Three birds with one stone? Sex ratios of seized critically endangered helmeted hornbill casques reveal illegal hunting of males, females and juveniles

Abstract

Hunted wildlife can often be used to answer questions about wild individuals. Sex ratios of hunted individuals can be important for understanding changes in population demographics and viability. Here we determined the sex ratio of the illegally hunted helmeted hornbill Rhinoplax vigil, a critically endangered species from Southeast Asia, to examine their vulnerability to hunters. Using casques seized in Hong Kong SAR between 2012 and 2016, we identified the sex of seized individuals using morphological and molecular methods as well as discriminant analysis. As R. vigil females can spend up to 6 months of the year sealed into tree cavity nests, they are reliant on males for food. The unique breeding ecology of this elusive species means that males are more likely to be observed than females throughout the year. These behavioural differences mean that there are several potential outcomes which may be observed in the sex ratio of the seized casques, depending on hunting strategies. Our results suggest that sex identification is possible via visual inspection of the gular skin colour and beak‐tip markings, but when these are not available, genetic methods or morphological measurements can be used. Our findings also indicated a primarily male‐biased sex ratio across the seizures; however, females, as well as juveniles, were also present in seizures. Although removing one sex from the wild can cause shifts in demographic dynamics over time, illegal and unsustainable hunting of any measure of a critically endangered species will ultimately heighten its risk of extinction. These methods and results are useful to conservationists and researchers interested in further study of hornbill populations and their viability and are ultimately important for the conservation and management of this critically endangered species.

Full text

Three birds with one stone? Sex ratios of seized critically
endangered helmeted hornbill casques reveal illegal
hunting of males, females and juveniles
C. E. R. Hatten
1
, H. B. Tilley
1
, Y. Hadiprakarsa
2
& C. Dingle
1
1 School of Biological Sciences, The University of Hong Kong, Hong Kong, China
2 Rangkong Indonesia, Bogor, Indonesia
Keywords
illegal wildlife trade; hunting; endangered
species; morphology; genetic sexing;
Rhinoplax vigil; sex ratios; population
viability.
Correspondence
Caroline Dingle, School of Biological
Sciences, The University of Hong Kong,
Hong Kong, China.
Email: cdingle@hku.hk
Editor: Iain Gordon
Associate Editor: Viviana Ruiz-Gutierrez
Received 18 January 2022; accepted 08
November 2022
doi:10.1111/acv.12838
Abstract
Hunted wildlife can often be used to answer questions about wild individuals. Sex
ratios of hunted individuals can be important for understanding changes in popula-
tion demographics and viability. Here we determined the sex ratio of the illegally
hunted helmeted hornbill Rhinoplax vigil, a critically endangered species from
Southeast Asia, to examine their vulnerability to hunters. Using casques seized in
Hong Kong SAR between 2012 and 2016, we identified the sex of seized individu-
als using morphological and molecular methods as well as discriminant analysis.
As R. vigil females can spend up to 6 months of the year sealed into tree cavity
nests, they are reliant on males for food. The unique breeding ecology of this elu-
sive species means that males are more likely to be observed than females through-
out the year. These behavioural differences mean that there are several potential
outcomes which may be observed in the sex ratio of the seized casques, depending
on hunting strategies. Our results suggest that sex identification is possible via
visual inspection of the gular skin colour and beak-tip markings, but when these
are not available, genetic methods or morphological measurements can be used.
Our findings also indicated a primarily male-biased sex ratio across the seizures;
however, females, as well as juveniles, were also present in seizures. Although
removing one sex from the wild can cause shifts in demographic dynamics over
time, illegal and unsustainable hunting of any measure of a critically endangered
species will ultimately heighten its risk of extinction. These methods and results
are useful to conservationists and researchers interested in further study of hornbill
populations and their viability and are ultimately important for the conservation
and management of this critically endangered species.
Introduction
Unsustainable and illegal hunting of wildlife contributes to
population declines, potentially leading to the extinction of
species (Branch, Lobo, & Purcell, 2013; Martin &
Caro, 2013; Borgerson, 2015). If one sex is targeted, hunting
can lead to skewed sex ratios (Marealle et al., 2010; Chris-
tensen & Fox, 2014; Festa-Bianchet & Mysterud, 2018).
Males are often targeted for their ornaments, such as horns
and tusks (Holmern et al., 2006; Chiyo, Obanda, &
Korir, 2015). Skewed sex ratios can lead to demographic
shifts including changes in effective population sizes, leading
to loss of genetic diversity and an increase in inbreeding as
well as conflict over mates (Harris, Wall, & Allendorf, 2002;
Charlesworth, 2009; Wedekind, 2012; Rosche et al., 2018).
These impacts can be particularly detrimental for threatened
species due to their small population sizes and low genetic
variability (Grayson et al., 2014; Willoughby et al., 2015).
Without suitable management targeted at the species or pop-
ulation (Wedekind, 2002) such as reducing harvesting quotas
(Caro et al., 2009) or employing targeted enforcement
(Wright et al., 2001), skewed sex ratios caused by hunting
can ultimately threaten population viability, causing eventual
functional extinction (Grayson et al., 2014).
Understanding the hunted sex ratio can help understand
the consequences of hunting. Hunted sex ratio analyses can
highlight subsequent changes to population dynamics and
breeding behaviour due to sex-skewed hunting (Down-
ing, 1981; Ginsberg & Milner-Gulland, 1994; Mondol, Mai-
land, & Wasser, 2014; Hagen, Sedinger, & Braun, 2018).
One sex may therefore be more vulnerable to hunting than
the other due to the presence of desired morphological fea-
tures or as a consequence of behaviour (Giroux &
B
edard, 1986; Coltman et al., 2003; Mondol et al., 2014;
Animal Conservation  (2022) – ª2022 Zoological Society of London. 1
Animal Conservation. Print ISSN 1367-9430
14691795, 0, Downloaded from https://zslpublications.onlinelibrary.wiley.com/doi/10.1111/acv.12838 by City University Of Hong Kong, Wiley Online Library on [30/11/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

Chiyo et al., 2015; Loveridge et al., 2016). Analysing sex
ratios of hunted individuals can therefore inform conserva-
tion management and aid future population studies.
The sex of hunted wildlife parts and products can be diffi-
cult to determine when both males and females contain the
desirable trait (Trail, 2021). Genetic sexing techniques can
be used in cases where visual identification is not possible
(Griffiths, Daan, & Dijkstra, 1996;P

erez-Espona
et al., 2010; Johnson, 2012; Karmacharya et al., 2018).
However, DNA is often highly degraded in hunted wildlife
parts like bone, horn and ivory (Ogden, Dawnay, & McEw-
ing, 2009; Ladoukakis & Zouros, 2017), making amplifica-
tion of nuclear DNA for sex identification difficult (Quincey
et al., 2013). A combination of morphological and genetic
analyses can therefore provide more certainty in sex determi-
nation, as shown across various species (Ottvall & Gun-
narsson, 2007; Pitzer et al., 2008; Hayman, Fairgrieve, &
Luckenbach, 2021).
Helmeted hornbills Rhinoplax vigil are classified as ‘Criti-
cally Endangered’on the IUCN Red List (BirdLife Interna-
tional, 2020) due to ongoing threats including habitat loss
and illegal hunting for their casques. R. vigil has a solid yel-
low/red casque, unique among hornbills (Manger Cats-
Kuenen, 1961; Kane, 1981; Kinnaird & O’Brien, 2007),
which is carved into ornaments and sold illegally (Beastall
et al., 2016; Jain et al., 2018b). Almost 6000 R. vigil cas-
ques and casque products have been seized worldwide since
2011–2021 across Indonesia and China (Beastall
et al., 2016; EIA, 2017; TRAFFIC, 2020; Hatten et al.,
unpublished data, 2022). If one sex is particularly targeted
for trade, the sex ratio of the remaining wild populations
could be affected, potentially impacting the ability of these
populations to recover.
Large, monogamous hornbills have been observed to have
1:1 sex ratios in the wild (Kinnaird & O’Brien, 2007; Mar-
gareta & Nugroho, 2013; Pawar, Mudappa, & Raman, 2020).
Although there is no published data on the natural sex ratios
of helmeted hornbills, field observations suggest that this
species also has a 1:1 sex ratio (Hadiprakarsa, unpublished
data). While this species is sexually dimorphic (Kemp &
Woodcock, 1995; Kaur et al., 2019), the casques can be
visually similar and therefore both sexes are potentially hunt-
ing targets. However, behavioural differences may result in
sex-biased removal, depending on the hunting strategies.
Throughout the year, males spend most of their time forag-
ing (Poonswad & Tsuji, 1994). Females in contrast spend up
to 172 days a year sealed into a nest cavity (Kinnaird &
O’Brien, 2007). While sealed into the nest, females undergo
a full moult and are reliant on the male for food (Kaur
et al., 2019). Observable adult sex ratios in hornbill popula-
tions are often skewed towards males during nesting seasons
as they spend more time flying around the tree canopy (Kin-
naird, O’Brien, & Suryadi, 1996; Margareta & Nugroho,
2013; Pawar et al., 2020). According to interviews with hun-
ters in Indonesia, hunters target nesting and fruiting trees
due to the presence of multiple R. vigil individuals at these
locations (Hadiprakarsa & Kinnaird, 2004; Hadiprakarsa, Ira-
wan, & Adhiasto, 2013; Miller et al., 2019). Little is known
about the number of males and females removed from the
wild for the trade, and this information is important for esti-
mating the impacts of hunting on population viability.
In this study, we calculated the sex ratio of seized R. vigil
casques as a proxy to estimate the relative numbers of males
and females removed from the wild. Casques were first iden-
tified as coming from males or females using visual mark-
ings and genetic sexing techniques. We then tested a
morphometric method to determine the sex in cases where
the visual or genetic determination was not possible. Com-
bining these techniques, we determined whether males,
females or both are targeted for trade. This information can
help determine the impacts of hunting on the remaining pop-
ulations of R. vigil and inform conservation strategies to mit-
igate these threats. In 2018, the IUCN SSC Helmeted
Hornbill Working Group (HHWG) released a 10-year Hel-
meted Hornbill Conservation Strategy and Action Plan
(2018–2027, Jain et al., 2018b). Our study aims to meet two
objectives under this Action Plan: Objective 1.3, Action
1.3.1 to ‘develop and/or disseminate identification keys for
HH parts and derivatives (high priority)’and Objective 3.2,
Action 3.2.5 to ‘collect morphological measurements and
genetic samples from confiscated beaks for wildlife forensics.
This will help to identify the sex of poached birds and
assess the impacts of poaching on specific in situ populations
... using standard morphometric techniques’.
Materials and methods
Sample collection
We were granted access to 209 R. vigil casques from seven
seizures made between 2012 and 2016 by the Agriculture,
Fisheries and Conservation Department (AFCD) of the Hong
Kong SAR government. Specimens were stored dry in con-
signment bags separated by case numbers in a locked storage
holding. The casque of this species is unique among all
other hornbill species and is easily identifiable by visual
inspection. We therefore identified the species of the casques
preliminarily based on detailed morphological references
(Manger Cats-Kuenen, 1961) and field record images (Kaur
et al., 2019). We confirmed species identification using DNA
barcoding on six individual casques (see details below).
Three specimen types (‘casques’) were observed (Fig. 1).
Confiscated casques were either (1) attached to the skull,
with upper and lower mandibles and skin tissue present
(‘heads’,n=22, Fig. 1a), (2) detached from the skull with
no lower mandible or skin tissue present (‘beaked casques’,
n=187, Fig. 1b) and (3) casques with the upper mandible
sawn off at the base (‘non-beaked casques’,n=60,
Fig. 1d).
We distinguished adults from juveniles by the presence of
red layers covering the casques (Fig. 1c). These outer red
layers are thought to deepen in colour with age, with a
thicker set of layers in a deeper red colour on older birds
and a thinner set of layers in a lighter orange colour on
younger R. vigil birds (Kaur et al., 2019). As large hornbills
reach maturity, new ridges form posteriorly and new ridges
2Animal Conservation  (2022) – ª2022 Zoological Society of London.
Sex ratios of seized helmeted hornbill casques C. E. R. Hatten et al.
14691795, 0, Downloaded from https://zslpublications.onlinelibrary.wiley.com/doi/10.1111/acv.12838 by City University Of Hong Kong, Wiley Online Library on [30/11/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

are lost anteriorly (Poonswad & Kemp, 1993), with casques
taking possibly longer than 4 years to fully form (Frith &
Douglas, 1978). As most casque carvings preserve the red
colouration in the final product (Phassaraudomsak, Krish-
nasamy, & Chng, 2019), we assumed that this colouration is
desirable in end products and would be unlikely to be
removed by hunters or traders prior to the trade. We there-
fore classified casques without red layers and ridges as juve-
niles and analysed them independently in the morphological
analyses.
Molecular sexing
We collected genetic samples from 166 casques. We used a
Dremel drill to collect 1.8–2.0 mg of powdered material per
casque (Ewart et al., 2020). Dried facial/gular skin was sam-
pled where available using a sterile scalpel to cut approxi-
mately 1.5 91.5 93 mm (Mundy, Unitt, &
Woodruff, 1997). Samples were placed into sterile 1.5 mL
Eppendorf microcentrifuge tubes. Sample areas, drill bits and
scalpels were sterilised with 5% bleach and then double-
distilled water (ddH
2
O) to remove surface contamination
prior to sampling. DNA was extracted using a phenol-
chloroform:isoamyl alcohol (PCIA) method modified for
extracting DNA from hornbill casques (Hatten et al., in
review, 2022). Samples were incubated in 0.6 mL cetyl
trimethylammonium bromide buffer, 0.4 mg proteinase K
and 10 lL freshly made 1 M dithiothreitol for 12 h at 65°C.
Chloroform:isoamyl alcohol (CIA, 24:1, 0.6 mL) was added,
samples were vortexed and centrifuged at 13 000 relative
centrifugal force (RCF) for 7 min. After the aqueous layer
was transferred to a clean tube, 0.6 mL of PCIA (25:24:1)
was added to extract the DNA and centrifuged again at
13 000 RCF for 7 min. The nucleic acid-containing aqueous
stage was then added to a clean tube before undergoing
another 0.6 mL CIA and aqueous stage transferred into a
final tube. Ice-cold 95% EtOH (1 mL) was then added and
samples left to precipitate at 80°C for 1 h. Samples were
centrifuged for 30 min at 13 000 RCF. The pellet was
washed twice with 0.5 mL 70% EtOH before being dried in
a speed-vac (Labconco CentriVapBenchtop Vacuum Con-
centrator) and resuspended in 30 lL of TE (10 mM Tris-
HC1 pH 8.0 and 1 mM EDTA). Two extraction negative
controls were included in each set of 20 samples. Species
identification was determined using primers for a commonly
used barcoding region, cytochrome B(cytB, Parson
et al., 2000). We used primers that were designed to target
fragments 761 bp in length of the mtDNA cytochrome b
gene (cytB) of 800 bp in length (including primers, Table 1,
Ouitavon et al., 2022). DNA sequences were visually exam-
ined on Geneious v9 Bioinformatics Software (‘Geneious’,
https://www.geneious.com) and compared with published ref-
erences through the NCBI Basic Local Alignment Search
Tool (‘BLAST’,http://www.ncbi.nlm.nih.gov/BLAST/)to
confirm species identification prior to sex identification.
Casques are thought to consist of keratin, which is known to
contain lower quantities of DNA compared to blood and mus-
cle (Bengtsson et al., 2012). As we did not have any informa-
tion on how long and under what conditions the casques had
been stored, we considered the casque DNA likely to be
degraded. To increase our ability to determine the sex under
such conditions, we used two polymerase chain reaction (PCR)
amplification methods to target the sex-linked chromohelicase
DNA-binding protein 1 (CHD 1) gene to ensure robust sex
Figure 1 Helmeted hornbill Rhinoplax vigil casque types across seizures. (a) Adult ‘head’, (b) adult ‘beaked casque’, (c) juvenile ‘beaked cas-
que’, (d) adult ‘non-beaked casque’. Images (a, b and d) were artificially lightened in Inkscape 1.0.2 (Inkscape Project, 2020) to allow darker
features to be more easily discernible. The scale bar shows the size.
Animal Conservation  (2022) – ª2022 Zoological Society of London. 3
C. E. R. Hatten et al. Sex ratios of seized helmeted hornbill casques
14691795, 0, Downloaded from https://zslpublications.onlinelibrary.wiley.com/doi/10.1111/acv.12838 by City University Of Hong Kong, Wiley Online Library on [30/11/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

assignments (Griffiths et al., 1996). Primers targeting this gene
amplify across introns of different sizes on the Z and W avian
sex chromosomes where males are homogametic (ZZ) and
females are heterogametic (ZW). First, we used previously
published primers CHD1 F/R (Lee et al., 2010) where one
band equates to homogametic males (ZZ, 536 bp) and two
bands equate to heterogametic females (ZW, 536 and 329 bp).
These primers have been tested previously on birds, including
R. vigil (C
ßakmak, Akın Peks
ßen, & Bilgin, 2017; Fitriana,
Irham, & Sutrisno, 2020). As it can be difficult to obtain high-
quality sequences for longer fragments when DNA is degraded,
we also designed primers to target shorter regions of the CHD
gene. These primers were designed using Primer3 software in
Geneious by identifying conserved regions on the Z and W
chromosomes within the previously published CHD1 regions.
These primers were designed to target specific sequence
regions unique to each of the sex chromosomes. For homoga-
metic males, primer pair CHDZ F/R (299-bp) should show one
band and no bands using primer pair CHDW F/R (193-bp) on
electrophoresis gels. For heterogametic females, both primer
pairs should result in a band on electrophoresis gels (Table 1).
Therefore, PCR products of samples determined as males had
to be observed on electrophoresis gels with one band at 536 bp
(CHD1 primers), or one band at 299 bp (CHDZ primers), and
no bands (CHDW primers), and females had to be observed
with one band each at 536 and 329 bp (CHD1) or one band at
299 bp (CHDZ primers) and one band at 193 bp (CHDW pri-
mers). For sex identification, at least one assay (using CHD1
primer pair or using both CHDW and CHDZ primer pairs) had
to consistently amplify twice.
The sex of four intact R. vigil heads was identified (two
male, two female) by comparing visual morphological fea-
tures of beak markings and skin tissue colour (as below) to
genetic results from tissue samples after three consistent
PCR amplifications using the published primers (CHD1).
One male and one female head sample were then used as
PCR positive controls. One PCR negative control was also
used per 10 PCR reactions.
PCR amplifications were conducted in 20 lL reactions
containing Biotechrabbit LysoHotStart 29PCR mastermix,
0.3 lmol L
1
primers, 1.5 mg mL
1
bovine serum albumin
and 20–50 ng of template DNA, using the Applied Biosys-
tems Veriti 96-Well Thermal Cycler. For amplification using
cytB primers, an initial denaturing step was conducted at
95°C for 2 min followed by 35 cycles at 94°C for 30 s,
55°C annealing temperature for 30 s, 72°C for 1 min and a
final extension step at 72°C for 4 min. For CHD1 F/R
amplification, a touchdown scheme was followed where the
annealing temperature was reduced by 1°C per cycle, starting
from 59°C, until it reached 51°C, followed by 30 cycles,
and a final extension at 72°C for 5 min (C
ßakmak
et al., 2017). The new CHDW and CHDZ primer pairs were
amplified with an initial denaturing step at 95°C for 2 min,
followed by 35 cycles at 95°C for 30 s, 54°C for 20 s and
72°C for 1 min, before a final extension step at 72°C for
7 min. Amplicons were separated by electrophoresis through
a 2% sodium boric acid agarose gel at 120 V for 30 min.
PCR amplification was repeated three times to ensure data
quality, and only samples with more than two identical
results were assigned sexes.
Sex identification based on visual and
morphometric information
We tested whether visual markings and morphometric mea-
surements can reliably be used to identify the sex of the
seized casques. Where gular skin was present (heads), cas-
ques were identified as female based on blue gular skin and
as male based on red skin colour (Fig. 2). For casques with
beaks intact (heads and beaked casques), females were iden-
tified by the presence beak markings at the tips (1–5 stria-
tions or “speckles”on the upper mandible with a thicker
smudge on the lower mandible; Kemp & Woodcock, 1995)
(Fig. 2).
From all 209 casques (including juveniles), we measured
the following morphological measurements to the nearest
0.1 mm using digital callipers (Ferrer et al., 2016): the top
of casque to join at top of beak (A), the top of casque to
bottom of beak (B), the width of beak–casque join (C) and
the casque width between ridges (taken underneath ridge,
D). All casques had these measurements in common regard-
less of how intact they were (Fig. 3). Weights (g) were also
recorded for each casque type.
We calculated mean values for all morphological measure-
ments for males, females and juveniles (Table 2). To test
whether male and female casques could be distinguished
based on these measurements, we performed Welch’s inde-
pendent two-sample t-tests for all four measurements.
Welch’st-test assumes that variables are normally distributed
and have equal variance. Using a Shapiro–Wilk test of nor-
mality, where normality can be assumed at P>0.05, all
measurements of juvenile casques and of measurements A
and B in adults were normally distributed. Measurements C
and D in adults were not normally distributed and so were
logged and square root transformed before analysis. All vari-
ables met the criteria for equal variances. To determine
Table 1 Primer pairs for PCR amplification of mitochondrial (cytB)
and nuclear (CHD) DNA extracted from Rhinoplax vigil casques
Primer
a
Sequences 50
–30
Amplicons
and Reference
hhcytbF GTACGGCTGACTAATCCGCA CytB 800-bp
(Ouitavon
et al., 2022)
hhcytbR GGCTGCCCACTCATGTGAG
CHD1F TATCGTCAGTTTCCTTTTCAGGT CHD 329-bp (W),
536-bp (Z)
(Lee et al., 2010)
CHD1R CCTTTTATTGATCCATCAAGCCT
CHDWF TGGGGGAGAGGAATAAGAGT CHD 193-bp (W)
(This study)CHDWR GACTTCTTGGCTACTATCAGC
CHDZF ACTGACAAAACCGTTACCTGA CHD 299-bp (Z)
(This study)CHDZR CGCAGAGGATGGAGATTCC
All amplicon lengths include primers.
a
F and R in the primer name refer to forward and reverse primers,
respectively.
4Animal Conservation  (2022) – ª2022 Zoological Society of London.
Sex ratios of seized helmeted hornbill casques C. E. R. Hatten et al.
14691795, 0, Downloaded from https://zslpublications.onlinelibrary.wiley.com/doi/10.1111/acv.12838 by City University Of Hong Kong, Wiley Online Library on [30/11/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

Figure 2 Male and female helmeted hornbill Rhinoplax vigil ‘heads’ from seizures in 2013. Blue facial/gular skin colour and black striations
on beaks are characteristics of female Rhinoplax vigil, and red facial/gular skin colour and no beak striations are characteristics of male
R. vigil. Images of hornbill heads and casques were artificially lightened in Inkscape 1.0.2 (Inkscape Project, 2020) to allow darker features
to be more easily discernible. The scale bar shows the size.
Figure 3 Common measurements taken on all seized helmeted hornbill Rhinoplax vigil casques A: top of casque to join at top of the beak,
B: top of casque to bottom of upper mandible, C: width of beak/casque join and D: width between ridges (taken underneath ridge). Images
of hornbill heads and casques were artificially lightened in Inkscape 1.0.2 (Inkscape Project, 2020) to allow darker features to be more easily
discernible. The scale bar shows the size.
Table 2 Range, mean and standard deviation for morphological measurements (mm) and weights (g) of male and female Rhinoplax vigil
casque specimens, that had been identified to sex via genetic/visual methods, of adults (heads, beaked and non-beaked casques), and juve-
niles (beaked and non-beaked casques, total n=165)
Variable
Adult males (n=81)
Adult females
(n=59)
Juvenile males
(n=17)
Juvenile females
(n=8)
Mean SD Mean SD Mean SD Mean SD
A (mm) 62.32 4.55 54.29 4.77 48.64 6.34 40.18 5.38
B (mm) 86.82 4.40 77.16 4.53 81.67 2.77 74.88 3.44
C (mm) 30.00 2.23 28.20 1.86 28.79 1.97 26.18 1.81
D (mm) 39.15 2.73 35.71 2.43 38.81 2.68 34.14 2.15
Head weight (g) (n=12) (n=10) (n=0) (n=0)
205.23 12.86 162.75 21.33 NA NA NA NA
Beaked casque weight (g) (n=64) (n=39) (n=16) (n=8)
82.18 17.27 61.35 11.50 41.69 10.63 29.61 6.78
Non-beaked casque weight (g) (n=5) (n=10) (n=1) (n=0)
59.24 5.61 60.32 16.17 27.2 NA NA NA
Measurements included: top of casque to join at top of the beak (A), top of casque to bottom of the beak (B), width of beak/casque join (C),
width between ridges (taken underneath the ridge, D).
Animal Conservation  (2022) – ª2022 Zoological Society of London. 5
C. E. R. Hatten et al. Sex ratios of seized helmeted hornbill casques
14691795, 0, Downloaded from https://zslpublications.onlinelibrary.wiley.com/doi/10.1111/acv.12838 by City University Of Hong Kong, Wiley Online Library on [30/11/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

whether there were any significant changes over time
between the sexes identified, we ran simple linear regression
analyses.
We next performed a linear discriminant analysis (LDA)
to determine the probability of randomly selected casques
being correctly identified as male or female (Reimann
et al., 2008). This method allows unknowns to be assigned
sex and has been previously used to determine the sex of
birds based on morphometric measurements (Henry
et al., 2015; Ferrer et al., 2016). We did not include weight
in these analyses because within adults and juveniles the cas-
ques varied in physical intactness. LDAs were performed
separately for adults and juveniles. Genetically and/or visu-
ally confirmed adult (n=140) and juvenile (n=25) casques
underwent 10-fold resampling cross-validations to estimate
the proportion of males and females being correctly classi-
fied. This k-fold method is a recommended method for small
to intermediate samples sizes (<200) and provides more
accurate estimations of the test error rate than other cross-
validation methods (Dechaume-Moncharmont, Monceau, &
Cezilly, 2011; James et al., 2014). Model accuracy was mea-
sured, and Cohen’s Kappa statistics were generated to assess
the agreement between two raters (i.e. the predefined male
and female groups) (Cohen, 1960), where Kappa >0.75 rep-
resents an excellent agreement level, and 0.4–0.75 represent
fair to the good agreement in the most widely accepted clas-
sification (Landis & Koch, 1977).
To determine whether the observed sex ratio differed sig-
nificantly from the expected sex ratio based on the assumed
1:1 sex ratio, we performed the chi-square goodness of fit
test. All data preparation, statistical analyses and figure-
making was performed in R version 1.4.1106 (R Core
Team, 2021).
Results
We confirmed the species identification of the six casques as
Rhinoplax vigil, using the cytB primers, with a 99–100%
pairwise identity match to reference sequence GU257918
(Viseshakul et al., 2011) on NCBI.
Genetic confirmation of species
identification
We successfully determined the sex for 51% of the casques
included in the genetic analysis (n=85) using either CHD 1
or CHD W/Z primers (Fig. 4; Table 3). We were able to
identify the sex for 100% of the casques for which we had
skin samples. No DNA was amplified in the negative con-
trols.
Sex identification using visual cues
The sex was determined for all heads and beaked casques
(n=149) using visual inspection of skin colour and black
beak markings. No genetically confirmed males had these
black markings. Sex determination based on beak markings
and gular skin matched the molecular sex identification with
100% accuracy. Non-beaked casques (adults n=15, juve-
niles n=1) were not included in this analysis as neither
visual cue was present.
Sex identification using morphometrics
Of the casques where the sex was confirmed by visual cues
and/or genetic methods, casques from males were signifi-
cantly larger than from females for all measurements
Figure 4 Electrophoresis gels of DNA amplified from the CHD genes from one male and one female Rhinoplax vigil casque (a). Control (PC)
male and female heads were also run (b). Primers used included CHD1F/R (*Lee et al., 2010), CHDW F/R and CHDZ F/R (**new, in this
study). NC =negative control, ladder =100 bp.
6Animal Conservation  (2022) – ª2022 Zoological Society of London.
Sex ratios of seized helmeted hornbill casques C. E. R. Hatten et al.
14691795, 0, Downloaded from https://zslpublications.onlinelibrary.wiley.com/doi/10.1111/acv.12838 by City University Of Hong Kong, Wiley Online Library on [30/11/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

(P<0.01) for both adults and juveniles (total n=25,
Fig. 5). Within casque types, beaked male casques were sig-
nificantly heavier than females (P<0.01) and adult casques
were significantly heavier than juvenile (Table 2,P<0.01).
Male heads were significantly heavier than female
(P<0.01), and there were no juvenile heads. There was no
significant difference between male and female weights for
adult non-beaked casques (P>0.05). There was only one
juvenile non-beaked casque and it was lighter than the adult
casques (Table 2).
In the LDA, 88.14% of females (n=52) and 90.12% of
males (n=73) were correctly classified based on the
genetic/visual sex identification (total n=140), with seven
females and eight males misclassified. The 10-fold repeated
cross-validation evaluated the model performance with high
accuracy =0.89, and Kappa =0.78 with an overall success
rate of 89.29%. Of the adult casques with unknown sex (to-
tal n=38), 63.16% were predicted as females (n=24) and
36.84% as males (n=14) according to the model. For juve-
nile casques, 87.50% of females (n=7) and 94.12% of
males (n=16) were correctly classified by the LDA based
on the genetic/visual sex identification (total n=25), with
one male and one female misclassified. The 10-fold repeated
cross-validation evaluated the model performance with high
accuracy =0.90, and Kappa =0.73, with an overall success
rate of 92.00%. Of the juvenile casques with unknown sex
(total n=6), 66.66% were predicted as females (n=4) and
33.33% as males (n=2) according to the model. Measure-
ments B (from the top of the casque to the bottom of the
beak) and D (the casque width between ridges) had the
Table 3 Sex ratios of Rhinoplax vigil specimens (n=209, heads, beaked and non-beaked casques) seized in the years 2012, 2013 and 2016
by the AFCD, Hong Kong
Seizure ID A
M:F
(M, F %)
Heads
(n)
Beaked
(n)
Non-beaked
(n)J
M:F
(M, F %)
Beaked
(n)
Non-beaked
(n)
Total
(n)
HK-2012-A 22:32 0 3 51 3:4 0 7 61
HK-2012-B 0:2 0 2 0 2:0 0 0 2
HK-2012-C 15:13 0 26 2 11:8 19 0 47
HK-2013-A 13:15 22 6 0 0:0 0 0 28
HK-2013-B 39:11 0 50 0 3:0 3 0 53
HK-2016-A 3:5 0 8 0 0 0 0 8
HK-2016-B 5:3 0 8 0 2:0 2 0 10
Sex ratio (n=209) 97:81 (55, 45%) 22 103 53 19:12 (61, 38%) 24 7 209
Total genetic sex
ratio (n=85)
42:36 (54, 46%) 22 41 15 7:0 (100, 0%) 6 1 85
Overall sex ratio 116:93 (56, 44%)
M=male, F =female, A
M:F
=adult sex ratio, J
M:F
=juvenile sex ratio.
Figure 5 Measurements for adult (n=140) and juvenile (n=25) male and female Rhinoplax vigil specimens with sex determined by
genetic/visual methods. Measurement A: top of casque to join at top of the beak (mm), B: top of casque to bottom of the beak (mm), C:
width of beak/casque join (mm), D: width between ridges (taken underneath ridge) (mm). ***Significant to P<0.01.
Animal Conservation  (2022) – ª2022 Zoological Society of London. 7
C. E. R. Hatten et al. Sex ratios of seized helmeted hornbill casques
14691795, 0, Downloaded from https://zslpublications.onlinelibrary.wiley.com/doi/10.1111/acv.12838 by City University Of Hong Kong, Wiley Online Library on [30/11/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

highest relative importance based on the magnitude of the
coefficients for the adult LDA (linear discriminant coeffi-
cients B: 1.517, D: 0.184), and B and C (the width of beak–
casque join) for the juvenile LDA (B: 0.899, C: 0.432).
These variables were therefore used to plot data for both
adults and juveniles (Fig. 6).
Age ratio
All seizures contained casques from adults and juveniles. Of
the 209 casques, 31 were identified as juveniles and 178 as
adults. Across casque types, adult casques were heavier than
juveniles (Table 2). We determined an overlap in weight
between adults and juveniles for beaked casques of 23.7 g
(40.10–63.80 g) but no overlap was observed for non-beaked
casques.
Sex ratio
For 165 casques, we were able to determine the sex based
on genetics/visual identification. For the 44 casques for
which we could not determine the sex using either of these
techniques, the sex was assigned based on LDA model pre-
dictions. We calculated the total male:female sex ratio for
all 209 casques across all seizures, including adults and
juveniles, to be 116:93 (M 56%, F 44%; Table 3).
Figure 6 Biplots showing (a) adult (n=178) and (b) juvenile (n=31) Rhinoplax vigil casques with known and unknown sex. “Sex”: points
show sex determined via genetics/visual identifications (female/male) and those that were not (unknown) prior to the model. “Predicted
sex”: ellipses show sex predicted by linear discriminant analysis modelling. (a) Is created using transformed measurements B (the top of
casque to the bottom of the beak), and D (and the casque width between ridges, taken underneath the ridge), and (b) with B and C (the
width of beaks–casque join), as variables with the highest relative importance in the adult and juvenile models, respectively.
8Animal Conservation  (2022) – ª2022 Zoological Society of London.
Sex ratios of seized helmeted hornbill casques C. E. R. Hatten et al.
14691795, 0, Downloaded from https://zslpublications.onlinelibrary.wiley.com/doi/10.1111/acv.12838 by City University Of Hong Kong, Wiley Online Library on [30/11/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

However, this observed sex ratio was not significantly dif-
ferent from the expected sex ratio of natural populations
(chi-square goodness of fit test: v
2
=2.53, d.f. =1,
P=0.1).
Across time, we observed 37 males and 47 females seized
in 2012 (total n=84, three seizures), 52 males and 26
females seized in 2013 (total n=78, two seizures) and eight
males and eight females seized in 2016 (total n=16, two
seizures). There were no significant changes in the number
of males (linear regression: R
2
=0.70, P=0.37) or females
(linear regression: R
2
=0.90, P=0.21) observed over time.
Discussion
We determined the sex ratio of traded R. vigil individuals
using visual, genetic and morphometric analyses to determine
the sex of seized casques. We found that both males and
females are targeted for trade, with a higher proportion of
male casques in the seizures we examined (although this sex
ratio was not significantly different from the expectation of a
1:1 sex ratio). A similar study of two Indonesian seizures in
Jakarta (2013) and Kalimantan (2016) using different mor-
phological measurements (Hadiprakarsa, unpublished data)
found an estimated male: female ratio of 201:130. This sex
ratio is significantly different (v
2
=15.23, d.f. =1,
P<0.001) from the assumed sex ratio of 1:1. Together these
results suggest that hunting may be skewed towards males in
this species, perhaps because males are active year-round,
whereas females spend up to half of the year in the nest dur-
ing the breeding season.
Sex identification
In live birds, male and female helmeted hornbills can be dif-
ferentiated based on visual observation –particularly by the
colour of the skin on their gular patches and the presence/ab-
sence of black markings near the tip of their beaks. If the
genetic analysis is possible and beaks are present on the
casque, the combination of visual and genetic techniques
can provide a two-step process to better identify the sex from
R. vigil casques than using measurements alone. However, as
the casques are usually detached from the skulls and the beaks
are often removed for trade, it is not always possible to use
these visual clues to identify the sex from which the casque
came. Here we show that in those cases, the sex of the casque
can be identified using casque measurements in combination
with genetic methods.
Morphometric measurements are widely used to determine
sex. Common measurements to determine the sex of birds
include weight, beak depth, beak length, wing and tail
lengths (Amat, Vi~
nuela, & Ferrer, 1993; Copello, Quintana,
& Somoza, 2006; Ferrer et al., 2016). Hornbill casques and
bills are thought to exhibit sexual dimorphism, possibly due
to sexual selection (Kinnaird & O’Brien, 2007). Our results
show that a combination of casque measurements can be
used to determine the sex with a high degree of accuracy (as
confirmed by genetic analyses). We found that casques from
males were larger and heavier than those from females in all
casque types apart from non-beaked adults, where the
females were heavier on average. Although females can be
larger in some sexually dimorphic birds, for example raptors
(Paton, Messina, & Griffin, 1994) and waders (Blomqvist
et al., 1997), this is not the case in hornbills (Kemp, 2001).
The overlap of the measurements between male and female
casques documented here suggests only slight differences in
size between male and female casques, so there may be
some errors when determining the sex based on morphomet-
ric measurements alone. We therefore propose that where
possible, sex determination should combine morphological
and genetic methods.
Potential impacts on populations
Across the six seizures, we found the observed sex ratio to
be slightly skewed towards males, although this was not sig-
nificantly different from a 1:1 sex ratio based on a chi-
squared test. If the sex ratio observed in this study represents
the true ratio of males and females being removed from the
wild, then the loss of reproductive males from the population
could impact species viability and potential for population
recovery. Harvesting skewed towards adult males is common
among targeted wildlife (Corlatti et al., 2019) and can reduce
the number of sexually mature males in the population, lead-
ing to declines in population fecundity (McLoughlin, Taylor,
& Messier, 2005). Population vulnerability from male-
selective hunting is thought to be more extreme in monoga-
mous species than in species with other mating systems
(Caro et al., 2009), with severe delays in female breeding
observed in hunted populations (Parker, Rosell, & Mys-
terud, 2007). In monogamous systems, fertilisations are lim-
ited equally by both sexes. This means that these systems
are at a greater risk of demographic imbalance from hunting
pressure and that the selective removal of even a few adult
males could negatively impact population growth more than
removing individuals randomly (Greene et al., 1998). As a
monogamous species of hornbill, removing R. vigil males
could delay birth timing and mate availability. The breeding
behaviour of helmeted hornbills compounds the potential
impact of removing males from the population. The female
can spend up to 6 months sealed into a nest with the chick,
during which time she undergoes a complete body moult, so
that for an extended period, both the female and the chick
are completely dependent on the male for survival. Remov-
ing males may therefore also lead to the loss of females and
chicks, further increasing species vulnerability. As fledged
juveniles remain close to their parents for a prolonged time
(Kaur et al., 2019), removing males may disrupt learned
responses such as foraging and navigating, as seen with
other animals (Allen et al., 2020). Further life history data
are urgently needed to help model the impacts of hunting on
population viability. Although the sex ratio of large hornbills
in the wild has been estimated as 1:1 (e.g. Pawar
et al., 2020), data from helmeted hornbills are not available,
so it is possible that our results reflect a naturally skewed
sex ratio. Given the natural history of this species and data
on other large monogamous hornbill species, we think it is
Animal Conservation  (2022) – ª2022 Zoological Society of London. 9
C. E. R. Hatten et al. Sex ratios of seized helmeted hornbill casques
14691795, 0, Downloaded from https://zslpublications.onlinelibrary.wiley.com/doi/10.1111/acv.12838 by City University Of Hong Kong, Wiley Online Library on [30/11/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

likely that the natural sex ratio of this species is 1:1, how-
ever, more data are needed to confirm this.
Targeted body parts of many hunted species are often sex-
ually dimorphic (Coltman et al., 2003). Despite casques from
females being slightly smaller, female casques were com-
monly observed in seizures, suggesting that both males and
females are targeted for trade. On the market, prices for cas-
que products are high regardless of size or dimensions, sug-
gesting that casques from both adult males and females are
valuable in the trade (Phassaraudomsak et al., 2019). This
pattern can be seen in other traded wildlife, such as rhinos
(Peppin et al., 2010) and pangolins (Wang, Turvey, &
Leader-Williams, 2020; Blecher, Ganswindt, &
Scheun, 2021), which exhibit low sexual dimorphism in their
targeted body parts. It is therefore unlikely that hunting is
driven solely by the sex of individuals, as shown in other
species (Mondol, Mailand, & Wasser, 2014). Either foraging
or feeding their dependents, adult males are more likely to
be observed in nature than females or juveniles due to the
long nesting season when females and juveniles are sealed
into their nests (Pawar et al., 2020). However, hunters have
been observed to target nests and/or fruiting trees, where
R. vigil females and fledged juveniles are found (Hadipra-
karsa et al., 2013; Miller et al., 2019), as with other traded
birds (Wright et al., 2001; Andersson et al., 2021). We spec-
ulate that if the seized sex ratio observed in this study
reflects hunting effort, then our results are due to a combina-
tion of hunter and bird behaviour that all individuals of
R. vigil are likely targeted by hunters, but that the behaviour
of the males may be causing them to be hunted more fre-
quently. It is important to note, however, that the number
and sex ratio of the birds seized may not necessarily reflect
those killed. Seizures also reflect enforcement efforts and
awareness (Burgess, Stoner, & Foley, 2014), and shipments
are sometimes combined from various locations before enter-
ing the destination countries (ADMCF, 2019). Therefore, the
numbers of R. vigil removed from the wild for trade pur-
poses are likely higher than recorded through trade statistics.
Conservation implications
Hunting pressure on long-lived species is often not sustain-
able (Fa & Brown, 2009), especially for endangered species.
Our results combined with those of the unpublished Indone-
sian study suggest that males are more commonly targeted
for trade. The removal of more males than females could
have a negative impact on the viability of this species by
decreasing the numbers of breeding males, causing breeding
delays and leading to the death of dependent females and
chicks during the breeding season. Due to the unique horn-
bill breeding system, the removal of a male from a popula-
tion could also lead to the death of the female and the
chick, as both are reliant on the male to provide food while
they are in the nest. Thus, the removal of more males from
the population does not necessarily mean that the sex ratio
in the wild populations is becoming more skewed but high-
lights that seizure data alone may underestimate the number
of individuals impacted by hunting and therefore the impact
of hunting on the population numbers and potential for
recovery.
Ultimately, as a critically endangered species, any hunting
pressure is likely to be unsustainable and damaging to
R. vigil population recovery and information on the methods
and outcomes of hunting will help to estimate these impacts.
Efforts to reduce the illegal hunting of this species are
urgently needed to reduce long-term population impacts.
Local community conservation-based strategies can provide
effective alternatives to help tackle illegal hunting for wild-
life trade (Roe & Booker, 2019) and have already success-
fully reduced illegal hunting of R. vigil across the species’
range (e.g. Novick et al., in review, 2022; Yeap et al., 2016;
Jain et al., 2018a). The collection of additional natural his-
tory data, such as data on natural sex ratios and population
density, for this species, will also help to better understand
the impacts of hunting on population processes. If population
density is much below the carrying capacity, and individuals
are taken from the population faster than new individuals
can be recruited into the population, then any significant
hunting is no longer sustainable (Robinson & Redford, 1994;
Conover, 2001), and population recovery will be significantly
impacted.
Future work
Conservation efforts for this species are hampered by the
lack of natural history and demographic information on this
species. The IUCN HHWG action plan calls for the collec-
tion of such data, and ongoing efforts across the range of
this species are collecting data on breeding behaviour, pop-
ulation density and other demographic traits. Work is
underway to develop a map of genetic variation across the
range of this species which will help determine the geo-
graphic origin of seized individuals (Jain et al., 2018b).
Paired with knowledge of the sex ratio of individuals
removed from the population through trade, as well as the
origin of the casques, population viability analyses could be
conducted to further model the impacts of hunting on this
species.
Authors’ contributions
CERH, YH and CD conceived the study; CERH and CD
designed the study, CERH and HBT collected the data,
CERH and CD analysed the data. All authors contributed to
the writing and revision of the manuscript. All authors
approved the final version of the manuscript for submission.
Acknowledgements
We acknowledge the Agriculture, Fisheries and Conservation
Department of the Hong Kong SAR government for provid-
ing R. vigil specimens for genetic and morphological analy-
sis. Thanks also to collaborators under the IUCN SSC
Helmeted Hornbill Working Group for imparting species
expertise and providing thought-provoking discussions on the
subject.
10 Animal Conservation  (2022) – ª2022 Zoological Society of London.
Sex ratios of seized helmeted hornbill casques C. E. R. Hatten et al.
14691795, 0, Downloaded from https://zslpublications.onlinelibrary.wiley.com/doi/10.1111/acv.12838 by City University Of Hong Kong, Wiley Online Library on [30/11/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

Funding
This work was supported by the Conservation Forensic Lab-
oratory at the University of Hong Kong (HKU) and funded
by the Ocean Park Conservation Foundation (grant no.
BD02.1819).
References
ADM Capital Foundation (ADMCF). (2019). Trading in
extinction: the dark side of Hong Kong’s wildlife trade.
Hong Kong: ADM Capital Foundation (ADMCF).
Allen, C.R., Brent, L.J., Motsentwa, T., Weiss, M.N. & Croft,
D.P. (2020). Importance of old bulls: leaders and followers
in collective movements of all-male groups in African
savannah elephants (Loxodonta africana). Sci. Rep. 10,1–9.
https://doi.org/10.1038/s41598-020-70682-y.
Amat, J.A., Vi~
nuela, J. & Ferrer, M. (1993). Sexing chinstrap
penguins (Pygoscelis Antarctica) by morphological
measurements. Col. Waterbirds 16, 213–215. https://doi.org/
10.2307/1521441.
Andersson, A.A., Gibson, L., Baker, D.M., Cybulski, J.D.,
Wang, S., Leung, B., Chu, L.M. & Dingle, C. (2021).
Stable isotope analysis as a tool to detect illegal trade in
critically endangered cockatoos. Anim. Conserv. 24, 1021–
1031. https://doi.org/10.1111/acv.12705.
Beastall, C., Shepherd, C.R., Hadiprakarsa, Y. & Martyr, D.
(2016). Trade in the helmeted hornbill Rhinoplax vigil: the
‘ivory hornbill’.Bird Conserv. Int. 26, 137–146. https://doi.
org/10.1017/S0959270916000010.
Bengtsson, C.F., Olsen, M.E., Brandt, L.Ø., Bertelsen, M.F.,
Willerslev, E., Tobin, D.J., Wilson, A.S. & Gilbert, M.T.P.
(2012). DNA from keratinous tissue. Part I: hair and nail.
Ann. Anat. 194(1), 17–25. https://doi.org/10.1016/j.aanat.
2011.03.013.
BirdLife International. (2020). Rhinoplax vigil.The IUCN red
list of threatened species 2020. e.T22682464A184587039.
https://doi.org/10.2305/IUCN.UK.2020-3.RLTS.
T22682464A184587039.en (accessed 22 June 2022).
Blecher, A.S., Ganswindt, A. & Scheun, J. (2021). Scales of
our lives: sex identification of Temminck’s pangolin
(Smutsia temminckii) using scales retrieved out of the illegal
wildlife trade. Gen. Comp. Endocrinol. 308, 113782. https://
doi.org/10.1016/j.ygcen.2021.113782.
Blomqvist, D., Johansson, O.C., Unger, U., Larsson, M. &
Flodin, L.
A. (1997). Male aerial display and reversed sexual
size dimorphism in the dunlin. Anim. Behav. 54, 1291–
1299. https://doi.org/10.1006/anbe.1997.0532.
Borgerson, C. (2015). The effects of illegal hunting and habitat
on two sympatric endangered primates. Int. J. Primatol. 36,
74–93. https://doi.org/10.1007/s10764-015-9812-x.
Branch, T.A., Lobo, A.S. & Purcell, S.W. (2013).
Opportunistic exploitation: an overlooked pathway to
extinction. Trends Ecol. Evol. 28, 409–413. https://doi.org/
10.1016/j.tree.2013.03.003.
Burgess, E.A., Stoner, S.S. & Foley, K.E. (2014). Brought to
bear: an analysis of seizures across Asia (2000–2011).
TRAFFIC, Petaling Jaya, Selangor, Malaysia. https://www.
traffic.org/site/assets/files/2552/brought_to_bear_report.pdf
(accessed 22 June 2022).
C
ßakmak, E., Akın Peks
ßen, C
ß. & Bilgin, C.C. (2017).
Comparison of three different primer sets for sexing birds.
J. Vet. Diagn. Invest. 29,59–63. https://doi.org/10.1177/
1040638716675197.
Caro, T.M., Young, C.R., Cauldwell, A.E. & Brown, D.D.E.
(2009). Animal breeding systems and big game hunting:
models and application. Biol. Conserv. 142, 909–929.
https://doi.org/10.1016/j.biocon.2008.12.018.
Charlesworth, B. (2009). Effective population size and patterns
of molecular evolution and variation. Nat. Rev. Genet. 10,
195–205. https://doi.org/10.1038/nrg2526.
Chiyo, P.I., Obanda, V. & Korir, D.K. (2015). Illegal tusk
harvest and the decline of tusk size in the African elephant.
Ecol. Evol. 5, 5216–5229. https://doi.org/10.1002/ece3.1769.
Christensen, T.K. & Fox, A.D. (2014). Changes in age and
sex ratios amongst samples of hunter-shot wings from
common duck species in Denmark 1982–2010. Eur. J.
Wildlf. Res. 60, 303–312. https://doi.org/10.1007/s10344-
013-0787-7.
Cohen, J. (1960). A coefficient of agreement for nominal
scales. Educ. Psychol. Meas. 20,37–46. https://doi.org/10.
1177/001316446002000104.
Coltman, D.W., O’Donoghue, P., Jorgenson, J.T., Hogg, J.T.,
Strobeck, C. & Festa-Bianchet, M. (2003). Undesirable
evolutionary consequences of trophy hunting. Nature 426,
655–658. https://doi.org/10.1038/nature02177.
Conover, M.R. (2001). Effect of hunting and trapping on
wildlife damage. Wildl. Soc. Bull. 29, 521–532. https://doi.
org/10.2307/3784176.
Copello, S., Quintana, F. & Somoza, G. (2006). Sex
determination and sexual size-dimorphism in southern
Giant-petrels (Macronectes giganteus) from Patagonia,
Argentina. Emu 106, 141–146. https://doi.org/10.1071/
MU05033.
Corlatti, L., Sanz-Aguilar, A., Tavecchia, G., Gugiatti, A. &
Pedrotti, L. (2019). Unravelling the sex-and age-specific
impact of poaching mortality with multievent modeling.
Front. Zool. 16,1–8. https://doi.org/10.1186/s12983-019-
0321-1.
Dechaume-Moncharmont, F.X., Monceau, K. & Cezilly, F.
(2011). Sexing birds using discriminant function analysis: a
critical appraisal. Auk 128,78–86. https://doi.org/10.1525/
auk.2011.10129.
Downing, R.L. (1981). Deer harvest sex ratios: a symptom, a
prescription, or what? Wildl. Soc. Bull. 9,8–13 https://www.
jstor.org/stable/3782011.
Environmental Investigation Agency (EIA). (2017). Mapping
seizures to aid conservation of imperilled helmeted hornbill.
https://eia-international.org/press-releases/mapping-seizures-
aid-imperilled-helmeted-hornbill/ (accessed 22 June 2022).
Animal Conservation  (2022) – ª2022 Zoological Society of London. 11
C. E. R. Hatten et al. Sex ratios of seized helmeted hornbill casques
14691795, 0, Downloaded from https://zslpublications.onlinelibrary.wiley.com/doi/10.1111/acv.12838 by City University Of Hong Kong, Wiley Online Library on [30/11/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

Ewart, K.M., Lightson, A.L., Sitam, F.T., Rovie-Ryan, J.J.,
Mather, N. & McEwing, R. (2020). Expediting the
sampling, decalcification, and forensic DNA analysis of
large elephant ivory seizures to aid investigations and
prosecutions. Forensic Sci. Int. Genet. 44, 102187. https://
doi.org/10.1016/j.fsiae.2021.100014.
Fa, J.E. & Brown, D. (2009). Impacts of hunting on mammals
in African tropical moist forests: a review and synthesis.
Mammal Rev. 39, 231–264. https://doi.org/10.1111/j.1365-
2907.2009.00149.x.
Ferrer, M., Morandini, V., Perry, L. & Bechard, M. (2016).
Sex determination by morphological measurements of black-
browed albatrosses (Thalassarche melanophrys) using
discriminant analysis. Waterbirds 39, 295–299. https://doi.
org/10.1675/063.039.0309.
Festa-Bianchet, M. & Mysterud, A. (2018). Hunting and
evolution: theory, evidence, and unknowns. J. Mammal. 99,
1281–1292. https://doi.org/10.1093/jmammal/gyy138.
Fitriana, Y.S., Irham, M. & Sutrisno, H. (2020). A molecular
genetic approach for sex determination on helmeted hornbill
(Rhinoplax vigil) casque: a forensic casework. BIO Web.
Conf. 19, 000020. https://doi.org/10.1051/bioconf/
20201900020.
Frith, C.B. & Douglas, V.E. (1978). Notes on ten Asian
hornbill species (Aves: Bucerotidae) with particular
reference to growth and behaviour. Nat. Hist. Bull. Siam
Soc. 27,35–82.
Ginsberg, J.R. & Milner-Gulland, E.J. (1994). Sex-biased
harvesting and population dynamics in ungulates:
implications for conservation and sustainable use. Conserv.
Biol. 8, 157–166. https://www.jstor.org/stable/2386730.
Giroux, J.F. & B
edard, J. (1986). Sex-specific hunting
mortality of greater snow geese along firing lines in
Quebec. J. Wildl. Mgmt. 50, 416–419. https://doi.org/10.
2307/3801097.
Grayson, K.L., Mitchell, N.J., Monks, J.M., Keall, S.N.,
Wilson, J.N. & Nelson, N.J. (2014). Sex ratio bias and
extinction risk in an isolated population of tuatara
(Sphenodon punctatus). PLoS One 9, e94214. https://doi.org/
10.1371/journal.pone.0094214.
Greene, C., Umbanhowar, J., Mangel, M. & Caro, T. (1998).
Animal breeding systems, hunter selectivity and
consumptive use in wildlife conservation. In Behavioural
ecology and conservation biology: 271–305. Caro, T. (Ed.),
Oxford: Oxford University Press.
Griffiths, R., Daan, S. & Dijkstra, C. (1996). Sex identification in
birds using two CHD genes. Proc. R. Soc. London Ser. B Biol.
Sci. 263, 1251–1256. https://doi.org/10.1098/rspb.1996.0184.
Hadiprakarsa, Y.Y., Irawan, R. & Adhiasto, D. (2013). Project
report: a preliminary investigation on the status of helmeted
hornbill (Rhinoplax vigil) head trade in West Kalimantan,
Indonesia. Rangkong Indonesia. Presentation on the 6th
International Hornbill Conference, Manila - Philippines. The
6th International Hornbill Conference. Hornbill Indonesia,
Manila - Philippines.
Hadiprakarsa, Y.Y. & Kinnaird, M.F. (2004). Foraging
characteristics of an assemblage of four Sumatran hornbill
species. Bird Conserv. Int. 14(Suppl. 1), S53–S62. https://
doi.org/10.1017/S0959270905000225.
Hagen, C.A., Sedinger, J.E. & Braun, C.E. (2018). Estimating
sex-ratio, survival, and harvest susceptibility in greater sage-
grouse: making the most of hunter harvests. Wildl. Biol. 1,
1–7. https://doi.org/10.2981/wlb.00362.
Harris, R.B., Wall, W.A. & Allendorf, F.W. (2002). Genetic
consequences of hunting: what do we know and what
should we do? Wildl. Soc. Bull. 30, 634–643. https://doi.org/
10.2307/3784528.
Hatten, C.E.R., Fitriana, Y.S., Prigge, T-L., Irham, M.,
Sutrisno, H., Abinawanto & Dingle, C. (In review, 2022).
Validating DNA species identification of seized helmeted
hornbill (Rhinoplax vigil) casques.
Hayman, E.S., Fairgrieve, W.T. & Luckenbach, J.A. (2021).
Molecular and morphological sex differentiation in sablefish
(Anoplopoma fimbria), a marine teleost with XX/XY sex
determination. Gene 764, 145093. https://doi.org/10.1016/j.
gene.2020.145093.
Henry, L., Biquand, V., Craig, A.J. & Hausberger, M. (2015).
Sexing adult pale-winged starlings using morphometric and
discriminant function analysis. PLoS One 10, e0135628.
https://doi.org/10.1371/journal.pone.0135628.
Holmern, T., Mkama, S., Muya, J. & Roskaft, E. (2006).
Intraspecific prey choice of bushmeat hunters outside the
Serengeti National Park, Tanzania: a preliminary analysis.
Afr. Zool. 41,81–87. https://doi.org/10.1080/15627020.2006.
11407338.
Inkscape Project. (2020). Inkscape. https://inkscape.org.
Jain, A., Aik, Y.C., Miller, A., Kaur, R., Yong, D.L. &
Bidayabha, T. (2018a). Securing safe havens for the
helmeted hornbill Rhinoplax vigil.BirdingAsia 30,26–32.
Jain, A., Lee, J.G.H., Chao, N., Lees, C., Orenstein, R., Strange,
B.C., Chng, S.C.L., Marthy, W., Yeap, C.A. & Rao, M.
(2018b). Helmeted hornbill (Rhinoplax vigil): status review,
range-wide conservation strategy and action plan (2018–
2027). Singapore: IUCN SSC Hornbill Specialist Group.
https://doi.org/10.13140/RG.2.2.25467.16168.
James, G., Witten, D., Hastie, T. & Tibshirani, R. (2014). An
introduction to statistical learning: with applications in R.
New York: Springer.
Johnson, R.N. (2012). conservation genetics and wildlife
forensics of birds. In Wildlife forensics: methods and
applications: 293–325. Huffman, J.E. & Wallace, J.R.
(Eds.), West Sussex: John Wiley & Sons, Ltd. . https://doi.
org/10.1002/9781119953142.
Kane, R.E. (1981). Notes and new techniques. Gems. Gemol.
XVII 17,96–97.
Karmacharya, D., Sherchan, A.M., Dulal, S., Manandhar, P.,
Manandhar, S., Joshi, J., Bhattarai, S., Bhatta, T.R.,
Awasthi, N., Sharma, A.N., Bista, M., Silwal, N.R.,
Pokharel, P., Lamichhane, R.R., Sharma, N., Llewellyn, B.,
Wultsch, C., Kelly, M.J., Gour, D., Waits, L., Hero, J.M. &
12 Animal Conservation  (2022) – ª2022 Zoological Society of London.
Sex ratios of seized helmeted hornbill casques C. E. R. Hatten et al.
14691795, 0, Downloaded from https://zslpublications.onlinelibrary.wiley.com/doi/10.1111/acv.12838 by City University Of Hong Kong, Wiley Online Library on [30/11/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

Hughes, J. (2018). Species, sex and geo-location
identification of seized tiger (Panthera tigris tigris) parts in
Nepal - a molecular forensic approach. PLoS One 13,
e0201639. https://doi.org/10.1371/journal.pone.0201639.
Kaur, R., Singh, S., Ramli, R., Hassan, H., Majinun, A.,
Ancrenaz, M., Ratag, M., Rauf, H.A., Jamal, J., Rauf,
A.S.A., Yunus, M.D.M., Arbani, M.A., Asmar, K. & Amir,
M.A. (2019). Observations at a nest of helmeted hornbill
Rhinoplax vigil in Borneo, Malaysia. Forktail 34,68–73.
Kemp, A.C. (2001). Family Bucocerotidae (Hornbills). In
Handbook of the birds of the world: 436–487. del Hoyo, J.,
Elliott, A. & Sargatal, J. (Eds.), Vol. 6, Barcelona: Lynx
Edicions.
Kemp, A.C. & Woodcock, M. (1995). The hornbills:
Bucerotiformes, Vol. 1. New York: Oxford University Press.
Kinnaird, M.F. & O’Brien, T.G. (2007). The ecology and
conservation of Asian hornbills: farmers of the forest.
Chicago: University of Chicago Press.
Kinnaird, M.F., O’Brien, T.G. & Suryadi, S. (1996).
Population fluctuation in Sulawesi red-knobbed hornbills:
tracking figs in space and time. Auk 113 , 431–440. https://
doi.org/10.2307/4088909.
Ladoukakis, E.D. & Zouros, E. (2017). Evolution and
inheritance of animal mitochondrial DNA: rules and
exceptions. J. Biol. Res. Thessaloniki 24,1–7. https://doi.
org/10.1186/s40709-017-0060-4.
Landis, J.R. & Koch, G.G. (1977). The measurement of
observer agreement for categorical data. Biometrics 33, 159–
174. https://doi.org/10.2307/2529310.
Lee, J.C.I., Tsai, L.C., Hwa, P.Y., Chan, C.L., Huang, A.,
Chin, S.C., Wang, L.C., Lin, J.T., Linacre, A. & Hsieh,
H.M. (2010). A novel strategy for avian species and gender
identification using the CHD gene. Mol. Cell. Probes 24,
27–31. https://doi.org/10.1016/j.mcp.2009.08.003.
Loveridge, A.J., Valeix, M., Chapron, G., Davidson, Z., Mtare,
G. & Macdonald, D.W. (2016). Conservation of large
predator populations: demographic and spatial responses of
African lions to the intensity of trophy hunting. Biol.
Conserv. 204, 247–254. https://doi.org/10.1016/j.biocon.
2016.10.024.
Manger Cats-Kuenen, C.S.W.M. (1961). Casque and bill of
Rhinoplax vigil (Forst.) in connection with the architecture
of the skull. Verh. Kon. Ned. Akad. Wet. Afd. Natuurkel. 53,
1–51.
Marealle, W.N., Fossøy, F., Holmern, T., Stokke, B.G. &
Røskaft, E. (2010). Does illegal hunting skew Serengeti
wildlife sex ratios? Wildl. Biol. 16, 419–429. https://doi.org/
10.2981/10-035.
Margareta, R. & Nugroho, E.K. (2013). The distribution and
population of wreathed hornbill (Aceros udulatus) in Mount
Ungaran Central Java. Int. J. Environ. Sci. Dev. 4(5), 492–
495. https://doi.org/10.7763/IJESD.2013.V4.401.
Martin, A. & Caro, T. (2013). Illegal hunting in the Katavi-
Rukwa ecosystem. Afr. J. Ecol. 51, 172–175. https://doi.org/
10.1111/aje.12000.
McLoughlin, P.D., Taylor, M.K. & Messier, F. (2005).
Conservation risks of male-selective harvest for mammals
with low reproductive potential. J. Wildl. Mgmt. 69, 1592–
1600 https://www.jstor.org/stable/3803518.
Miller, A.E., Rikardus, M., Sari, I.S., Sagita, N., Gary, D. &
Adirahmanta, S.N. (2019). Safeguarding a nest of the
critically endangered helmeted hornbill Rhinoplax vigil in
Kalimantan, Indonesia, with notes on the nesting behaviour.
BirdingAsia 32,24–29.
Mondol, S., Mailand, C.R. & Wasser, S.K. (2014). Male
biased sex ratio of poached elephants is negatively related
to poaching intensity over time. Conserv. Genet. 15, 1259–
1263. https://doi.org/10.1007/s10592-014-0603-2.
Mundy, N.I., Unitt, P. & Woodruff, D.S. (1997). Skin from
feet of museum specimens as a non-destructive source of
DNA for avian genotyping. Auk 114 , 126–129. https://doi.
org/10.2307/4089075.
Novick, B., Crouch, J., Ahmad, A., Rodiansyah, Muflihati,
Kartikawati, Sudaryanti Sagita, N. & Miller, A. E. (In
review, 2022). Understanding the impacts of a community-
led integrated landscape initiative in Indonesia.
Ogden, R., Dawnay, N. & McEwing, R. (2009). Wildlife
DNA forensics - bridging the gap between conservation
genetics and law enforcement. Endanger. Species Res. 9,
179–195. https://doi.org/10.3354/esr00144.
Ottvall, R. & Gunnarsson, G. (2007). Morphological and
molecular sex identification of redshanks Tringa totanus.
Bird Study 54, 127–129. https://doi.org/10.1080/
00063650709461464.
Ouitavon, K., McEwing, R., Penchart, K., Sri-aksorn, K. &
Chimchome, V. (2022). DNA recovery and analysis from
helmeted hornbill (Rhinoplax Vigil) casques and its potential
application in wildlife law enforcement. Forensic Sci. Int.
Anim. Environ. 2, 100037. https://doi.org/10.1016/j.fsiae.
2021.100037.
Parker, H., Rosell, F. & Mysterud, A. (2007). Harvesting of
males delays female breeding in a socially monogamous
mammal; the beaver. Biol. Lett. 3, 107–109. https://doi.org/
10.1098/rsbl.2006.0563.
Parson, W., Pegoraro, K., Niederst€
atter, H., F€
oger, M. &
Steinlechner, M. (2000). Species identification by means of
the cytochrome b gene. Int. J. Leg. Med. 114 ,23–28.
https://doi.org/10.1007/s004140000134.
Paton, P.W., Messina, F.J. & Griffin, C.R. (1994). A
phylogenetic approach to reversed size dimorphism in
diurnal raptors. Oikos 71, 492–498. https://doi.org/10.2307/
3545837.
Pawar, P.Y., Mudappa, D. & Raman, T.S. (2020). Hornbill
abundance and breeding incidence in relation to habitat
modification and fig fruit availability. Ibis 163, 473–485.
https://doi.org/10.1111/ibi.12895.
Peppin, L., McEwing, R., Ogden, R., Hermes, R., Harper, C.,
Guthrie, A. & Carvalho, G.R. (2010). Molecular sexing of
African rhinoceros. Conserv. Genet. 11, 1181–1184. https://
doi.org/10.1007/s10592-009-9912-2.
Animal Conservation  (2022) – ª2022 Zoological Society of London. 13
C. E. R. Hatten et al. Sex ratios of seized helmeted hornbill casques
14691795, 0, Downloaded from https://zslpublications.onlinelibrary.wiley.com/doi/10.1111/acv.12838 by City University Of Hong Kong, Wiley Online Library on [30/11/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License

P
erez-Espona, S., P
erez-Barber

ıa, F.J., Jiggins, C.D., Gordon, I.J.
& Pemberton, J.M. (2010). Variable extent of sex-biased
dispersal in a strongly polygynous mammal. Mol. Ecol. 19,
3101–3113. https://doi.org/10.1111/j.1365-294X.2010.04733.x.
Phassaraudomsak, M., Krishnasamy, K. & Chng, S. (2019).
Trading faces - online trade of helmeted and other hornbill
species on facebook in Thailand. Malaysia: TRAFFIC
Southeast Asia. https://doi.org/10.13140/RG.2.2.11118.15684.
Pitzer, S., Hull, J., Ernest, H.B. & Hull, A.C. (2008). Sex
determination of three raptor species using morphology and
molecular techniques. J. Field Ornith. 79,71–79. https://doi.
org/10.1111/j.1557-9263.2008.00147.x.
Poonswad, P. & Kemp, A. (Eds.). (1993). Manual to the
conservation of Asian hornbills. Bangkok: Hornbill Project.
Poonswad, P. & Tsuji, A. (1994). Ranges of males of the
great hornbill Buceros bicornis, Brown hornbill Ptilolaemus
tickelli, and wreathed hornbill Rhyticeros undulatus in Khao
Yai National Park, Thailand. Ibis 136,79–86. https://doi.org/
10.1111/j.1474-919X.1994.tb08133.x.
Quincey, D., Carle, G., Alunni, V. & Quatrehomme, G.
(2013). Difficulties of sex determination from forensic bone
degraded DNA: a comparison of three methods. Sci. Justice
53, 253–260. https://doi.org/10.1016/j.scijus.2013.04.003.
R Core Team. (2021). R: a language and environment for
statistical computing. Vienna, Austria: R Foundation for
Statistical Computing. https://www.R-project.org/.
Reimann, C., Filzmoser, P., Garrett, R.G. & Dutter, R. (2008).
Statistical data analysis explained: applied environmental
statistics with R. Chichester: Wiley.
Robinson, J.G. & Redford, K.H. (1994). Measuring the
sustainability of hunting in tropical forests. Oryx 28, 249–
256. https://doi.org/10.1017/S0030605300028647.
Roe, D. & Booker, F. (2019). Engaging local communities in
tackling illegal wildlife trade: a synthesis of approaches and
lessons for best practice. Conserv. Sci. Pract. 1, e26. https://
doi.org/10.1111/csp2.26.
Rosche, C., Schrieber, K., Lachmuth, S., Durka, W., Hirsch,
H., Wagner, V., Schleuning, M. & Hensen, I. (2018). Sex
ratio rather than population size affects genetic diversity in
Antennaria dioica.Plant Biol. 20, 789–796. https://doi.org/
10.1111/plb.12716.
TRAFFIC. (2020). Huge seizure of helmeted hornbill casques
and other wildlife parts in Indonesia. News article, 11th
November 2020.https://www.traffic.org/news/huge-seizure-
of-helmeted-hornbill-casques-and-other-wildlife-parts-in-
indonesia (accessed 20 July 2022).
Trail, P.W. (2021). Morphological analysis: a powerful tool in
wildlife forensic biology. Forensic Sci. Int. Anim. Environ.
1, 100025. https://doi.org/10.1016/j.fsiae.2021.100025.
Viseshakul, N., Charoennitikul, W., Kitamura, S., Kemp, A.,
Thong-Aree, S., Surapunpitak, Y., Poonswad, P. &
Ponglikitmongkol, M. (2011). A phylogeny of frugivorous
hornbills linked to the evolution of Indian plants within
Asian rainforests. J. Evol. Biol. 24, 1533–1545. https://doi.
org/10.1111/j.1420-9101.2011.02285.x.
Wang, Y., Turvey, S.T. & Leader-Williams, N. (2020).
Knowledge and attitudes about the use of pangolin scale
products in traditional Chinese medicine (TCM) within
China. People Nat. 2, 903–912. https://doi.org/10.1002/pan3.
10150.
Wedekind, C. (2002). Manipulating sex ratios for conservation:
short-term risks and long-term benefits. Anim. Conserv. 5,
13–20. https://doi.org/10.1017/S1367943002001026.
Wedekind, C. (2012). Managing population sex ratios in
conservation practice: how and why. In Topics in
conservation biology:81–96. Povilitis, T. (Ed.). London:
IntechOpen. https://doi.org/10.5772/37601.
Willoughby, J.R., Sundaram, M., Wijayawardena, B.K.,
Kimble, S.J., Ji, Y., Fernandez, N.B., Antonides, J.D.,
Lamb, M.C., Marra, N.J. & DeWoody, J.A. (2015). The
reduction of genetic diversity in threatened vertebrates and
new recommendations regarding IUCN conservation
rankings. Biol. Conserv. 191, 495–503. https://doi.org/10.
1016/j.biocon.2015.07.025.
Wright, T.F., Toft, C.A., Enkerlin-Hoeflich, E., Gonzalez-
Elizondo, J., Albornoz, M., Rodr
ıguez-Ferraro, A., Rojas-
Su
arez, F., Sanz, V., Trujillo, A., Beissinger, S.R.,
Berovides, A.V., G
alvez, A.X., Brice, A.T., Joyner, K.,
Eberhard, J., Gilardi, J., Koenig, S.E., Stoleson, S.,
Martuscelli, P., Meyers, J.M., Renton, K., Rodr
ıguez, A.M.,
Sosa-Asanza, A.C., Vilella, F.J. & Wiley, J.W. (2001). Nest
poaching in neotropical parrots. Conserv. Biol. 15, 710–720.
https://doi.org/10.1046/j.1523-1739.2001.015003710.x.
Yeap, C.A., Lim, K.C., Noramly, G., Carang, R., Carang, A.
& Pandak, M. (2016). The Malaysian nature society hornbill
conservation project. Malayan Nature J. 68, 149–159.
14 Animal Conservation  (2022) – ª2022 Zoological Society of London.
Sex ratios of seized helmeted hornbill casques C. E. R. Hatten et al.
14691795, 0, Downloaded from https://zslpublications.onlinelibrary.wiley.com/doi/10.1111/acv.12838 by City University Of Hong Kong, Wiley Online Library on [30/11/2022]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License