tip, 4th or fifth ray longest, reaching to beyond middle, or pos-
terior 1/4th of caudal fin. Pectoral fin rounded, 4th longest, reaching to vertical from base of
first or second anal-fin spine. Pelvic fin pointed, first ray longest; in young reaching to base of
4rd anal-fin spine; in large adults produced, at most to soft anal- fin base. Caudal fin rounded.
Colouration in preservative. Ground colour fawn or pale grey. Bars 1(a, b) to 6 present, dark
brown or dark grey, 2–3 scales wide; bar 6 absent above lateral band or extending only short
distance above it bar 5 exceptionally interrupted in E1 scale row; Interbars 1–2 scales wide; lat-
eral band on E1 scale row extending from gill cleft caudad to Interbar 4; Bar 5 bars 5 and 6
integer or, typically coalesced dorsally to form U-shaped marking (when Bars 5 and 6 inter-
rupted in E1 scale row) or Y shaped-marking (when Bar 5 continuous across scale row E1),
open to dorsal-fin base, extending dorsally at most to dorsal-fin base. Bars vertical or dorsal
and ventral portions of bars 2–4 slightly caudally inclined. Dorsal portions of bar 7 present,
expressed as short rostrad inclined brown or grey bars crossing anterior dorsal-fin base and
occiput, respectively. Midlateral black or dark brown blotch present in Bar 4 on E1 scales and
parts of adjacent scales; may be slightly widened or more intensely pigmented but distinct
spots absent from Bars 2 and 3. Bars 2–7 extending dorsad onto base of dorsal fin, and deep
black blotch particularly prominent in most specimens in above Bar 5. In Bars 2–6, vertical
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 86 / 122
black stripe may be present at middle or posterior margin of scales below scale row 0. Caudal
blotch (Bar 1p) distinct, expressed as vertically dark grey or brown extended oval blotch across
middle of caudal-fin base; or round blotch on dorsal lobe, and indistinct paler pigmentation
on lower lobe. Vertical fins pale grey, semitranslucent. Pelvic fin dark grey distally, lighter
medially.
Geographical distribution (Fig 1). Australoheros ipatinguensis has a wide distribution along
the coast of southeastern Brazil, from Saquarema north to Euano
´polis in the Rio Buranhe
´m
basin based on morphology, and from the Rio Macae
´north to Itau
´nas based on DNA samples.
The corrected type locality [108] is still close to Ipatinga, and within the Rio Doce basin, just in
the next municipality, and the correction has no immediate practical consequences.
Comments. The name ipatinguensis was explained [6] as being ‘in reference to the city
where the new species was collected’, referring to the municipality and city of Ipatinga. The
extra ‘u” in the name remains unexplained.
Australoheros ipatinguensis was described based on the holotype, 53.5 mm SL, and 14 para-
types, 9.6–44.5 mm SL, from the Rio Doce basin. The diagnosis is based on character states in
combination, including 12 caudal vertebrae, absence of marks on the side of the head; 15 dor-
sal fin spines, 10–11 dorsal fin rays, 9 anal fin rays, ‘common snout of Australoheros’ 24–25
proximal radials in dorsal fin; narrow ectopterygoid, absence of ‘depression on head’ [means
indented frontal contour; but minimal indentation shown on the photo of the holotype, fig. 7
although the outline of the specimen on the image has been edited with photo editing soft-
ware]; 13 proximal radials in anal fin base; arm of epibranchial 1 long, arms of epibranchial 2
with two short tubular processes, 10 rib pairs, 25–26 scales in a longitudinal row, body depth
47.3–51.2, last dorsal-fin spine 14.2–16.6% of SL, last anal-fin spine length 14.3–15.6%; arms of
trunk bar 7 with the same width. No autapomorphy is indicated.
Nominal species listed here as synonyms of Australoheros ipatinguensis were described by
Ottoni and collaborators with diagnoses that refer to character states pertaining to southern
species (spots on head absent, 12 caudal vertebrae), number of fin spines and rays, number of
proximal radials in dorsal and anal fins, number of pairs of ribs and, caudal peduncle length/
SL ratio, one or two long tubular processes on arms of epibranchial 2, long or short anterior
arm on epibranchial 1, width of the ectopterygoid. Characters unique to particular species in
the Uruguay basin are irrelevant here. The caudal peduncle is very short in most species of
Australoheros, including A.ipatinguensis, and besides that no regression analysis was made,
values may have low reproducibility. The counts of proximal radials in the dorsal and anal fins
is a duplication of fin-ray counts, but minus one for the compound anterior anal-fin pterygio-
phore, and better resolution in whether the last fin ray is independent or attached to the ptery-
giophore of the penultimate fin ray. Osteological characters were commented on above p. 00.
There are no indications on how many specimens or sizes were used to generate the osteologi-
cal data. Ottoni and Costa [6] did not provide frequencies for their meristic data; such were
available for species described in later papers, and visualise modality and potential extreme val-
ues in ranges, but the only representatives of A.ipatinguensis with frequencies are then the
nominal species A.capixaba and A.perdi. In the end, what we can comment on is mainly fin-
ray counts, scale counts and colour pattern.
Table 21 displays characters taken from the species diagnoses in the original descriptions
that lists proposed differences within A.ipatinguensis as here understood. Although Ottoni
et al. [47] indicated synonymy of A.autrani and A.saquarema, the morphological diagnoses of
those species were not updated at the same time; hence it may be appropriate here to refer to
the original diagnoses. In this tabulation, only the low number of pectoral-fin rays in A.perdi
might suggest a unique condition for the type series.
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 87 / 122
The tabular comparison shows relative internal consistency Some characters stand out and
disagree with our data, particularly the count of scales along the middle of the side (E1 scales
in our terminology, indicated as the same E1 by Ottoni [9]. The counts are too high whichever
method was used, but internally consistent. Australoheros oblongus and A.ipatinguensis have
24, rarely 23 E1 scales. Counting scales on the image of the holotype of A.muriae (Ottoni &
Costa. 2008: fig. 10), we arrived at maximum of 24, same as on the paratype MCP 42584,
although the range given for A.muriae is the extreme 27–29. The number of pectoral fin-rays
(14–15) is higher than our counts (12–13). In the osteological data, A.ipatinguensis sensu
Ottoni & Costa, is distinguished by narrow ectopterygoid and short epibranchial 2 processes.
The dorsal-fin counts for A.perdi are somewhat low, as commented below, but not out of
range. None of the meristic characters or proportional measurements is unique for any of the
nominal species in Table 21.
Australoheros autrani was based on the holotype from Silva Jardim in the Rio São João
basin, and 25 paratypes, all from the Rio São João, a small coastal stream just south of Rio Para-
ı
´ba do Sul. The holotype was not figured. The diagnosis distinguishes A.autrani from other
species in the same region by 10 pairs of ribs; anal-fin rays 9–10; proximal radials in dorsal fin
25–26; 15–16 dorsal fin spines, 10–12 soft dorsal-fin rays; 13–14 proximal radials in the anal-
fin base: absence of ‘depression on head’ [indented frontal contour]; caudal peduncle length
10.2–11.9% of SL; arms of bar 7 of equal width, two long tubular processes on arms of epibran-
chial 2, and wide ectopterygoid. No autapomorphy is signalled, and no character states dis-
criminating from A.saquarema. Identified only on the basis of the locality, our sequences of A.
autrani confirmed a unique haplotype, but at less than 2% uncorrected p distance in mt-coI
from other A.ipatinguensis and no morphological autapomorphy; hence our data did not sup-
port species status.
The original description of Australoheros muriae was based on 20 specimens, 20.9–121.3
mm SL from the Rio Muriae
´and tributaries. The Rio Muriae
´is a left bank tributary of the
lower Rio Paraı
´ba do Sul. The diagnosis lists character states in combination only, including
12 caudal vertebrae; marks absent from sides of head; 15 dorsal-fin spines; 14–15 pectoral-fin
rays; 11–12 soft dorsal-fin rays; 9–10 anal-fin rays; 24–25 proximal dorsal-fin radials; caudal
peduncle length 10.2–11.9% SL; wide ectopterygoid; epibranchial 2 arms with long tubular
processes; arm of epibranchial 1 long; arms of trunk vertical bar 7 of equal width, and ‘com-
mon snout of Australoheros’. It is distinguished from A.saquarema and A.macaensis. by dor-
sal spine number (16 vs 15). In our material from the Rio Muriae
´, seven had 15 spines, two
had 16. It was distinguished from A.saquarema,A.macaensis and A.ipatinguensis by more
soft dorsal-fin rays (11–12 vs 10–11). This range overlapped also with the counts given for A.
autrani (10–12). Australoheros muriae is further distinguished by more anal-fin rays than A.
macaensis (9–10 vs 8–9), which again is overlapping counts within the range of 8–10 for A.ipa-
tinguensis in the restricted sense. A.muriae is distinguished from A.autrani by fewer dorsal-
fin proximal radials (24–25 vs 25–26), again overlapping, and potentially different only from
A.perdi (22–24) in the species range 22–26; and shorter caudal peduncle. From ipatinguensis it
is distinguished by wide ectopterygoid and more scales in longitudinal row (27–29 vs 25–26).
Australoheros saquarema was based on the holotype, 80.3 mm SL, and 25 paratypes, 30.4–
79.2 mm SL from the Rio Burac¸ão and Rio Tinguı
´, two small streams flowing to the Lagoa
Saquarema and located close to the Rio São João. The Lagoa de Saquarema itself is a marine
lagoon. The diagnosis is based on characters in combination only, and refers to 14–15 proxi-
mal radials in the anal fin; head with depression near the snout in specimens longer than 30.0
mm SL; 10 rib pairs; 17–18 scales in the upper lateral line; wide ectopterygoid; arms of epibran-
chial 2 with two long tubular processes; arm of epibranchial 1 long, and arms of trunk vertical
bar 7 with the same width. The description is illustrated with a live colour photo of one of the
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 88 / 122
paratypes. No character state discriminating from A.autrani isas listed in the diagnosis. Proxi-
mal anal radials 13–14 in A.autrani vs 14–15 in A.saquarema are mentioned reciprocally, but
the overlap is non-discriminating.
A potential autapomorphy is described as ‘depression near the snout in specimens over 30
mm SL’. This state is not illustrated, but as it was expressed on the paratypes that we examined,
it is an artifact—the collapsed recess for the premaxilla.
Australoheros macaensis was described based on 24 specimens, 24.7–73.7 mm SL, from two
localities in the coastal Rio Macae
´basin, north of Silva Jardim. Distinguishing from A.ipatin-
guensis,A.autrani, and A.muriae the original diagnosis refers to ‘head with a depression near
the snout in individuals above 30.0 mm SL’, vs absence of such depression. This character
state, shared only with A.saquarema, is referable to collapse of the premaxillary recess in pre-
served specimens. It does not show on fig. 9, of a specimen 65.1 mm SL. In the diagnosis of A.
capixaba, it is stated that A.capixaba differs from A.macaensis and A.saquarema in ‘not hav-
ing a detached snout, with a depression on the snout (vs. detached snout, with depression on
head in specimens above 30.0 mm SL)’. There is no further reference to ‘detached snout’.
Australoheros macaensis is stated to be different from A.saquarema in fewer proximal radi-
als on anal-fin base (13–14 vs 14–15) but this is not discriminating; from A.ipatinguensis and
A.muriae by the number of dorsal-fin spines (16 vs 15), but even if valid for the modal values,
dorsal-fin spine counts vary in these nominal species, including 15 spines in a paratype of A.
macaensis (MCP 42403), and 16 in a paratype of A.ipatinguensis (MCP 42369); from A.mur-
iae and A.autrani by the number of soft rays in the anal fin (8–9 vs 9–10, but this is not dis-
criminating; from A.autrani,A.ipatinguensis, and A.saquarema by 11 rib pairs vs 10, but the
number of ribs should match the number of precaudal vertebrae minus 3, and all are stated to
have 14 precaudal vertebrae, corresponding to 13 precaudal vertebrae as we count them. Aside
from the rib count, there seems to be no character separating A.macaensis from A.saquarema,
which in turn is shown here to be identical to A.autrani.
The description of Australoheros capixaba was based on 29 specimens, 29.0–101.8 mm SL,
from the Rio Itau
´nas, Rio São Mateus, and Rio Doce in Espı
´rito Santo. The holotype is figured
(fig. 1), apparently in a photo tank before preservation. The outlines of the dorsal, caudal, and
anal fins have been retouched using image manipulation software. The original diagnosis dis-
tinguishes A.capixaba from A.saquarema,A.muriae,and A.ipatinguensis by longer caudal
peduncle (9.6–11.4% SL vs 6.6–7.9 combined in the other three nominal species.
Australoheros autrani has similar caudal-peduncle length ratio (10.2–11.9%SL) [6], and A.
perdi is reported with even longer caudal peduncle (9.3–11.6%) [10]. A.capixaba is further dis-
tinguished from A.autrani,A.ipatinguensis,A.muriae, and A.saquarema by 8 soft anal-fin
rays (9–10 in the others. We find 8–10 soft anal-fin rays in our material from Rio Itau
´nas and
Rio São Mateus, and specimens from the Rio Muriae
´with down to 8. Australoheros capixaba
is further distinguished from A.macaensis and A.saquarema by large red spots on the dorsal
portion of the trunk (vs absent); and from A.autrani,A.macaensis and A.saquarema by hav-
ing reddish chest (vs chest not reddish). Large red spots are absent from the image of the holo-
type (fig. 19). Most or all species of Australoheros have an indistinct layer of erythrophores on
yellow, green, or blue background colour; this is probably the case here as well. As formulated,
the description of the colour characteristics seems to distinguish A.autrani,A.macaensis, and
A.saquarema from the rest of Australoheros.
No specimens were available from the type locality of A.perdi, but the locality and descrip-
tion suggest that this name was based specimens of A.ipatinguensis—as it appears from the fig-
ure, in a very poor state of preservation. The diagnosis makes various comparisons with other
species. Foremost is the vertebral number 13+12, the total of 25 stated to be unique for the
genus, which it is not (cf. Table 3). The count of 13+12 vertebrae is uncommon in
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 89 / 122
Australoheros, however. Because Ottoni and collaborators count vertebrae in a way different
from us, however, their count possibly equals our 12+13, which is very rare in the genus
(Table 3). Australoheros perdi is said to differ from a series of other species by having ‘head
with depression’. On fig. 2 it looks like the premaxillary recess has collapsed in the upper speci-
men, but there is no obvious ‘depression’ in the front of the lower specimen. The sentence
with this statement may also be incomplete or partly duplicated: ‘Australoheros perdi differs
from A.autrani,A.barbosae,A.capixaba,A.ipatinguensis,A.macacuensis,A.macaensis,A.
muriae,A.paraibae,A.robustus,A.ribeirae and A.saquarema; and from A.autrani,A.barbo-
sae,A.capixaba,A.ipatinguensis,A.macacuensis,A.muriae,A.paraibae,A.robustus,A.
ribeirae and A.ribeirae by having head with depression in the region above the eyes (vs. head
without depression).’ Australoheros perdi is also stated to be different from A.barbosae,A.
muriae,A.autrani,A.capixaba,A.macaensis in having 11–13 vs. 14–15 pectoral-fin rays.
Ottoni et al.’s table 2 gives frequencies for the pectoral fin count: 11 (2), 12 (15), 13 (3). We
counted 13 pectoral-fin rays in 4 specimens from the Rio Macacu. In the total material of A.
ipatinguensis, 13 was the most common count, 12 in 10 specimens, 11 in one, and 14 in three;
A.oblongus had almost exclusively 13; one with 12,10 with 14. Thus, the count in A.perdi
matches the frequency in A.ipatinguensis and A.oblongus.Australoheros perdi is stated to dif-
fer from A.robustus by 14–16 dorsal spines vs 17. Our A.robustus have (in A.oblongus), 16–17
dorsal-fin spines. The commonest number of dorsal-fin spines in Australoheros was 16 fol-
lowed by 15 and 17, and thus 14 was uncommon (Table 6). The range given in Ottoni et al.’s
table 2 shows, however, a low frequency for 14 dorsal-fin spines [(14 (2), 15 (16), 16 (2)]. Pro-
portional measurements were not discriminating, as demonstrated in Table 21, No colour
characters were included in the diagnosis. Whereas the sample of Australoheros from Lagoa
Gambazinho (91 specimens, including some heads and many juveniles), may represent a dis-
tinct species indicated by lower vertebral counts, low pectoral-fin count (Table 21) all data are
compatible with an expanded concept of A.ipatinguensis.
Material examined. All from Brazil. Not assigned to nominal species: MNRJ 39366, 3, 69.2–
99.1 mm SL; Rio de Janeiro: São Jose
´da Barra: Barra do Ac¸u, 21˚51’2’’S 41˚0’2’’W; F.Pupo and
I.Verissimo, 8 Jun 2009.—MCP 17849, 1,73.6 mm SL; Minas Gerais: Teo
´filo Otoni: Rio San-
tana (tributary of the Rio Mucuri), on road Teo
´filo Otoni to Carlos Chagas (BR-418) at about
22 km E of Teo
´filo Otoni,17˚50’39.0"S 41˚20’54.0"W; R.E. Reis, S.A. Schaefer, E.H.L. Pereira, J.
F. Pezzi, 19 Jan 1995.—MCP 18140, 1, 31.1–46.9 mm SL; Minas Gerais: Teo
´filo Otoni: Ribeirão
da Areia, tributary of Rio Mucuri, on road from Pote
´to Ladainha, 17˚42’34.0"S 41˚47’35.0"W;
W.G. Saul, J.C.Garavello and A.S. Santos, 19 Jan 1995.—MCP 17840, 2, 19.7–44.5 mm SL;
Espı
´rito Santo: Rio Novo do Sul: Rio Novo do Sul, tributary of the Rio Moa
´, on road BR-101
little south of Rio Novo do Sul, 20˚52’33’’S, 40˚57’50’’W.; R.E. Reis, W.G. Saul and E.H.L. Per-
eira, 22 Jan 1995.—MCP 36955, 2, 21.8–22.2 mm SL; Espı
´rito Santo: Linhares: Rio Ipiranga
basin: Rio Ipiranga in Pontal do Ipiranga,19˚12’1’’S, 39˚43’22’’W; J.F.Pezzi, 8 Oct 2004.—
MZUSP uncat., 9, 19.0–46.4 mm SL; Espı
´rito Santo: Linhares: Rio Doce basin: Lagoa Nova;
[19˚31’08.4"S 39˚47’07.2"W]; H.A. Britzki and I.A. Dias, 3 Feb 1965.—MZUSP 16178, 9, 31.0–
81.7 mm SL; Rio de Janeiro: Rio Paraı
´ba do Sul at São João da Barra Collector and date not
recorded.[approx. 21˚51’00"S 41˚00’00"W].—UFBA 4717, 2 (of 5), 40.9–59.7 mm SL; Bahia:
Euna
´polis: Rio Buranhe
´m, in village Colo
ˆnia, near Ilhas; R. Burger and J.A. Reis, 24 Oct 2008.
—UFBA 4735, 2 (of 5), 50.7–60.6 mm SL; Bahia: Euna
´polis, Rio Buranhe
´m in Euna
´polis; R.
Burger and J.A. Reis, 24 Oct 2008.—UFBA 4944, 2 (of 4), 45.5–61.6 mm SL; Bahia: Euna
´polis:
Rio Buranhe
´m, near village Colo
ˆnia, 16˚09’14.8"S 39˚21’08.3"W, 140 mASL; A.M. Zanata, R.
Burger, A.B.A. Go
´es, T.A. Carvalho, 26 Feb 2009.—MCP 44943, 1, 83.3 mm SL; Espı
´rito Santo:
Domingos Martins: Rio Jucu basin: stream on road between Domingos Martins and Melgac¸o,
tributary of Rio Jucu, 20˚15’23’’S, 40˚40’14’’W.; R.E. Reis et al., 24 Jan 2010.—MCP 36657, 5,
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 90 / 122
24.6–61.4 mm SL; Rio de Janeiro: São Francisco de Itabapoana: Rio Guaxindiba on Fazenda
Santa Cruz, near Maniva, 21˚22’58’’S 41˚10’58’’W; J.F. Pezzi, 11 Sep 2004.
Assigned to nominal species: [Australoheros autrani]: MCP 42364, 2 paratypes, 47.3–52.1
mm SL; Rio de Janeiro: Silva Jardim: Rio A
´guas Claras, tributary of Rio São João, 29 km N of
Silva Jardim, 22˚40’00’’S 42˚22’00’’W; F. Autran, M. Landim, C. Moreira and A. Vianna, 30
Aug 1997.—UFRGS 18879, 3, 17.1–53.4 mm SL; Rio de Janeiro: Silva Jardim, ditch on road
between Gaviões and Japuı
´ba, 22˚34’33.0"S 42˚33’39.0"W; P.C. Silva, 1 Jan 2014. Near type
locality of A.autrani.—[Australoheros muriae]: MCP 42584, 1, paratype, 53.2 mm SL; Minas
Gerais: Itaperuna: Rio Paraı
´ba do Sul basin, Rio Muriae
´near crossing BR 256/RJ186 (acampa-
mento Restaurante Barra Vento), 21˚15’00’’S 41˚45’00’’W; D.F. Moraes and J.D.H. Halboth,
23 Jan 1990.—MHNG 2514.85, 3, 41.4–62.9 mm SL; Rio de Janeiro: Itaperuna: Rio Muriae
´on
road BR 393, 17 km south of Itaperuna [21˚16’23.0"S 41˚47’00.1"W]; W. Costa, M. Melgac¸o, R.
Mazzoni-Buchas and C. Weber, 11 Dec 1990.—MNRJ 47291, 1, 66.4 mm SL; Rio de Janeiro:
São Jose
´de Uba: Rio Paraı
´ba do Sul basin, Co
´rrego São Domingos at bridge of RJ-198, 200 m
from crossing with BR-393, 21˚18’56’’S 41˚51’58’’W; D.F. Moraes, Jr., E.B. Neuhaus and V.
Brito, 10 May 2016.—MNRJ 47307, 82, 10.0–97.8 mm SL; Rio de Janeiro: Itaperuna, bridge
over the Co
´rrego São Domingos, on road toward Fazenda São Domingos, 21˚15’44’S 41˚
47’47’’W; D.F. Moraes, Jr., E.B. Neuhaus and V. Brito, 10 May 2016. [Topotypical specimens, 4
measured, 60.8–97.8 mm SL.]—
[Australoheros saquarema]: MCP 42366, 2 paratypes, 45.3–48.0 mm SL; Rio de Janeiro:
Saquarema: Co
´rrego Buracão, tributary of Rio Mato Grosso, 22˚52’24’’S 42˚36’22’’W; W.
Costa, L. Villa Verde, F.P. Ottoni, J.L. Mattos and E. Mattos, 9 Oct 2005.—[Australoheros
macaensis]:—MCP 20195, 1, 84.7 mm SL; Rio de Janeiro: Macae
´: Rio do Salto, about 14 km
NW of Rio Dourado on BR101, tributary of the Rio Macae
´, 22˚23’11’’S 42˚07’19’’W; J.F. Pezzi,
E.H.L. Pereira and J. Montoya, 20 Jan 1997.—MCP 42403, 2 paratypes of A.macaensis, 30.9–
40.4 mm SL; Rio de Janeiro: Macae
´: Reserva União, 22˚25’35’’S 42˚02’21’’W; F.P. Ottoni, A.
Barbosa and J. Mattos, 29 Oct 2007.—MNRJ 24226, 3, 30.6–49.0 mm SL. Rio de Janeiro:
Macae
´: Parque Nacional Restinga de Jurubatiba, Lagoa de Carapebus, [approx. 22˚14’ 50’’S,
41˚36 20’’W]; P.H. Carvalho, J.I.S. Botero and J.F. Caluca, 7 Aug 2001.—MNRJ 47279, 3, 59.2–
61.7 mm SL; Rio de Janeiro, Macae
´: Rio dos Quarenta, under bridge on BR-101, about 500 m
from the interchange with RJ-106 highway, 22˚13’6’’S 41˚45’32’’W; P.A. Buckup, M.R. Britto,
C.R. Moreira, 29 Apr 2016. Topotypical specimens of A.macaensis.—NPM 5307, 2, 23.4–35.4
mm SL; Rio de Janeiro: Macae
´: Parque Nacional Restinga de Jurubatiba Lagoa Cabiunas,
Lagoa de Jurubatiba, 22˚18’05"S, 41˚41’36"W; A.C. Petry, 12 Aug 2015..—UFRGS 18911, 1,
53.2 mm SL; Rio de Janeiro: Macae
´: pool on country road between Barra de Macae
´and Cara-
pebus, 22˚13’38.0"S 41˚41’07.0"W; P.C. Silva, U. Santos, A. Hirschmann, A. Thomaz and T.P
Carvalho, 1 November 2014.—[Australoheros capixaba]: Rio Itau
´nas basin: MCP 18141, 6
paratypes, 10.5–49.2 mm SL; Espı
´rito Santo: Montanha: stream tributary of the Rio Itau
´nas
crossing road from Nanuque to Montanha about 5 km south of Nanuque; 17˚57’46’S, 40˚
23’46’’W; R.E. Reis, W.G. Saul and E.H.L. Pereira, 26 Jan 1995.—CZNC 1099, 4 (of 6), 134–
85.5 mm SL. Espı
´rito Santo: Pedro Cana
´rio: Cristal do Norte: Rio Itau
´nas, above and below the
dirt road at the foot of the Co
´rrego Limoeiro, 18˚12’46"S 40˚54’49"W; L.F.S. Ingenito et al., 10
Jun 2015.—UFBA 4995, 1, 60.5 mm SL; Espı
´rito Santo: Pedro Cana
´rio: Rio da Samambaia, on
BR 10, 18˚07’20.6"S 39˚33’20.2"W, 28 mASL; A.M. Zanata, R. Burger, A.B.A. Go
´es and T.A.
Carvalho, 27 Feb 2009.—Rio São Mateus basin: MCP 18139, 6, paratypes, 9.6–64.9 mm SL;
Espı
´rito Santo: Nova Vene
´cia: Rio São Mateus basin: Rio Cricare
´, about 1 km above Nova
Vene
´cia, R.E. Reis, W.G. Saul and E.H.L. Pereira, 26 Jan 1995. 18˚42’2’’S, 40˚24’58’’W.—
CZNC 87, 3, 15.3–35.5 mm SL; Espı
´rito Santo: São Mateus: Rio São Mateus basin: Lago do
Co
´rrego Canivete, tributary of the Co
´rrego Grande, tributary of the Rio São Mateus, within
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 91 / 122
CEUNES/UFES, at ES-422, 18˚40’8"S 39˚50’49"W; F.M. Chagas et al., 17 Nov 2011.—CZNC
954, 1, 28.3 mm SL; Espı
´rito Santo: São Mateus: Co
´rrego Canivete (tributary of the Co
´rrego
Grande, tributary of the Rio São Mateus), within CEUNES/UFES, Bairro Litoraneo, 18˚4016’’S
39˚51’25"W; L.F.S. Ingenito et al., 23 Apr 2014.
CZNC 994, 3, 15.7–47.6 mm SL; Espı
´rito Santo: São Mateus: Co
´rrego Canivete (tributary of
the Co
´rrego Grande, tributary of the Rio São Mateus), within CEUNES/UFES, Bairro Litora-
neo, 18˚40’16’’S 39˚51’25"W; S. Bitti et al., 25 Jun 2014.—CZNC 1017, 2, 18.5–19.4 mm SL;
Espı
´rito Santo: São Mateus: Co
´rrego Canivete (tributary of the Co
´rrego Grande, tributary of
the Rio São Mateus), within CEUNES/UFES, Bairro Litoraneo, 18˚40’16"S 39˚51’25"W; L.F.S.
Ingenito et al., 28 Jul 2014.—CZNC 1027, 1, 23.8 mm SL; Espı
´rito Santo: São Mateus: Co
´rrego
Canivete (tributary of the Co
´rrego Grande, tributary of the Rio São Mateus), within CEUNES/
UFES, Bairro Litoraneo, 18˚40’16’’S 39˚51’25"W; L.F.S. Ingenito et al., 28–29 Aug 2014.
Australoheros sanguineus Ottoni, 2013. Australoheros sanguineus Ottoni, 2013 [12]: 161,
fig. 2. (holotype MCP 14556; type locality Brazil: Santa Catarina state: arroio Lindo, tributary
of the rio Cubatão, near the road SC-301, near BR-101, Pirabeiraba, Joinville municipality).
Definition. Based on the position in the mt-cyb and mt-coI trees and minimum uncorrected
p-distance in mt-coI exceeding 2% from all other species of the genus, Australoheros sangui-
neus is a distinct evolutionary lineage. Specimens of A.sanguineus are similar to A.acaroides,
A.kaaygua, A. minuano,A.ricani. and A.mboapari in presence of zipper band, but no mor-
phological synapomorphy was registered.
Description of sample. Meristic data are given in Tables 3–9, proportional measurements in
Table 16.Fig 25 shows general appearance of adults.
Moderately elongate to deep-bodied, laterally compressed. Sexes isomorphic except vertical
and pelvic fins slightly longer in some large males than in large females. Predorsal contour
straight ascending or with slight indentation anterior to orbits, curved anterior to dorsal fin
origin. Nuchal elevation absent in both sexes. Dorsal profile curved, slightly descending to end
of dorsal-fin base. Caudal peduncle slightly tapering, contours straight. Prepelvic contour
slightly curved, straight, or slightly concave anteriorly, convex posteriorly. Abdominal contour
straight or slightly convex. Anal-fin base contour straight ascending. Head short, laterally com-
pressed. Snout short, blunt, subtriangular in lateral aspect, rounded in dorsal aspect. Mouth
terminal, forward directed, close to horizontal line from lower margin of orbit or slightly more
ventral in large specimens. Lips moderately thick, lip folds interrupted or subcontinuous ante-
riorly. Jaws equal in anterior extension; maxilla and premaxilla not reaching to vertical from
anterior margin of orbit. Orbit removed from frontal contour, in middle of head length, in
upper half of head. Teeth in both jaws caniniform, slightly recurved, in outer row slender,
increasing in size toward symphysis. Bicuspid teeth not observed. Teeth in outer hemiseries in
upper/lower jaw 9–16/10–17. Inner teeth in two rows. Gill rakers externally on first gill-arch 2
epibranchial, one in angle and 6–7 ceratobranchial. Microbranchiospines present externally
on 2nd to 4th gill-arch.
Dorsal-fin spines increasing in length to about 6th or 7th, from which subequal, last spine
longest, soft dorsal-fin rounded in young, in adults with broad pointed tip, third, fourth or
fifth soft fin-ray longest, reaching to about middle or 4/5 of caudal fin. Soft anal fin rounded in
young, in adults with a short point formed by fourth soft fin-ray, reaching to about middle or
4/5 of caudal fin. Pectoral fin rounded, 4th or 5th ray longest, reaching to vertical from anal
orifice or first anal-fin spine. Pelvic fin pointed, first soft ray longest, reaching to base of third
anal-fin spine (broken in holotype). Caudal fin rounded.
Scales on body finely ctenoid. Predorsal midline scales about 10–13, slightly smaller than
flank scales, covered by skin, only part with exposed margin, irregularly arranged, mixed
cycloid and weakly ctenoid. Chest scales ctenoid, almost size of flank scales. Cheek scales
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 92 / 122
Fig 25. Australoheros sanguineus. A. holotype, adult female, 84.2 mm SL; MCP 14556; Brazil: Santa Catarina:
Joinville: Rio Cubatão basin: Arroio Lindo. B. Adult male, 82.1 mm SL; MCP 40635; Joinville: Rio Cubatão Norte. C.
Australoheros cf. sanguineus, adult male, 63.2 mm SL; Brazil: Santa Catarina: Petrola
ˆndia: stream tributary of the Rio
Perimbo on road between BR 282 and Petrola
ˆndia (tributary of the Rio Itajai-Ac¸u); MCP 22440. D. Australoheros
sanguineus, adult female, 69.0 mm SL; NUP 8861; Brazil: Parana
´: Palmas: border with Pinhão: Rio Iratim, tributary of
the Rio Iguac¸u.
https://doi.org/10.1371/journal.pone.0261027.g025
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 93 / 122
cycloid, in 3–5 series, covered by skin. Opercular scales cycloid, covered by skin. Between first
upper lateral line scale and dorsal-fin origin 3 large scales or 3 large and one small scale. Lateral
line scales absent from caudal fin, except in one specimen (NRM 30953 73.6 mm SL), with two
tubed scales in ventral lobe. One large and one small or two small scales separating last scale of
upper lateral line from dorsal-fin base. Prepelvic scales anteriorly small, cycloid and without
free margin, remaining scales only slightly smaller than flank scales, weakly ctenoid and with
free margin. Fin scales ctenoid. Row of minute scales along dorsal-fin base from spine IX or
XI, basal squamation gradually expanded, interradial scales in single series, from spine XII–
XVI, on soft fin up to 5 interradial scales, scales absent from last one or two interradial mem-
branes. Soft anal fin with narrow basal scale layer, interradial scales from behind 6th spine, up
to 6 scales in interradial row.
Colouration in preservative. Adults, about 50 mm and larger with ground colour beige,
fawn, or pale grey. Bars 1(a, b) to 6 present, dark brown, 2–3 scales wide; bar 6 distinct or obso-
lete absent below lateral band; interbars 2–3 scales wide, except Interbar 1 usually narrower
than one scale width; lateral band extending from gill cleft caudad to Interbar 4 composed of
dark spots on scales in rows 0 and E1, forming a pattern reminding of a zipper; or band mainly
on E1 row, with irregular margins; dark scale spots on posterior scales in E1 row may extend
band to include Bar 2; Bar 5 terminating dorsally in lateral band or extending dorsally at most
to dorsal-fin base. Bar 5 entire Bars generally vertical, dorsal portions of bars 2–4 usually
slightly caudally inclined. Dorsal portions of any combination of Bars 4 and 5 or Bars 5 and 6
commonly forming a Y mark with posterior branch distinctly paler than anterior branch. Dor-
sal portions of Bars 5 and 6 otherwise expressed as independent irregular light brown blotches.
Dorsal portions of bars 7 and 8 present, expressed as short rostrad inclined light brown or grey
bars crossing anterior dorsal-fin base and occiput, respectively. Midlateral black or dark
brown blotch present in Bar 4 on E1 scales and parts of adjacent scales barely exceeding bar 4
in width; corresponding portions of bars 2 and 3 may be slightly widened or more intensely
pigmented but distinct spots absent from bars 2 and 3. Caudal spot (Bar1b) indistinct, or dis-
tinct, light or dark brown, darker on upper lobe, but extending as a dark vertical bar across
middle of the caudal-fin base. Brown spot close to margin of each scale below level of midlat-
eral band forming indistinct narrow lines on abdominal side, gradually weaker and disappear-
ing ventrad. Black or dark brown blotch usually present at anterior end of horizontal band
and at upper base of pectoral fin. Dorsal fin translucent or pale grey, with grey, or dark grey
blotches at interradial bases, continuous with or slightly separate from bars 2 to 6 and/or 7.
Anal and caudal fins translucent, pale grey. Pelvic fin grey or brown, paler medially.
Geographical distribution (Fig 1). Rio Cubatão and Rio Pirai basins; headwaters of the Rio
Iguac¸u; tentatively in the Rio Itajai-Ac¸u and Rio Sambaqui basins.
Comments.Australoheros sanguineus was described based on the holotype and 10 para-
types, 57.9–105.3 mm SL according to Ottoni [12], all from the Rio Cubatão basin near Join-
ville. The diagnosis is based on character states in combination, including colour pattern, fin-
ray counts, proportional measurements, frontal contour, number of proximal radials, extent of
scale row at dorsal-fin base. The only potential synapomorphy is the presence of a ‘blood red’
spot at the dorsal and ventral corners of the caudal fin, distinguishing from species in which
only reddish pigment is present, red pigment is absent, or when a ‘complete bar’ of red pig-
ment is present along the posterior margin of the caudal fin. The description was based on
specimens preserved in 1908, 1974 and 1985, and no voucher is given for live colours. The he
colour description on p. 165 matches the photograph, fig. 1 of a living specimen without local-
ity information. It is consequently not known if the type series conforms to the diagnosis
regarding live colours. As far as can be ascertained, the photo was first published in small size
in an article about aquarium fish in the area of Joinville [109]. Heros facetus was mentioned in
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 94 / 122
the article, but there was no indication that the photo would be related to the observations in
the article; more likely the several vignette photos on p. 31 were provided by the editor of the
journal. Several species of Australoheros, including, apparently A.facetus as illustrated by (Cal-
viño [62], fig. 3), also have red blotches at the corners of the caudal fin, and there seems to be
no information on variation in intensity of this red colour neither in Australoheros from the
lower Rio Cubatão nor from elsewhere. The specimen illustrated by Ottoni [12], fig. 1 seems
indistinguishable from Australoheros acaroides. As explained under A.acaroides, Ottoni [12],
fig. 3, used a photo of A.facetus to illustrate live colouration in A.acaroides.
The original description [12] characterises Australoheros sanguineus as having 14 pectoral-
fin rays, but the holotype and other specimens from Joinville had 12 or 13 as counted by us.
The caudal spot is said to be diagnostically round, but, as apparent already from the photo-
graph of the holotype [12], fig. 2), it has a caudal blotch in the shape of a vertical midbasal bar.
Other characters listed In the original description refer to absence of metallic blotches on the
anal-fin base, the number of proximal dorsal- and anal-fin radials, anal-fin (soft) rays, pleural
ribs, as well as various proportional measurements, and more colour characters in living speci-
mens, referring to figs 1 and 3. The absence of metallic blotches was confirmed in our speci-
mens from Joinville. The number of proximal radials, i.e. the pterygiophore portion that
extends down between the neurapophyses or haemapophyses, is probably correlated with the
number of fin rays, but in both the dorsal and anal fin, the proximal radial of the last ray may
be absent or very reduced. On the X-radiograph (fig. 5), there seems to be 25 dorsal proximal
radials as stated [12], but then there are two associated with the first dorsal-fin spine, possibly
indicating absence of an anterior dorsal-fin spine. The first two anal-fin spines share proximal
radial, so there are 13 proximal radials in the anal fin, as also stated [12]. There seems to be 11
pleural ribs on fig. 5, as stated [12], but this number was not unique within the genus. Also, the
count of 9 anal-fin soft rays was common in the genus and present in all or most of our speci-
mens from Joinville. The basal dorsal-fin squamation started after the 8th spine in the holo-
type, not after the 11th as stated in the original description [12] (but after the 10th or 11th in
NRM 30953), and the basal anal-fin squamation in the holotype started after the first spine
(4th or 5th in NRM 30953), not the 7th as stated [12], and interradials appeared after the 4th
spine.
With regard to proportional measurements, the supposed differences are applied in com-
parison with specimens of a wide range of sizes, and does not account for allometry. They may
also be flawed because the standard length of the holotype was apparently taken to the poste-
rior margin of the caudal spot instead of the base of the caudal fin (end of the hypural plate).
The holotype was 84.2 mm in standard length, not 88.1 mm as stated in the original descrip-
tion [12]. This means that, e.g. the caudal peduncle is not longer (9.8–10% of SL) in the type
series than in a range of species with a combined interval of 5.1–9.2% of SL according to Ottoni
[12], but at least the holotype is contained in that interval with 8.9% of SL.
Our comparison of measurements of specimens from Joinville with other Australoheros
suggested that the proportional measurements were in line with other coastal Australoheros.
The conclusion is that there was no character or character combination in the original diagno-
sis by which to recognise specimens of Australoheros from Joinville as a separate species of
Australoheros. Mitochondrial DNA, however, showed that there was a distinct species in the
area, potentially sister species to A.ribeirae, and we apply the name A.sanguineus on that
MOTU. The material here referred to A.sanguineus was limited, and did not enable a compre-
hensive description. Collecting efforts in the Rio Lindo failed to find specimens of Australo-
heros, and the holotype remains the only specimen known from the type locality. Other
specimens from near Joinville were from the northern branch of the Rio Cubatão, and from
the Rio Pirai, south of Joinville.
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 95 / 122
Specimens of Australoheros from the Rio Itajai-Ac¸u basin (Fig 25C) and Morretes may rep-
resent A.sanguineus, but the absence of strong morphological discriminating data and DNA
data prevented a conclusive determination.
The mt-cyb sequences from LBP 1050 (Papanduva, Rio Negro basin), and NRM 49554 (Rio
Chopim; as A angiru in R
ˇı
´čan et al. [13]), both from the upper Rio Iguac¸u basin, were identical
to sequences from the coastal streams near Joinville, representing A.sanguineus (MCP 40635;
MK414416-414418). The upper Iguac¸u samples were more similar in body shape and colour
pattern to coastal A.sanguineus than to A.angiru, being relatively deep-bodied and having a
more or less distinct zipper style lateral band, but lacking the dark spots on the side character-
ising A.angiru. Apparently, A.sanguineus is distributed in both the interior Parana
´River
basin as well as in coastal Atlantic streams. The voucher specimen for our mt-co1 sequence
LBP 1050 was identified by the provider as A.kaaygua, probably based on the locality.
R
ˇı
´čan et al. [13] described A.angiru on the basis 27 specimens from the upper Rio Uruguay
in Santa Catarina, previously identified as A.kaaygua by R
ˇı
´čan and Kullander [3,4], but listed
also four non-type specimens from Palmas and Pinhão, in the Rio Iguac¸u basin. Considerable
weight was given also to aquarium specimens reported by Staeck [112] from the Iguac¸u and
upper Uruguay basin. The only specimens available from the Iguac¸u basin, however, are the
four specimens NUP 7743, 3683, 3697, and 8861, which we identified as A.sanguineus, and
which were in a very bad state of conservation, two of them eviscerated, and one without cau-
dal fin.
R
ˇı
´čan and Kullander [3], and R
ˇı
´čan et al. [13] listed a specimen NRM 49554, tissue number
1179, GenBank Accession number for mt-cyb AY998658, with data suggesting that it came
from the Rio Iguac¸u. This specimen/tissue sample was recorded later as lost from the NRM
collection. The specimen was identified as ‘A. jacutinga’ by R
ˇı
´čan and Kullander [3] and as A.
angiru by R
ˇı
´čan et al. [13]. The mt-cyb sequence grouped it with A.sanguineus (Fig 13), sug-
gesting that it represents the Iguac¸u population of A.sanguineus.
Staeck [110] published a short note reporting on a species of ‘Cichlasoma’ related to ‘C.face-
tum’ that he and party collected in the Rio do Peixe in 1995, and subsequently propagated in
the German aquarium hobby. The note is illustrated with aquarium images of a male and
female. Staeck ([111] reported on cichlids related to ‘C.’ facetum collected in 1995 in Rio Cho-
pim and Rio do Peixe, which he obviously considered to be of the same species. The article is
illustrated with an image of the same specimen shown by Staeck [110], but also breeding male
and territorial male from the Rio Chopim. R
ˇı
´čan et al. ([13]: fig. 7,) republished the territorial
male image as ‘male in neutral phase’; a different angle of the breeding male; and a new image
with a breeding female. All those images were identified by R
ˇı
´čan et al. [13] as A.angiru).
Because Staeck considered the Australoheros collected in Rio Chopim and Rio do Peixe to be
the same species, it is most likely that the aquarium population mentioned by Staeck, and
source of the NRM 49554 specimen, may have consisted only of the Chopim species; less likely
that the two species hybridised in captive breeding—or that it represents an aquarium import
of coastal Australoheros sanguineus unrelated to Staeck’s observations.
We identified the four NUP specimens assigned by R
ˇı
´čan et al. [13] to A. angiru as speci-
mens of A.sanguineus in a poor state of conservation (Fig 25D).
Consequently, as far as known, Australoheros angiru is endemic to the upper Rio Uruguay.
Staeck’s specimens from the Rio Chopim and the NUP specimens were similar to other A.san-
guineus in colour pattern and deep body. In a pictorial guide to the fishes of the Rio Iguac¸u,
Baumgartner et al. [112] published an image of a specimen similar to the preserved NUP speci-
mens, but with deformed caudal peduncle and caudal fin. Paiz et al. [113] studied karyotypes
of specimens identified as A.angiru collected in São Lourenc¸o do Oeste, Santa Catarina, in iso-
lated lagoons not connected to the Iguac¸u or Uruguay rivers. This study was uninformative
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 96 / 122
concerning the systematic position of A.angiru as the issue was not addressed. In passing,
however, Paiz et al. mentioned another record of A.angiru from the Rio Guarani (about
25.51667˚S 53.15˚W), in the lower Rio Iguac¸u basin, which may as well rather represent A.
sanguineus or A. kaaygua, It seems thus that the population of A.sanguineus in the upper Rio
Iguac¸u basin may have gone undetected. Available data on Australoheros kaaygua, the other
species of the genus recorded from the Iguac¸u basin is limited. The colour pattern places it
with the southern species with a distinct zipper type lateral band; the only sequence available
(13)
Does not support identity with Australoheros sanguineus.
Specimens examined. All from Brazil. Atlantic versant: MCP 14556, 1, holotype, adult
female, 84.2 mm SL; Santa Catarina: Joinville: Rio Cubatão basin: Arroio Lindo, tributary
of the Rio Pirabeiraba, on side of road SC-301 close to BR-101, 26˚13’0"S 48˚54’W; C.A.S.
Lucena, L.R. Malabarba and R.E. Reis, 19 Sep 1985.—MCP 6912, 2 paratypes, 54.7–60.1 mm
SL; Rio Cubatão (norte), close to road BR-101, 26˚12’0"S 48˚55’0"W; C.A.S. Lucena, L.R. Mala-
barba and R.E. Reis, 19 Sep 1985.—MCP 40635. 1, 82.1 mm SL; Joinville: Rio Cubatão Norte
on road Quiriri de Baixo, 26˚8’33.0’’S, 48˚59’45.0’’W; 7 Oct 2016, J. Pezzi da Silva and E. H.L.
Pereira.—NRM 30953, 2, 73.6–84.1 mm SL; Joinville: Rio Pirai basin, 18 km SE Joinville, 26˚
30’00.2"S 48˚43’58.9"W; K.H. Lu¨ling, 20 Oct 1980.—Rio Iguac¸u basin: LBP 1050, 5, 40.2–56.9
mm SL; Santa Catarina: Papanduva: Rio Iguac¸u basin; tributary of Rio São João, 26˚22.049’S
50˚07.149’W; C. Oliveira et al., 12 Jan 2001.—MCP 13732, 5 18.7–56.9 mm SL; Santa Catarina:
Mafra: Rio São Lourenc¸o in Cabo de São Lourenc¸o, at 12 km from Mafra; tributary of the Rio
Negro, tributary of the Rio Iguac¸u, 26˚09’00.0"S 49˚53’00.0"W; P. Azevedo, A. Bergmann, E.H.
L. Pereira and L. Amato, 5 May 1989.—NUP 3967, 59.6, mm SL; Parana
´: Pinhão: Rio São
Pedro, tributary of the Rio Iguac¸u, 26˚S, 51˚45’W. NUPELIA staff, 29 Mar 1993.—NUP 7743,
67.1 mm SL; Parana
´: Palmas, border with Pinhão: Rio Iratim, tributary of the Rio Iguac¸u, 26˚
5’S, 51˚35’W. Nupelia staff, 25 Apr 1993.—NUP 8861, 70.4 mm SL; Parana
´: Pinhão: Rio São
Pedro, tributary of the Rio Iguac¸u, 26˚S, 51˚45’W. Nupe
´lia staff, 27 Apr 1993.—NUP 3683, 1,
71.8 mm SL; Parana
´: Pinhão: Rio São Pedro, tributary of the Rio Iguac¸u, 26˚S, 51˚45’W; Nupe
´-
lia staff, 28 Mar 1993.
Australoheros sp. cf. A.sanguineus: MCP 12234, 1, 59.3 mm SL; Parana
´: Morretes: Rio Sam-
baqui basin, Rio Sagrado at Posto Florestal, 25˚29’00.0"S 48˚50’00.0"W; C.A.S. Lucena, L.R.
Malabarba and A. Bergmann, 26 Jul 1988.—MCP 22440, 14, 1 measured 63.2 mm SL; Santa
Catarina: Petrola
ˆndia: stream tributary of the Rio Perimbo on road between BR 282 and Petro-
la
ˆndia (tributary of the Rio Itajai-Ac¸u), 27˚35’41.0"S 49˚44’35.0"W; R.E. Reis, A.R. Cardoso, P.
A. Buckup and F. Melo, 21 Dec 1998.—NUP 10504, 1, 78.5 mm SL: Santa Catarina: Ibirama:
Rio Itajai-Ac¸u drainage: Rio Hercilio: Rio Hercilio, 27˚18’56.0"S 49˚32’52.0"W; GERPEL, 7
Aug 2010.—NUP 2738, 1, 67.5 mm SL; Parana
´: Tijucas do Sul: Rio São João, Reservato
´rio
Vossoroca (Chamine
´), 25˚ 49’13’’S 49˚04’04’’W, Copel ichthyology staff, Nov 2001.—CAS
66934pt. 3, 24.6–40.1 mm SL. Brazil: State of Santa Catarina: Rio Iguassu basin Porto União A.
L. Carvalho, 22 Apr 1944 [with 25 specimens of ‘Geophagus’ brasiliensis, 15.1–40.8 mm SL].
Australoheros mboapari, new species. Definition. Based on the unique concealed or
absent cheek squamation and the combination of character states in colouration, squamation,
vertebrae count shared only with A.tembe,A.forquilha, and A.ricani Australoheros mboapari
is hypothesised to be a distinct evolutionary lineage. Specimens of A.mbapoari can be distin-
guished from all other species of Australoheros by scales absent from all or lower half of cheek,
or present deeply embedded (vs exposed by thin skin layer or free margins and covering all of
cheek). Australoheros mbapoari shares with A.forquilha,A.ricani,A.tembe, and A.ykeregua a
row of minute scales along the base of the caudal fin reaching anteriorly to or almost to the
anterior insertion of the dorsal fin (vs scale layer ending at middle or more posterior position
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 97 / 122
along the dorsal-fin base); with A.ricani black soft dorsal fin in adult females (vs soft dorsal fin
light). It differs from all species of Australoheros except for A.forquilha,A.tembe, and A.ykere-
gua by the absence of abbreviated portions of dorsal parts of bars 5–6 anterodorsally on the
side; prepelvic scales deeply embedded (vs with free margins); caudal fin subtruncate (vs.
rounded); broad pelvic-fin tip with first and second rays subequal in length (vs first ray longest
(first may be longer also in A.ykeregua); from all except A.forquilha,A.kaaygua,A.tembe,
and A.ykeregua by deep lachrymal bone). Stout lower pharyngeal tooth plate with packed,
mainly molariform teeth (vs. tpph plate with slender teeth laterally and a few stout teeth pos-
teromedially potentially distinguishing from congeneric species, but comparative data equivo-
cal). Other characteristics include caudal spot absent or diminutive in adults; absence of Y-
shaped bars; scales in E1 row usually 25–26 (vs. usually 23–24 in congeneric species); single
abdominal bar or bar absent in adults (vs 2–3); vertebrae 13+14 = 27 (vs. 13+13, rarely any
other number), absence of dark suborbital markings (vs present in A.forquilha and ykeregua);
absence of spots in unpaired fins (vs present in A.forquilha,A.scitulus and variable in A.
oblongus;); and autapomorphic cheek squamation and female breeding colour. Distinguished
from A.tembe and A.kaaygua by moderately thick lips (vs hypertrophied). Lateral band of zip-
per type, similar to most southern congeneric species, excepting only A.facetus.
Holotype. MCP 49000, adult male, 101.7 mm SL (Fig 26A); Brazil: Rio Grande do Sul: Anto
ˆ-
nio Prado: Rio Taquarı
´drainage, Quaresma, close to the Rio das Antas, 28˚52’46’’S 51˚
19’12’’W; J.D. Latini et al., Oct 2003.
Paratypes. All from Brazil, Rio Grande do Sul, Rio Taquari drainage: MCP 23044, 46, 17.2–
90.4 mm SL; Anto
ˆnio Prado: Rio Toro, on the road from Vila Flores to Anto
ˆnio Prado, 28˚
52’19’’S 51˚26’57’’W; R.E. Reis, J.F. Pezzi and E.H.L. Pereira, 21 Jan 1999.–MCP 33554, 4,
81.1–95.6 mm SL; Nova Roma do Sul: Arroio do Carma, near mouth in Rio das Antas, 28˚
58’93’’S 51˚23’12’’W; J.D. Latini et al., 2003.–MCP 33639, 1, 97.3 mm SL; Santa Ba
´rbara: Rio
das Antas close to mouth of Rio Carreiro, 29˚5’29’’S. 51˚42’42’’W; J.D. Latini et al., 28 Sep
2002.–MCP 33659, 7, 65.7–84.8 mm SL; Same data as holotype.–MCP 34988, 4, 62.1–77.5 mm
SL; Brazil: Anto
ˆnio Prado: Rio Ituı
´m at Cachoeira do Saltinho, tributary of the Rio Turvo, 28˚
37’S 51˚23’W; A.R. Cardoso and V.A. Bertaco, 6 Mar 20004.–MCP 40953, 3, 56.0–97.3 mm SL;
Verano
´polis: Rio da Prata, tributary of the Rio das Antas, 28˚58’16"S 51˚27’20"W; J.D. Latini,
V.A. Capatti and S. Rodrigues, Nov 2005.—MCP 44382. 2, 78.5–87.2 mm SL. Verano
´polis:
mouth of the Rio Pratinha, 28˚56’S 51˚27’59’’W; J.F. Pezzi, 14 Jan 2007.—MCP 47552, 1, 106.2
mm SL; Nova Roma do Sul: Rio da Prata, tributary of the Rio das Antas, 28˚58’15’’S 51˚
27’20’’W; J. D. Latini et al., Oct 2011.–UFRGS 9688, 23 (3, 92.5–107.9 mm SL; 20, 21.3–36.1
mm SL); Dois Lajeados: Rio Carreiro above PCH Linha Emı
´lia, 28˚56’24"S 51˚46’47"W; J.
Ferrer and G. Frainer, 17 Jan 2008.—UFRGS 13184. 2, 46.5–48.1 mm SL; Muitos Capões: Rio
Taquari drainage: Rio Ituı
´m at PCH Saltinho, 28˚37’09"S 51˚21’14"W; J. Anza and G. Frainer,
22 Mar 2010.
Description of type series. Meristic data area given in Tables 3–9, proportional measure-
ments in Table 17. For general appearance, see Fig 26.
Sexes isomorphic except fins slightly longer in some large males than in large females, and
genital papilla in males slender, conical, in females wider, blunt. Moderately elongate, laterally
compressed. Predorsal contour straight ascending to above orbit where curved, almost hori-
zontal slightly anterior to dorsal-fin origin; occiput posteriorly markedly compressed and with
slight compressed nuchal elevation in large specimens of both sexes. Dorsal contour anteriorly
horizontal, soft dorsal-fin base slightly curved and descending. Caudal peduncle contours
slightly sloping. Prepelvic contour slightly curved or straight. Abdominal contour straight hor-
izontal except for slightly convex in females. Anal-fin base slightly convex, ascending. Head
short, laterally compressed. Snout short, blunt, subtriangular in lateral aspect, narrowly
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 98 / 122
Fig 26. Australoheros mboapari. A.holotype, MCP 49000, adult male, 101.7 mm SL; Brazil: Rio Grande do Sul:
Anto
ˆnio Prado: Rio Taquarı
´drainage, Quaresma, close to the Rio das Antas. B. Paratype, adult female, 95.1 mm SL:
MCP 33554; Brazil: Rio Grande do Sul: Nova Roma do Sul: Rio Taquari drainage: Arroyo do Carma, near mouth in the
Rio das Antas. C. Paratype, young male, 81.1 mm SL: MZUSP 33554; Brazil: Rio Grande do Sul: Nova Roma do Sul:
Rio Taquari drainage: Arroyo do Carma, near mouth in the Rio das Antas. D. paratype, juvenile, 39.3 mm SL; MCP
23044; Rio Grande do Sul: Rio Taquari drainage: Anto
ˆnio Prado: Rio Toro, on the road from Vila Flores to Anto
ˆnio
Prado.
https://doi.org/10.1371/journal.pone.0261027.g026
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 99 / 122
rounded in dorsal aspect. Mouth terminal, far removed from lower margin of orbit. Lips mod-
erately thick, lip folds interrupted anteriorly. Jaws equal in anterior extension; maxilla and pre-
maxilla not reaching to vertical from anterior margin of orbit. Orbit removed from frontal
contour, in middle of head length, in upper half of head. Teeth in both jaws subcaniniform,
erect, in outer row slender, increasing in size toward symphysis; anterior teeth frequently
worn apically. Bicuspid teeth observed in one specimen, in which 2 anterior teeth in lower jaw
bicuspid (MCP 33354, 82.0 mm SL). Teeth in outer hemiseries in upper/lower jaw 8–13/11–
16. Inner teeth in 1–3, usually 2 rows in both jaws. Gill rakers externally on first gill-arch 1–3
epibranchial, one in angle and 5 (3), 6 (24), 7 (1) ceratobranchial. Microbranchiospines present
externally on 2nd to 4th gill-arch.
Lower pharyngeal tooth plate (Fig 27) moderately stout, wider than long (length 73% of
width); dentigerous area triangular (length 60% of width); In admedian row of 6 teeth and
flanking teeth on right side, anteriormost teeth slender, erect, posterior teeth in sequence grad-
ually stouter, with apex flat or with minor median cusp; remaining teeth slender, erect, with
minor anterior subapical widening and antrorse posterior cusp, gradually smaller toward bone
margins.
Scales on body finely ctenoid. Circumpeduncular scale rows 16 (28). Predorsal midline
scales about 13–15, about half size of flank scales, covered by skin, only part with exposed mar-
gin, irregularly arranged, weakly ctenoid. Cheek scales absent or in 2–3 series on upper half of
cheek, cycloid, covered by skin. Opercular scales mixed cycloid and ctenoid, covered by skin
or margin partly exposed. Accessory lateral line scales absent from caudal fin. Between first
upper lateral line scale and dorsal-fin origin four large scales. Between last upper lateral line
scale and dorsal fin one large and two smaller scales, or one large and one small scale, excep-
tionally two large scales. Prepelvic scales about half size of flank scales, embedded in skin, with-
out free margin. Lateral chest scales ctenoid, with exposed margin, about same size as flank
scales. Fin scales ctenoid. Row of minute scales along dorsal-fin base from anterior spines or
more posterior, basal squamation gradually expanded, interradial scales from between 9th to
14
th
spine caudad, on soft fin in one or two rows with up to six scales between two soft rays,
scales present also on last two interradial membranes. Anal fin with narrow basal scale layer,
on soft-rayed portion up to six scales in interradial row.
Dorsal-fin spines increasing in length to 6th from which subequal, last spine longest, soft
dorsal-fin rounded or subacuminate in young and some females, otherwise with broad pointed
tip, fifth fin-ray longest, reaching to about 1/3 or middle of caudal fin. Soft anal fin rounded or
subacuminate in young and some females, otherwise with a short point formed by fourth soft
ray, reaching to about 1/3 or middle of caudal fin. Pectoral fin rounded, fifth ray longest, not
reaching to vertical from genital papilla. Pelvic fin pointed, in males reaching to genital papilla
or anterior 1–2 spines of anal fin, in females to genital papilla; first and second rays of nearly
same length, outer or inner branch of first branched ray, or outer branch of second branched
ray longest. Caudal fin subtruncate.
Vertebrae 13+14 = 27 (MCP 23044).
Colouration in preservative. Ground colour pale beige-yellow. Markings on head indistinct,
including two grey stripes between orbits. A black spot on upper margin of pectoral-fin base.
Occiput dark grey. Snout and gill cover light grey. Cheek pale greyish brown. Chest pale yellow
or greyish yellow. In most specimens, caudal spot absent and caudal-fin base uniformly pale
grey; in some specimens caudal spot present as dark grey bar across middle of caudal-fin base
or as ill-defined greyish spot close above middle of caudal-fin base. Vertical bars indistinct; in
large specimens (>70 mm) sides nearly uniform except for black midlateral blotch and vari-
ably expressed lateral band. Three dark stripes across scaled predorsal region (bars 7, 8, 9)
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 100 / 122
indistinct. Bar 1 and Interbar 1 commonly absent, as caudal peduncle of same colour as cau-
dal-fin base. Bars and Interbars straight vertical. Lateral band indistinct, expressed as contigu-
ous black spots on anterior scales in E1 row and variably on anterior scales in row 0;
continuous to Bar 5, variably expressed, but not distinct posteriorly on side.
Fig 27. Australoheros mboapari; lower pharyngeal tooth plate in occlusal (top), anterolateral (middle) and caudal
(bottom) aspect; MCP 230444, 68.4 mm SL.
https://doi.org/10.1371/journal.pone.0261027.g027
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 101 / 122
When at all distinguishable, Interbar 2 indistinct, between dorsal and ventral margin of cau-
dal peduncle; Bar 2 about three scales wide, from end of dorsal-fin base, not reaching anal-fin
base; Interbar 3 about two scales wide, between down from middle of soft dorsal fin base but
not quite reaching anal-fin base; Bar 3 about two or three scales wide, down from posterior
two or three spines in dorsal fin but not reaching down to anal-fin base; Interbar 4 one scale
wide, between about 3rd–4th from last spines in dorsal and anal fins. Bar 4 three scales wide,
straight vertical from slightly above anal-fin origin to dorsal-fin base. Interbar 4 indistinct,
about one scale wide, from above genital papilla dorsad to dorsal fin base. Bar 5 indistinct,
about three scales wide, reaching dorsally to dorsal-fin base. Bar 6 absent below lateral band
from about 30 mm SL, but present indistinct in some specimens up to 60 mm SL. Bar 7
expressed as a dark spot at anterior end of lateral band. Y-shaped markings absent from dorsal
side.
Spinous dorsal and anal fins, and pelvic fin dark grey. Soft dorsal and anal fins, and caudal
fin with light grey fin rays and contrasting dark brown (anal fin) or black (dorsal fin) interra-
dial membranes. In males, black interradial pigment in dorsal fin concentrated to margin of
next fin-ray; in females all of dorsal fin interradial membrane black, giving the appearance of a
large black blotch. Dark blotches along base of spinous dorsal fin absent.
Juveniles 17.2–38.8 mm SL (MCP 23044) pale yellowish brown, fins hyaline. Caudal spot
expressed either as black bar across middle of caudal-fin base or minute spot on dorsal lobe
immediately above middle of base. Lateral band absent or faintly indicated in scale rows 0 and
E1. Lateral bars 1–6 present, usually also bar 7, pale brownish, straight vertical, extending
between dorsum and venter (total three abdominal bars). Bars absent or faint from about 40
mm SL. Large black midlateral spot, round or slightly deeper than long. Small spots or short
dark dashes on interradial membranes of soft dorsal and caudal fins.
Explanation of specific name. The specific name is a noun in apposition, referring to the
geographical distribution of the species, the Rio das Antas, which was previously known as
Mboapari [114].
Geographical distribution (Fig 1). Rio das Antas and tributaries from about Rio São Marcos
to and in the Rio Carreiro.
Comments.Australoheros mboapari is parapatric with Australoheros acaroides in the region
of Nova Roma do Sul. The two species can be separated by colour pattern, meristic data and
proportional measurements. In A.acaroides the preorbital depth is distinctly larger and both
the upper and lower jaw are slightly longer than in A.mboapari. The cheek scales are clearly
evident in A.acaroides, arranged in 3–4 rows and covering almost all of the cheek unlike in A.
mboapari in which the scales are few, deeply embedded, or absent.
Australoheros mboapari shares general appearance with A.forquilha,A.ykeregua, and A.
tembe being relatively elongate, with deep lachrymal bone, low mouth, slightly elevated occiput
at least in large specimens, embedded scales on head, cheek, and chest, indistinct or absent cau-
dal spot, distinct midlateral spot, subdued vertical bars, relatively long caudal peduncle, and
subtruncate caudal fin. It differs from those species by thinner lips, absence of small dark spots
on dorsal and caudal fins, and slightly shorter basal scale row on dorsal fin. We suggest that the
similarities with A.forquilha,A.ykeregua, and A.tembe reflect rheophily rather than phyloge-
netic relationship. Adults of all these species usually have strongly truncate anterior teeth
usually with flat tips, whereas the coastal A.acaroides only has sharp caniniform teeth. We
interpret the flat-tipped teeth as abraded, and resulting from sand taken in with food extracted
from the bottom and/or hard shelled prey like snails. This interpretation follows also from the
stout pharyngeal bone with enlarged molariform teeth typical of cichlids eating hard prey.
In the Rio Jacuı
´drainage, A.mboapari was most similar to A.ricani, e.g. in the long row of
minute scales along the dorsal-fin base, and absent or indistinct caudal spot. The rare number
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 102 / 122
of five anal-fin spines were recorded from both species. Non-parametric comparison of counts
showed that they were distinct (Mann-Whitney U test, p = 0.000–0.001) in overlapping num-
ber of anal-fin spines (modally 5 in A.ricani, 6 in A.mboapari), dorsal-fin spines (modally 15
in A.ricani, 16 in A.mboapari), E1 scales, upper and lower lateral line scales, but not in num-
ber of soft dorsal- and anal-fin rays, or pectoral-fin rays. Australoheros mboapari had the high-
est number of E1 scales recorded in the genus, modally 26, occasionally 27. Twenty-six E1
scales were frequent also in A.forquilha and A.ricani.
Australoheros mbapoari differed from the similar and geographically adjacent A.ricani in
slopes on SL of preorbital depth, lower jaw length, head width, pectoral-fin length, and length
of last dorsal-fin spine (ANOVA p <0.05), and on intercept on head length, snout length,
orbital diameter, interorbital width, and upper jaw length (ANCOVA, p <0.05). The slight dif-
ference in jaw lengths showed in the proportional measurements, Figs 13–16, where the size
ranges are reasonably comparable), A.mboapari has slightly shorter upper jaw (8.8–10.9%SL
(vs 10.2–11.5 in A.ricani), and lower jaw (11.7–14.2%SL vs 13.1–15.7% in A.ricani). Australo-
heros mboapari had deeper preorbital than the other coastal Australoheros excepting A.acar-
oides (Tables 13–16). This character, however, was positively allometric, and only extremely
large specimens of A.acaroides had developed a deep lachrymal bone.
MCP 31176, from the Rio Guapore
´, a tributary of the Rio Taquarı
´with mouth downstream
from the mouth of the Rio Carreiro may represent Australoheros ricani, but grouped with A.
mboapari in the PCA, and was left unidentified. It was included in the PCA, but not in the pro-
portional measurements in Tables 13–16. The only adult included in the PCA deviated from
A.mboapari in body proportions and relatively exposed scales. The upper Rio Guapore
´is very
close to headwaters of the Rio Jacuı
´.
Australoheros taura was based on specimens from the Antas and Tainhas rivers in the
upper Rio Taquarı
´drainage [7]. Specimens and DNA sequences of Australoheros from the
upper Rio das Antas and Rio Tainhas were identified as A.acaroides. The original description
highlighted similarities with A.tembe in long snout and deep head, and indirectly suggested a
morphology similar to A.mboapari. Known localities of A.mboapari are more downstream in
the Rio das Antas than the recorded localities for A.taura. The original description of A.taura
and examination of topotypes and paratypes agree with A.acaroides in rounded rather than
subtruncate caudal fin, up to 25 vs 26–27 E1 scales, shorter row of minute scales along the dor-
sal-fin base, and fully scaled cheek.
Additional specimens examined. Not type:. MCP 31176, 13, 30.3–94.3 mm SL. Brazil: Rio
Grande do Sul: Rio Taquarı
´drainage: Guapore
´: stream tributary of the Rio Guapore
´at PCH
Guapore
´. A. R. Cardoso and V. A. Bertaco, 2 Dec 2002. 28˚54’S, 51˚56’W.
Australoheros ricani, new species. Definition. Based on the position in the phylogenetic
trees based on mt-cyb and mt-coI, and more than 3% divergence in minimum uncorrected p-
distance from other species of Australoheros,A.ricani is a distinct evolutionary lineage. No
morphological autapomorphy was registered. Specimens of A.ricani share with A.mboapari,
A.forquilha, and A.ykeregua a row of minute scales along the dorsal-fin base extending cepha-
lad to close to the anterior insertion of the dorsal fin (4th dorsal-fin spine), and with A.mboa-
pari a black soft dorsal fin in females (vs dorsal fin black throughout, or with black blotches at
intervals). It is distinguished from A.mboapari by 3–5 rows of scales on cheek, exposed or dis-
cernible under thin skin cover.
Holotype. UFRGS 28500, adult female, 75.5 mm SL (Fig 28A); Espumoso: Rio Morcego, 28˚
53’55’’S 52˚49’0.5’’W; K. Bonato and R. Dala-Corte, 18 Dec 2012.
Paratypes. All from Brazil: Rio Grande do Sul, upper Rio Jacuı
´drainage. Rio Jacuı
´-mirim:
MCP.
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 103 / 122
Saldanha, 28˚26’39’’S 53˚12’37’’W; R.E. Reis, E.H.L. Pereira and V.A. Bertaco, 2 Apr 1999.
—Mormac¸o: Rio Quati, 28˚38’52’’S 52˚37’11’’W: UFRGS 22015, 1 juv.; K.O. Bonato, P.C.
Silva, C. Hartmann, and A. Langoni, 26 Aug 2012—UFRGS 22016, 4 juv.; K.O. Bonato, J. Win-
gert, L.G. Artioli, 27 Aug 2012—UFRGS 22020, 3, 20.9–56.9 mm SL; K.O. Bonato, A. Hirsch-
mann, A. Hartmann and A. Langoni, 20 Apr 2013—UFRGS 22026, 4, 27.4–90.7 mm SL;
UFRGS 22028, 4, 39.8–77.3 mm SL; K. Bonato, N. Bertier, A. Hirschmann, 21 Jun 2012—
UFRGS 22036, 4, 22.6–92.0 mm SL; K. Bonato, N. Bertier, A. Hirschmann, 19 Oct 2012.—
UFRGS 22037, 4: 41.1–76.6 mm SL; K. Bonato, N. Bertier, A. Hirschmann, 19 Dec 2012.—
Espumoso: Rio Morcego, 28˚53’55’’S 52˚49’0.5’’W: UFRGS 19968, 11, 4, 22.4–84.9 mm SL; K.
O. Bonato, J. Ferrer, C. Voguel and L. Cavalheiro, 19 Jun 2012.—UFRGS 22027, 8, 14.0–81.6
mm SL, K. Bonato, A. Hirschmann, C. Hartmann and S. Langoni, 20 Apr 2013.—UFRGS
22029, 9, 19.5–100.9 mm SL; K.O. Bonato, P.C. Silva, C. Hartmann and A. Langoni, 27 Jun
2013—UFRGS 22033, 4, 24.1–29.8 mm SL; K.O. Bonato, J. Wingert, and L.G. Artioli, 24 Aug
Fig 28. A. Australoheros ricani, holotype adult female, 75.5 mm SL; UFRGS 28500; Brazil: Rio Grande do Sul, Rio Jacuı
´drainage: Espumoso: Rio
Morcego, tributary of the Rio Jaquı
´-mirim. B. Australoheros cf. ricani, “Jacuı
´”, adult female, 105.2 mm SL; MZUSP 30411; Brazil:_Rio Grande do Sul:
Marau: Rio Jacuı
´drainage: Arroio Três Passos, tributary of the Rio Jacuı
´-mirim.
https://doi.org/10.1371/journal.pone.0261027.g028
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 104 / 122
2012—UFRGS 22038, 3, 29.2–72.5 mm SL; K.O Bonato, N. Bertier and A. Hirschmann, 18 Oct
2012—UFRGS 22039, 4, 37.3–73.2 mm SL; K. Bonato, and R. Dala-Corte, 18 Dec 2012—
UFRGS 22040, 15, 13.7–64.9 mm SL; K.O. Bonato and J. Ferrer, 22 Feb 2013.—Espumoso, Rio
Turvo, 28˚43’47’’S 52˚47’40.4’’W: UFRGS 22017, 54.7–63.7 mm SL; K.O. Bonato, and R. Dala-
Corte, 17 Dec 2012—UFRGS 22019, 1, 51.0 mm SL; K.O. Bonato, A. Hirschmann, A. Hart-
mann and A. Langoni, 19 Apr 2013.—UFRG 22025, 3, 57.8–68.3 mm SL; K.O. Bonato, J.
Ferrer, N. Bertier and A. Hirschmann, 29 Oct 2012.—UFRGS 22032, 1 juv.; K.O. Bonato, J.
Wingert and L.G. Artioli, 26 Aug 2012.—UFRGS 22034, 2 juvs; K.O. Bonato, N. Bertier, and
A. Hirschmann, 29 Oct 2012.—Espumoso, Rio Turvo, 28˚43’S 52˚47’W’’: UFRGS 22021, 2
juvs; K.O. Bonato, J. Ferrer and C. Voguel, 29 Jun 2012.
Description of type series. Meristic data are given in Tables 3–9, proportional measurements
in Table 18:Fig 28A shows the general aspect.
Sexes isomorphic except genital papilla in males slender, conical, in females wider, blunt.
Both sexes with minor nuchal elevation present or absent. Moderately elongate, laterally com-
pressed. Predorsal contour straight ascending to slightly posterior to orbit where curved,
almost horizontal, slightly anterior to dorsal fin origin; a minor indentation in frontal contour
anterior to orbit in most large specimens; occiput posteriorly markedly compressed and with
slight compressed nuchal elevation in large specimens. Dorsal contour horizontal along about
half of spinous dorsal-fin base, posteriorly descending, straight, or slightly curved. Caudal-
peduncle contours slightly sloping or straight. Prepelvic contour slightly curved or straight.
Abdominal contour straight horizontal. Anal-fin base slightly convex, ascending. Head short,
laterally compressed. Snout short, blunt, subtriangular in lateral aspect, narrowly rounded in
dorsal aspect. Mouth terminal, forwards directed, distinctly removed from lower margin of
orbit. Lips moderately thick, lip folds interrupted anteriorly. Jaws equal in anterior extension;
maxilla and premaxilla not reaching to vertical from anterior margin of orbit. Orbit removed
from frontal contour, but close in specimens with frontal indentation; in middle of head
length, major part in upper half of head. Teeth in both jaws subcaniniform, erect, in outer row
slender, increasing in size toward symphysis; anterior teeth occasionally worn apically. No
bicuspid teeth observed. Teeth in outer hemiseries in upper/lower jaw 7–15, 11–19; inner teeth
in 2 rows in both jaws, much smaller than outer teeth. Gill rakers externally on first gill-arch
1–2 (usually) epibranchial, one in angle and 7 (11) ceratobranchial. Microbranchiospines pres-
ent externally on 2nd to 4th gill-arch.
Scales on body finely ctenoid. Predorsal midline scales about 10–13, about 2/3 size of flank
scales, covered by skin, only part with exposed margin, irregularly arranged, weakly ctenoid or
cycloid. Cheek scales in 3–5 rows, covering all of cheek except narrow area anteroventrally;
scales embedded in skin, but clearly visible, cycloid. Opercular scales mixed cycloid and cte-
noid, covered by skin or margin partly exposed. Between upper lateral line and anterior inser-
tion of dorsal fin, dorsal-fin origin four large scales One large and one small scale, or one large
and two smaller scales separating last scale of upper lateral line from dorsal-fin base. Accessory
lateral line scales absent from caudal fin. Prepelvic scales cycloid, about half size of flank scales,
embedded in skin, with free margin posteriorly. Lateral chest scales finely ctenoid, with
exposed margin, about same size as flank scales. Fin scales ctenoid. Row of minute scales along
dorsal-fin base from between about 4th spine caudad, basal squamation gradually expanded,
interradial scales from between 10th and 13th spine caudad, on soft fin in one or two rows
with up to 8 scales between two soft rays, scales present also on last two interradial membranes.
Anal fin with narrow basal scale layer, interradial scales from 6th spine, on soft-rayed portion
up to 4 scales in interradial row. Caudal fin scales on proximal 1/3, in large specimens up to
middle of fin.
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 105 / 122
Dorsal-fin spines increasing in length to 6th or 7th from which subequal, last spine longest,
soft dorsal-fin subacuminate or with broad pointed tip, 5th fin-ray longest, reaching at most to
about middle of caudal fin. Soft anal fin subacuminate or with a short point formed by fifth
soft ray, reaching to about 1/3 of caudal fin, or slightly longer. Tip of pectoral fin rounded, 4th
or 5th ray longest, not reaching to vertical from genital papilla. Pelvic fin pointed, reaching to
or slightly beyond base of anterior insertion of anal fin; outer branch of first fin-ray longest, or
both branches equal. Caudal fin rounded.
Colouration in preservative. Ground colour fawn or pale beige-yellow, each scale with dis-
tinct brown spot at distal margin; pale greyish along ventral surfaces. A black spot on upper
margin of pectoral-fin base. Occiput brown. Snout, preopercle, gill cover, lower jaw light grey.
Lips pale grey. Cheek light brown. Two faint brown stripes between orbits, crossing front. Cau-
dal spot often obsolete, otherwise small, light brown, midbasal or located slightly dorsal to
middle of base of fin. Vertical bars 1–5 distinct, brown. Bar 4 present above anal-fin origin.
Bar 5 present anterior to vent and extending dorsad to lateral band. Interbar 4 between bars 4
and 5 present. Bar 6 and Interbar 5 present slightly posterior to pectoral fin-base. Bar 6 indis-
tinct, not reaching below level of pectoral-fin base, but variably extended above lateral band.
Bar 5 not divided vertically. In adult females Bars 1–4 or 1–5 may be dark brown or blackish
brown except for dorsal and ventral terminal portions. Interspace between dark caudal-fin
base and Bar 1 narrow or absent. Bar 1 not reaching lower caudal-peduncle margin; darker
above lateral line where commonly also including black spot. Bar 2 between posteriormost soft
rays of dorsal fin and anal fin, but usually not reaching anal-fin base. Bar 3 between about last
1–3 dorsal- and anal-fin spines, reaching to or not to anal-fin base. Short stripes crossing top
of head just above eye (corresponding to Bar 8), across occiput (and through anterior dorsal-
fin base (Bar 7).
Lateral band indistinct, from head to, but not crossing Interbar 4, formed by black or dark
contiguous spots on scales in E1scale row and upper halves of scales in row 0; posterior vertical
bars with intensified black or brown scales in same scale rows forming indistinct or deep black
blotches in bars 4 and 3. Bars 2–4 distinct, bar 1 variably expressed; bars with variably darker
or lighter scales, forming irregular and indistinct lines along posterior side. Y-mark formed by
upper portions of Bars 5 and 6 present or absent.
Spinous dorsal- and anal-fins brown; in adult females, spinous dorsal fin and anterior soft
dorsal-fin interradial membranes black. Pectoral fin pale grey or diaphanous. Pelvic fin brown
or dark grey anteriorly, paler, to hyaline on inner rays; black in some adult females. Caudal fin
with grey interradial spaces and lighter fin rays, slightly darker along posterior margin. Juve-
niles similar to adults in colouration, but vertical bars indistinct; distinct rows of small dark
spots along flank; blotch in Bar 4 distinct; caudal spot absent.
Explanation of specific name. Oldřich R
ˇı
´čan, University of South Bohemia, was the first to
recognise Australoheros species richness,, and made the pioneering analyses, discovering and
highlighting the phylogeny and species richness of inland species of Australoheros [3,4]. The
specific name is a noun in the genitive case.
Geographical distribution (Fig 1). Tributaries of the Rio Jacuı
´-Mirim, in the Rio Jacuı
´drain-
age, State of Rio Grande do Sul.
Comments. The type series of Australoheros ricani was most similar to that of Australoheros
mboapari, and comments on measurements and meristic data are given under that species.
Most of the specimens were in bad condition, juveniles, and/or eviscerated. Two tissue sam-
ples from the Rio Morcego, tributary of the Rio Jacuı
´-mirim supported recognition of samples
from the upper Rio Jacuı
´as representing a distinct species of Australoheros in the upper Rio
Jacuı
´basin. DNA samples of Australoheros from downstream the Saltos do Jacuı
´, at Ibarama,
Arroio Corupa
´, and further in the Rio Soturno basin, clustered with samples of A.acaroides.
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 106 / 122
Samples from Rio dos Caixões and Rio Jacuizinho, with the mouth far below the Saltos do
Jacuı
´, were assigned to A.acaroides based on morphology. This distribution pattern suggests
that the Saltos do Jacuı
´formed a dispersal barrier, separating A.ricani from the more wide-
spread A.acaroides. Two specimens from a tributary of the Rio Ingaı
´, originally draining to
the Rio Jacuı
´-Mirim, were assigned to A.acaroides, with hesitation. It is possible that A.ricani
may have been restricted to just the original Rio Jacuı
´-Mirim and upper Rio Jacuı
´, most of
which now submerged in the Passo Real dam, but the pre-dam collecting record is limited to
what is reported here.The Passo Real dam, blocking the Rio Jacuı
´in the region of Salto Grande
do Jacuı
´, was inaugurated in 1973 The sample of A. sp. Jacuı
´”, MZUSP 30411, seems to be the
only record of Australoheros from the upper Rio Jacuı
´before 1973. Several pre-dam samples
are available from the region of the more downstream Dona Francisca dam, inaugurated in
2001, and those samples were identified here as A.acaroides.
Australoheros sp. “Jacuı
´” was recognised as a distinct species by R
ˇı
´čan and Kullander [3,4],
who included it in a phylogenetic analysis and in descriptive comparisons with other species of
Australoheros. They disposed of only one sample (MZUSP 30411), in suboptimal state of pres-
ervation, which they referred to as “sp. jacui” and “sp. Jacui”. The collecting site of MZUSP
was recorded only as ‘Arroio Três Passos, afl. do Jacuı
´Mun. Marau RS’, which we believe was
a stream in the town Três Passos, southwest of Marau, and consequently in the Rio Jacuı
´drain-
age at approximately 28˚28’00.0’ ’S 52˚21’60.0’ ’W. The Três Passos stream was most likely a
tributary of the Rio Jacuı
´-mirim. Records of other fishes collected by the same collector refer
to ‘Rio Três Passos’.
The morphology and colour pattern of the sample of A. sp. “Jacuı
´” (Fig 28B) described by
R
ˇı
´čan and Kullander ([4] and confirmed by us, agreed with the morphology and colour pattern
of the the type series of A.ricani and consequently are inclined to refer A. sp. “Jacui” to A.
ricani, with reservation for the differences in meristic data. R
ˇı
´čan and Kullander grouped A.
sp.”jacuı
´”with A.forquilha and A.tembe, based on a morphological parsimony cladogram,
specifically characterized by long cover of minute scales along the dorsal-fin base, with two
scales instead of one, long caudal peduncle with more than two vertebral centra, and highest
number (4) of scale rows between the anterior insertion of the dorsal fin and the upper lateral
line. Australoheros sp. “jacuı
´” and A.forquilha were observed as unique in sharing a character-
istic shape of the head and mouth, and possessing two instead of one scale in the anterior por-
tion of the scale cover along the dorsal-fin base. The lower axial meristic data agreed better
with A.acaroides than with A.forquilha and A.tembe. The phylogenetic analysis here (Figs
11–13), recovered A.ricani as closest to A.acaroides and similar species with horizontal
stripes.
Meristic data and proportional measurement are given for Australoheros “Jacuı
´” in Tables
3–9, and 19, respectively. Low metameric meristic data distinguished the Três Passos sample
from the type series of Australoheros ricani. This was particularly obvious in the consistently
few anal-fin spines (modally 5) distinguishing the Três Passos sample from other A ricani as
well as all other species of Australoheros which typically had at least 6 anal-fin spines, but there
was a slight overlap (Table 7). The number of anal-fin spines was significantly different from
the type series of A.ricani and other southern species with 5 anal spines (A.mboapari,A.face-
tus, and A.acaroides) (Mann-Whitney U test, p = 0.000–0.001). Low numbers of dorsal-fin
spines (94% with 15 spines, vs 53%) and E1 scales (50% with 24, vs none contrasted with the
type series of A.ricani¸ but were not otherwise exceptional. Low meristic data was reason for
hesitation whether the Três Passos sample was of the same species as the other specimens here
referred to A.ricani. PCA with and without pelvic-fin length and caudal-peduncle depth
showed A.ricani as relatively distinct both from A.acaroides and from the Três Passos sample,
the latter mainly overlapping A.acaroides. X-radiographs were available for the Três Passos
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 107 / 122
sample only, with 13+13 (16) or 13+12 (2) vertebrae, reflecting the common condition (13
+13) in the genus. The Três Passos specimens, however, had 2 (3 in one) vertebrae contained
within the caudal peduncle, an unusual condition in the genus remarked on by R
ˇı
´čan and Kul-
lander [4] (2008), and which may agree with a relatively long caudal peduncle in the type series
of A.ricani.
Additional specimens examined. Not types: Australoheros cf. ricani: MCP 31176, 13, 30.3–
94.3 mm SL. Brazil: Rio Grande do Sul: Rio Taquarı
´drainage: Guapore
´: stream tributary of the
Rio Guapore
´at PCH Guapore
´. A.R. Cardoso and V. A. Bertaco, 2 Dec 2002. 28˚54’S 51˚56’W.
—Australoheros Jacuı
´”: MZUSP 30411, 18, 45.0–115.2 mm SL; Marau: Arroio Três Passos,
affluent of the Rio Jacuı
´, 28˚28’00.0’’S 52˚21’’60.0’’W; G.Q. Benvegnu
´, 28 Jul 1971.
Discussion
The present attempt to characterise species of coastal Australoheros using traditional morpho-
metrics, a coalescence-based species delimitation method, and phylogeny, was moderately suc-
cessful. Traditional counts and distance measurements showed very little variation across the
species eventually defined despite that all those past species descriptions were founded mainly
on meristic data and proportional measurements. Likewise, melanophore pattern was found
to be very similar across the coastal putative species, although colour pattern was frequently an
important component of species descriptions. The bPTP analyses of mitochondrial genes pro-
vided conflicting patterns of species delimitation, possibly a consequence of strong similarities
across the ingroup, but also reflecting shortcomings of the methodology. The phylogenetic
analysis, however, provided reciprocal strong support for a branching pattern resolving some
of the problematic MOTUs in the bPTP analyses, and not conflicting with morphological data.
The main result of the present analysis is a new view of species composition, relationships
and geographical structure of coastal species of Australoheros. Among the 33 nominal species
in the genus, we recognise 15 as valid, and add two new species. Thirteen species were
described recently from the Sudeste region of Brazil, but our data support only three species
from this region (A.ribeirae,A.oblongus, and A.ipatinguensis) We recovered A.acaroides
with a huge distribution in the Laguna dos Patos basin and A.facetus from the Parana
´and
Uruguay basins in Argentina and Uruguay. We discovered two new species (A.mboapari,A.
ricani), and confirmed the distinctness of Australoheros “Jacuı
´”. Those species have limited
distribution and possess distinct morphological characters by which they can be identified.
Unlike in the well-demarcated congenerics in the Rio Uruguay basin, morphological identifi-
cation is otherwise difficult with Atlantic versant species of Australoheros. This may be a con-
sequence of very recent separation, shared crypsis or insufficient data.
The conception of two well separated groups of Australoheros was not corroborated. Most
species have a southern distribution, and within that group, there are several distinct lineages.
A disrupted distribution along the coast cannot be demonstrated, as localities of Australoheros
ribeirae and A.sanguineus are relatively close. Indeed, coastal species tend to be more similar
to each other than to the inland species, so that the contrast is rather between the species from
the upper Uruguay and Parana
´drainages and the coastal species, than between southern and
northern species.
Our general conclusion is similar to the earliest phylogenetic analysis of the group in 2006
[3]. It built on the approach used by Wiens and Penkrot [115], contrasting morphological and
molecular analyses in species delimitation, an approach inspiring integrative taxonomy [116].
The philosophy of integrative taxonomy was then that shortcomings of one analytical method
may be balanced by the strength of another method but it may also be applied in a battery of
data sets as envisaged by Pante et al. [117]. R
ˇı
´čan and Kullander’s 2006 analysis [3] included
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 108 / 122
both morphology- and DNA-based analyses, and contrasted character-based species delimita-
tion using multivariate and discriminant analyses on morphometric characters against parsi-
mony-based phylogenetic analyses of DNA and morphology. The morphological analysis of
species-discriminant character states (species as terminal units), differed only slightly from
one using sets of character states (populations as terminal units). There were marked differ-
ences between the morphology-based and the DNA based tree topologies, however. Part of the
explanation for that may be that in 2006 DNA was available only for about half of the species,
and some samples were misidentified, affecting correct identification of A. “jacutinga” (mor-
phological sample from A.angiru, but DNA sample from A.sanguineus, as identified herein;
DNA sample from A. “uruguai” from Uruguay identified as A.acaroides herein, and not likely
to be from Uruguay). With the necessary adjustments of identifications, the results from R
ˇı
´čan
and Kullander [3] are corroborated here. R
ˇı
´čan et al. [13] used the same methodology as R
ˇı
´čan
and Kullander [3], but with improved molecular coverage. Those results are corroborated here
as far as species overlap.
The most distinctive species in the genus reported previously were those in the Uruguay
and Parana
´basins that are associated with fast flowing water–Australoheros forquilha,A.
tembe and A.ykeregua–whereas other species have a generalised body shape and colouration
shared with most cichlasomatin and many heroin cichlid species. Also, the new species
described here belong in this category, and were recognized for their morphology. Whereas
species status was confirmed with DNA analysis for A.ricani, no fresh collections of A.mboa-
pari are known, and it was recognised as distinct only by morphological characteristics.
Crypsis in Australoheros
The introductory message of Ottoni et al. [47], as well as the conclusion, characterised portions
of Australoheros as cryptic: species were misidentified as A.facetus; ‘species of the ‘autrani’
group are very similar and difficult to diagnose’; ‘Australoheros has a taxonomically confused
and controversial history’.
We have found that it may be difficult to establish a formal ‘diagnosis’ for species of Austra-
loheros, but even so, by reducing the Sudeste species to three, there remain no truly cryptic spe-
cies, only nominal species that still have not been analysed morphologically to any depth.
Species of Australoheros may be cryptic in one respect, however. Observations on live A.min-
uano and A. scitulus showed that they were capable of changing the melanophore and erythro-
phore pattern rapidly and frequently (SOK, pers. obs.). Older aquarium literature [60] also
mentions this characteristic for A.facetus. Notwithstanding, and somewhat unexpected, there
exist no controlled studies on the pigmentation or behaviour of species of Australoheros. The
only dedicated ethological study of Australoheros [25] did not mention colour pattern or col-
ours, but different expressions of the colour pattern were illustrated by Baduy et al. [21]. We
nevertheless suggest that species of Australoheros maintain, by stabilising selection, a disrup-
tive melanophore pattern that can be adjusted to habitat, probably for camouflage, i.e. their
colour and behaviour is cryptic.
Unresolved identifications and missing data
Our results point to several problem cases. One tissue sample from the Rio Arapey was identi-
fied as Australoheros minuano, but is highly divergent. It may represent yet another taxon or
intraspecific variation. Only additional material and analysis can shed light on this case. Our
material is deficient in representation of the type locality of A.autrani, and absence of material
from the type locality of A.saquarema.
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 109 / 122
Absence of tissue samples representing Australoheros minuano from the type locality pro-
vides for some hesitation in describing new species from the Rio Uruguay basin, as the type
series of A.minuano is very similar to A.acaroides,A.minuano, and A.ricani, and the original
description combined data from A.minuano, juveniles from the Rio Quaraı
´, and large pre-
served adults from the type locality in the Rio Piratini drainage.
The distinct scale morphology and unique low meristic data of Australoheros “Jacuı
´” might
justify species status of the single sample available to us. Nevertheless, we prefer the recogni-
tion without a formal scientific name pending the availability of fresh preserved specimens
and DNA for a strong basis for a decision.
Australoheros mboapari emerged out of morphological comparisons with the parapatric A.
acaroides. It remains known only from specimens fixed in formalin; no DNA is available.
Limited observations suggest that at least some species of Australoheros have a specific
breeding colour pattern with black breast region and increased amount of yellow or red on the
sides, and probably highly species specific. Again, there are no behaviour studies available on
colour pattern in Australoheros. South American cichlid species, as diurnal and biparental
with distinct sexual dimorphism, for the most part characterised by elements of the colour pat-
tern, predomimantly the melanophore pattern in preserved specimens [118–121]. Other char-
acters are usually close to uniform across a genus. Many of the South American cichlid species
are or have been in the aquarium hobby and there are numerous observations and published
photographs documenting species specific live colours and colour patterns that are informative
for species taxonomy and make useful diagnostic characters [61,26,121]. Species of Australo-
heros, however, have not been important in the aquarium trade for decades, and there is very
little information from hobbyists over the past 50 years. It seems highly likely that controlled
behaviour studies including live colour variation will contribute to species taxonomy among
species of Australoheros.
Species delimitation. Analyses of mt-cyb and mt-coI confirmed species status for previ-
ously described species from the Parana
´and Uruguay basins, as well as southern species
including A.sanguineus and justify recognition of A.ricani, and the sample here referred to A.
minuano. In fishes, 2–3% uncorrected p-distance in mt-coI has commonly been considered as
a species level cutoff [49,122]. This may be sufficient for a uniform group of species, but may
not reflect a genetically diverse group with several different evolutionary histories, or extend
across different genes. Coalescence analyses seek to find multiple branching points (mono-
phyly) along gene trees, and are implemented in several DNA-based species delimitation
methods. We used here bPTP [73] which takes a fully resolved Bayesian tree as a start, and
which gives a probability measure for each identified ‘species’. For the most part of the results,
the bPTP terminals agree with character or DNA- based species determined by morphometry
and phylogenetic analysis. Failure to find a credible gene tree, as in the mt-cyb analysis here,
may reflect weaknesses in the data (largely from GenBank) or ongoing gene flow among the
many nominal species from the Sudeste, which latter can impact the delimitation [123]. The
bPTP analysis with mt-coI agrees with the BI trees of both mt-coI and mt-cyb, and the uncor-
rected p-distances, and we assume this as the best phylogenetic scenario hypothesis and species
delimitation.
Our molecular analysis is methodologically similar to that of Ottoni et al. [47] in the appli-
cation of Bayesian Inference and bPTP, and the data overlap; the major difference is our mt-
coI dataset., whereas Ottoni et al. only used the mt-cyb gene. Where we do not see any species
differences, and we can show that genetic distances are minor in the northern species, espe-
cially compared with the interspecies distances in the southern species, Ottoni et al. distinguish
species. This is not due to difference in length of the mt-cyb fragment (Ottoni et al.’s sequences
are slightly shorter) or to major differences in the data sets (the mt-cyb datasets are almost
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 110 / 122
identical). However, the minor differences/short branches between the nominal taxa of the
“Autrani” group in the BI tree were regarded as species and the bPTP analysis was made with a
very much reduced specimen sampling compared to the BI tree, with only one or two speci-
mens of each nominal species, and a reduced outgroup of non-Sudeste species. Support values
were not reported. The bPTP analysis is otherwise not incompatible with our rejected mt-cyb
analysis.
When we assigned samples from the Sudeste drainages to localities according to original
descriptions, only two species were recognisable from mt-coI and mt-cyb, with practically no
within-group variation. Consequently, A.autrani,A.macaensis,A.muriae and A.capixaba are
considered to represent a single species with A.ipatinguensis as the oldest available name; and
A.macacuensis,A.robustus,A.montanus,A.paraibae,A mattosi, and A.barbosae are consid-
ered to represent a single species, with A.oblongus as the oldest available name. DNA was not
available from type localities of A ipatinguensis or A.saquarema, and consequently absent in
the mt-coI dataset. Australoheros perdi is represented in the mt-coI dataset by samples from
Pingo-d’A
´gua, adjacent to the type locality. Our mt-cyb sequences combined with GenBank
data confirm the mt-co1 result, and extend synonymisation to mt-cyb MOTUs. Australoheros
oblongus is restricted to the middle course of the Rio Paraı
´ba do Sul in Minas Gerais, the Rio
das Velhas drainage in the adjacent Rio São Francisco drainage, tributaries of the upper Rio
Parana
´(Rio Tietê, Rio Grande and the isolated Rio Macacu, which drains to the Baia de Gua-
nabara, and a small costal river in Ubatuba, south of Rio de Janeiro. DNA was not available
from the Rio Guandu population. Australoheros ipatinguensis has a wide distribution close to
the Atlantic coast, extending from Rio Saquarema near Rio Janeiro to the Rio Buranhe
´m in
southern Bahia, but DNA samples were available only to the Rio Itau
´nas drainage in northern
Espı
´rito Santo to the north, and to the Rio Macae
´in Rio de Janeiro to the south.
Ottoni et al. [47] used two species mt-cyb delimitation analyses that we did not try to repli-
cate. ‘WP’, based on Wiens & Penkrot’s [117] proposal of species delimitation based on phy-
logenies of haplotypes; and one they called “CBB’ and described as character-based DNA
barcoding referring to DeSalle et al. [124]. DeSalle et al. and their references focused on bar-
code reader construction and expressed a critique of tree-based species delimitation, particu-
larly the use of distances in species delimitation. Their counterproposal was mainly to use
nucleotides as taxonomic characters. Ottoni et al. [47] implemented this in maps of nucleotide
substitutions. Ottoni et al. also referred to BI values, but not for species delimitation.
The WP and CBB analyses were reported as both delimiting 11 species: A.ipatinguensis,A.
macaensis,A.macacuensis,A.muriae,A.perdi,A.sanguineus,A.ribeirae,A.cf. capixaba,A.
autrani,A.barbosae, and A.robustus, synonymising A.mattosi A.paraibae,A.saquarema,A.
tavaresi, and A.montanus. Seven species (A.autrani,A.barbosae,A.mattosi,A.paraibae,A.
robustus,A.saquarema,tavaresi, and Australoheros cf. montanus) ended up in three species:
A.autrani,A.barbosae, and A.robustus).
For practical purposes, uncorrected p-distances in the BI tree, used by us, equates the WP
method as a measure of gene flow.
The bPTP analysis was reported as recovering nine lineages within the “A.autrani group”,
of which A.macacuensis,A.macaensis,A.muriae,A.ribeirae and A.sanguineus were stated to
corroborate morphologically established species. Nine other nominal species (A.autrani,A.
barbosae,A.ipatinguensis,A.mattosi,A.paraibae,A.perdi,A.robustus A.saquarema,A.
tavaresi), and two tentatively identified species (Australoheros cf. capixaba,Australoheros cf.
montanus) were reduced to four: A.autrani,A.barbosae,A.ipatinguensis, and A.robustus.
Australoheros paraibae, and A.tavaresi were treated as synonyms of A.barbosae. This is not in
conflict with our analysis. Australoheros saquarema was treated as a synonym of A.autrani.
This is not in conflict with our analysis. Australoheros mattosi and A. cf. montanus were treated
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 111 / 122
as synonyms of A.robustus. This is not in conflict with our analysis given that the identity of
the A. cf. montanus can be confirmed. Australoheros perdi and A. cf. capixaba were treated as
synonyms of A.ipatinguensis. This agrees with our analysis, given that the identity of the A. cf.
capixaba can be confirmed.
Weighting the bPTP against the WP and CBB methods, Ottoni et al. [47] concluded that
there were nine or 11lineages of Australoheros in the Sudeste, i.e. A.ribeirae,A.sanguineus,A.
barbosae,A.macacuensis A.robustus,A.muriae,A.macaensis,A.ipatinguensis, and A.autrani
for nine bPTP); add A.perdi and A. cf. capixaba for the sum of 11 (WP and CBB).
In the BI tree [47], fig. 2, there is a very strong difference between northern and southern
species in branch lengths, which includes even very similar OTUs in the south (e.g. A.facetus)
and which rather suggests that the northern MOTUs are homogenous rather than distinctly
branching, but this was not commented on.
Phylogeny and geographical distribution. The coastal species of Australoheros do form a
clade distinct in morphology and DNA from the Uruguay and Parana
´species studied by R
ˇı
´čan
and Kullander [3,4] and R
ˇı
´čan et al. [13]. The Uruguayan species as a rule exhibit distinct col-
our patterns and morphologies, and show more intra-group variation than the coastal species.
Geographically, there are no sharp limits in distribution, however. Australoheros scitulus is the
most common species of Australoheros in Uruguay, present from the coast upstream to the
Brazilian part of the river; A.acaroides is widespread in the Jacuı
´drainage and adjacent streams
in the Laguna dos Patos basin, but also present in the uppermost Rio Uruguay (Rio Pelotas).
Ottoni et al.’s [4,6,7] suggestion of a southern and a Sudeste group of species based on
morphology, was based on the vertebral count, and due to different methods of counting only.
Nonetheless, some species from the Upper Uruguay and Parana
´drainages (A.scitulus,A.
tembe,A,forquilha, and A.ykeregua), average more caudal vertebrae (24 or 25) than other
Australoheros.
Whereas Australoheros sanguineus is by geographical distance closer to the southern spe-
cies, the mt-coI tree (Fig 11) places A.sanguineus+A.ribeirae as sistergroup to the northern
species, and the mt-cyb tree has A.sanguineus+A.ribeirae as part of a trichotomy with the
northern and southern species (Fig 13).
The most surprising discovery concerning distribution was the presence in the upper Rio
Iguac¸u drainage of A.sanguineus, a species described from the coastal Rio Cubatão. There are
no published records of Australoheros from the Rio Iguac¸u drainage before 2006 (cf. Casciotta
et al. [83]: A.kaaygua; R
ˇı
´čan and Kullander [3]: misidentified A.sanguineus as A.kaaygua).
This could be due to insufficient collecting and but also slow expansion of unintentional intro-
ductions from fish farms. Another cichlid species found in several localities in the upper Rio
Iguac¸u is a member of the ‘Geophagus’ brasiliensis species group, common in coastal rivers,
was considered to be most likely introduced in the Rio Iguac¸u drainage basin [1]. A sample
reported here under Australoheros sp. cf. sanguineus collected in 1944 in the Rio Iguac¸u basin
near União da Vitoria opens for alternative scenarios. It consists of juveniles of a species of
Australoheros and ‘Geophagus’ brasiliensis. Unfortunately, the small size and condition of the
specimens prevents identification at species level.
Samples from the Laguna dos Patos drainage and the coast of Santa Catarina south of Imba-
tuba, as well as samples from the upper Rio Pelotas in the Uruguay River basin and tributaries
to Laguna Merı
´n in Uruguay, belong to a widely distributed species, A.acaroides.Australo-
heros facetus is widely distributed in the Uruguayan and Argentinian portions of the lower Rio
Uruguay. Distinct species are present in the upper Rio Jacuı
´and, with reservation, the Rio
Yaguaro
´n. A distinct species is present in the Rio das Antas, but no DNA was available. mt-coI
sequences were not available for several species: Australoheros mboapari,A.minuano,A.gua-
rani, and the nominal species A.tavaresi and A.perdi.
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 112 / 122
In the extreme south, Australoheros acaroides is a widespread species in the rivers draining
to Laguna dos Patos and Lagoa Mirim, and tributaries of the Rio Pelotas (uppermost Rio Uru-
guay). Australoheros facetus is present in rivers along the Uruguayan coast and the adjacent
lower Rio Parana
´. In Uruguay, the Cuchilla Grande complex separates the Rio Negro drainage
from rivers draining to the Lagoa Mirim, what apparently also keeps A.facetus confined to riv-
ers west of the Cuchilla Grande divide. The only anomaly is A.minuano, which was collected
both in the Yaguaro
´n and Negro drainages and in the Rio Taquari, draining to the Laguna
Merı
´n.
The Cuchilla Grande Range (maximum elevation 513 mASL), and contiguous ranges to the
northwest on the Brazilian-Uruguayan border, seems to form a barrier separating A.facetus
and Uruguay basin species from the neighbouring A.acaroides (sister species of A.facetus)
and remaining northern species. Outcrops of the Serra Geral north of Imaruı
´separate A.acar-
oides and A.sanguineus. The further northern distribution of the genus largely extends along
the coast, with distinct populations in isolated rivers, but notably without records from many
rivers and lagoons.
Thomaz et al. [125,126] presented a Brazilian Pleistocene coastline model based on a -125
m glacial maximum sea level drop about 18kya BP, affecting the many isolated coastal drain-
ages along the Brazilian coast. It supports palaeodrainages with extended courses among
which the named Tramandaı
´, Laguna dos Patos, Itajaı
´Ribeira de Iguape, Paraı
´ba do Sul, Doce,
Ubatuba, Macacu, Saquarema, Itabapoana, São Francisco, Tietê, Macae
´/São João, Mucuri, and
Itabapoana are relevant for Australoheros as extensions of the present drainages. The example
species studied by Thomaz et al. [125,127,128], Hollandichthys multifasciatus (Eigenmann
and Norris, 1900) did show variation along the coast. Except for the description of a second
species of the genus at the extreme south of the distribution of the genus, Hollandichthys tara-
mandahy Bertaco & Malabarba, 2013 [129], no species level taxonomic analysis was made. The
latter species, restricted to the Ararangua
´, Mampituba Maquine
´, and Tramandaı
´and Três For-
quilhas river drainages [129] overlaps with the northern distribution of Australoheros
acaroides.
The South American coastline line was further affected by the Holocene transgression
reaching about 4 metres 5 kya BP from the Rio de La Plata to northern Brazil [130–133] and
flooding the coastal lagoons with salt water.
Because several coastal species occur in more than one river basin, e.g. A.acaroides in the
Jacuı
´and Pelotas (Uruguay) basins, A.oblongus in the Parana
´, Doce, Ubatuba, Macacu, and
São Francisco basins; A.ipatinguensis in several small river basins, and the Rio Doce basin; A.
minuano in the Laguna Merı
´n and Rio Uruguay basins; and possibly A.sanguineus in the
Cubatão and Iguac¸u basins, events of stream capture may have been significant in dispersal
and speciation in coastal Australoheros. Particularly southeastern and northeastern Brazil has a
long history of tectonic activity and stream capture expressed in Recent fish distributions
[134]. The extensive overlap of A.ipatinguensis and A.oblongus in the lower Rio Paraı
´ba do
Sul, as well as widely distributed in coastal rivers north of the Rio Paraı
´ba do Sul, might fit in
the palaeodrainage scenario, but it is uncertain what the effects could have been. Rather than a
coastal biogeography, we propose that Australoheros is mainly associated with the Parana
´and
Uruguay River basins, and the coastal species are derived not from coastal river jumping, but
rather stream capture events in the Rio Parana
´drainage.
Species as concepts/hypotheses vs diagnoses
R
ˇı
´čan et al. [13] showed that the morphological characters presented by Ottoni et al. [5–8] did
not support the proposed species, and we have also demonstrated here that those species and
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 113 / 122
others described from the Sudeste up till 2012 were not justified on the basis of the data pro-
vided in the original diagnoses.
autochthon. In lieu of other justification, each nominal species was given a complex diagno-
sis based on character states in combination, including both character states observed on the
type series, and states cited from literature (mainly from R
ˇı
´čan and Kullander8 [4]). Reserva-
tions concerning the diagnoses are detailed in the species accounts above. Whereas all conclu-
sions herein also are open to testing, and have known limitations, the wide discrepancy in
species recognition may require a comment.
In systematic biology, a diagnosis is ‘a brief listing of the most important characters or char-
acter combinations that are peculiar to the given taxon and by which it can be differentiated
from other similar or closely related ones’ [135], but it also has the function of complying in
descriptions of new species with the requirement in the International Code of Zoological
Nomenclature [43] of a statement of distinguishing characters (Article 13.1.1). Already Black-
welder [136]. noticed that diagnoses were often very sketchy. Diagnoses are typically given
only in the original description of a species to comply with the Code, a ‘diagnosis’ does not
need to be correct, and incorrect information later detected in the diagnosis have no conse-
quences for the availability of the name. Providing a diagnosis, hence, does not equal a species
delimitation or showing a justification for species status of a sample. Dubois [137], also recog-
nising the duality of ‘diagnosis’, considered taxonomic diagnoses as intensional (character-
based) definitions of taxa (concepts), and provided a thorough review of the concept of diag-
nosis itself. Obviously, a name and a ‘diagnosis’ for the fulfilment of requirements of the Code
is not a justification that a certain sample described by character states in the definition justi-
fies recognition of a new taxon. The best examples here come from composite morphology-
based species, i.e. an invalid concept that at some time defined a species. Consequently, the jus-
tification for a species based on a specific sample of individuals and/or specimens, becomes
the crucial part of the taxonomic analysis. Almost all named species of South American fishes
were based on ad hoc definitions describing a sample–character-based delimitation as used in
R
ˇı
´čan and Kullander 2006 [3]–rather than conceptualisation underpinned by autapomorphy
or phylogenetic position. As demonstrated by R
ˇı
´čan et al. [13]) and above, diagnoses of multi-
ple Sudeste species of Australoheros fail the discrimination criterion but fulfil the nomencla-
tural requirement.
Dichotomous identification keys in biology are related to ‘diagnoses’, enabling less experi-
enced users to make identifications using simple markers [135,136]. This requires that the spe-
cies in question is valid, that it has a simple marker, preferably unique in the genus or family,
and that the user enters the key at a valid dichotomy (same family or genus as the target). In
poorly known groups, or groups with less conspicuous markers, keys may be inefficient or
insufficient for informed identifications.
Previous studies of Australoheros were mainly descriptive or analytical, and did not attempt
to popularise the findings. That is reasonable given the absence of documented characters for
identifying nominal species in the genus as a whole. Out of 18 taxonomic or phylogenetic
papers on Australoheros published from 1995 until 2017, two contain identification keys [4,
84]. The genetic data presented herein are public and can be used for species determination of
unidentified samples. Species distributions are relatively well demarcated and can be used to
reduce options for species identification, particularly in combination with available meristic
data. Practical tools such as determination keys are not available for non-specialists to confi-
dently identify specimens of Australoheros in the field or under lab conditions, or living indi-
viduals in the ornamental fish trade. Such tools should ideally be worked out in future research
and by practitioners in a relevant geographical context, observing autapomorphies and onto-
genetic stages as well as sexual dimorphism and reproductive status. Because determination
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 114 / 122
keys are intended for users with little experience in identifying species of the group concerned
and require at least one autapomorphy or unique marker for each species, our presentation of
discriminating characters must mark the limit of confident morphological species markers in
Australoheros.
Alpha taxonomy is a science that traditionally has been based on positive evidence only, as
exemplified by diagnosis-/character-based species delimitation and characters in combination.
Validity is not based on tests or falsifiability, but on opportune continuous corroboration over
time, except that often not even corroboration is achieved over time. ‘Cichlasoma facetum’ is a
good example of a species that has been recognised and referred to through generations of ich-
thyologists, despite that it has not been more than a name. ‘Characters in combination’ is a
similar phenomenon but somewhat in reverse when based on sample data. The more character
states put into the combination, the more likely it is that one of the character states is not
found in a specimen and then the species is invalidated in toto, whereas additions do not affect
validity. Species by species comparisons is also a method that can provide false corroboration.
Most likely any two samples will be different in some way, it is just a matter of digging a bit or
mixing own data with data published by others. The method is also sensitive to revised knowl-
edge of the comparison species. The best known weakness in species delimitation is number
of specimens; a single specimen may just be an aberrant individual and small geographically
separated samples may reflect local conditions only. Very large samples, on the other hand,
may obfuscate existence of rare species markers. Those practices suggest that, implicitly, the
null hypothesis is that samples are different, rather than same. On top of that, the human
factor is a taxonomist, and the main occupation of a taxonomist is to describe species or fail
professionally.
We also, have not been successful in providing morphological discriminating identification
tools for species proposed, i.e. defining species. Aside from practical shortcomings, particularly
access to well-preserved specimens and tissue for DNA analysis, limit the option for corrobo-
rated species hypotheses.
Naming or just proposing a species based on properties of a sample is an act of classification
that can be justified as a hypothesis essential for testing [138] but this also means that species
taxonomy must challenge the doctrine of stability of names because every named unit must
primarily be a considered a working hypothesis and not an established fact. Absence of tests of
the particular hypothesis indicates a low level of corroboration of a species taxon as a valid evo-
lutionary unit or lineage. Relieving taxonomy of the naming procedure and accepting that
existing names are temporary designations is probably to ask too much of the system, but
emphasising that particular species are concepts subject to indefinite testing, allowing compet-
ing results at every moment, may contribute to a more stable taxonomy.
The unified species concept [50] provides a framework for species recognition as it focuses
on the evidence of lineage separation and a view of species as concepts defined by specific
properties, in contrast to defining species by ad hoc sample properties. Conversion to a
hypothesis-based South American fish taxonomy will be a major challenge, but also open new
perspectives to fish evolution.
Supporting information
S1 File. GenBank and BOLD sequenes used.
(PDF)
S2 File. Extralimital species of Australoheros.
(PDF)
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 115 / 122
S3 File. Box plots of proportional measurements.
(PDF)
S4 File. Principal component analyses: Plots and tables.
(DOCX)
S5 File. Bayesian phylogenetic tree of concatenated mt-coI and mt-cyb sequences.
(PDF)
S1 Table. Uncorrected p-distances.
(XLSX)
Acknowledgments
Specimens were put at our disposal by James Maclaine, (BMNH), Patrice Pruvost (MNHN),
and staff of CIMC, LBP, MNRJ, MZUSP, NPM, NUP), UFBA, UFRGS, UNV), and UNICTIO.
Additional collecting was performed by Paulo A. Buckup, Marcelo R. Britto, Cristiano Mor-
eira, Decio Moraes, Jr; Se
´rgio Alexandre dos Santos, Emanuel B. Neuhaus, and Victor de Brito
(MNRJ), Jose
´Pezzi da Silva, Roberto E. Reis, Edson Pereira, and Diogo Araujo (MCP), Rafael
Angrizani, Tiago Carvalho, and Junior Vasquez.
Author Contributions
Conceptualization: Carlos A. Santos de Lucena, Sven Kullander.
Data curation: Carlos A. Santos de Lucena, Sven Kullander, Michael Nore
´n.
Formal analysis: Sven Kullander, Michael Nore
´n, Ba
´rbara Calegari.
Funding acquisition: Carlos A. Santos de Lucena.
Investigation: Carlos A. Santos de Lucena, Sven Kullander, Michael Nore
´n, Ba
´rbara Calegari.
Methodology: Sven Kullander, Michael Nore
´n.
Project administration: Carlos A. Santos de Lucena.
Resources: Carlos A. Santos de Lucena.
Supervision: Carlos A. Santos de Lucena.
Validation: Carlos A. Santos de Lucena, Sven Kullander, Michael Nore
´n, Ba
´rbara Calegari.
Writing – original draft: Sven Kullander.
Writing – review & editing: Carlos A. Santos de Lucena, Sven Kullander, Michael Nore
´n, Ba
´r-
bara Calegari.
References
1. Araujo Argoloa L, Lo
´pez-Ferna
´ndez H, Batalha-Filho H, Antunes de Mello Affonso R press. Unraveling
the systematics and evolution of the ‘Geophagus’ brasiliensis (Cichliformes: Cichlidae) species com-
plex. Mol Phyl. Evol. 150:106855. https://doi.org/10.1016/j.ympev.2020.106855 PMID: 32442518
2. Teixeira de Mello F, Gonza
´lez-Bergonzoni I, Loureiro M. 2011. Peces de agua dulce de Uruguay.
Montevideo: Ministerio de Ganaderı
´a, Agricultura y Pesca; 2011.
3. R
ˇı
´čan O, Kullander SO. Character- and tree-based delimitation of species in the 0Cichlasoma0facetum
group (Teleostei, Cichlidae) with the description of a new genus. J. Zool. Syst. Evol. Res. 2006; 44:
136–152.
4. R
ˇı
´čan O, Kullander SO. The Australoheros (Teleostei: Cichlidae) species of the Uruguay and Parana
´
River drainages. Zootaxa 2008; 1724: 1–51.
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 116 / 122
5. Ottoni FP, Oyakawa OT, Costa WJEM. A new species of the genus Australoheros from the rio Ribeira
do Iguape basin, São Paulo, Brazil (Labroidei: Cichlidae: Cichlasomatinae). Vertebr. Zool. 2008; 58:
75–81.
6. Ottoni FP, Costa WJEM. Taxonomic revision of the genus Australoheros R
ˇı
´čan & Kullander, 2006
(Teleostei: Cichlidae) with descriptions of nine new species from southeastern Brazil. Vertebr. Zool.
2008; 58: 207–232.
7. Ottoni FP, Cheffe MM. A new species of Australoheros (Labroidei, Cichlidae, Cichlasomatinae) from
the upper rio das Antas, laguna dos Patos System, southern Brazil. Spixiana 2009; 32; 153–159.
8. Ottoni FP. Australoheros capixaba, a new species of Australoheros from south-eastern Brazil (Labroi-
dei: Cichlidae: Cichlasomatinae). Vertebr. Zool. 2010; 60: 19–25.
9. Ottoni FP 2012. Three new species of Australoheros from southeastern Brazil, with taxonomic notes
on Chromys oblonga,Heros autochthon and H.jenynsii (Teleostei: Labroidei: Cichlidae). Vertebr.
Zool. 2012; 62: 83–96.
10. Ottoni FP, Lezama AQ, Triques ML, Fragoso-Moura EN, Lucas CCT et al. Australoheros perdi, new
species (Teleostei: Labroidei: Cichlidae) from the lacustrine region of the Doce River Valley, south-
eastern Brazil, with biological information. Vertebr. Zool. 2011; 61: 137–145.
11. Schindler I, Ottoni FP, Cheffe M M. Heros acaroides Hensel, 1870 –a valid species of Australoheros
(Teleostei: Perciformes: Cichlidae) from the Patos-Mirim lagoon system, south Brazil. Vertebr.Zool.
2010; 60: 139–146.
12. Ottoni FP. Australoheros sanguineus sp. n.–a new cichlid species from the rio Cubatão basin,southern
Brazil (Cichlidae: Heroini). Vertebr Zool. 2013; 63: 161–169.
13. R
ˇı
´čan O, Pia
´lek L, Almiro
´n A, Casciotta J. Two new species of Australoheros (Teleostei: Cichlidae),
with notes on diversity of the genus and biogeography of the Rı
´o de la Plata basin. Zootaxa, 2011;
2982: 1–26.
14. Ringuelet RA, Ara
´mburu RH, de Ara
´mburu AA. Los peces argentinos de agua dulce. La Plata: Provin-
cia de Buenos Aires, Comisio
´n de Investigacio
´n Cientı
´fica; 1967.
15. de los Angeles Gutie
´rres M, Bistoni M, Haro JG. Ha
´bitos alimentarios de Cichlasoma facetum (Jenyns)
(Pisces, Cichlidae) en el Rı
´o Promero (Co
´rdoba, Argentina). Revista de la Asociacio
´n de Ciencias Nat-
urales del Litoral 1986; 17 (1): 115–126.
16. Nobel N, Laufer G, Serra W. Density, body size and diet overlap of four fish species in artificial reser-
voirs in the Pampas, Uruguay. North-Western Journal of Zoology 2019; 15 (1): 48–54.
17. Ribeiro F, Orjuela RL, Collares-Pereira MJ 2007. Variability in feeding ecology of a South American
cichlid: a reason for successful invasion in mediterranean-type rivers? Ecology of Freshwater Fish
2007 16: 559–569. https://doi.org/10.1111/j.1600-0633.2007.00252.x
18. Ottoni FP, Katz AM. Feeding ecology of the genus Australoheros (Teleostei: Cichlidae: Cichlinae)
based on examined specimens and literature information. Boletim do Laborato
´rio de Hidrobiologia,
2017 27; 13–18.
19. Yafe A, Loureiro M, Scasso F, Quintans F. Feeding of two Cichlidae species (Perciformes) in an [sic]
hypertrophic urban lake. Iheringia 2020; 92: 73–79.
20. Go
´mez SE, Gonza
´lez NJ, Giusto A. Velocidad de natacio
´n de un especialista en maniobra, Cichla-
soma facetum (Jenyns) (Pisces, Cichlidae), en condiciones experimentales. Revista del Museo
Argentino de Ciencias Naturales, N.S. 2003; 5 (1): 87–92.
21. Baduy F, Guerreiro PM, Cana
´rio AV, Saraiva JL. Social organization and endocrine profiles of Austra-
loheros facetus, an exotic freshwater fish in southern Portugal. Acta ethologica 2017; 20: 263–277.
https://doi.org/10.1007/s10211-017-0271-6
22. Carecho J, Baduy F, Guerreiro PM, Saraiva JL, Ribeiro F, Verı
´ssimo A. Taxonomic re-evaluation of
the non-native cichlid in Portuguese drainages. Fishes in Mediterranean Environments 2018;. 001: 1–
11+1. https://doi.org/10.29094/FiSHMED.2018.001
23. Kottelat M, Freyhof J. Handbook of European freshwater fishes. Cornol: Published by the authors;
2007.
24. Avile
´s J, Lo
´pez A, Flores H. Interacciones tro
´ficas de Australoheros facetus (Perciformes; Cichlidae),
pez exo
´tico en el humedal El Culebro
´n, Coquimbo, Chile. Rev. Biol. Mar. Oceanogr. 2018; 53: 99–
105. https://doi.org/10.22370/rbmo.2018.53.0.1261
25. Sineiro de Sprechmann AM. Comportamiento parental en Cichlasoma facetum (Jenyns). Revista de
Biologia del Uruguay 1978; 6: 31–38.
26. Stawikowski R, Werner U. Die Buntbarsche Amerikas Band 1. Stuttgart: Verlag Eugen Ulmer; 1998.
27. Werner U. Ein farbenpra
¨chtiger Chanchito aus Uruguay. DATZ 2016; 69 (4): 16–19.
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 117 / 122
28. Meinken H. Cichlaso
´ma face
´tum (Jenyns) “Chanchito”. In Holly M, Meinken H, Rachow A. 1934–1967.
Die Aquarienfische in Wort und Bild. Winnenden and Stuttgart: Verlag Julius E.G. Wegner and Alfred
Kernen Verlag1934–1967; Sheets 12–0/123[1936].
29. Jenyns L. 1842. Part IV. Fish. In: Darwin C, editor. The Zoology of the voyage of H.M.S. Beagle under
the command of Captain Fitzroy, R.N. during the years 1832–1836. London; Smith, Elder and Co.
30. de Castelnau F. Animaux nouveaux ou rares recueillis pendant l’expe
´dition dans les parties centrales
de l’Ame
´rique du sud, de Rio de Janeiro àLima, et de Lima au Para exe
´cute
´e par ordre du gouverne-
ment franc¸ais pendant les anne
´es 1843 à1847 sous la direction du Comte Francis de Castelnau. Pois-
sons. Paris: P. Bertrand; 1855.
31. Gu¨nther A. Catalogue of the fishes in the British Museum. Volume fourth. London: Trustees of the
British Museum;1862.
32. Heckel J. Johann Natterer’s neue Flussfische Brasilien’s nach den Beobachtungen und Mittheilungen
des Entdeckers beschrieben. (Erste Abtheilung, die Labroiden.) Annalen des Wiener Museums der
Naturgeschichte 1840; 2: 327–470.
33. Steindachner F. Abhandlung u¨ber einige neue Fischarten aus den Sammlungen des Wiener-Muse-
ums. Anzeiger der Kaiserlichen Akademie der Wissenschaften, Wien, Mathematisch-Naturwis-
senschaftliche Classe 1869; 6: 149–150.
34. Hensel R. Beitra
¨ge zur Kenntniss der Wirbelthiere Su¨dbrasiliens Fortsetzung). Arch. Natges. 1870;
36: 50–91.
35. Steindachner F. Die Su¨sswasserfische des su¨do
¨stlichen Brasilien. Sitzungsberichte der Kaiserlichen
Akademie der Wissenschaften, Mathematisch-Naturwissenschaftliche Classe 1875; 70, (1. Abthei-
lung.): 499–538.
36. Pellegrin J. 1904. Contribution àl’e
´tude anatomique, biologique et taxinomique des Poissons de la
famille des Cichlide
´s. Me
´m. Soc. zool. Fr. 1904; 16: 41–399.
37. Regan CT. A revision of the fishes of the American cichlid genus Cichlosoma and of the allied genera.
J. Nat. Hist. (7) 1905; 16: 60–77, 225–243, 316–340, 433–445.
38. Kullander SO. A revision of the South American cichlid genus Cichlasoma (Teleostei: Cichlidae).
Stockholm: Swedish Museum of Natural History; 1983.
39. Haseman JD. An annotated catalog of the cichlid fishes collected by the Expedition of the Carnegie
Museum to Central South America, 1907–10. Ann. Carnegie Mus. 1911; 7: 329–373.
40. R
ˇı
´čan O, Pia
´lek L, Dragova
´K, Nova
´k J. Diversity and evolution of the Middle American cichlid fishes
(Teleostei: Cichlidae). Vertebr. Zool. 2016; 66: 1–102.
41. Kullander SO. 1998 A phylogeny and classification of the South American Cichlidae (Teleostei: Perci-
formes) In: Malabarba LR, Reis RE, Vari RP, Lucena ZMS, Lucena CAS (editors). Phylogeny and clas-
sification of Neotropical fishes. Porto Alegre: EdIPUCRS; pp. 461–498.
42. Allgayer R. Re
´vision et redescription du genre Theraps Gu¨nther, 1862. Description de deux espèces
nouvelles du Mexique. Revue franc¸aise de Cichlidophiles 1989; (July), 4–30.
43. International Commission on Zoological Nomenclature. International Code of Zoological Nomencla-
ture, Fourth Edition. London: International Trust for Zoological Nomenclature; 1999.
44. Smith WL, Chakrabarty P, Sparks JS. Phylogeny, taxonomy. and Evolution of Neotropical cichlids
(Teleostei: Cichlidae: Cichlinae). Cladistics 2007; 24: 625–641.
45. R
ˇı
´čan O, Zardoya R, Doadrio I. Phylogenetic relationships of MiddleAmerican cichlids (Cichlidae, Her-
oini) based on combined evidence from nuclear genes, mtDNA, and morphology. Phylogenet Evol.
2008; 49: 941–957.
46. Lo
´pez-Ferna
´ndez H, Winemille KO, Honeycutt RL. Multilocus phylogeny and rapid radiations in Neo-
tropical cichlid fishes (Perciformes: Cichlidae: (Cichlinae). Mol. Phylogenet. Evol. 2010; 55: 1070–
1086. https://doi.org/10.1016/j.ympev.2010.02.020 PMID: 20178851
47. Ottoni FP, Mattos O, Katz AM, Braganc¸a PHN. Phylogeny and species delimitation based on molecu-
lar approaches on the species of the Australoheros autrani group (Teleostei, Cichlidae), with biogeo-
graphic comments. Zoosyst. Evol. 2019; 95 (1): 49–64. https://doi.org/10.3897/zse.95.31658
48. DeSalle R, Goldstein P. Review and interpretation of trends in DNA Barcoding. Front. Ecol. Evol.
2019; 7: 302. https://doi.org/10.3389/fevo.2019.00302
49. Kullander S, Nore
´n M, Rahman MM, Mollah AR. Chameleonfishes in Bangladesh: hipshot taxonomy,
sibling species, elusive species, and limits of species delimitation (Teleostei: Badidae). Zootaxa 2019;
4586 (2): 301–337. https://doi.org/10.11646/zootaxa.4586.2.7 PMID: 31716133
50. de Queiroz K. Species concepts and species delimitation. Syst. Biol. 2007; 56: 879–886. https://doi.
org/10.1080/10635150701701083 PMID: 18027281
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 118 / 122
51. de Lucena CAS, Calegari B, Pereira EL, Dallegrave E. O uso de o
´leo de cravo na eutana
´sia de peixes.
Blm Soc. Bras.l Ict. 2013; 105: 20–24.
52. Use of Fishes in Research Committee (joint committee of the American Fisheries Society, the Ameri-
can Institute of Fishery Research Biologists, and the American Society of Ichthyologists and Herpetol-
ogists). Guidelines for the use of fishes in research. Bethesda, Maryland: American Fisheries
Society; 2014.
53. Kullander SO. Cichlid fishes of the Amazon River drainage of Peru. Stockholm: Swedish Museum of
Natural History;1986.
54. Systat Software. Systat version 13. San Jose: Systat Software, Inc.; 2009.
55. Humphries JM, Bookstein FL, Chernoff B, Smith RG, Elder RL, Poss S. Multivariate discrimination by
shape in relation to size. Syst. Zool. 1981; 30:291–308.
56. Roberts TR. The freshwater fishes of western Borneo (Kalimantan Barat, Indonesia). Mem. Calif.
Acad. Sci. 1989; 14: x–xii, 1–210.
57. Kullander SO, Rahman MM, Nore
´n M, Mollah AR. Laubuka tenella, a new species of cyprinid fish from
southeastern Bangladesh and southwestern Myanmar (Teleostei, Cyprinidae, Danioninae). ZooKeys
2018; 742: 105–126. https://doi.org/10.3897/zookeys.742.2251
58. R
ˇı
´čan O, Musilova
´Z, Mus
ˇka M, Nova
´k J. Development of coloration patterns in Neotropical cichlids
(Teleostei: Cichlidae: Cichlasomatinae). Folia Zool. 2005; 54, Monograph 1: 1–46.
59. Ottoni FP. Life colouration of three Australoheros species from the rio Paraı
´ba do Sul basin, southeast-
ern Brazil (Teleostei: Labroidei: Cichlidae). Vertebr. Zool. 2013; 63: 9–13.
60. Bade E. Das Su¨sswasser-Aquarium. III. Teil. Vierte Auflage. Berlin: VerlagFritz Pfenningstorff; 1923.
61. Stawikowski R, Werner U. Die Buntbarsche Amerikas. Band 3: Erdfresser, Hecht- und Kammbunt-
barsche. Stuttgart: Verlag Eugen Ulmer; 2004.
62. Calviño PA 2007. Precisio
´n sobre la localidad tipo de cuatro especies de peces de aguas continen-
tales colectadas por Charles Darwin, en Maldonado, Uruguay. Boletı
´n del Killi Club Argentino BIBCA
13: 40–51.
63. Taylor WR, Van Dyke GC. Revised procedures for staining and clearing small fishes and other verte-
brates for bone and cartilage study. Cybium 1985; 9:107–119.
64. Ward RD, Zemlak TS, Innes BH, Last PR, Hebert PDN. DNA barcoding Australia’s fish species. Phi-
los. Trans. R. Soc. Lond. B Biol. Sci. 2005; 360:1847–1857. https://doi.org/10.1098/rstb.2005.1716
PMID: 16214743
65. Sevilla RG, Diez A, Noren M, Mouchel O, Jerome M, Verrez-Bagnis V et al. Primers and polymerase
chain reaction conditions for DNAbarcoding teleosts based on the mitochondrial cytochrome b and
nuclear rhodopsin genes. Mol. Ecol. Notes 2007; 7:730–734.
66. Benson DA, Cavanaugh M, Clark K, Karsch-Mizrachi I., Ostell KD, Pruitt D et al. GenBank. Nucleic
Acids Res. 41 2012; Database issue: D36–D42. https://doi.org/10.1093/nar/gks1195 PMID:
23193287
67. Ratnasingham S, Hebert PD. BOLD: The Barcode of Life Data System. http://www.barcodinglife.org).
Mol. Ecol Resour. 2007; 7: 355–364. https://doi.org/10.1111/j.14718286.2007.01678.x (2007)
68. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S et al. Geneious Basic: an inte-
grated and extendable desktop software platform for the organization and analysis of sequence data.
Bioinformatics 2012; 28: 1647–1649. https://doi.org/10.1093/bioinformatics/bts199 PMID: 22543367
69. Katoh K, Misawa K, Kuma KI, Miyata T. MAFFT: a novel method for rapid multiple sequence alignment
based on fast Fourier transform. Nucleic Acids Res 2002); 30: 3059–66. https://doi.org/10.1093/nar/
gkf436 PMID: 12136088
70. The Zebrafish Information Network, 2019:https://wiki.zfin.org/display/general/ZFIN+Zebrafish
+Nomenclature+Conventions
71. Masters BC, Fan V, Ross HA. Species delimitation–a Geneious plugin for the exploration of species
boundaries. Mol Ecol Resour. 2011; 11: 154–157. https://doi.org/10.1111/j.1755-0998.2010.02896.x
PMID: 21429114
72. Srivatsan A, Meier R. On the inappropriate use of Kimura2parameter (K2P) divergences in the DNA
barcoding literature. Cladistics 2012; 28, 190–194. https://doi.org/10.1111/j.1096-0031.2011.00370.x
PMID: 34861755
73. Zhang J, Kapli P, Pavlidis P, Stamatakis A. A general species delimitation method with applications to
phylogenetic placements. Bioinformatics 2013; 29: 2869–2876. https://doi.org/10.1093/
bioinformatics/btt499 PMID: 23990417
74. Huelsenbeck JP, Ronquist F. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics
2001; 17: 754–755. https://doi.org/10.1093/bioinformatics/17.8.754 PMID: 11524383
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 119 / 122
75. Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Ho
¨hna S et al. MrBayes 3.2: Efficient
Bayesian phylogenetic Inference and model choice across a large model space. Syst. Biol. 2012; 61:
539–542. https://doi.org/10.1093/sysbio/sys029 PMID: 22357727
76. Darriba D, Taboada GL, Doallo R, Posada D. jModelTest 2: more models, new heuristics and parallel
computing. Nat Methods 2012; 9: (8)772. https://doi.org/10.1038/nmeth.2109 PMID: 22847109
77. Rambaut A, Suchard M, Drummond A.Tracer. Version 1.6. 2014. http://treebioedacuk/software/tracer/
78. Trewavas E. Tilapiine fishes of the genera Sarotherodon,Oreochromis and Danakilia. London: British
Museum (Natural History); 1983.
79. Lucena CAS, Kullander SO. The Crenicichla species of the Uruguai River drainage in Brazil. Ichthyol.
Explor. Freshw. 1992; 3:97–160.
80. Chakrabarty P. A morphological phylogenetic analysis of Middle American cichlids with special
emphasis on the section ’Nandopsis’ sensu Regan. Misc. Publ. Mus. Zool. Univ. Mich. 2007) 198: 1–
31.
81. Barel CDN, van Oijen MJP, Witte F, & Witte-Maas E. An introduction to the taxonomy and morphology
of the haplochromine Cichlidae from Lake Victoria. Netherlands Journal of Zoology 1977; 27: 333–
389.
82. Jordan DS, Evermann B. The fishes of North and Middle America. Part II. Washington: Smithsonian
Institution; 1898.
83. Casciotta JR, Go
´mez S.E, Toresani NI. ‘Cichlasoma’ tembe, a new cichlid species from the rı
´o Parana
´
basin, Argentina (Osteichthyes, Labroidei). Ichthyol.Explor Freshw. 1995; 6:193–200.
84. Casciotta JR, Almiro
´n AE, Go
´mez E. A new species of Australoheros (Teleostei: Perciformes: Cichli-
dae) from the rı
´o Iguazu
´basin, Argentina. Zool. Abh. Dresden. 2006; 55: 77–83.
85. R
ˇı
´čan O, Kullander SO. 0Cichlasoma0scitulum: a new species of cichlid fish from the Rı
´o de La Plata
Region in Argentina, Brazil, and Uruguay. Copeia 2003; 2003: 794–802.
86. Casciotta JR, Arratia G. Tertiary fishes from Argentina and reassessment of the phylogeny of New
World cichlids (Perciformes: Labroidei). Kaupia 1998; 2: 195–240.
87. Casciotta JR. Cichlid-fishes from la Plata basin in Argentina: Laetacara dorsigera (Heckel), Bujurquina
vittata (Heckel), and ‘Cichlasoma’ facetum (Jenyns) (Perciformes: Labroidei. Neotro
´pica 1998; 44:
23–39.
88. Steindachner, F 1870. Ichthyologische Notizen (IX). Sitzungsberichte der Kaiserlichen Akademie der
Wissenschaften, Mathematisch-Naturwissenschaftliche Classe 1870; 60, (1. Abtheilung): 290–318.
89. [Du¨rigen, B]. Fremdla
¨ndische Zierfische. Der Chanchito, Bla
¨tter fu¨r Aquarien- und Terrarienfreunde
1894; 5 (23): 286 [image in issue 21, unpaginated].
90. Axelrod HR, Schultz LR. Handbook of tropical aquarium fishes. New York and other cities: 1955.
91. Geyer W. Katechismus fu¨r Aquarienliebhaber. Dritte Auflage. Magdeburg: Creutz’che Verlagsbuch-
handlung: 1896.
92. Castello HP. Cichlasoma facetum. Un cı
´clido de Buenos Aires y sus alrededores. Vida Acuatica 1972;
1972 (11): 367–371.
93. Devincenzi GJ. Peces del Uruguay. II. Nuestra fauna ictiolo
´gica segu
´n nuestras colecciones. Anales
del Museo Nacional de Montevideo 1924: 4 (2): 139–290.
94. Malabarba L, Carvalho Neto P, Bertaco VA, Carvalho TP, Santos JF, Artioli LGS. Guia de identificac¸ão
dos peixes da bacia do rio Tramandaı
´. Porto Alegre: Via Sapiens: 2013.
95. Santos E 1954. Peixes da a
´gua doce (vida e costumes dos peixes do Brasil), Zoologia brasilica 2. Rio
de Janeiro: F Briguiet & Cia., editors; 1954.
96. Fowler HW. Os peixes de a
´gua doce do Brasil. Volume II. Arq. Zool. 1954; 9: 1–400.
97. Kullander SO, Silfvergrip AMC. Review of the South American cichlid genus Mesonauta Gu¨nther (Tel-
eostei, Cichlidae) with descriptions of two new species. Rev. Suisse Zool. 1999; 98: 407–448.
98. de Castelnau F. Expe
´dition dans les parties centrales de l’Ame
´rique du sud, de Rio de Janeiro a Lima,
et de Lima au Para;Execute
´e par ordre du gouvernement Francais pendant les anne
´es 1843 a 1847,
sous la direction de Francis de Castelnau. Histoire de voyage Tome deuxième. Paris: P. Bertrand;
1850.
99. Papavero N. Essays on the history of Neotropical dipterology, vol. 1. São Paulo: Museu de Zoologia,
Universidade de São Paulo; 1971.
100. Natural History Museum 2014. Dataset: Collection specimens. Resource: Specimens. Natural History
Museum Data Portal (data.nhm.ac.uk). https://doi.org/10.5519/0002965 Retrieved: 17:22 23 Nov
2020 (GMT).
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 120 / 122
101. Gray GG. List of the specimens of birds in the collection of the British Museum. Second Edition. Lon-
don: Trustees of the British Museum; 1848–1867.
102. Carmo GF, Triques ML. Australoheros mattosi Ottoni, 2012 (Teleostei: Cichlidae): live coloration, pop-
ulation differences, and new data on adult external anatomy. Biotemas 2016; 29: 55–66.
103. von Martens E. Reinhold Hensel. Leopoldina 1882; 19–21.
104. Hensel R. Beitra
¨ge zur Kenntniss der Wirbelthiere Su¨dbrasiliens. Arch. Natges. 1867; 36: 120–162.
105. Hensel R. Beitra
¨ge zur Kenntniss der Wirbelthiere Su¨dbrasiliens (Fortsetzung). Arch. Natges.1868;
36: 324–375.
106. Paepke J, Schindler I. The type specimens of Neotropical Cichlidae (Teleostei: Perciformes) in the
Museum fu¨r Naturkunde Berlin. Zoosyst. Evol. 2013 89; 259–274.
107. Litz T, Salvia H, Stawikowski R. Ein weiterer “Chanchito” aus Uruguay. DATZ 2006; 59: 6–11.
108. Ottoni FP, Katz AM, Braganc¸a PHN. Correction of the type locality of Australoheros ipatinguensis (Tel-
eostei: Cichlidae). Ichthyol. Explor. Freshw. 2020, 30; ( 1:17–19).
109. Joinville Franciozi V. Die aquaristik [sic] in Deutsch-Brasilien. Aquariofilia 1989; 7: 30–36.
110. Staeck W. Neuer Chanchito. DATZ 1997; 50: 62–63.
111. Staeck W 1998. Ein neuer Cichlide aus dem “Cichlasoma” facetum-Komplex. DCG-Informationen
1998; 29(5): 81–85.
112. Baumgartner G, Pavanelli CS, Baumgartner D, Bifi AG, Debona T, Frana V. 2012. Peixes do baixo rio
Iguac¸u. Maringa
´: Editora da Universidade Estadual de Maringa
´; 2012.
113. Paiz LM, Baumgartner L, Moresco MM, Treco FR, da Grac¸a WJ, Margarido VP. Evolutionary and bio-
geographical approach on Australoheros angiru (Cichlidae) from lagoons in a dividing plateau between
the basins of the Iguassu River and the Uruguay River, Brazil. Reviews in Fish Biology and Fisheries
2014; 24: 399–407. https://doi.org/10.1007/s11160-13-9321-y
114. Kreutz RM, Machado NTG. O povoamento do Vale do Taquati, Rio Grande do Sul. Lajeado: Editora
Univates; 2017.
115. Wiens JJ, Penkrot TA. 2002. Delimiting species using DNA and morphological variation and discordant
species limits in spiny lizards (Sceloporus). Syst. Biol. 2020; 51 (1): 69–91.
116. Dayrat D. Towards integrative taxonomy. Biol. J. Linn. Soc. 2005, 85 (3): 407–417. https://doi.org/10.
1111/j.1095-8312.2005.00503.x
117. Pante E, Puillandre N, Viricel A, Arnaud-Haond S, Aurelle D et al. Species are hypotheses: avoid con-
nectivity assessments based on pillars of sand. Mol. Ecol. 2015; 24: 525–544. https://doi.org/10.1111/
mec.13048 PMID: 25529046
118. Kullander SO, Ferreira EJG. A review of the South American cichlid genus Cichla, with descriptions of
nine new species (Teleostei: Cichlidae). Ichthyol. Explor. Freshwaters 2006; 17: 289–398.
119. Lucena CAS. Two new species of the genus Crenicichla Heckel, 1840 from the upper rio Uruguay
drainage (Perciformes: Cichlidae). Neotrop. Ichthyol. 2007; 5: 449–456.
120. Ready JS, Sampaio I, Schneider H, Vinson C, Dos Santos T, Turner GF.Colour forms of Amazonian
cichlid fish represent reproductively isolated species. J. Evol. Biol. 2006; 19: 1139–1148. https://doi.
org/10.1111/j.1420-9101.2006.01088.x PMID: 16780514
121. Koslowski I. Die Buntbarsche Amerikas. Band 2: Apistogramma & Co. Stuttgart: 318 Verlag Eugen
Ulmer; 2002.
122. Ward RD. DNA barcode divergence among species and genera of birds and fishes. Mol Ecol Resour.
2009; 9:1077–1085. https://doi.org/10.1111/j.1755-0998.2009.02541.x PMID: 21564845
123. Luo A, Ling C, Ho SYW, Zhu CD. Comparison of methods for molecular species delimitation across a
range of speciation scenarios. Syst. Biol. 2018; 67 (5): 830–846. https://doi.org/10.1093/sysbio/
syy011 PMID: 29462495
124. DeSalle R, Egan MG, Siddall MM. The unholy trinity: taxonomy, species delimitation and DNA barcod-
ing. Philosophical Transactions of the Royal Scociety B.2005; 360: 1905–1916. https://doi.org/10.
1098/rstb.2005.1722 PMID: 16214748
125. Thomaz AT, Malabarba LR, Bonatto L, Knowles LC. Testing the effect of palaeodrainages versus hab-
itat stability on genetic divergence in riverine system: study of Neotropical fish of the Brazilian coastal
Atlantic forest. Journal of Biogeography 2015; 42: 2389–2401.
126. Thomaz AT, Knowles LL. Flowing into the unknown: inferred paleodrainages for studying the ichthyo-
fauna of Brazilian coastal rivers. Neotrop Ichthyol. 2018; 16(3): e180019, 2018. https://doi.org/10.
1590/1982-0224-20180019
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 121 / 122
127. Thomaz AT, Malabarba LR Malabarba, Bonatto SL L. The phylogenetic placement of Hollandichthys
Eigenmann 1909 (Teleostei: Characidae) and related genera. Mol. Phyl.Evol. 2010; 57: 1347–1352.
https://doi.org/10.1111/jbi.2597
128. Thomaz A, Malabarba L, Knowles L. Genomic signatures of paleodrainages in a freshwater fish along
the southeastern coast of Brazil: genetic structure reflects past riverine properties. Heredity 2017;
119: 287–294. https://doi.org/10.1038/hdy.2017.46 PMID: 28767104
129. Bertaco V, Malabarba LR. A new species of the characid genus Hollandichthys Eigenmann from
coastal rivers of southern Brazil (Teleostei: Characiformes) with a discussion on the diagnosis of the
genus. Neotrop. Ichthyol. 2013; 11 (4): 767–778. https://doi.org/10.1590/S1679-62252013000400004
130. Martı
´nez S, Rojas A. 2013. Relative sea level during the Holocene in Uruguay. Palaeogeography,
Palaeoclimatology, Palaeoecology, 374: 123–31. https://doi.org/10.1016/j.palaeo.2013.01.010
131. Bracco R, Inda H, del Puero L, Capdepont I, Panario D, Castiñeira et al. Comments to ’A reply to "Rela-
tive sea level during the Holocene in Uruguay" by Bracco et al. (2013). Palaeogeography, Palaeocli-
matol. Palaeoecol. 401: 166–170. https://doi.org/10.1016/j.palaeo.2013.10.012
132. Martı
´nez S, Rojas A. A reply to to “Relative sea level during the Holocene in Uruguay”. Palaeogeogr.
Palaeoclimatol. Palaeoecol.2014; 401:166–170.
133. Martı´nez S, Rojas A. 2014. Comments to ‘A reply to "Relative sea level during the Holocene in Uru-
guay” by Bracco et al, (2013). Palaeogeogr. Palaeoclimatol. Palaeoecol. 2014; 401: 171–172. https://
doi.org/10.1016/j.palaeo.2014.01.021
134. Ribeiro AC. Tectonic history and the biogeography of the freshwater fishs from the coastal drainages
of eastern Brazil: an example of faunal evolution associated with a divergent. continental margin. Neo-
trop. Ichthyol. 2006; 4: 225–246.
135. Mayr E Principles of Systematic Zoology. St. Louis, San Francisco, Toronto, London, Sydney:
McGraw-Hill; 1969.
136. Blackwelder RE. Taxonomy. New York, London, Sydney: John Wiley & Sons; 1967.
137. Dubois A. Diagnoses in zoological taxonomy and nomenclature. Bionomina 2017; 12: 63–85.
138. Wilkins JS, Ebach ME. The nature of classification. London: Palgrave McMillan; 2014.
PLOS ONE
Species diversity and phylogeny of Australoheros
PLOS ONE | https://doi.org/10.1371/journal.pone.0261027 December 9, 2022 122 / 122
Available via license: CC BY 4.0
Content may be subject to copyright.
