Content uploaded by Parinda Barua
Author content
All content in this area was uploaded by Parinda Barua on Nov 28, 2022
Content may be subject to copyright.
Online Copy
Abstract
Aim:
Methodology:
Results:
Interpretation:
The study aims to standardize a Real-Time LAMP assay for effective, highly sensitive, and rapid detection of BBTV in North-east India.
Forty samples of banana showing BBTV like
symptoms were collected from Assam, India and subjected to
conventional PCR for confirmation. Six sets of BBTV LAMP primers
were designed and the PCR positive samples were subjected to Real-
Time LAMP assay for detection of BBTV. Finally, a sensitivity test of
BBTV LAMP assay and comparison of BBTV LAMP assay with
conventional PCR was done using seven 10-fold dilutions of total
genomic DNA of leaf samples with the highest dilution starting from
-1
100 ng µl .
Initially a total of twenty six out of forty banana samples were
tested positive for BBTV with conventional PCR method. The Real-
Time LAMP assay for BBTV detection resulted in typical sigmoidal
amplification curves with the peak values ranging between 8.00 to
o
12.15 min and annealing derivatives ranging between 83.3 C to
o
84.3 C in the tested samples. Sensitivity testing and comparison of
BBTV Real-Time LAMP assay with conventional PCR revealed that
-1
the BBTV LAMP assay could efficiently detect up to 0.0001ng µl of
-1
total DNA against 0.01ng µl in conventional PCR.
The findings highlight rapid, sensitive, accurate and
effective diagnosis of BBTV using Real-Time LAMP method. This
method can be preferred over conventional diagnostic techniques like
PCR or ELISA for rapid large scale detection of BBTV in banana plants
in North-east India.
Key words: Banana, Banana bunchy top virus, Rapid detection,
Real-Time LAMP assay
873-878
Vol. 432022
November
© Triveni Enterprises, Lucknow (India)
How to cite : Kaushik, D., M.H. Halabi, P. Barua and P.D. Nath: Real-Time loop-mediated isothermal amplification assay for rapid detection of Banana bunchy top
virus in North-east India. J. Environ. Biol., 43, 873-878 (2022).
Journal of Environmental Biology
p-ISSN: 0254-8704 • e-ISSN: 2394-0379 • CODEN: JEBIDP
Received: 22.06.2021 Revised: 21.10.2021 Accepted: 25.06.2022
1 1 1,2 1
D. Kaushik , M.H. Halabi , P. Barua * and P.D. Nath
1Department of Plant Pathology, Assam Agricultural University, Jorhat-785 013, India
2Regional Agricultural Research Station, Assam Agricultural University, Titabor-785 630, India
*Corresponding Author Email : *parindabarua@gmail.com https://orcid.org/0000-0001-8976-8822ORCiD:
Journal website : www.jeb.co.in « E-mail : editor@jeb.co.in
Journal of Environmental Biology
Triveni EnterprisesTriveni Enterprises
(Educational Services Set-up)(Educational Services Set-up)
JEBJEB
®®
DOI : http://doi.org/10.22438/jeb/43/6/MRN-2043
Original Research
Real-Time loop-mediated isothermal
amplification assay for rapid detection of Banana
bunchy top virus in North-east India
Field survey and collection of banana leaf samples
showing BBTV or virus-like symptoms
Initial detection by conventional PCR using BBTV specific primers
BBTV positive samples from PCR analysis
Design and standardization of six set of LAMP primers
Rapid detection of BBTV by Real-Time LAMP
Sensitivity comparison of BBTV Real-Time LAMP with conventional PCR
The results of this study highlight the rapid, sensitive, accurate
and effective diagnosis of BBTV in
North-east India using Real-Time LAMP method.
Online Copy
¨Journal of Environmental Biology, November 2022¨
samples, it is comparatively less sensitive than PCR (Su et al.,
2003). Conventional PCR for BBTV generally requires high
quality DNA that is free off polyphenols, polysaccharides, and
endogenous nucleases. It is difficult to achieve as banana leaves
contain a high quantity of polysaccharides, polyphenols, and
secondary metabolites like alkaloids, flavonoids, phenols, and
terpenes (Das et al., 2009; Shankar et al., 2011). The quantification
of BBTV through real-time PCR using SYBR green has been
reported (Fu et al., 2009; Watanabe and Bressan, 2013). In recent
years, sensitive quantification assays using TaqMan probes in real-
time PCR (TaqMan PCR) have been developed and used
successfully to detect BBTV (Chen and Hu, 2013).
Loop-mediated isothermal amplification (LAMP) is a
molecular detection technique developed in the year 2000
(Notomi et al., 2000). During LAMP, the reaction can be
performed in a single tube maintaining an isothermal condition at
60-65 °C for less than 30 min in a LAMP machine (OptiGene, UK)
and the amplification is measured on real-time basis. For the
LAMP reaction, four sets of specially designed primers are
required which recognizes six distinct sequences on the target
gene. Moreover, the addition of loop primers is known to
accelerate this LAMP reaction (Notomi et al., 2000; Nagamine et
al., 2002). Compared to PCR, it is less affected by inhibitors and
hence, widely used now days for detecting of plant pathogens
(Kaneko et al., 2007). Peng et al. (2012) reported that the
-1
detection limit of LAMP assay was approximately 1 pg μl DNA
and is about 100-fold more sensitive than PCR. Hence, LAMP can
be considered as an efficient alternative to conventional PCR.
The objective of the present study is rapid detection of BBTV from
North East India using Real Time LAMP method. The study also
aims to evaluate the sensitivity of Real Time LAMP over
conventional PCR so as to use LAMP as an effective alternative to
conventional detection methods like ELISA or PCR for the rapid
and highly sensitive detection of BBTV in banana.
Materials and Methods
Virus source and sample collection: Banana fields in the
Jorhat district of Assam, India were surveyed for BBTV virus
infection during the growing season of 2019 and 2020. A total of
40 leaf samples of banana plants showing BBTV or virus-like
symptoms were collected from four different fields. The collected
samples were brought to the laboratory of Plant Virology,
Department of Plant Pathology, Assam Agricultural University and
o
stored at - 80 C for around a month until the time of detection.
Genomic DNA extraction and conventional PCR: The total
genomic DNA was extracted from the collected leaf samples of
banana plants by using a modified CTAB protocol (Cullings,
1992). The genomic DNA was also extracted from a mass
propagated virus-free plantlet of Grand Naine cultivar (AAA
genome) of banana which was taken as a healthy control for
further experiments. Total DNA was quantified using a NanoDrop
spectrophotometer (Eppendorf Biospectrophotometer) and the
-1
concentration of extracted DNA was adjusted to 100ng µl in
Introduction
Banana (Musa spp.), is a widely consumed fruit globally.
In India, banana and plantains are viewed as the fourth most
important fruit crop with annual production of 30 million tons
(FAOSTAT, 2018) and grown mostly by the small farmers with less
holding of land (Dash and Rai, 2016; Kaur et al., 2018). Banana
bunchy top disease (BBTD) caused by Banana bunchy top virus
(BBTV) belongs to genus Babuvirus, family Nanoviridae is
considered as a major threat to global banana and plantain
cultivation (Vetten et al., 2012). The virus is non-enveloped and
contains six components of circular ssDNA (DNA1-6) each
approximately 1 kb in size. Since it’s first report from Fiji in 1889
(Magee, 1927), the disease has been recorded in 33 countries
from Africa, Asia, Australia, and the South Pacific Islands (Dale,
1987, Diekmann and Putter, 1996, Ferreira et al., 1997; Amin et
al., 2008). Due to high destructive potential of disease, BBTV is
listed as one of the world’s 100 worst invasive diseases, and the
International Plant Protection Convention has include it as a
pathogen to be subjected to rigorous quarantine measures
(IPPC, 2010; Kumar et al., 2011). In India, BBTD is considered as
one of the most important viral disease of banana.
Selvarajan and Balasubramanian (2014) reported BBTD
outbreaks in Kodur, Andhra Pradesh and Jalgaon, Maharashtra,
India during 2007-2010 resulted in production loss of worth 50
million US dollars per annum. The North-east India comprising
eight states is a bio-diversity hot spot and possess diverse
germplasm of banana including both wild and cultivated. BBTD
is widely spread in the entire North-east India and possess a
grave risk to banana cultivation in the area. Banana plants
affected by BBTV show vein clearing, foliar chlorosis, and a
typical bunchy top-like appearance with stunted growth and
distorted bunches. It is transmitted by banana aphid
(Pentalonia nigronervosa) in a persistent, circulative, and non-
propagative manner (Kumar et al., 2015). It has been reported
that early infection of this virus can lead up to 100% of crop loss
(Dale, 1987) and so far, no reports of resistance have been
found in Musa spp. to BBTV. The management of BBTD is
solely dependent on the use of virus-free propagating
materials, using tissue culture-based techniques, rouging and
destruction of infected plants, insect vector management, and
implementation of quarantine barriers. Therefore, the
development of rapid and efficient detection is the need of the
hour for effective management of BBTD (Peng et al., 2012).
Some of the previously described molecular diagnostic
protocols for routine detection of BBTV are Enzyme-Linked
Immunosorbent Assay (ELISA) (Wu and Su, 1990; Thomas and
Dietzgen, 1991), Double Antibody Sandwich ELISA (DAS-ELISA)
(Wanitchakorn et al., 2000), Polymerase Chain Reaction (PCR)
(Manikckam et al., 2002; Su et al., 2003) and high- throughput
real-time PCR methods (Chen and Hu, 2013). Although ELISA
and PCR are the most common method used in diagnostics,
these methods are cumbersome and time consuming. Moreover,
ELISA although convenient for processing a large number of
874 D. Kaushik et al.: Rapid detection of Banana bunchy top virus by Real-Time LAMP assay
Online Copy
¨Journal of Environmental Biology, November 2022¨
D. Kaushik et al.: Rapid detection of Banana bunchy top virus by Real-Time LAMP assay 875
(OptiGene, UK) which included Geobacillus species DNA
polymerase, thermostable inorganic pyrophosphatase, optimized
buffer (containing MgCl , deoxynucleotide triphosphates, and
2
double-stranded DNA dye) and 5 μl of extracted DNA with a
-1
concentration of 100ng µl as a template. LAMP assay was
optimized at 65⁰C for 30 min on a real-time fluorometer Genie II
(Optigene, UK). The Genie II device allows creating an annealing
curve for confirmation of amplification specificity by additional
heating and cooling step from 98°C to 80°C (0.05°C/s) for 6 min
to allow re-annealing of amplified product.
Comparison of LAMP with conventional PCR: In order to
determine the sensitivity of Real-Time LAMP assay for BBTV and
to compare the results with conventional PCR, seven 10-fold
dilutions were made of total genomic DNA with the highest dilution
-1
starting from 100ng µl . DNA from a healthy Grand Naine plant
was used as a negative control. Both Real-Time LAMP assay and
a conventional PCR were carried out using these dilutions and the
results were compared.
Results and Discussion
Preliminary testing of forty samples by conventional PCR
showed that twenty-six were infected with BBTV. A consistent
band of 1075 bp was obtained with the BBTV primer (DNA-3) in all
the positive samples whereas no band was observed during
agarose gel electrophoresis in healthy Grand Naine plantlet
which was taken as negative control (Fig. 3 a). DNA extracted
from twenty-six BBTV positive samples and one healthy Grand
Naine plantlet as negative control were used for BBTV Real-Time
LAMP assay using primers designed under this study.
All the BBTV positive samples showed amplification
during Real-Time LAMP assay whereas no amplification was
observed in the case of healthy sample. It was observed that the
peak amplification time typically ranged between 8.00 to 12.15
o
min and the annealing derivatives ranged between 83.3 C to
o
84.3 C in all the tested samples. The loop-mediated isothermal
amplification (LAMP) assay, a nucleic acid-based detection
assay, can rapidly amplify the target DNA with high specificity
under isothermal conditions (Notomi et al., 2000). The LAMP
assay takes advantage of high strand displacement activity of
nuclease-free water and stored at -20 before testing. The forty
test samples along with one healthy sample were subjected to a
conventional PCR for confirmation using a set of standard primer
that amplifies a region of the coat protein in DNA3 of BBTV
genome (Kakati and Nath, 2018; Baldodiya et al., 2019). PCR
primers used were: BBTV-DNA3 forward primer ( 5’
ATCAAGAAGAGGCGGGTTGG 3’) and BBTV-DNA3 reverse
primer (5’ GGATTTCTTCGGA TACCTAGCCAT 3’). PCR was
carried out in a 10 µl reaction mixture containing 5 µl of
EmeraldAmp GT 2x PCR Master Mix, 0.5 µl each of forward and
reverse primer (10 pmol concentrations), 0.5 µl of 50ng of total
genomic DNA, and 3.5 µl of distil sterile water in Agilent
Technologies Sure Cycler 8800. The samples were initially
denatured at 94 °C for 2 min followed by 30 cycles of denaturation
at 94 °C for 30 sec, annealing for 30 sec at 53°C and synthesis at
72°C for 1 min, and final extension at 72°C for 5 minutes. The
PCR products were subjected to gel electrophoresis using 1.5%
agarose stained with ethidium bromide. The electrophoresis was
carried out and visualized under Bio-Rad Gel Doc TM EZ Imager.
Primer design for LAMP: The coat protein coding sequences of
ten BBTV isolates were obtained from GenBank and multiple
alignment analysis was performed using Clustal Omega EMBL-
EBI software (Chojnacki et al., 2017). The Gene Bank accession
numbers of the sequences used in the alignment were;
JN250599, MG825490, MF688998, KF246091, EU190967,
EU190966, EU190965, EU190968, AF246122, and DQ996466.
Based on the alignment, six sets of primers targeting a conserved
region of coat protein sequence were designed with the help of
primer design software, Primer Explorer V5 (Eiken Co., Ltd.,
Japan:http://primerexplorer.jp). LAMP assay was performed
using the following primers shown in Table 1, which includes
forward and reverse outer primers (F3_CP and B3_CP), forward
and reverse inner primers (FIP_CP and BIP_CP), and forward
and reverse loop primers (loop F_CP and loop B_CP).
Reaction mixtures and optimal condition for LAMP assays:
Real-Time LAMP was carried out on a Genei II instrument
(OptiGene, UK) in 25 µl reaction volume consisting of 5µl of
primer mix containing 20 pmol each of inner primers FIP and BIP,
5 pmol each of outer primers F3 and B3, 10 pmol each of loop
primers FLP and BLP; 15 μl of isothermal master mix ISO 0001
oC
Table 1: Primers for BBTV LAMP assays used under this study
Primer name Primer type Primer sequence (5′ – 3′) Length Position on
(bp) CP gene (bp)
F3_CP Forward outer CTACTGATAAAACATTACCCAGAT 24 146-169
B3_CP Reverse outer TC CCACTACATACCAGTT 19 329-347
FIP_CP (F1c + F2) Forward inner CTCTTGATCATAGCCCAATGAAGTATGGAAAA 48 F1c: 224 - 248
TGTTTATGCTTCTTGT F2: 178-200
BIP_CP(B1c +B2) Reverse inner TCTTGGGAAATCAACCAGCCGTAACCAGATG 42 B1c: 250-270
GCTATGTTCAG B2: 308-328
Loop F_CP Forward loop CGGGCTTCACCTTGCAC 17 72-88
Loop B_CP Reverse loop TCTGGAAGCCCCAGGTTTAT 20 149-168
Online Copy
¨Journal of Environmental Biology, November 2022¨
876 D. Kaushik et al.: Rapid detection of Banana bunchy top virus by Real-Time LAMP assay
certain polymerases allowing for isothermal amplification of
nucleic acids. A LAMP assay, therefore, allows for rapid detection
of infectious diseases without using complex equipment which
enables it to be used on-site (Fukuta et al., 2003; Hansen et al.,
2016). Selvarajan et al. (2015) developed a simple, rapid as well
as solvent-free nucleic acid extraction protocol for detecting of
BBTV by LAMP and well conventional PCR methods. Moreover,
as principle, LAMP does not require a thermal cycler. In LAMP, the
reactions can be performed using a heating block or a water bath
under isothermal conditions (Peng et al., 2012). However in the
present study, the use of OptiGene, UK kit helped in maintaining
stability in the preparation of reaction mixture for LAMP assay.
The use of a real-time fluorometer Genie II (Optigene,
UK) device allowed easy monitoring of amplification in real-time
using fluorescence. Another advantage of LAMP over other
detection methods is that in LAMP, the risk of cross-
contamination can be kept to a minimal level using closed-tube
detection system (Peng et al., 2012). During sensitivity testing of
Real-Time LAMP assay of BBTV and comparing it with
conventional PCR, it was observed that the BBTV LAMP assay
-1
could efficiently detect up to 0.0001ng µl of DNA. However, the
amplification time was found to increase progressively with
reducing quantity of sample. Whereas in the case of conventional
PCR, no bands were observed beyond 10-5 dilution, that is
-1
0.01ng µl of DNA as shown in Fig. 3 (b). Therefore, from these
results, it can be concluded that the Real-Time LAMP assay for
BBTV was at least a hundred times sensitive than conventional
PCR. Typical amplification curve of BBTV LAMP assay for the
tested samples along with negative control is shown in Fig. 1 (a)
and the amplification curves of seven 10-fold dilutions of total
genomic DNA during LAMP assay is shown in Fig. 1 (b).
The annealing derivatives and dissociation curves of
LAMP products of the tested samples and negative control as
well as the seven 10-fold dilutions are depicted in Fig 2 (a and
b). Similar work on BBTV LAMP was done by Peng et al. (2012)
-1
where they reported a detection limit of 1pg μl plasmid DNA
-1
through LAMP assay which was lower than 100pg μl plasmid
DNA for BBTV detected through PCR assay. This proves the
sensitivity of LAMP over PCR. In a recent study, Galvez et al.
(2020), reported the limit of detection for BBTV LAMP protocol
-1 -1
was 10pg µl whereas it was 100pg µl for its corresponding PCR
assay indicating higher levels of sensitivities of BBTV LAMP
assays compared to the corresponding PCR assays for detecting
of the virus. As LAMP is a sensitive method, hence using LAMP,
Fig. 1: Loop-mediated isothermal amplification curves showing BBTV detection on Real-Time basis. (a) Amplification of BBTV infected samples along
with negative control, (b) BBTV amplification of seven 10-fold dilutions of total genomic DNA starting from 100ng to 0.0001ng along with negative control.
Fig. 2: Annealing derivatives and dissociation curves of Real Time LAMP product showing BBTV detection (a) Annealing derivatives and dissociation
curves of BBTV infected samples along with negative control, (b) Annealing derivatives and dissociation curves of seven 10-fold dilutions starting from
100ng to 0.0001ng along with negative control.
40000
30000
20000
10000
0
-10000
60000
40000
20000
0
-20000
Fluorescence
Fluorescence
BBTV1
BBTV2
BBTV3
BBTV4
BBTV5
BBTV6
BBTV7
CONTROL
BBTV100ng
BBTV10ng
BBTV1ng
BBTV0.1ng
BBTV0.01ng
BBTV0.001ng
BBTV0.0001ng
CONTROL
Amplification Amplification
00:05:00 00:10:00 00:15:00 00:20:00 0 0:25:00 00:30:00 00:05:00 00:10:00 00:15:00 00:20:00 0 0:25:00 00:30:00
Time (hh:mm:ss) Time (hh:mm:ss)
AB
BBTV1
BBTV2
BBTV3
BBTV4
BBTV5
BBTV6
BBTV7
CONTROL
BBTV100ng
BBTV10ng
BBTV1ng
BBTV0.1ng
BBTV0.01ng
BBTV0.001ng
BBTV0.0001ng
CONTROL
20,000.00
15,000.00
10,000.00
5,000.00
0.00
-5,000.00
Anneal Derivative Anneal Derivative
Fluorescence derivative
Fluorescence derivative
14,000.00
12,000.00
10,000.00
8,000.00
6,000.00
4,000.00
2,000.00
0.00
-2,,000.00
79.00 84.00 89.00 94.00 79.00 84.00 89.00 94.00
o o
Temperature ( C) Temperature ( C)
AB
Online Copy
¨Journal of Environmental Biology, November 2022¨
D. Kaushik et al.: Rapid detection of Banana bunchy top virus by Real-Time LAMP assay 877
Conflict of interest: The authors declare that they have no
conflict of interest.
Data from other sources: Not applicable.
Consent to publish: All authors agree to publish in the Journal of
Environmental Biology.
References
Almasi, M., H. Jafary, A. Moradi, N. Zand, M.A. Ojaghkandi and S.
Aghaei: Detection of coat protein gene of the potato leafroll virus by
reverse transcription loop-mediated isothermal amplification. J.
Plant Pathol. Microbiol., 4, 2 (2013).
Amin, I., J. Qazi, S. Mansoor, M. Ilyas and R.W. Briddon: Molecular
characterisation of Banana bunchy top virus (BBTV) from
Pakistan. Virus Genes, 36, 191-198 (2008).
Baldodiya, G.M., G. Baruah, B.K. Borah, M.K. Modi and P.D. Nath:
Molecular characterization and sequence analyses of banana
bunchy top virus infecting banana cultivar Jahaji (Dwarf
Cavendish) in Assam, India. 3 Biotech., 9, 110 (2019).
Chen, Y. and X. Hu: High-throughput detection of banana bunchy top
virus in banana plants and aphids using real-time TaqMan® PCR.
J. Virol. Meth., 193, 177-183 (2013).
Chojnacki, S., A. Cowley, J. Lee, A. Foix and R. Lopez: Programmatic
access to bioinformatics tools from EMBL-EBI update. Nucleic
Acids Res., 45, 550-553 (2017).
Cullings, K.W.: Design and testing of a plant‐specific PCR primer for
ecological and evolutionary studies. Mol. Ecol., 1, 233-240 (1992).
Dale, J.L.: Banana bunchy top: An economically important tropical plant
virus disease. Advan. Virus Res., 33, 301-325 (1987).
Das, B.K., R.C. Jena and K.C. Samal: Optimization of DNA isolation and
PCR protocol for RAPD analysis of banana/ plantain (Musa spp.).
Int. J. Agric. Sci., 1, 21-25 (2009).
Dash, P.K. and R. Rai: Translating the “Banana genome” to delineate
stress resistance, dwarfing, parthenocarpy and mechanisms of
fruit ripening. Front. Plant Sci., 7, 15-43 (2016)
Ferreira S. A., E.E. Trujillo and D.Y. Ogata: Banana Bunchy Top Virus.
N.p.: College of Tropical Agriculture and Human Resources, N.
pag. University of Hawaii at Manoa (1997).
Food and Agriculture Organization of the United Nations: FAOSTAT
statistical database. Rome, Italy: FAO. Retrieved from
http://www.fao.org/faost at/en/#data/QC. Accessed July 07, 2020
(2018).
mild infections can also be detected effectively which might give
false negative during detection using conventional PCR methods.
Apart from BBTV, the LAMP technique is also being widely used
globally for rapid and sensitive detection of several plant viruses
like Odontoglossum Ring Spot Virus (ORSV) (Tsai et al., 2016),
Banana Bract Mosaic Virus (BBrMV) (Koh et al., 2020), Potato
Leaf Roll Virus (PLRV) (Almasi et al., 2013; Ju, 2011), Potato
Virus Y (PVY) (Tredar et al., 2018) etc. In this study, the Real-
Time LAMP method was standardized for detecting BBTV in
North-east India as it gives us cumulative advantages over
conventional diagnostic methods like ELISA or PCR. Apart from
being highly sensitive, this method has proven to be both time
as well as cost effective. Moreover, the closed tube detection
system of LAMP is highly suitable for general laboratories as it
minimizes the risks of cross contamination.
In conclusion, the results of the present study suggest
that the Real-Time LAMP method can be a preferred option for
rapid and sensitive detection of BBTV during disease monitoring
as well as during large-scale propagation of virus-free plantlets by
tissue culture techniques.
Acknowledgment
The authors would like to thank the Department of
Biotechnology, Government of India for providing funds to the
senior author.
Add-on Information
Authors’ contribution: D. Kaushik: Conceptualization, design,
material preparation, data collection as a part of PhD research;
M.H. Halabi: Standardization and design of LAMP assay; P.
Barua: Conceptualization, manuscript preparation and
proofreading; P.D. Nath: Major advisor and project PI to Dipshika
Kaushik, fund acquisition.
Research content: The research content is original and has not
been published elsewhere.
Ethical approval: Not applicable.
Fig. 3: Agarose gel electrophoresis photographs showing BBTV detection using PCR assay (a) Amplification of 7BBTV infected representative samples
along with negative control. Lane M: 100 bp DNA ladder (Takara); Lane B: Negative control or blank; Lane 1-7: Seven BBTV infected samples (b) BBTV
amplification of seven 10-fold dilutions starting from 100ng along with negative control. Lane M: 100 bp DNA ladder (Takara); Lane B: Negative control or
blank; Lane P: Positive control; Lane 1-7: Seven 10-fold serial dilutions of total genomic DNA at 100, 10, 1, 0.1 0.01. 0.001 and 0.0001 ng/µl.
M B 1 2 3 4 5 6 7 M M B P 1 2 3 4 5 6 7 M
1075 bp 1075 bp
1000 bp
1000 bp
AB
Online Copy
¨Journal of Environmental Biology, November 2022¨
878 D. Kaushik et al.: Rapid detection of Banana bunchy top virus by Real-Time LAMP assay
Fu, H.C., J.M. Hu, T.H. Hung, H.J. Su and H.H. Yeh: Unusual events
involved in Banana bunchy top virus strain evolution.
Phytopathology, 99, 812-822 (2009).
Fukuta, S., T. Iida, Y. Mizukami, A. Ishida, J. Ueda, M. Kanbe and Y.
Ishimoto: Detection of Japanese yam mosaic virus by RT-LAMP.
Arch. Virol., 148, 1713-1720 (2003).
Galvez, L.C., C.F.C. Barbosa, R.B.L. Koh and V.M. Aquino: Loop-
mediated isothermal amplification (LAMP) assays for the detection
of abaca bunchy top virus and banana bunchy top virus in abaca.
Crop Prot., 131, 105-101 (2020).
Hansen, Z.R., B.J. Knaus, J.F. Tabima, C.M. Press, H.S. Judelson, N.J.
Grunwa ld and C.D. Smart: Loop-mediat ed isoth erm al
amplification for detection of the tomato and potato late blight
pathogen Phytophthora infestans. J. Appl. Microbiol., 120, 1010-
1020 (2016).
IPPC: Glossary of phytosanitary terms. ISPM no. 5 in International
Standards for Phytosanitary Measures, IPPC Secretariat, FAO,
Rome (IT) (2010). https://www.ippc.int/largefiles/adopted_
ISPMs_previousversions/en/ISPM_05_2 010 _En _20 10-05-
10.pdf [Accessed on 20th September, 2022].
Ju, H.J.: Simple and rapid detection of potato leaf roll virus by reverse
transcription loop-mediated isothermal amplification. Plant Pathol.
J., 27, 385–389 (2011).
Kakati, N. and P.D. Nath: Genetic diversity of banana bunchy top virus
(BBTV) prevalent in Assam causing banana bunchy top disease.
Int. J. Curr. Microbiol. App. Sci., 7, 1547-1560 (2018).
Kaneko, H., T. Kawana, E. Fukushima and T. Suzutani: Tolerance of loop-
mediated isothermal amplification to a culture medium and biological
substances. J. Biochem. Biophys. Meth., 70, 499– 501 (2007).
Kaur, N., A. Alok, N. Kaur, P. Pandey, P. Awasthi and S. Tiwari: CRISPR/
Cas9-mediated efficient editing in phytoene desaturase (PDS)
demonstrates precise manipulation in banana cv. Rasthali
genome. Funct. Integr. Genom., 18, 89-99 (2018).
Koh, R.B., C.F.C. Barbosa, V.M. Aquino and L.C. Galvez: Rapid, simple
detection of banana bract mosaic virus in abaca using a one step
reverse transcription loop mediated isothermal amplifcation (RT
LAMP) assay. J. Gen. Plant Pathol., 86, 433-441 (2020).
Kumar, P.L., R. Hanna, O.J. Alabi, M.M. Soko, T.T. Oben, G.H.P. Vangu
and R.A. Naidu: Banana bunchy top virus in Sub-Saharan Africa:
Investigations on virus distribution and diversity. Virus Res., 159,
171-182 (2011).
Kumar, P.L., R. Selvarajan, M.L. Iskra-Caruana, M. Chabannes and R.
Hanna: Chapter seven–biology, etiology, and control of virus
diseases of banana and plantain. Advan. Virus Res., 91, 229-269
(2015).
Magee, C.J.: Investigation on the bunchy top disease of banana. Bulletin,
Council for Scientific and Industrial Research (Australia) 30, 64
(1927)
Manickam, K., S. Doraiswamy, T. Ganapathy and R. Rabindran: Early
detection of banana bunchy top virus in India using polymerases
chain reaction. Acta Phytopathol. Entomol. Hung., 37, 9-16 (2002).
Nagamine, K., T. Hase and T. Notomi: Accelerated reaction by loop
mediated isothermal amplification using loop primers. Mol. Cell.
Probes., 16, 223–229 (2002).
Notomi, T., H. Okayama, H. Masubuchi, T. Yonekawa, K. Watanabe, A.
Nobuyuki and T. Hase: Loop-mediated isothermal amplification of
DNA. Nucl. Acids Res., 28, e63-e63 (2000).
Peng, J., J. Zhang, J. Xia, Y. Li, J. Huang and Z. Fan: Rapid and sensitive
detection of banana bunchy top virus by loop- mediated isothermal
amplication. J. Virol. Methods., 185, 254-258 (2012)
Shankar, K., L. Chavan, S. Shinde and B. Patil: An improved DNA
extraction protocol from four in vitro banana cultivars. Asian J.
Biotechnol., 3, 84-90 (2011).
Selvarajan, R. and V. Balasubramanian: Host-virus interactions in
banana-infecting viruses. In: Plant Virus-host Interaction
Molecular Approaches and Viral Evolution (Eds.: R.K. Gaur, T.
Hohn and P. Sharma). Elsevier Academic Press, pp. 57-78
(2014).
Selvarajan, R., V. Balasubramanian and T. Sasireka: A simple, rapid and
solvent free nucleic acid extraction protocol for detection of
banana bunchy top virus by polymerase chain reaction and loop-
mediated isothermal amplification. Eur. J. Plant Pathol., 142, 389-
396 (2015).
Su, H.J., L.Y. Tsao, M.L. Wu and T.H. Hung: Biological and molecular
categorization of strains of banana bunchy top virus. J.
Phytopathol., 151, 290-296 (2003).
Thomas, J.E. and R.G. Dietzgen: Purification, characterization and
serological detection of virus-like particles associated with banana
bunchy top disease in Australia. J. Gen. Virol., 72, 217-224 (1991).
Treder, K., J. Chołuj, B. Zacharzewska, L. Babujee, M. Mielczarek, A.
Burzyński and A.M. Rakotondrafara: Optimization of a magnetic
capture RT-LAMP assay for fast and real-time detection of potato
virus Y and differentiation of N and O serotypes. Arch. Virol., 163,
447–458 (2018).
Tsai, C.C., C.Y. Huang, I.S. Weng, W.L. Liu and C.H. Chou: One-step RT-
LAMP analysis for efficient detection of Odontoglossum Ring Spot
vrus from Oncidiinae hybrids (Orchidaceae). J. Gen. Plant Pathol.,
82, 89–95 (2016).
Vetten, H.J., J.L. Dale, I. Grigoras, B. Gronenborn, R. Harding, J.W.
Randles, Y. Sano, J.E. Thomas, T. Timchenko and H.H. Yeh:
Family Nanoviridae: In: Virus Taxonomy: Classification and
Nomenclature of Viruses: Ninth Report of the International
Committee on Taxonomy of Viruses. (Eds.: A.M.Q. King, E.B.
Carstens and E.J. Lefkowitz). Elsevier/Academic Press, San
Diego, CA, USA, pp. 395–404 (2012).
Wanitchakorn, R., R.M. Harding and J.L. Dale: Sequence variability in
the coat protein gene of two groups of banana bunchy top isolates.
Arch.Virol., 145, 593-602 (2000).
Watanabe, S. and A. Bressan: Tropism, compartmentalization and
retention of banana bunchy top virus (Nanoviridae) in the aphid
vector Pentalonia nigronervosa. J. Gen. Virol., 294, 209-219 (2013).
Wu, R.Y. and H.J. Su: Production of monoclonal antibodies against
banana bunchy top virus and their use in enzyme‐linked
immunosorbent assay. J. Phytopathol., 128, 203-208 (1990).
