The fifth family of the true crickets (Insecta: Orthoptera: Ensifera: Grylloidea), Oecanthidae defin. nov.: phylogenetic relationships and divergence times

Abstract

Crickets are frequently used as a model in several areas of science, including acoustic communication, behaviour and neurobiology. However, only a few of these studies are placed in an evolutionary framework due to the limited number of phylogenetic hypotheses for true crickets. We present a phylogenetic hypothesis for a newly defined family of crickets, Oecanthidae defin. nov., sister-group of Gryllidae defin. nov. The phylogenetic analyses are based on molecular and morphological data under likelihood and parsimony criteria and molecular data for divergence-times estimation (Bayesian inference). We used 107 terminals from all biogeographic regions and six fossils for the time calibration of the tree. All analyses resulted in Oecanthidae with four subfamilies: Euscyrtinae, Oecanthinae defin. nov., Podoscirtinae defin. nov. and Tafaliscinae defin. nov. Based on our results, we revise the definition and internal classifications of the subfamilies, supertribes and tribes. A new tribe, Phyllogryllini trib. nov. is described. We also update their diagnoses, list the genera of the tribes and list their apomorphies. We provide an identification key for all suprageneric taxa of Oecanthidae, plus all genera of Tafaliscinae. Finally, we discuss the phylogenetic relationships of Oecanthidae, their divergence times, habitat diversity and the importance of ovipositor variation in this clade.

Full text

Zoological Journal of the Linnean Society, 2022, XX, 1–44. With 20 figures.
1
The fifth family of the true crickets (Insecta: Orthoptera:
Ensifera: Grylloidea), Oecanthidae defin. nov.:
phylogenetic relationships and divergence times
LUCAS DENADAI DE CAMPOS1,3,*,, PEDRO GUILHERME BARRIOS DE SOUZA DIAS2,,
JORGE ALVES AUDINO1,, LAURE DESUTTER-GRANDCOLAS3,† and
SILVIO SHIGUEO NIHEI1,†
1Departamento de Zoologia, Instituto de Biociências, Universidade de São Paulo, São Paulo, Brazil
2Departamento de Entomologia, Museu Nacional, Universidade Federal do Rio de Janeiro, Rio de
Janeiro, Brazil
3Institut de Systématique, Évolution et Biodiversité, Muséum national d’Histoire naturelle, Sorbonne
Université, CNRS, UPMC, EPHE, UA, Paris, France
Received 23 March 2022; revised 9 June 2022; accepted for publication 26 July 2022
Crickets are frequently used as a model in several areas of science, including acoustic communication, behaviour
and neurobiology. However, only a few of these studies are placed in an evolutionary framework due to the limited
number of phylogenetic hypotheses for true crickets. We present a phylogenetic hypothesis for a newly defined family
of crickets, Oecanthidae defin. nov., sister-group of Gryllidae defin. nov. The phylogenetic analyses are based on
molecular and morphological data under likelihood and parsimony criteria and molecular data for divergence-times
estimation (Bayesian inference). We used 107 terminals from all biogeographic regions and six fossils for the time
calibration of the tree. All analyses resulted in Oecanthidae with four subfamilies: Euscyrtinae, Oecanthinae defin.
nov., Podoscirtinae defin. nov. and Tafaliscinae defin. nov. Based on our results, we revise the definition and
internal classifications of the subfamilies, supertribes and tribes. A new tribe, Phyllogryllini trib. nov. is described.
We also update their diagnoses, list the genera of the tribes and list their apomorphies. We provide an identification
key for all suprageneric taxa of Oecanthidae, plus all genera of Tafaliscinae. Finally, we discuss the phylogenetic
relationships of Oecanthidae, their divergence times, habitat diversity and the importance of ovipositor variation in
this clade.
ADDITIONAL KEYWORDS: calibration – diversification – Gryllidea – molecular systematics – morphology.
INTRODUCTION
Crickets (Orthoptera, Gryllidea) are frequently used
as models for studies in acoustic communication
(Bailey, 1991; Gerhardt & Huber, 2002), neurobiology
(Hedwig, 2014; Pollack et al., 2016) and behaviour
(Gwynne & Morris, 1983; Huber et al., 1989; Matthews
& Matthews, 2009). These insects are also well-known
for their high speciation rates, as highlighted by their
diversity on islands (Otte & Alexander, 1983; Otte,
1994; Shaw, 2002; Ritchie & Garcia, 2005). By contrast,
few studies have analysed cricket evolution in a wide
taxonomic scope, which can be due first to a global
deficit of phylogenies of cricket clades, and second to a
lack of data on cricket natural history in the wild.
Crickets have been included in studies with broad
taxonomic sampling of Orthoptera, with a relatively
small number of terminals (Song et al., 2015, 2020).
Currently, only one large-scale phylogenetic study is
dedicated to Gryllidea (Chintauan-Marquier et al.,
2016). Sanno et al. (2021) studied a limited sample
of mitogenomes of the whole cricket clade, and their
results confirmed those of Chintauan-Marquier
et al. (2016). Other works have focused on limited
*Corresponding author. E-mail: lcdenadai@gmail.com
†Last co-authors.
[Version of record, published online 2 November
2022; http://zoobank.org/ urn:lsid:zoobank.
org:pub:4BB4333D-64F0-4485-9C2B-47546ECFE65F]
applyparastyle “fig//caption/p[1]” parastyle “FigCapt”
© The Author(s) 2022. Published by Oxford University Press on behalf of The Linnean Society of London.
All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

2 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
geographical range (Nattier et al., 2011; He et al.,
2020) or lower taxonomic levels, such as subfamilies
(Robillard & Desutter-Grandcolas, 2004, 2006; Vicente
et al., 2017), tribes (Tan et al., 2021) and genera (Huang
et al., 2000; Desutter-Grandcolas & Robillard, 2003;
Mendelson & Shaw, 2005; Shen et al., 2020; Campos
et al., 2021), which represent a selected, biased
sample of cricket diversity. Consequently, phylogenetic
hypotheses for true crickets (Orthoptera: Grylloidea)
are still scarce, preventing advances in evolutionary
studies of this emblematic group of organisms.
Despite a large number of time-calibrated trees
available in the insect literature, only a few include
Orthoptera (Song et al., 2015, 2020), and fewer focus
on crickets. In fact, dated trees are available only for
Eneopterinae (Gryllidae) and its subordinate taxa
(Vicente et al., 2017; Dong et al., 2018; Tan et al.,
2021). This subfamily is becoming a novel model in
evolutionary biology, thanks to combined advances in
taxonomy, phylogeny and observations in the field and
laboratory (Robillard, 2021). But even these studies
suffer from the still incipient fossil record of Grylloidea
(see: Vicente et al., 2017), with few complete fossils,
often misclassified due to the lack of phylogeny-based
taxonomy with apomorphic characters for the clades
(Desutter-Grandcolas et al., 2021).
Chintauan-Marquier et al.’s (2016) phylogenetic
tree of Grylloidea, based on 205 taxa from all world
regions (except the poles) and six molecular markers
(mitochondrial and nuclear), supports four main
clades in this superfamily, which were proposed as four
families, i.e. Gryllidae Laicharting, 1781; Mogoplistidae
Costa, 1855; Phalangopsidae Blanchard, 1845; and
Trigonidiidae Saussure, 1874. The family Gryllidae
was divided into two clades, named ‘clade F’ and ‘clade
G’ (Fig. 1). This classification has been largely adopted,
but without a complete congruence between phylogeny
and taxonomy (Cigliano et al., 2022).
We undertook a detailed study of clade F of
Chintauan-Marquier et al. (2016). In the taxonomy used
by Cigliano et al. (2022), clade F is part of the Gryllidae
family, which comprises a ‘subfamily group Gryllinae’ (with
six extant subfamilies), a ‘subfamily group Podoscirtinae’
(including four subfamilies: Euscyrtinae Gorochov,
1985, Hapithinae Gorochov, 1986, Pentacentrinae
Saussure, 1878 and Podoscirtinae Saussure, 1878)
and two separate subfamilies (Eneopterinae Saussure,
1874 and Oecanthinae Blanchard, 1845). By contrast,
according to Chintauan-Marquier et al. (2016), clade
F gathers the Oecanthinae and only three subfamilies
of the ‘subfamily group Podoscirtinae’, i.e. Euscyrtinae,
Hapithinae and Podoscirtinae; all the other subfamilies
were included in clade G or, for at least one of them, in
another cricket family.
Chintauan-Marquier’s et al. (2016) clade F is thus
unrecognized as a taxon in the present state of cricket
taxonomy. Moreover, it has not yet been tested or
defined by a clear set of synapomorphies, a confusion
also shared with its sister-clade G. Clade F shows a
remarkable morphological diversity combined with
a large disparity of habitats, mostly related to plant
stratification, with species inhabiting grasses, shrubs,
short and tall trees, in forests or open areas, in the
canopy or the understorey (Otte & Alexander, 1983;
Otte, 1994; Otte & Pérez-Gelabert, 2009; Campos &
Desutter-Grandcolas, 2020; Campos et al., 2020). With
worldwide distribution, these insects are also diverse
in their body sizes (~10mm to ~40mm), forewing
morphology with various acoustic structures (from
complete and functional to absent, with all intermediate
stages), forewing development (from aptery to long
wings covering the entire body) and ovipositor shapes
(Otte & Alexander, 1983; Otte & Pérez-Gelabert, 2009;
Anso et al., 2016; Gorochov, 2017; Campos & Desutter-
Grandcolas, 2020).
Explaining the diversity and evolution of cricket
clade F will provide an excellent model for evolutionary
studies on behaviour, bioacoustics, biogeography
and trait evolution, not to mention insights into the
influence of past environmental events on clade
diversification (Grant et al., 2017). In addition, the
morphological diversity of these crickets, combined
with a robust phylogenetic framework, will provide
essential clues to understanding their affinity to plant
stratification and how the use of different habitats has
shaped their evolutionary success.
In the present paper, we reconstruct a phylogenetic
hypothesis of a large set of taxa (107) in order to
test the monophyly of clade F sensu Chintauan-
Marquier et al.’s (2016) and infer a robust phylogenetic
framework necessary to support the taxonomic
organization of true crickets. Analyses were conducted
under Bayesian inference (BI), maximum likelihood
(ML) and maximum parsimony (MP) criteria.
Figure 1. Summarized relationship of Grylloidea families
from the phylogenetic hypothesis of Chintauan-Marquier
et al. (2016).

THE FIFTH FAMILY OF TRUE CRICKETS 3
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
Phylogenetic inference was based on molecular
and morphological data, except for BI, which used
only molecular data. Our results confirm the monophyly
of clade F and justify the redefinition of a fifth family of
true crickets: Oecanthidae defin. nov. (Fig. 2), sister of the
newly defined family Gryllidae. To further understand
the evolution of the family, we estimate a time-calibrated
tree of Oecanthidae under BI using the available fossils
of Grylloidea. In addition, we revise the definition and
internal classification of all subfamilies included in
Oecanthidae, reorganizing them into monophyletic
supertribes and tribes. We list the apomorphies for
each clade and update their diagnoses. Finally, we
propose an identification key for all suprageneric taxa
plus the genera of Neotropical Tafaliscinae defin. nov.
A new tribe, Phyllogryllini, is defined in the supertribe
Hapithidi defin. nov. (Podoscirtinae).
MATERIAL AND METHODS
Taxon sampling
For the phylogenetic analyses, 107 terminals (17
outgroup, 90 ingroup) were selected (Table 1), based
on clades F + G proposed by Chintauan-Marquier
et al. (2016) and on molecular and morphological data
availability. All selected specimens are documented for
three or more molecular markers (sequenced by us or
from GenBank, see next section). Cranistus colliurides
Stål, 1861 (Trigonidiidae:Trigonidiinae) was used to
root the trees. The sequenced and examined material
belongs to the following institutions: Laboratório
de Insetos do Departamento de Zoologia da UNESP
de Botucatu, Botucatu (BOTU), Muséum national
d’Histoire naturelle, Paris (MNHN), Museu de Zoologia
da Universidade de São Paulo, São Paulo (MZSP) and
Instituto Nacional de Pesquisas da Amazônia Manaus,
(INPA). Distributional data were compiled from
Orthoptera Species File (OSF) (Cigliano et al., 2022),
except for taxa used herein. The definitions of areas
follow Dinerstein et al. (2017).
molecular daTa
We documented molecular markers frequently used in
molecular studies of Grylloidea (Robillard & Desutter-
Grandcolas, 2006; Nattier et al., 2011, 2012; Song
et al., 2015; Chintauan-Marquier et al., 2016). These
include two mitochondrial markers, rDNA 12S and
rDNA 16S; and two nuclear markers, rDNA 18S and
two subunits of rDNA 28S (A and D) (Table 2). In
total, we obtained 2763 base pairs for each specimen
when all four markers were sequenced. In this study,
we greatly expanded the taxonomic sampling and
molecular data for crickets, with 354 new sequences
(66.17%), in addition to 114 previously published
sequences (21.3%) (Robillard & Desutter-Grandcolas,
2006; Chintauan-Marquier et al., 2016) (Table 1). Our
molecular dataset is 87.47% complete.
DNA was extracted from the mid (large specimens)
or hind (small specimens) femora muscular tissue of
dried or alcohol preserved material. The specimens
were selected based on conservation and age. Newly
collected specimens had the mid or forelegs dissected
and stored in absolute ethanol under –20 °C. All
procedures for DNA sequencing were conducted in
the Laboratório de Evolução Molecular (LEM) of
Departamento de Zoologia, Instituto de Biociências,
Universidade de São Paulo (USP) (Brazil) and in
the Service de Systématique Moléculaire (SSM) of
the Muséum national d’Histoire naturelle (MNHN)
(France) (Table 1).
In the LEM, ammonium acetate protocol was used
for DNA extraction. The polymerase chain reaction
(PCR) products were purified using Agencourt
Ampure XP kit (Beckman Coulter) and prepared
for sequencing with BigDye Terminator v.3.1 Cycle
Sequencing Kit (Applied Biosystems). Samples were
sequenced at Departamento de Botânica, IB-USP. In
the SSM, DNA extraction was automatized with the
workstation epMotion 5075 following the operating
manual. QIAamp DNA tissue micro kit (QIAGEN)
was used following the manufacturer’s instructions.
The PCR products were sent to Eurofins in France for
sequencing. All sequences were analysed for quality,
assembled in the software package phred/phrap
v.0.02/0.99 (Ewing & Green, 1998; Ewing et al., 1998),
edited in Consed v.28.0 (Gordon & Green, 2013) and
visualized in AliView v.1.27 (Larsson, 2014).
morphological daTa
The morphological matrix is based on characters of
adult males and females, including male genitalia. The
specimens were examined under the stereomicroscopes
Zeiss Stemi DV4 and Wild M3Z. The morphological
terminology adopted, including the male phallic
complex, follows Desutter (1987), Desutter-Grandcolas
(2003) and Campos & Desutter-Grandcolas (2020).
The nomenclature of forewings venation follows
Desutter-Grandcolas et al. (2017), modified by
Schubnel et al. (2019), based on Béthoux & Nel (2001)
for fossils. Male phallic complex was dissected and
cleared in KOH 10% for a few hours (depending on the
degree of sclerotization of each specimen) and stored
individually with the specimen. Drawings were made
under a Leica MZ9.5 and a Wild M3Z stereomicroscope
coupled with a camera lucida. Photographs were taken
with a Leica DFC-420 camera coupled to a Leica MZ16
stereomicroscope and with a Canon 60D coupled with

4 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
Figure 2. Diversity of Oecanthidae: A, Proturana subapterus, female (Euscyrtinae) (photo: Laure Desutter-Grandcolas);
B, Oecanthus sp., male (Oecanthinae: Oecanthidi: Oecanthini) (photo: Marcos Fianco); C, Diatrypa sp., male (Oecanthinae:
Diatrypidi) (photo: Neucir Szinwelski); D, Stenoecanthus planixiphus, male and female mating (Oecanthinae) (photo:
Sylvain Hugel); E, Tafalisca hugeli, male (Tafaliscinae: Tafaliscidi) (photo: Sylvain Hugel); F, Apterotrypa mitarakensis, male
(Tafaliscinae: Paroecanthidi: Neometrypini) (photo: Sylvain Hugel); G, Angustitrella sp., male (Tafaliscinae: Paroecanthidi:
Paroecanthini) (photo: Pedro Souza-Dias); H, Phyllogryllus velutinus, male (Podoscirtinae: Hapithidi: Phyllogryllini) (photo:
Lucas Denadai de Campos); I, Cearacesa sp., male (Podoscirtinae: Hapithidi: Cearacesaini) (photo: Lucas Denadai de
Campos); J, Matuanus caledonicus, male (Podoscirtinae: Podoscirtidi: Aphonoidini) (photo: Hervé Jourdan); K, Adenopterus
sp., female (Podoscirtinae: Podoscirtidi: Aphonoidini) (photo: Phillipe Grandcolas); L, Trulajlia hibinonis, male (Podoscirtinae:
Podoscirtidi: Truljaliini) (photo: Masaki Ikeda, Wikipedia).

THE FIFTH FAMILY OF TRUE CRICKETS 5
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
Table 1. Sampled taxa for molecular data. Accession numbers are indicated for GenBank sequences. Realms: Afr, Afrotropic; Aus, Australasia; Ind, Indo-Malay;
Neo, Neotropical; Oce, Oceania; Pal, Palaeotropical. *Sequences obtained at Laboratório de Evolução Molecular (LEM/USP); **sequences obtained at Service de
Systématique Moléculaire (SSM/MNHN); - missing data
Taxon Molecular
code
Subfamily Realm Locality 12S 16S 18S 28SA 28SD Morphology
characters
Absonemobius
guyanensis
LDG 047 Nemobiinae Neo French Guiana,
Arataye
KR903868 - KR904058 KR903497 KR902996 193
Cranistus colliurides DNA 23 Trigonidiinae Neo Brazil, Itatiaia OM501650* OM501746* OM501898* OM501816* OM501971* 188
Aracamby sp.
Cantareira
DNA 02 Luzarinae Neo Brazil, São Paulo OM501635* OM501731* OM501883* OM501801* OM501961* 190
Eidmanacris
endophallica
PSD 404 Luzarinae Neo Brazil, Serra dos
Orgãos
OM501715* - OM501954* OM501878* OM502005* 196
Endecous sp.
Cantareira
DNA 03 Luzarinae Neo Brazil, São Paulo OM501636* OM501732* OM501884* OM501802* OM501962* 191
Cardiodactylus
novaeguineae
CnoPe Eneopterinae Aus Vanuatu, Espiritu
Santo
JF972506 JF972521 JF972537 KR903500 KR902998 197
Eneoptera
surinamensis
DNA 26 Eneopterinae Neo Brazil, Camacan OM501653* OM501749* OM501900* - OM501972* 197
Ligypterus
linharensis
DNA 27 Eneopterinae Neo Brazil, Camacan OM501654* OM501750* OM501901* OM501819* - 197
Xenogryllus
eneopteroides
XenAC Eneopterinae Afr Central African Re-
public
KR904023 KR903829 KR904205 KR903670 KR903148 197
Anurogryllus sp.
Itatiaia
DNA 45 Gryllinae Neo Brazil, Itatiaia OM501667* OM501763* OM501913* OM501832* - 179
Eumodicogryllus
bordigalensis
LDG 174 Gryllinae Neo The Netherlands KR903962 KR903785 KR904149 KR903622 KR903100 141
Gryllodes sigillatus LDG 042 Gryllinae Afr Comoros, Anjouan KR903863 KR903701 KR904053 KR903529 KR903027 197
Gryllus sp. Veredas DNA 30 Gryllinae Neo Brazil, Veredas OM501657* OM501753* OM501904* OM501822* OM501974* 149
Zebragryllus
nouragui
LDG 094 Gryllinae Neo French Guiana,
Arataye
KR903900 KR903729 KR904088 KR903565 KR903055 197
Creolandreva
crepitans
LDG 138 Landrevinae Afr Mauritius KR903931 KR903758 KR904118 KR903592 KR903079 197
Odontogryllus
setosus
LDG 100 Landrevinae Neo French Guiana,
Arataye
KR903905 KR903734 KR904093 - - 196
Xulavuna sp. nov. DNA 69 Landrevinae Neo Brazil, Contraguaçu OM501683* OM501779* OM501929* OM501848* - 181
Euscyrtus aff.
bipunctatus
LDG 161 Euscyrtinae Aus Vanuatu, Espiritu
Santo
KR903951 KR903775 KR904138 KR903492 KR902988 188
Euscyrtus bivittatus LDG 187 Euscyrtinae Afr Mauritius KR903969 KR903791 KR904155 KR903629 - 143
Proturana
subapterus
LDG 163 Euscyrtinae Aus New Caledonia KR903953 - KR904140 KR903613 KR903094 188

6 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
Taxon Molecular
code
Subfamily Realm Locality 12S 16S 18S 28SA 28SD Morphology
characters
Diatrypa (Diatrypa)
sp. Sta.Teresa
DNA 16 Oecanthinae Neo Brazil, Santa Teresa OM501643* OM501739* OM501891* OM501809* OM501967* 180
Diatrypa (Diatrypa)
tuberculata
DNA 17 Oecanthinae Neo Brazil, Itatiaia OM501644* OM501740* OM501892* OM501810* OM501968* 197
Diatrypa
(Latispeculum) sp.
Manaus
DNA 51 Oecanthinae Neo Brazil, Manaus OM501672* OM501768* OM501918* OM501837* OM501980* 189
Diatrypa
(Latispeculum) aff.
brunnea
DNA 38 Oecanthinae Neo Brazil, Jau OM501661* OM501757* OM501907* OM501826* OM501975* 180
Diatrypini Black gen.
nov.?
DNA 47 Oecanthinae Neo Brazil, Igrapiúna OM501668* OM501764* OM501914* OM501833* OM501978* -
Neoxabea brevipes DNA 48 Oecanthinae Neo Brazil, Salesópolis OM501669* OM501765* OM501915* OM501834* - 197
Neoxabea sp. GUY LDG 556 Oecanthinae Neo French Guiana,
Arataye
OM501702** - OM501948** OM501866** OM501999** 105
Oecanthus chopardi LDG 173 Oecanthinae Afr Yemen, Socotra - KR903784 KR904148 KR903493 KR902990 -
Oecanthus lineolatus DNA 65 Oecanthinae Neo Brazil, São Lourenço
do Sul
OM501682* OM501778* OM501928* OM501847* - 197
Oecanthus pallidus DNA 40 Oecanthinae Neo Brazil, Botucatu OM501663* OM501759* OM501909* OM501828* OM501976* 197
Oecanthus sp. BRA LDG 538 Oecanthinae Neo Brazil, Linhares OM501696** OM501788** OM501943** OM501861** - -
Oecanthus sp. COM LDG 045 Oecanthinae Afr Comoros, Anjouan KR903866 KR903704 KR904056 KR903532 KR903030 147
Prognathogryllus
pihea
LDG 388 Oecanthinae Oce Hawaii OM501692** OM501785** OM501938** OM501856** OM501990** 146
Thaumatogryllus
variegatus
LDG 389 Oecanthinae Oce Hawaii OM501693** - OM501939** OM501857** OM501991** 183
Adenopterus sp.1 LDG 631 Podoscirtinae Aus New Caledonia OM501706** - OM501952** OM501870** OM502003** -
Adenopterus sp.2 LDG 637 Podoscirtinae Aus New Caledonia OM501707** OM501793** OM501953** - OM502004** -
A. (Aphonomorphus)
aff. montanus Jau
DNA 37 Podoscirtinae Neo Brazil, Jau OM501660* OM501756* - OM501825* - 180
A.(Euaphonus) sp.
GUY
LDG 179 Podoscirtinae Neo French Guiana,
Arataye
KR903965 KR903787 - KR903624 - 180
Archenopterus
adamantus
LDG 492 Podoscirtinae Aus New Caledonia - - OM501941** OM501859** OM501993** 180
Archenopterus sp. LDG 218 Podoscirtinae Aus New Caledonia OM501686** - OM501932** OM501850** OM501987** -
Archenopterus sp.
NCAL
LDG 200 Podoscirtinae Aus New Caledonia OM501685** OM501781** OM501931** - OM501986** 180
Calscirtus amoa LDG 219 Podoscirtinae Aus New Caledonia KR903993 - KR904176 KR903642 KR903120 188
Table 1. Continued

THE FIFTH FAMILY OF TRUE CRICKETS 7
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
Taxon Molecular
code
Subfamily Realm Locality 12S 16S 18S 28SA 28SD Morphology
characters
Calscirtus sp. LDG 629 Podoscirtinae Aus New Caledonia OM501704** OM501792** OM501950** OM501868** OM502001** -
Cearacesa cearensis DNA 25 Podoscirtinae Neo Brazil, Porto Seguro OM501652* OM501748* OM501899* OM501818* - 197
Cearacesa nova DNA 50 Podoscirtinae Neo Brazil, Gameleira do
Assuará
OM501671* OM501767* OM501917* OM501836* - 197
Freyrius sp. COM LDG 096 Podoscirtinae Afr Comoros, Anjouan KR903901 KR903730 KR904089 KR903566 KR903056 189
Gryllophyllus sp.
GDP
LDG 043 Podoscirtinae Neo Guadeloupe OM501684** OM501780** OM501930** OM501849** OM501985** 189
Hapithus sp. MEX LDG 204 Podoscirtinae Neo Mexico, Chiapas KR903982 - KR904166 KR903635 - 188
Matuanus aff. mira-
bilis
LDG 630 Podoscirtinae Neo New Caledonia OM501705** - OM501951** OM501869** OM502002** 189
Mistchenkoana sp.
Santo
LDG 160 Podoscirtinae Aus Vanuatu, Espiritu
Santo
KR903950 KR903774 KR904137 KR903611 KR903092 188
Munda aff. asyrinx LDG 131 Podoscirtinae Ind Indonesia, Java KR903927 KR903754 KR904114 KR903588 KR903076 187
Phyllogryllus
pipilans
lbr 408 Podoscirtinae Neo French Guiana,
Papaichton
OM501714** OM501799** OM501960** OM501877** - 149
Phyllogryllus sp.
Veredas
DNA 49 Podoscirtinae Neo Brazil, Veredas OM501670* OM501766* OM501916* OM501835* OM501979* 99
Phyllogryllus
velutinus
DNA 60 Podoscirtinae Neo Brazil, Belterra OM501678* OM501774* OM501924* OM501843* - 197
Pixipterus sp. NCAL LDG 543 Podoscirtinae Aus New Caledonia OM501697** OM501789** OM501944** - OM501995** 189
POD gen. nov.? Santo LDG 269 Podoscirtinae Aus Vanuatu, Espiritu
Santo
OM501689** OM501784** OM501935** OM501853** - 112
Podo Archenopterus LDG 628 Podoscirtinae Aus New Caledonia OM501703** OM501791** OM501949** OM501867** OM502000** -
Prozvenella
bangalorensis
LDG 216 Podoscirtinae Ind India, Karnataka KR903991 - KR904174 KR903641 KR903118 190
Somnambula livida LDG 222 Podoscirtinae Neo French Guiana, Saint-
Jean-du-Maroni
KR903996 KR903805 KR904179 KR903645 KR903123 141
Somnambula ucayali DNA 52 Podoscirtinae Neo Brazil, Manaus OM501673* OM501769* OM501919* OM501838* OM501981* 197
Sonotrella
(Calyptotrella)
bispinosa
LDG 268 Podoscirtinae Ind Indonesia OM501688** OM501783** OM501934** OM501852** OM501989** 172
Stenogryllus sp. GDPlbr 397 Podoscirtinae Neo Guadeloupe OM501712** OM501797** OM501958** OM501873** OM502008** -
Stenogryllus sp.
MGA
LDG 459 Podoscirtinae Neo Marie-Galante OM501694** OM501786** OM501940** OM501858** OM501992** 197
Taroba elephantina DNA 24 Podoscirtinae Neo Brazil, Foz do Iguaçu OM501651* OM501747* - OM501817* - 197
Truljalia hibinonis LDG 234 Podoscirtinae Ind China, Padang OM501687** KR903809 KR904182 KR903494 KR902992 189
Table 1. Continued

8 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
Taxon Molecular
code
Subfamily Realm Locality 12S 16S 18S 28SA 28SD Morphology
characters
Adenophallusia
legendrei
LDG 554 Tafaliscinae Neo French Guiana,
Mitaraka
OM501700** - OM501946** OM501864** - 197
Amblyrhethus
bahiensis
DNA 07 Tafaliscinae Neo Brazil, Chapada dos
Guimarães
OM501639* OM501735* OM501887* OM501805* OM501964* 180
Amblyrhethus
lineatus
DNA 54 Tafaliscinae Neo Brazil, Linhares OM501675* OM501771* OM501921* OM501840* OM501983* 180
Amblyrhethus
alagoensis
DNA 53 Tafaliscinae Neo Brazil, Satuba OM501674* OM501770* OM501920* OM501839* OM501982* 104
Angistitrella vicina 1 LDG 555 Tafaliscinae Neo French Guiana,
Mitaraka
OM501701** - OM501947** OM501865** OM501998** 197
Angustitrella aff.
vicina 1 GUY
LDG 092 Tafaliscinae Neo French Guiana,
Nouragues
KR903899 KR903728 KR904087 KR903564 KR903054 103
Angustitrella
mataraku
DNA 28 Tafaliscinae Neo Brazil, Porto Velho OM501655* OM501751* OM501902* OM501820* - 197
Angustitrella picipes DNA 57 Tafaliscinae Neo Brazil, Linhares OM501676* OM501772* OM501922* OM501841* OM501984* 180
Angustitrella sp. GuyLDG 091 Tafaliscinae Neo French Guiana,
Arataye
KR903898 KR903727 KR904086 KR903563 KR903053 103
Angustitrella sp. Guylbr 015 Tafaliscinae Neo French Guiana,
Papaichton
OM501708** OM501794** - OM501871** - -
Angustitrella sp.
Manaus
DNA 34 Tafaliscinae Neo Brazil, Manaus OM501659* OM501755* OM501906* OM501824* - 197
Angustitrella
vicina 2
lbr 125 Tafaliscinae Neo French Guiana,
Mitaraka
OM501710** - OM501956** OM501872** - -
Apterotrypa
mitarakensis
LDG 548 Tafaliscinae Neo French Guiana,
Mitaraka
OM501698** - - OM501862** OM501996** 189
Apterotrypa sp.nov.1
Foz
DNA 22 Tafaliscinae Neo Brazil, Foz do Iguaçu OM501649* OM501745* OM501897* OM501815* - 196
Apterotrypa sp.nov.2
Jau
DNA 13 Tafaliscinae Neo Brazil, Jau OM501642* OM501738* OM501890* OM501808* OM501966* 196
Apterotrypa sp.nov.3
Cariacica
DNA 43 Tafaliscinae Neo Brazil, Cariacica OM501666* OM501762* OM501912* OM501831* - 196
Apterotrypa sp.nov.4
GUY
LDG 224 Tafaliscinae Neo French Guiana,
Nouragues
KR903997 KR903806 KR904180 KR903646 KR903124 139
Brazitrypa longiapex DNA 18 Tafaliscinae Neo Brazil, Santa Teresa OM501645* OM501741* OM501893* OM501811* OM501969* 197
Brazitrypa sp.nov.
Foz
DNA 31 Tafaliscinae Neo Brazil, Foz do Iguaçu OM501658* OM501754* OM501905* OM501823* - 103
Brazitrypa
paranaensis
DNA 08 Tafaliscinae Neo Brazil, Foz do Iguaçu OM501640* OM501736* OM501888* OM501806* - 197
Table 1. Continued

THE FIFTH FAMILY OF TRUE CRICKETS 9
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
Taxon Molecular
code
Subfamily Realm Locality 12S 16S 18S 28SA 28SD Morphology
characters
Brazitrypa paulista DNA 10 Tafaliscinae Neo Brazil, Salesópolis OM501641* OM501737* OM501889* OM501807* OM501965* 197
Brazitrypa sp. BRA LDG 296 Tafaliscinae Neo Brazil, Santa Lucia OM501691** - OM501937** OM501855** - 171
Cylindrogryllus
pitanga
DNA 64 Tafaliscinae Neo Brazil, Ilhéus OM501681* OM501777* OM501927* OM501846* - 197
Neometrypus badius DNA 42 Tafaliscinae Neo Brazil, Cariacica OM501665* OM501761* OM501911* OM501830* - 197
Neometrypus catiae DNA 05 Tafaliscinae Neo Brazil, Salesópolis OM501637* OM501733* OM501885* OM501803* - 197
Neometrypus couriae DNA 59 Tafaliscinae Neo Brazil, Belterra OM501677* OM501773* OM501923* OM501842* - 196
Neometrypus
marcelae
DNA 06 Tafaliscinae Neo Brazil, Itatiaia OM501638* OM501734* OM501886* OM501804* OM501963* 197
Neometrypus
azevedoi
DNA 39 Tafaliscinae Neo Brazil, Itatiaia OM501662* OM501758* OM501908* OM501827* - 197
Neometrypus maiae LDG 285 Tafaliscinae Neo Brazil, Linhares OM501690** - OM501936** OM501854** - 174
Perutrella
septentrionalis
lbr 407 Tafaliscinae Neo French Guiana OM501713** OM501798** OM501959** OM501876** OM502009** 197
Tafalisca aff.
elongata
DNA 63 Tafaliscinae Neo Brazil, Belterra OM501680* OM501776* OM501926* OM501845* - 180
Tafalisca ansoi LDG 109 Tafaliscinae Neo French Guiana,
Papaichton
KR903913 - KR904102 - - 180
Tafalisca bahiensis DNA 20 Tafaliscinae Neo Brazil, Itamaraju OM501647* OM501743* OM501895* OM501813* OM501970* 103
Tafalisca duckeana DNA 19 Tafaliscinae Neo Brazil, Manaus OM501646* OM501742* OM501894* OM501812* - 197
Tafalisca elongata
elongata
LDG 499 Tafaliscinae Neo French Guiana,
Mitaraka
OM501695** OM501787** OM501942** OM501860** OM501994** 197
Tafalisca hugeli LDG 553 Tafaliscinae Neo French Guiana,
Mitaraka
OM501699** OM501790** OM501945** OM501863** OM501997** 180
Tafalisca sp.nov.2
GDP1
lbr 083 Tafaliscinae Neo Guadeloupe OM501709** OM501795** OM501955** OM501874** OM502006** 197
Tafalisca sp.nov.2
GDP2
lbr 296 Tafaliscinae Neo Guadeloupe OM501711** OM501796** OM501957** OM501875** OM502007** -
Tafalisca sp. Jau DNA 21 Tafaliscinae Neo Brazil, Jau OM501648* OM501744* OM501896* OM501814* - 103
Tafalisca vestigialis DNA 62 Tafaliscinae Neo Brazil, Belterra OM501679* OM501775* OM501925* OM501844* - 197
Veredatrypa rosai DNA 29 Tafaliscinae Neo Brazil, Veredas OM501656* OM501752* OM501903* OM501821* OM501973* 197
Veredatrypa seca DNA 41 Tafaliscinae Neo Brazil, Ubajara OM501664* OM501760* OM501910* OM501829* OM501977* 180
Total of characters 513 473 671 414 495 197
Table 1. Continued

10 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
either a 100 mm or a 65 mm 1–5× macro lens using the
software helicon remoTe. Photographs were edited
with affi ni Ty phoT o. Plates and drawings were
produced in affiniTy designer.
Some characters of the forewings were investigated
using scanning electron microscopy (SEM). Samples of
male forewings were dehydrated in a graded ethanol
series until 100%, critical point dried using CO2 as
an intermediate fluid, mounted on stubs and coated
with gold. Samples were examined using a Scanning
Electron Microscope Zeiss SIGMA VP at the Instituto
de Biociências da Universidade de São Paulo.
Character description follows Sereno (2007) and the
matrix was constructed in MESQUITE v.3.61 ( Maddison
& Maddison, 2021). Inapplicable characters were coded as
‘-’ and unobserved characters as ‘?’. Out of 197 characters
(170 binary and 27 multistate), seven are based on
previous studies (Robillard & Desutter-Grandcolas, 2004;
Souza-Dias, 2015) and 190 are proposed for the first time
in this study. Winclada v.1.0 (Nixon, 2002) was used
to map and identify morphological synapomorphies
and homoplasies over the resulting trees. The list of
characters and the morphological matrix are provided
in the Supporting Information (Files S1, S2). Characters
illustrations (Figs S1–S9) and morphological characters
mapped over trees with fast optimization (Fig. S10) are
also in the Supporting Information.
A total of 197 characters were constructed based
on external morphology from 95 terminals (Table 1):
27 from the head, 43 from the forewings, 12 from the
thorax, 15 from the ovipositor, 47 from the legs and 48
from the male genitalia.
abbreviaTions
The abbreviations used to describe characters, indicate
in figures and diagnoses and to cite in the text are
listed below:
Wings: FW: forewing; HW: hindwing; Sc: subcostal;
PCu: post-cubital (stridulatory file); hv: harp veins;
CuP: cubital posterior; CuPa: anterior branch of
CuP; CuPb: posterior branch of CuP; R: radial; M +
CuA: medial + cubital anterior.
Thorax: DD: dorsal disc.
Ovipositor: dv: dorsal valves of ovipositor; vv: ventral
valves of ovipositor.
Legs: T: tibia; F: femur; I, II, III: anterior, medial,
posterior (legs, tibia and femur); iad, iam, iav: inner
apical dorsal, median, ventral (spurs); oad, oam,
oav: outer apical dorsal, median, ventral (spurs);
tar: tarsomere; TIII subapical and apical spurs
formula indicated inner/outer respectively, counted
from distal spurs upward.
Male genitalia: LLophi: lateral lophi of pseudepiphallus;
MedLophi: median lophi of pseudepiphallus; PsP:
pseudepiphallic paramere; PsAp: pseudepiphallic
apodeme; r: rami; arc: ectophallic arc; EctF:
ectophallic fold; vpEct: ventral projection of
ectophallic invagination; EctAp: ectophallic apodeme;
End: endophallus; EndAp: endophallic apodeme.
phylogeneTic analyses and divergence Time
esTimaTion
Multiple alignments were generated through MAFFT
v.7.310 (Katoh et al., 2002; Katoh & Standley, 2014)
under the following parameters: globalpair, maxiterate
16, reorder. Since not all regions of a gene evolve at
the same rate, some regions of the alignment may be
highly conserved (without information), while others
are extremely divergent and full of gaps. Thus, it is
recommended to remove these conflicting phylogenetic
information regions (Lake, 1991; Olsen & Woese,
1993; Swofford et al., 1996; Lutzoni et al., 2000) .
Consequently, GBlocks (Castresana, 2000) was applied
under less stringent parameters through Seaview
(Galtier et al., 1996) to identify and remove redundant
or highly heterogeneous sites on the 28SD fragments.
Sequences were concatenated with sequence-
maTrix (Vaidya et al., 2011). Phylogenetic analyses
Table 2. Molecular markers used in this study
Gene Primer Base pairs Reference
12S rRNA 12SF TACTATGTTACGACTTAT ~500 Kambhampati (1995)
12SR AAACTAGGATTAGATACCC
16S rRNA 16S AG CGCCTGTTTATCAAAAACATGT ~470 Robillard & Desutter-
Grandcolas (2006)
16S AG AGATCACGTAAGAATTTAATGGTC
18S rRNA 18S A2 ATGGTTGCAAAGCTGAAAC ~670 Giribet et al. (1999)
18S 9R GATCCTTCCGCAGGTTCACCTAC
28SA rRNA 28S R1.2a CCCSSGTAATTTAAGCATATTA ~400 Whiting (2002)
28S Rd3b CCYTGAACGGTTTCACGTACT Jarvis et al. (2004)
28SD rRNA 28S F4 CGACACGCCCCGATCCTCAGAGCCA ~500 Chintauan-Marquier et al.
(2016)
28S R4 GATTCTGACGTGCAAATCGATC

THE FIFTH FAMILY OF TRUE CRICKETS 11
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
were performed under maximum likelihood (ML)
and maximum parsimony (MP) criteria for combined
molecular and morphological data. Bayesian inference
(BI) was conducted to estimate clade divergence times
using only molecular data.
Model selection was carried out by ModelFinder
(Kalyaanamoorthy et al., 2017) under corrected
the Akaike information criterion (AICc), resulting
in GTR+F+R6 for the molecular data concatenated
and ORDERED+FQ+ASC+G4 for the morphological
matrix. ML analysis was performed by IQTREE v.1.6.1
(Nguyen et al., 2015) and branch support was estimated
by ultrafast bootstrap (UB) (Hoang et al., 2018), with
5000 replicates, and bootstrap (B) (Felsenstein, 1985),
with 500 replicates.
MP analysis was conducted in TNT v.1.5 (Goloboff
& Catalano, 2016) under a New Technologies search
with 100 replicates holding 10 000 trees per replicate,
ratchet 200, drift 200 and fuse 10. The branch support
was estimated by bootstrap (Felsenstein, 1985) and
Jackknife (JK) (Farris et al., 1996) with 1000 replicates
each. The consistency index (ci) (Kluge & Farris, 1969)
and retention index (ri) (Farris, 1989) were calculated.
BI was used to estimate clade divergence times
under the fossilized birth–death model (Heath et al.,
2014) in BEAST2 (Bouckaert et al., 2019). A relaxed
molecular clock was applied, assuming an uncorrelated
log-normal model on branch rates (Drummond
et al., 2006; Gavryushkina et al., 2014). Posterior
probabilities (PP) were sampled using Markov chain
Monte Carlo (MCMC) method for three independent
chains with 100 000 000 generations, pre-burn-in
for 25 000 000 generations and sampling every 5000
generations. Convergence of posterior probabilities
was visually analysed in TRACER v.1.7.1 (Rambaut
et al., 2018) and verified in the R package Convenience
1.0 (Fabreti & Höhna, 2021) based on effective sample
size (ESS > 625) for all continuous parameters and
split frequencies (Supporting Information, File S3).
Tree files were assembled in log combiner
(Bouckaert et al., 2019). Then, trees were summarized
as a maximum clade credibility tree after pruning
fossil taxa and removing a burn-in of 10% in
Treean noTaTor (Bouckaert et al., 2019). Posterior
probabilities on the nodes and bars indicating 95%
highest posterior density intervals (HPD) were
annotated with R package Strap 1.4 (Wills, 1999) and
then edited in affiniTy designer. A plot of lineages-
through-time was generated in icyTree (Vaughan,
2017). In order to facilitate figure presentation, HPD
bars were indicated only on nodes of interest. The time-
calibrated tree with HPD bars for all nodes is available
in the Supporting Information (Fig. S11).
Fossil ages were obtained from the Paleobiology
Database (paleobiodb.org) and confirmed with original
descriptions of each fossil. The root age of the tree
was assumed from the gap of the two most ancient
fossils of extinct families of Grylloidea between 182.7
and 208.5 Myr: Sinagryllus xinjiangensis Wang et al.,
2019 (Baissogryllidae) and Protogryllus (Protogryllus)
grandis Zeuner, 1937 (Protogryllidae). Another six
fossils were selected to calibrate internal node ages,
two used in a previous study (Vicente et al., 2017),
Araneagryllus dylani Heads, 2010 (Phalangopsidae:
Luzarinae) 17.1 ± 7 Myr and Proanaxipha
madgesuttonae Heads et al., 2012 (Gryllidae:
Pentacentrinae) 17.1 ± 7 Myr. Besides these, we also
included Araripegryllus camposae Martins-Neto, 1991
(Gryllidae) 117 ± 7 Myr, Birmaninemobius hirsutus
Xu et al., 2020 (Trigonidiidae: Trigonidiinae) 96.55 ± 4
Myr (Desutter-Grandcolas et al., 2021), Madasumma
europensis Chopard, 1936 (Oecanthidae) 35.95 ± 3
Myr and Stenogryllodes brevipalpis Chopard, 1936
(Oecanthidae) 35.95 ± 3 Myr.
The classification of orthopteran fossils is historically
marked by misidentifications and difficulties related
to homology assessment (Desutter-Grandcolas et al.,
2021). To ensure a reliable classification of the fossil
taxa used to calibrate the age of internal nodes, fossil
morphological data were included in the morphological
matrix and concatenated with the molecular data
matrix. We then conducted a Bayesian inference in
BEAST2 using the MCMC method with 50 000 000
generations, pre-burn-in for 12 500 000, and trees
sampled every 5000 generations. Based on this
approach, the classification of all six fossil taxa was
confirmed. The morphological data matrix including
the fossils (File S2) and the resulting summarized
tree with their positions (Fig. S12) are provided in the
Supporting Information.
RESULTS
phylogeneTic analyses and divergence Time
According to our results, we propose considering clade
F, from Chintauan-Marquier et al. (2016), as a fifth
family of Grylloidea, i.e. family Oecanthidae, recovered
as sister-group of Gryllidae defin. nov. in all analyses.
Oecanthidae comprises four well-supported clades,
corresponding to subfamilies Euscyrtinae Gorochov,
1985; Oecanthinae Blanchard, 1845; Podoscirtinae
Saussure, 1878; and Tafaliscinae Desutter, 1988.
Euscyrtinae is the sister-group of the other three
subfamilies, with the following topology: Euscyrtinae
+ ((Oecanthinae + Podoscirtinae) + Tafaliscinae) (Fig.
3; Table 3; Supporting Information, Figs S13, S14,).
Each subfamilial clade includes subsequent divisions,
which we consider as supertribes and tribes (Fig. 3 ). Two
supertribes divide Oecanthinae defin. nov.: Oecanthidi
Blanchard, 1845, with Oecanthini Blanchard, 1845 and
Xabeini Vickery & Kevan, 1983 tribes; and Diatrypidi

12 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
Desutter, 1988, with only one tribe, Diatrypini
Desutter, 1988. Podoscirtinae defin. nov. is composed of
Podoscirtidi Saussure, 1878 and Hapithidi Gorochov,
1985. Podoscirtidi with Aphonoidini Gorochov,
2008, Podoscirtini Saussure, 1878, and Truljaliini
Gorochov, 2020; their relationship is the same in all
analyses: Truljaliini + (Aphonoidini + Podoscirtini).
Hapithidi has four tribes, one of which is new:
Aphonomorphini Desutter, 1988; Cearacesaini Koçak
& Kemal, 2010; Hapithini Gorochov, 1986; and
Phyllogryllini Campos, trib. nov.; with the relationship
Cearacesaini + (Hapithini + (Aphonomorphini +
Phyllogryllini)). Tafaliscinae is re-erected with two
supertribes: Paroecanthidi Gorochov, 1986 divided
into Paroecanthini Gorochov, 1986 and Neometrypini
Desutter, 1988; and Tafaliscidi Desutter, 1988 with a
single tribe, Tafaliscini Desutter, 1988.
The topology for divergence times under BI
(Fig. 3) is similar to the topologies obtained under
ML (Supporting Information, Fig. S13) and MP
(Supporting Information, Fig. S14), including all
main clades mentioned above, such as subfamilies,
supertribes and tribes. Only minor differences were
observed on internal nodes of Diatrypidi, Oecanthidi
and Tafaliscidi (Fig. 3). Inside the Podoscirtidi clade,
Prozvenella bangaloriensis Desutter-Grandcolas
Figure 3. Time-calibrated phylogenetic tree of Oecanthidae. Divergence-time analysis under Bayesian inference based on
four DNA markers and six fossil calibrating internal nodes (red asterisks). Red numbers are the mean ages of the nodes.
Bars indicate 95% highest posterior density intervals for nodes of interest. Posterior probabilities different from 1 are
indicated in black numbers on nodes. Inset A, lineages-through-time plot.

THE FIFTH FAMILY OF TRUE CRICKETS 13
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
et al., 2003 belongs to Podoscirtini, while it has a
sister relationship to all taxa of Podoscirtidi, except
Truljaliini in ML and MP. Finally, in the Neometrypini
clade, Cylindrogryllus pitanga (de Mello, 1990) is
the sister-group of Brazitrypa Gorochov, 2011 +
Neometrypus Desutter, 1988, while it is the sister group
of Neometrypus only in ML and MP. The majority of
nodes have PP = 1 (Fig. 3). Results of ML and MP trees
are in the Supporting Information (File S4; Figs S13,
S14). Subfamilies and supertribes distributions are
indicated in Figure 4.
Divergence times
The divergence times were estimated for supra-generic
clades with 95% highest posterior density interval
(HPD): Oecanthidae, 130.1 Myr (109.9–166.8 Myr);
Euscyrtinae, 27.2 Myr (15.4–40.2 Myr); Oecanthinae,
109.6 Myr (87.3–141.77 Myr); Podoscirtinae, 103.7 Myr
(82.5-134.3 Myr); Tafaliscinae, 109.8 Myr (88.9–142
Myr). The split between Tafaliscinae and Oecanthinae
+ Podoscirtinae probably occurred around 124 Mya,
and the split of Podoscirtidi and Hapithidi is estimated
around 103.6 Mya, both in the Lower Cretaceous. The
most recent common ancestors of many supertribes date
back to the Upper Cretaceous, including Oecanthidi (87.2
Mya), Podoscirtidi (91.2 Mya), Hapithidi (89.4 Mya) and
Paroecanthidi (97.2 Mya). Diatrypidi (62.6 Mya) and
Tafaliscidi (53.9 Mya) diverged during the Palaeocene.
While some tribes have ancient origins during
the Upper Cretaceous, like Podoscirtini (68.9 Mya),
Paroecanthini (78.2 Mya) and Neometrypini (76.1
Mya), some have more recent divergences such as
Cearacesaini (62.7 Mya) in the Eocene; Xabeini
(51.3 Myr), Oecanthini (53.4 Mya), Truljaliini (47.3
Mya), Aphonoidini (39.2 Mya), Hapithini (52.1 Mya),
Aphonomorphini (50.9 Mya) and the new tribe
Phyllogryllini (49.6 Mya) during the Palaeocene.
The mean ages are indicated on suprageneric nodes
in Figure 3. The lineage-through-time plot (Fig. 3A)
indicates a sharp increase of lineages around 60 Mya
and 20 Mya, during the Palaeogene.
Classification
Based on our results, we propose a new classification
to organize Oecanthidae hierarchically (Table 3) and
to complete the hierarchical description of the cricket
clade. Morphological synapomorphies of the family,
subfamilies and supertribes are listed in Table 4, those
of tribes in Table 5, and the characters mapped on to the
trees in the Supporting Information (Fig. S10). We also
provide a comparative table with the main differences
between Oecanthidae and Gryllidae defin. nov. (Table 6).
Diagnoses of each taxonomic category of Oecanthidae
with included taxa is included in the Systematics section.
Table 3. Proposed new classification of Oecanthidae
based on the ML, MP and BI resulting trees
Oecanthidae Euscyrtinae
Oecanthinae Oeacanthidi Oecanthini
Xabeini
Diatrypidi Diatrypini
Podoscirtinae Podoscirtidi Aphonoidini
Podoscirtini
Truljaliini
Hapithidi Hapithini
Aphonomorphini
Cearacesaini
Phyllogryllini
Tafaliscinae Tafaliscidi Tafaliscini
Paroecanthidi Paroecanthini
Neometrypini
Figure 4. Distribution maps of Oecanthidae subfamilies
and supertribes.

14 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
Furthermore, an identification key of all suprageneric
taxa and all genera of Tafaliscinae is presented.
SYSTEMATICS
family OECANTHIDAE blanchard, 1845
DEfIN. NOv.
Oecanthites Blanchard, 1845: 245, Saussure, 1874:
428, Saussure, 1878: 590.
Oecanthiens Saussure, 1874: 427, Saussure, 1878: 534.
Oecanthinae Saussure, 1897: 251, Scudder, 1987:
62, Azam, 1901: 104, Kirby, 1906: 109, Zeuner, 1939:
212, Walker, 1966: 265, Otte & Alexander, 1983: 374,
Gorochov, 1986: 851–858, Toms & Otte, 1988: 471,
Nickle, 1992: 195, Otte, 1994: 85, Rentz, 1996: 147, Otte
& Perez-Gelabert, 2009: 491, Gorochov, 2015: 31–34,
Collins & Carson, 2014: 170, Chintauan-Marquier
et al., 2016: 73, Rentz & Su, 2019: 231.
Oecanthidae Brunner von Wattenwyl, 1873: 164,
Brunner von Wattenwyl, 1882: 420, Bruner, 1916: 395,
Chopard, 1949: 673, Chopard, 1951: 198, Vickery, 1977:
11, Chopard, 1968: 427, Kevan, 1982: 2, Desutter, 1987:
223, Coray & Lehmann, 1998: 94.
Type genus: Oecanthus Serville, 1831.
Distribution: Worldwide.
Diagnosis: Crickets inhabiting trees and shrubs (a few
exceptions registered in caves, see Xabeini), small to
large size; apterous, brachypterous or with developed
wings (with or without stridulatory apparatus).
Latero-anterior regions of metanotum generally
inflated (Supporting Information, Fig. S4C, D, E),
sometimes with bristles. TIII with five or more inner
apical spurs (except Oecanthidi); first and second
tarsomeres of legs I and II same-sized with pulvillum
Table 4. Morphological synapomorphies of Oecanthidae, its subfamilies and supertribes
Family Subfamily Supertribe State of character
Oecanthidae Ovipositor straight in lateral view 102(0)
iad spur three times or more longer than oad spur of TIII 133(1)
Tarsomere I and II of legs I and II same-sized 138(0)
Euscyrtinae Fastigium top truncated in frontal view 15(0)
Oecanthinae Apex of dorsal valves of ovipositor bifurcate 91(3)
iav spur of TIII reduced 136(1)
Endophallic sclerite two times longer than pseudepiphallic sclerite 194(2)
Diatrypidi Apex of ventral valves of ovipositor bifurcate 100(3)
Dorsal valves of male genitalia present and well developed 197(1)
Oecanthidi Mouthparts prognathous 24(0)
Inner ventral spur of TI absent 111(0)
Inner ventral spur of TII absent 115(0)
Dorsal spines of tarsomere I on inner margin of leg III absent 140(0)
Dorsal spines of tarsomere I on outer margin of leg III absent 141(0)
Claws bifid 149(1)
Ectophallic arc curved anteriorly 178(2)
Podoscirtinae Ventral serrulation on apex of ovipositor dorsal valves present 93(1)
Ectophallic fold apex bilobate 181(1)
Endophallus posterior projection double 196(1)
Hapithidi Median and lateral ocelli aligned 9(1)
Harp veins parallel to stridulatory file (PCu) 47(1)
Bilobate apex of ectophallic fold connected 182(1)
Podoscirtidi Stridulatory file (PCu) curved forming a 90° angle 41(0)
Proximal region of the stridulatory file (PCu) parallel to CuPa 42(0)
Pseudepiphallic sclerite MedLophi short 158(1)
Pseudepiphallic MedLophi dorsal to LLophi 159(2)
Tafaliscinae Stridulatory file sinuosity close to CuPa 40(1)
Ovipositor dorso-ventrally flattened 88(1)
PsAp posteriorly directed 169(1)
Tafaliscidi Apex of dorsal valves of ovipositor truncated 91(1)
Apex of ventral valves of ovipositor truncated 100(2)
Paroecanthidi Endophallic sclerite dorso-ventrally flattened 190(1)

THE FIFTH FAMILY OF TRUE CRICKETS 15
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
(Supporting Information, Fig. S5J, L) and second
tarsomere of leg III with pulvillum, second tarsomere
of TI and TII flattened dorso-ventrally (except some
Oecanthidi); inner apical spurs three times or more
longer than outer apical spurs of TIII (Supporting
Information, Fig. S6D); apex of ovipositor generally
with projections, protuberances and/or lateral margins
serrulate, sometimes smooth (Euscyrtinae) (Fig. 5D),
ovipositor generally upcurved, sometimes straight
or downcurved. Male genitalia: median region of
Table 5. Morphological synapomorphies of tribes of Oecanthidae
Supertribe Tribe State of character
Oecanthidi Xabeini Cerci shorter than FII 83(0)
Subapical spurs of TIII absent 120(0)
oav spur absent 135(0)
Inner apical spur of tarsomere I of leg III absent 144(0)
Outer apical spur of tarsomere I of leg III absent 146(0)
Oecanthini Outer ventral spur of TII absent 116(0)
Distal projection of ectophallic arc present 179(1)
Hapithidi Cearacesaini -
Hapithini PsP lateral 165(1)
PsP connected to pseudepiphallic sclerite 166(1)
Aphonomorphini Ectophallic arc straight 178(0)
Phyllogryllini -
Podoscirtidi Truljaliini Pronotum DD flattened in lateral view 74(1)
Aphonoidini -
Podoscirtini Pseudepiphallic sclerite capsular 151(1)
Paroecanthidi Paroecanthini Stridulatory file (PCu) bisinuous 39(2)
Harp veins divided into two clusters 48(1)
TI inflated 103
PsP strongly reduced 162(1)
Ectophallic invagination strongly reduced 174(1)
Neometrypini -
Table 6. Main differences between Oecanthidae and Gryllidae
Oecanthidae defin. nov. Gryllidae defin. nov.
Head - Pubescent
- Antennal scape same size or wider than fastigium
- Fastigium longer than wide or as long as wide in dorsal
view
- Median ocellus dorsal
- Lateral ocelli dorsal
- Generally smooth
- Antennal scape narrower than fastigium
- Fastigium generally wider than long in
dorsal view;
- Median ocellus facial
- Lateral ocelli generally frontal
Legs - TIII iad spur three times or more longer than oad spur
- Tarsomeres I and II of legs I and II same-sized
- Tarsomere II of legs I and II flattened
- Presence of pulvillum
- TIII iad spur slightly longer than oad spur
- Tarsomere I of legs I and II longer than
tarsomere II
- Tarsomere II of legs I and II not flattened
- Pulvillum absent (except Eneopterinae)
Male genitalia - Ectophallic arc not complete (except Cearacesaini)
- MedLophi bilobated when present (except Veredatrypa)
- Ectophallic arc complete (except
Landrevinae)
- MedLophi single when present.
Ovipositor - Apex of ovipositor with lateral serrulation or projections
(except Euscyrtinae)
- Apex of ovipositor with smooth laterals,
without projections
Habitat - Different types of vegetation, from grasses to canopies
(except some species of the genus group
Prognathogryllus)
- Vegetation, under barks, litter, ground,
cavities

16 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
ectophallic arc not connected (Fig. S7A) (except
Cearacesaini).
Differential diagnosis: Oecanthidae are separated
from Mogoplistidae by the presence of subapical spurs
on serrulated hind tibiae (subapical spurs lacking in
Mogoplistidae). They are separated from Trigonidiidae
by their serrulated TIII, head shape, lack of strong
setae on the head and body, number of apical spurs
on TI and TIII and male pseudepiphallic sclerite (see:
Desutter-Grandcolas et al., 2021). They are separated
from Phalangopsidae by the different number of spurs
on TIII, FIII longer than TIII, the second tarsomere
flattened (except in some Phaloriinae) and presence
of pulvillum. Finally, they are also excluded from
Gryllidae by the shape of MedLophi and LLophi,
presence of serrulation above the subapical spurs
on TIII, head pubescent, the fastigium shape (wider
in Gryllidae), antennal scape not reduced, first and
second tarsomeres same-sized (first tarsomere longer
than the second in Gryllidae), presence of pulvillum
(also present in Eneopterinae) (Table 6).
Included subfamilies: Euscyrtinae Gorochov, 1985,
Oecanthinae Blanchard, 1845 defin. nov., Podoscirtinae
Saussure, 1878 defin. nov., Tafaliscinae Desutter, 1988
defin. nov.
Remarks: Oecanthidae are mainly composed of crickets
that live in plants, from long grasses to tall trees. The
apex of their ovipositor, generally strongly sclerotized,
bears serrulation and/or structures adapted to
ovipositing inside leaves and under the bark of trees.
Their forewings are diverse, and several groups are
characterized by their acoustic apparatus or non-
acoustic communication structures. This newly erected
family was considered as the clade F in Chintauan-
Marquier et al. (2016) and was split between the
subfamily Oecanthinae and the Podoscirtinae
Subfamily Group by Cigliano et al. (2022). Based on
the phylogenetic hypotheses presented above, with
solid support and the morphological synapomorphies
(Table 4; Supporting Information, Fig. S10), we have
enough evidence to elevate this lineage to family level
(Fig. 3; Supporting Information, Figs S13, S14) and
separate it from Gryllidae defin. nov.
subfamily euscyrTinae gorochov, 1985
Euscyrtinae Gorochov, 1985: 89, Gorochov, 1986: 138,
Gorochov, 1987: 1–192, Desutter, 1987: 234, Otte,
1994: 70, Yin & Liu, 1995: 116, Yang & Yang, 2012:
1–45, Gorochov, 2015: 31–41, Chintauan-Marquier
et al., 2016: 73, Rentz & Su, 2019: 192, Meena &
Swaminathan, 2020: 559.
Type genus: Euscyrtus Guérin-Méneville, 1844.
Distribution: Tropical regions, except South America.
Diagnosis: Mainly found in shrubs and tall grasses,
from small to medium size. Top of fastigium truncated
in frontal and lateral views (Fig. 5B; Supporting
Information, Fig. S1G). TIII with six or more inner
subapical spurs; claws inner margin serrulate (Fig. 5C;
Supporting Information, Fig. S6Gb), more or less as in
Trigonidiinae (Trigonidiidae). FWs present or absent,
when present generally without stridulatory apparatus.
Ovipositor generally downcurved in lateral view; apex of
dorsal valves above ventral apex of ventral valves; apex
not enlarged; lateral margins of apex smooth (Fig. 5D).
Figure 5. A, Euscyrtus aff. bipunctatus, male, dorsal habitus. Proturana subapterus: B, head and pronotum, lateral view;
C, claw; D, ovipositor; dorsal view. Scales: 1mm.

THE FIFTH FAMILY OF TRUE CRICKETS 17
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
Included genera: Beybienkoana Gorochov, 1988,
Burrianus Chopard, 1962, Euscyrtodes Gorochov,
1987, Euscyrtus Guérin-Méneville, 1844, Merrinella
Otte & Alexander, 1983, Patiscodes Gorochov, 1988,
Patiscus Stål, 1877, Proturana Otte, 1987, Tozeria Otte
& Alexander, 1983, Turana Otte & Alexander, 1983
Remarks: There have been no records of these
crickets in South America until now. However, some
representatives (not yet described) with all features
of Euscyrtinae were observed in the MNHN collection
registered from South America (LDC, pers. obs.).
subfamily OECANTHINAE blanchard, 1845
DEfIN. NOv.
Oecanthites Blanchard, 1845: 245, Saussure, 1874:
428, Saussure, 1878: 590.
Oecanthiens Saussure, 1874: 427, Saussure, 1878: 534.
Oecanthinae Saussure, 1897: 251, Scudder, 1987:
62, Azam, 1901: 104, Kirby, 1906: 109, Zeuner, 1939:
212, Walker, 1966: 265, Otte & Alexander, 1983: 374,
Gorochov 1986: 851–858, Toms & Otte, 1988: 471,
Nickle, 1992: 195, Otte, 1994: 85, Rentz, 1996: 147, Otte
& Perez-Gelabert, 2009: 491, Gorochov, 2015: 31–34,
Collins & Carson, 2014: 170, Chintauan-Marquier
et al., 2016: 73, Rentz & Su, 2019: 231.
Type genus: Oecanthus Serville, 1831.
Distribution: Worldwide.
Diagnosis: Generally found in trees or bushes.
Almost all representatives with well-developed FWs
and stridulatory apparatus (except in Paraphasius
Chopard, 1927, Leptogryllus Perkins, 1899 and
Thaumatogryllus Perkins, 1899); lateral field not
perpendicular to dorsal field, forming less than 90°
angle (easily observable in posterior view) Supporting
Information, (Fig. S2J2). TIII iav spur significantly
reduced (Supporting Information, Fig. S6E). Dorsal
valves of ovipositor bifurcate (Supporting Information,
Figs S4Ja, S5C, D), covering ventral valves laterally.
Male genitalia: pseudepiphallic sclerite wider than
long; LLophi bilobate.
Included supertribes: Oecanthidi Blanchard, 1845
supertrib.nov., Diatrypidi Desutter, 1988 supertrib. nov.,
Incertae sedis: Stenoecanthus Chopard, 1912.
superTribe OECANTHIDI blanchard, 1845
supErTrIb. NOv.
Oecanthites Blanchard, 1845: 245. Saussure, 1874:
428. Saussure, 1878: 590.
Type genus: Oecanthus Serville, 1831.
Distribution: Worldwide.
Diagnosis: Small to medium and generally slender
crickets; head prognathous; pronotum longer than wide,
caudal margin wider than cephalic margin in dorsal
view; FWs generally hyaline; when present, mirror well
developed, generally divided by two straight and parallel
veins (Fig. 6B; Supporting Information, Fig. S3H); apical
field generally absent or sometimes shorter than mirror;
auditory tympana oval and large present on inner and
Figure 6. A, Neoxabea brevipes, head dorsal view. Oecanthus sp.: B, male, pronotum and FW; C, claw. Scales: 1mm.

18 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
outer face of TI; inner ventral apical spur of TI and TII
absent; FIII thin, proximal portion with similar width of
distal portion in lateral view; dorsal spines of tarsomere
of leg III absent (Fig. 7A); claws bifid (Fig. 6C; Supporting
Information, Fig. S6G). Male genitalia: ectophallic arc
curved anteriorly; ectophallic apodeme generally short
(Supporting Information, Fig. S8G).
Included tribes: Oecanthini Blanchard, 1845, Xabeini
Vickery & Kevan, 1983
Incertae sedis: Paraphasius Chopard, 1927, Apiculatus
Yuan, Ma & Gu, 2022 (fossil), Birmanioecanthus Yuan,
Ma & Gu, 2022 (fossil).
Tribe oecanThini blanchard, 1845
Oecanthites Blanchard, 1845: 245, Saussure, 1874:
428, Saussure, 1878: 590.
Oecanthini Otte, 1994: 85, Rentz & Su, 2019: 232.
Type genus: Oecanthus Serville, 1831.
Distribution: Worldwide.
Diagnosis: Frequently green or pale brown, but with
representatives with other colours. Fifth article of
maxillary palpus straight; male metanotum generally
with a central fossa and a central cluster of bristles. Outer
ventral spur of TII absent; TIII generally with 3/3 subapical
spurs. Male genitalia: distal projection of ectophallic arc
present (Supporting Information, Fig. S8G).
Included genera: Oecanthodes Toms & Otte, 1988,
Oecanthus Serville, 1831, Viphyus Otte, 1988.
Tribe xabeini vickery & kevan, 1983
Xabeinae Vickery & Kevan, 1983:649.
Xabeini Otte, 1994: 87, Gorochov, 1995: 45, Rentz & Su,
2019: 235.
Type genus: Xabea Walker, 1869.
Distribution: Australasia, Indo-Malaya, Nearctic,
Neotropics and Oceania.
Diagnosis: Antennal scape sometimes with a distal
tubercle (Fig. 6A); FWs generally developed, except
for Leptogryllus and Thaumatogryllus, which are
brachypterous or apterous (endemic of Hawaiian
Islands). Cerci shorter than FII (Supporting
Information, Fig. S4G); TIII subapical spurs absent
(Fig. 7A); TIII oav and iav absent; spines, inner and
outer apical spurs of tarsomere I of leg III absent (Fig.
7B, C).
Included genera: Genus group Prognathogryllus
Zimmerman, 1948: Leptogryllus Perkins, 1899,
Prognathogryllus Brunner von Wattenwyl, 1895,
Thaumatogryllus Perkins, 1899; genus group Xabea
Vickery & Kevan, 1983: Neoxabea Kirby, 1906, Xabea
Walker, 1869
superTribe DIATrypIDI desuTTer, 1988
supErTrIb. NOv.
Diatrypini Desutter, 1987: 235, Desutter, 1988: 369,
Otte, 1994: 65, Gorochov, 1995: 1–213.
Diatrypina Gorochov, 2013: 16, Gorochov, 2017: 98.
Type genus: Diatrypa Saussure, 1874.
Distribution: Neotropics.
Diagnosis: Small-sized with developed HWs, FWs, and
stridulatory apparatus (Fig. 8A, B). FWs apical field
present, generally smaller or with same size of mirror;
TI auditory tympana present on inner and outer faces;
TIII subapical spurs 5/5. Female subgenital plate
posterior border surrounding ovipositor (Supporting
Information, Fig. S4J). Ventral valves of ovipositor
bifurcate; apex of ovipositor wider than the structure
in dorsal and ventral views (Supporting Information,
Figs S4J, S5C, D). Male genitalia: dorsal valves
Figure 7. Neoxabea brevipes. A, hind tibia and tarsi; B, hind tibia distal margin and tarsi, inner view; C, hind tibia distal
margin and tarsi, outer view. Scales: 1mm. Abbreviations: see Material and methods.

THE FIFTH FAMILY OF TRUE CRICKETS 19
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
well-developed; endophallic sclerite elongate, two
or more times longer than pseudepiphallic sclerite
(Supporting Information, Fig. S7D); spermatophore
generally well developed and well sclerotized.
Included genus: Diatrypa Saussure, 1874
Remarks: Previously considered a subtribe of
Aphonoidini (Podoscirtinae) (Cigliano et al., 2022), this
lineage is elevated to supertribe and is transferred to
Oecanthinae based on the phylogenetic hypotheses
presented here. This clade includes only one genus
divided into two subgenera with 67 species. The
genus Diatrypa must be reviewed, as many new taxa
(specimens observed in MNHN and MZSP) are to be
described. This group is presently poorly documented,
perhaps because it occurs mostly in the canopy.
subfamily pODOsCIrTINAE saussure, 1878
DEfIN. NOv.
Podoscirtites Saussure, 1878: 693, Saussure, 1893: 257.
Eneopterinae Kirby, 1906: 92, Chopard, 1968:
365, Chopard, 1969: 326. Vickery, 1977: 14, Otte &
Alexander, 1983: 1–477.
Eneopteridae Kevan, 1977: 40.
Podoscirtidae Bruner 1916: 416, Chopard, 1951: 491,
Desutter, 1987: 224, Desutter, 1988: 361.
Podoscirtinae Gorochov, 1986: 519, Otte, Alexande &
Cade, 1987: 448, Vasanth, 1993: 114, Otte, 1994: 72,
86. Oshiro, 1995: 37, Yin, Haisheng & Liu, 1995: 213,
Ingrisch, 1997: 48, Gorochov, 2002: 303–350, Gorochov,
2003: 267-303, Gorochov, 2004: 33, Gorochov, 2005: 181–
208, Gorochov, 2006: 33–46, Gorochov, 2007: 237–289,
Gorochov, 2008: 15, Gorochov, 2010: 205–245, Gorochov,
2011: 216–270, Gorochov, 2013: 15–58, Gorochov, 2015:
31–41, Anso, Jourdan & Desutter-Grandcolas, 2016:
30, Desutter-Grandcolas, Anso & Jourdan, 2016: 436,
Gorochov, 2017: 11–106, Gorochov, 2018: 77–121, Rentz
& Su, 2019: 124, Gorochov, 2020: 248, Gorochov, 2021:
65, Gorochov, 2021: 381–389, Zheng et al., 2021: 401.
Type genus: Podoscirtus Serville, 1838.
Distribution: Worldwide.
Diagnosis: Small to large-sized, body generally
fusiform, intensely covered by bristles, with developed
FWs, sometimes with stridulatory apparatus not
developed. TIII with five or more outer and inner
subapical spurs. Apex of dorsal valves of ovipositor
serrulate laterally and ventrally, covering ventral
valves laterally and sometimes ventrally (Fig. 9B,
C). Male genitalia: apex of ectophallic fold bilobate;
posterior projection of endophallus double (U-shaped)
(Fig. 9A) when present; EndAp generally flattened
laterally.
Included supertribes and genera: Podoscirtidi
Saussure, 1878 supertrib.nov., Hapithidi Gorochov,
1986 supertrib. nov.
Incertae sedis: Allopterites Cockerell, 1920 (fossil),
Stenogryllodes Chopard, 1936 (fossil).
superTribe pODOsCIrTIDI saussure, 1878
supErTrIb. NOv.
Podoscirtites Saussure, 1878: 693. Saussure, 1893: 257.
Type genus: Podoscirtus Serville, 1838.
Figure 8. Diatrypa (Diatrypa) tuberculata. A, female; B, male.

20 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
Distribution: Afrotropics, Australasia, Indo-Malaya,
Oceania and Palaearctic.
Diagnosis: FWs and HWs well developed, frequently
covering the entire abdomen, generally with stridulatory
apparatus developed (Fig. 10A), sometimes with FWs
bearing only longitudinal veins (Fig. 10B). When
stridulatory apparatus developed, stridulatory vein
(PCu) curved, forming a 90° angle, proximal branch
parallel to CuPa (Fig. 10C); CuPa higher than CuPb in
lateral view. TI inner tympanum, when present, generally
profound. Male genitalia: MedLophi of pseudepiphallic
sclerite when present, short; MedLophi dorsal to LLophi
(Fig. 10D; Supporting Information, Fig. S8E).
Included tribes: Aphonoidini Gorochov, 1986,
Podoscirtini Saussure, 1878, Truljaliini Gorochov, 2020
defin. nov.
Remarks: The clade corresponding in our phylogeny
to the Podoscirtidi is clearly undersampled. Future
phylogenetic studies on this supertribe, including more
taxa, will be necessary to organize and verify more tribes
as proposed herein. Besides, Prozvenella bangaloriensis
appears isolated in the ML (Supporting Information,
Fig. S13) and MP (Supporting Information, Fig. S14)
trees. In BI this taxon resolves inside Podoscirtini
(Fig. 3). Thus, we decided to maintain this genus as
classified in Cigliano et al. (2022). For these reasons,
we avoid designing subtribes, as the relations between,
and definitions of, present-day genus groups are still
unclear.
Tribe aphonoidini gorochov, 1986
Aphonoidini Gorochov, 1986: 521, Desutter, 1987: 234,
Otte, 1994: 77, Gororchov, 1995: 29, Gorochov, 2007:
237, Gorochov, 2008: 15, Gorochov, 2013: 15-58, Rentz
& Su, 2019: 124.
Type genus: Aphonoides Chopard, 1940.
Distribution: Afrotropics, Australasia, Indo-Malaya,
Oceania and Palaearctic.
Diagnosis: Small to medium crickets, TI bearing at
least one tympanum. Male: FWs with longitudinal
veins, lacking stridulatory apparatus, anal area not
delimited (Fig. 10B); subgenital plate longer than
wide, posterior margin straight. Male genitalia:
spermatophore generally elongated, well sclerotized.
MedLophi absent; endophallic sclerite generally not
symmetric. Female: subgenital plate posterior margin
without median invagination; apex of ovipositor well
Figure 9. A, Ultratrella gracilis, male genitalia, ventral view. B, Taroba elephantina, apex of ovipositor: a, dorsal view, b,
ventral view. C, Idiotrella karnyi, apex of ovipositor: a, dorsal view, b, ventral view. Scales: 1mm. Abbreviations: see Material
and methods.

THE FIFTH FAMILY OF TRUE CRICKETS 21
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
sclerotized as in Oecanthinae; apex of dv wider than
the rest of ovipositor; vv longer than dv.
Included genera: Aphasius Saussure, 1878,
Corixogryllus Bolívar, 1900, Gryllaphonus Chopard,
1951, Munda Stål, 1877, Umbulgaria Otte & Alexander,
1983, Utona Gorochov, 1986; genus group Aphonoides
Gorochov, 2008: Aphonoides Chopard, 1940, Exomunda
Gorochov, 2007, Furcimunda Gorochov, 2007,
Zamunda Gorochov, 2007; genus group Deinutona
Gorochov, 2008: Deinutona Gorochov, 2008, Paputona
Gorochov, 2008; genus group Mistshenkoana Gorochov,
2008: Dinomunda Gorochov, 2007, Mistshenkoana
Gorochov, 1990; genus group Protomunda Gorochov, 2008:
Brevimunda Gorochov, 2007, Protomunda Gorochov,
2007; genus group Unka Gorochov, 2008: Pseudounka
Gorochov, 2008, Unka Otte & Alexander, 1983.
podoscirTini saussure, 1878
Podoscirtites Saussure, 1878: 693, Saussure, 1893: 257.
Podoscirtinae Desutter, 1987: 234.
Podoscirtini Chopard, 1968: 365, Otte & Alexander,
1983: 310, Otte, 1994: 72, Otte, 1994: 86, Rentz, 1996:
138, Gorochov, 2004: 187–215, Gorochov, 2010: 206,
Rentz & Su, 2019: 156.
Type genus: Podoscirtus Serville, 1838.
Distribution: Afrotropics, Australasia, Indo-Malaya,
Oceania and Palaearctic.
Diagnosis: Small to large size crickets. Male: FWs
generally developed bearing stridulatory apparatus,
sometimes without hv or mirror (or both). Male
genitalia: pseudepiphallic sclerite generally capsular
(Fig. 10D; Supporting Information, Fig. S7F); apex
of LLophi frequently curved upwards (Supporting
Information, Fig. S7F). Female: apex of dv of ovipositor
pointed, its surface smooth, presence of bristles in apex
inner margin (Fig. 9C); apex of vv generally rounded.
Included genera: Abaxitrella Gorochov, 2002,
Adenopterus Chopard, 1951, Anaudus Saussure,
1874, Anisotrypus Saussure, 1878, Archenopterus
Otte, 1987, Atrella Gorochov, 2003, Calscirtus Otte,
1987, Furcitrella Gorochov, 2002, Fryerius Uvarov,
1940, Hemiphonoides Chopard, 1951, Hemitrella
Gorochov, 2003, Heterecous Saussure, 1897,
Homalotrypus Brancsik, 1895, Idiotrella Gorochov,
2002 (transferred from Aphonomorphini), Indotrella
Gorochov, 2003, Insulascirtus Otte & Rentz, 1985,
Matuanus Gorochov, 1986, Mnesibulus Stål, 1877,
Noctitrella Gorochov, 1990, Ocellotrella Gorochov,
2021, Parametrypa Brunner von Wattenwyl, 1873
(transferred from Paroecanthini), Paranaudus
Saussure, 1878, Phyllotrella Gorochov, 1988, Pixipterus
Desutter-Grandcolas, 2016, Poliotrella Gorochov,
1988, Posus Bolívar, 1890, Prozvenella Gorochov,
2002, Pseudomadasumma Shiraki, 1930, Rupilius
Stål, 1876, Scepastus Gerstaecker, 1863, Trelleora
Gorochov, 1988, Valiatrella Gorochov, 2005, Varitrella
Gorochov, 2003, Xuanwua He & Gorochov, 2015,
Figure 10. A, Fryerius sp., male, dorsal habitus; B, Munda aff. asyrinx, male, dorsal habitus; C, Truljalia hibinonis, male,
pronotum and FW, dorsal view; D, Madasumma melanotum, male genitalia, lateral view. Scales: 1mm. Abbreviations: see
Material and methods.

22 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
Zvenella Gorochov, 1988; genus group Hemiphonus
Otte & Alexander, 1983: Hemiphonus Saussure,
1878, Riatina Otte & Alexander, 1983; genus group
Madasumma Otte & Alexander, 1983: Madasumma
Walker, 1869, Tamborina Otte & Alexander, 1983
Subtribe Podoscirtina Saussure, 1878: Allotrella
Gorochov, 2006, Atruljalia Gorochov, 1988, Brevitrella
Gorochov, 2004, Eupodoscirtus Gorochov, 2004,
Kilimagryllus Sjöstedt, 1910, Malawitrella Gorochov,
2021, Malgasotrella Gorochov, 2004, Neozvenella
Gorochov, 2004, Ombrotrella Gorochov, 2006,
Podoscirtus Serville, 1838, Spinotrella Gorochov, 2004,
Stenotrella Gorochov, 2005, Ultratrella Gorochov, 2004,
Zvenellomorpha Gorochov, 2004.
Remarks: The genus Parametrypa Brunner von
Wattenwyl, 1873 was recently transferred to the
Neotropical tribe Paroecanthini (Gorochov, 2021). However,
this genus is from the southern African continent, and
there are no males described for any species. Male
characters are crucial for the classification of Oecanthidae.
The poor knowledge of this genus and its discrepant
distribution could support the reallocation of Parametrypa
to Podoscirtini again. There is a similar situation
for Idiotrella Gorochov, 2002. According to Cigliano
et al. (2022), this genus belongs to Aphonomorphini, a
Neotropical tribe; however, the distribution of Idiotrella
is through southern China and Indonesia. Moreover, the
male genital structures and a developed stridulatory
apparatus match with Podoscirtini, not Aphonomorphini,
whose forewings have only longitudinal veins (see
Aphonomorphini diagnosis below).
Tribe TruljAlIINI gorochov, 2020 DEfIN. NOv.
Truljaliina Gorochov, 2020:248.
Type genus: Truljalia Gorochov, 1985.
Distribution: Afrotropics, Indo-Malaya and
Palaearctic.
Diagnosis: Medium to large size crickets. Pronotum
DD flattened in lateral view (Supporting Information,
Fig. S4Bb); TI inner tympanum generally covered by
sclerotized tab (Supporting Information, Fig. S5I); TIII
subapical spurs 6/6 or more. Male: FWs well developed,
bearing stridulatory apparatus (Fig. 10C). Male
genitalia: PsP generally cylindrical, its tip pointed (Fig.
10E); endophallic sclerite sometimes regressed as in
Truljalia Gorochov, 1985 and Sonotrella Gorochov, 1988.
Included genera: Sonotrella Gorochov, 1988, Truljalia
Gorochov, 1985; genus group Dolichogryllus Gorochov,
2005: Acrophonus Bolívar, 1910, Afrotruljalia
Gorochov, 2005, Depressotrella Gorochov, 2005,
Dolichogryllus Bolívar, 1910, Eumadasumma
Chopard, 1934, Hemitruljalia Gorochov, 2005,
Pachyaphonus Chopard, 1954, Pseudotruljalia
Gorochov, 2005.
superTribe HApITHIDI gorochov, 1986
supErTrIb. NOv.
Hapithini Gorochov, 1986: 521.
Hapithinae Desutter, 1987: 234. Desutter, 1988: 362.
Type genus: Hapithus Uhler, 1864.
Distribution: Nearctic and Neotropics.
Diagnosis: Small to large-sized, FWs generally
developed, stridulatory apparatus, present or absent.
Lateral and median ocelli almost aligned (Fig. 11A);
fifth article of maxillary palpus upcurved almost 90°,
sensilla region apical (Fig. 11B); pronotum caudal
margin convex on the middle. When stridulatory
apparatus present: stridulatory file generally sinuous,
with stridulatory file on the midlength; bearing one
or two transversals harp veins, almost parallel to
stridulatory file (Figs 14B, 15B). Female subgenital
plate concave or with a median invagination. Male
genitalia: EctF apex bilobate; endophallus U-shaped.
Included tribes: Aphonomorphini Desutter, 1988,
Cearacesaini Koçak & Kemal, 2010, Hapithini
Gorochov, 1986, Phyllogryllini Campos, trib. nov.
Figure 11. A, Cearacesa sp., frontal head; B, A. (Aphonomorphus) aff. montanus, maxillary palpus. Scale: 1mm.

THE FIFTH FAMILY OF TRUE CRICKETS 23
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
Remarks: Previously considered a subfamily, we
propose this supertribe to organize the classification
of Podoscirtinae.
Tribe aphonomorphini desuTTer, 1988
Aphonomorphini Desutter, 1988: 362, Otte, 1994: 78,
Gorochov, 1995: 29.
Type genus: Aphonomorphus Rehn, 1903.
Distribution: Neotropics.
Diagnosis: Medium to large-sized; FWs and HWs
developed, surpassing abdomen, FWs without stridulatory
apparatus, shorter than HWs (Fig. 12A). Posterior
margin of eyes slightly concave (Fig. 12B; Supporting
Information, Fig. S1Ea); PCu vein not curved, sometimes
with stridulatory teeth on ventral face; TI inner tympana
present (except Paraphonus), frequently profound; Apical
spurs of tarsomere I of leg III same-size or longer than
tarsomere I (Fig. 12C, D). Male genitalia: elongated,
sometimes asymmetric (Fig. 12E); EctAp elongated;
ectophallic arc straight; EndAp well developed, flattened
laterally (Fig. 12E; Supporting Information, Fig. S9A).
Included genera: Aenigmaphonus Gorochov, 2010,
Aphonomorphus Rehn, 1903, Eneopteroides Chopard,
1956, Podoscirtodes Chopard, 1956 (transferred
from Podoscirtinae), Paraphonus Hebard, 1928,
Spiraphonus Gorochov, 2010.
Remarks: Aphonomorphini do not have a stridulatory
apparatus. However, several representatives of this
group, like Aphonomorphus and Eneopteroides, have
stridulatory teeth in the ventral face of the PCu vein,
which is not curved. These crickets also have tympana
on TI, indicating that they could emit acoustic
signals or avoid predators. There are no records of
acoustic communication within this tribe. The genus
Podoscirtodes was included in the Podoscirtinae
subfamily (Cigliano et al., 2022), but it does not belong
to any group inside this subfamily. The characteristics
mentioned in the diagnosis above fit the characteristics
of this genus, allowing its transfer to Aphonomorphini.
Furthermore, the records of Podoscirtodes are all from
Neotropical region (Cigliano et al., 2022), which match
the distribution of the Aphonomorphini tribe.
Tribe cearacesaini koçak & kemal, 2010
Neomorphini Desutter, 1988: 364, Otte, 1994: 80,
Cearacesaini Koçak & Kemal, 2010: 155, Desutter-
Grandcolas, 2017: 117–124, Cearacesaina Gorochov,
2017: 54.
Type genus: Cearacesa Koçak & Kemal, 2010 (for
Neomorphus Desutter, 1988).
Distribution: Neotropics, only South America.
Figure 12. Eneopteroides bicolor: A, male, dorsal habitus; B, head and pronotum, lateral view. A. (Aphonomorphus)
aff. montanus: C, hind tibia distal margin and tarsi, inner view; D, hind tibia distal margin and tarsi, outer view. E, A.
(Euaphonus) sp., male genitalia, ventral view. Scales: 1mm. Abbreviations: see Material and methods.

24 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
Diagnosis: Small to medium-sized, FWs and HWs
developed (except Taroba elephantina de Mello &
Souza-Dias, 2010), surpassing abdomen, without
stridulatory apparatus (Fig. 13A). Eyes crossed by
horizontal bands, generally two or three (Figs 11A,
13A; Supporting Information, Fig. S1F); veins of
lateral field of FWs parallel to dorsal field; TIII with
5/5 subapical spurs, sometimes six on inner side.
Male genitalia: rami connected anteriorly (Fig. 13B;
Supporting Information, Fig. S8I); ectophallic arc
connected.
Included genera: Barota Gorochov, 2017, Cearacesa
Koçak & Kemal, 2010, Najtaecesa Desutter-Grandcolas,
2017, Taroba de Mello & Souza-Dias, 2010.
Remarks: Like Aphonomorphini crickets, Cearacesaini
have developed FWs without stridulatory apparatus.
However, this group does not have stridulatory teeth
on the ventral face of the PCu vein, suggesting that
these crickets do not use their tympana for acoustic
communication. Their external morphology is extremely
diverse between the species of this tribe (see: Desutter-
Grandcolas, 2017), so male genitalia are necessary for
their identification. This is the only oecanthid taxon
with the ectophallic arc complete (Fig. 13B).
Tribe hapiThini gorochov, 1986
Hapithini Gorochov, 1986: 521, Desutter, 1987: 234,
Otte, 1994: 79, Desutter-Grandcolas & Bland, 2003: 48,
Gorochov, 2017: 13.
Type genus: Hapithus Uhler, 1864.
Distribution: Neotropics and southern Nearctic.
Diagnosis: Small to medium-sized, FWs developed,
sometimes brachypterous (Margarettia and Knyella),
bearing a well-developed stridulatory apparatus
(Fig. 14A). Male metanotum sometimes with median
projection; FWs mirror with or without a dividing vein,
generally shorter than apical field (Fig. 14B); tympana
frequently present on both sides of TI; TIII subapical
spurs generally 8/6, with variations from five to ten
on inner margin and from five to seven on outer
margin; apical spurs of tarsomere I of leg III shorter
than tarsomere I of leg III. Ovipositor ventral valves
laterally serrulate. Male genitalia: LLophi dorsal to
MedLophi (Fig. 14C; Supporting Information, Fig.
S8D); PsP lateral and connected to pseudepiphallic
(Supporting Information, Fig. S8C); EctF bilobate and
connected distally, proximal portion convex (forming
dorsal cavity) in dorsal and ventral views (Supporting
Information, Fig. S8C).
Included genera: Carylla Otte & Perez-Gelabert,
2009, Hapithus Uhler, 1864, Hapithoides Hebard,
1928, Jabulania Otte & Perez-Gelabert, 2009, Knyella
Otte & Perez-Gelabert, 2009, Laurellia Otte & Perez-
Gelabert, 2009, Margarettia Otte & Perez-Gelabert,
2009, Sabelo Otte & Perez-Gelabert, 2009, Sipho Otte
& Perez-Gelabert, 2009, Stenogryllus Saussure, 1878,
Walkerana Otte & Perez-Gelabert, 2009.
Tribe pHyllOgryllINI campos TrIb. NOv.
Zoobank registration: urn:lsid:zoobank.
org:act:7FFCCBCF-4064-46D9-B329-E53254666904.
Type genus: Phyllogryllus Saussure, 1878.
Distribution: Neotropics.
Diagnosis: Medium to large-sized, FWs well developed,
surpassing abdomen, bearing a stridulatory apparatus,
HWs longer than FWs (Fig. 15A). Lateral and median
ocelli connected laterally or remarkably close to each
Figure 13. A, Cearacesa sp., male; B, Cearacesa cearensis, male genitalia, dorsal view. Scale: 1mm. Abbreviations: see
Material and methods.

THE FIFTH FAMILY OF TRUE CRICKETS 25
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
other (Fig. 15C; Supporting Information, Fig. S1D);
pronotum DD flattened in lateral view (Supporting
Information, Fig. S4Bb); FWs lateral field shorter than
dorsal field; TIII with six or seven inner and four to six
outers subapical spurs; apical spurs of tarsomere I of leg
III same-size or longer than tarsomere I. Male genitalia:
MedLophi absent; anterior margin of pseudepiphallic
sclerite upcurved (Supporting Information, Fig. S8F);
r shorter than pseudepiphallic sclerite (Fig. 15D).
Female copulatory papilla generally poorly sclerotized,
sometimes almost no discernible.
Differential diagnosis: Phyllogryllini is excluded
from all the other tribes of Hapithidi by the median
Figure 14. A, H. (Hapithus) vagus, male, dorsal habitus; B, Stenogryllus sp., male, pronotum and FW, dorsal view; C, H.
(Hapithus) sp., male genitalia, lateral view. Scales: 1mm. Abbreviations: see Material and methods.
Figure 15. A, Phyllogryllus velutinus, male, dorsal habitus; B, Gryllophyllus sp., male, pronotum and FW, dorsal view.
Phyllogryllus sp.: C, frontal head; D, male genitalia, lateral view. Scales: 1 mm. Abbreviations: see Material and methods.

26 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
and lateral ocelli close (sometimes connected)
and MedLophi of male genitalia absent. It is
excluded from Aphonomorphini by the presence of
stridulatory apparatus, symmetrical pseudepiphallic
sclerite, ectophallic arc posteriorly bent (straight
in Aphonomorphini) and spermatophore poorly
sclerotized (strongly sclerotized in Aphonomorphini).
It is excluded from Cearacesaini by the presence of
stridulatory apparatus, ectophallic arc not complete
and distal apex of rami not connected. It is also
excluded from Hapithini by the long FWs surpassing
the abdomen, apical field longer than mirror, PsP
ventral and not connected to pseudepiphallic sclerite
(lateral and connected to pseudepiphallic sclerite in
Hapithini).
Remarks: Considered previously as Hapithini, this
new tribe appears as a separate lineage from the other
tribes of Hapithidi (Fig. 3; Supporting Information,
Figs S13, S14). Despite the fact that there are no
morphological synapomorphies in this clade, the
morphological characters mentioned in the diagnosis
also support this hypothesis.
Included genera: Gryllophyllus Gorochov, 2017,
Phyllogryllus Saussure, 1878, Somnambula Gorochov,
2017.
subfamily TAfAlIsCINAE desuTTer, 1988,
DEfIN NOv.
Tafaliscinae Desutter, 1988: 367.
Tafaliscini Desutter, 1988: 367, Otte, 1994: 68,
Gorochov, 1995: 1–213.
Tafaliscina Gorochov, 2011: 254, Gorochov, 2017: 87,
Campos, Souza-Dias & Nihei, 2020: 333, Campos &
Desutter-Grandcolas, 2020: 393.
Type genus: Tafalisca Walker, 1869.
Distribution: Neotropics.
Diagnosis: Small to large-sized, FWs absent,
brachypterous or well-developed wings (with or
without stridulatory apparatus) (Figs 17A, 18A,
19A; Supporting Information, Fig. S2A–C). Fifth and
fourth articles of maxillary palpi with similar size,
fifth article slightly upcurved (Fig. 16A); when FWs
with stridulatory apparatus present; stridulatory
file sinuous or bisinuous (Paroecanthini): proximal
connection of harp veins generally present. FIII
generally longer than TIII; TIII subapical spurs 5/4
(Supporting Information, Fig. S6B) (except some
Paroecanthini 5/5 and Perutrella 4/3). Ovipositor
flattened dorso-ventrally, upcurved in lateral view;
apex of dorsal valves above ventral valves (Fig. 16B);
apex lateral margins of ventral valves of ovipositor
smooth (Fig. 16Cb). Male genitalia: inner margin
of LLophi frequently membranous (Supporting
Information, Fig. S7A, C).
Included supertribes: Paroecanthidi Gorochov, 1986,
supertrib.nov., Tafaliscidi Desutter, 1988, supertrib.
nov.
Remarks: After its proposal (Desutter, 1988), this
subfamily was considered as a tribe (Gorochov, 1995)
and later as a subtribe (Gorochov, 2011) within the
Podoscirtinae subfamily. The results presented here,
including the topologies and their synapomorphies,
support the hypothesis that this Neotropical lineage is a
subfamily of Oecanthidae composed of two supertribes
(Paroecanthidi and Tafaliscidi) redefined below.
superTribe pArOECANTHIDI gorochov, 1986,
supErTrIb. NOv.
Paroecanthini Gorochov, 1986:516, Desutter, 1987: 235,
Desutter, 1988: 369, Otte, 1994: 68, Gorochov, 2011:
Figure 16. A, Tafalisca elongata elongata, maxillary palpus; B, Apterotrypa mitarakensis, ovipositor, lateral view; C,
Angustitrella vicina, apex of ovipositor: a, dorsal view; b, ventral view. Scales: 1mm. Abbreviations: see Material and methods.

THE FIFTH FAMILY OF TRUE CRICKETS 27
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
217, Gorochov, 2017: 81, Campos, Souza-Dias & Nihei,
2020: 333, Campos & Desutter-Grandcolas, 2020: 356.
Type genus: Paroecanthus Saussure, 1859.
Distribution: Neotropics.
Diagnosis: Small to medium-sized crickets, FWs
developed, brachypterous or without wings. Pronotum
as wide as long or longer than wide; metanotal
structures frequently present (Supporting Information,
Fig. S4C, E). Apex surface of dorsal valves of ovipositor
wrinkled (Fig. 16Ca). Male genitalia: EndAp absent
(Fig. 18C; Supporting Information, Fig. S8B, H).
Included tribes: Paroecanthini Gorochov, 1986,
Neometrypini Desutter, 1988.
Tribe pArOECANTHINI gorochov, 1986 DEfIN.
NOv.
Paroecanthini Gorochov, 1986:516, Desutter, 1987: 235,
Desutter, 1988: 369, Otte, 1994: 68, Gorochov, 2011:
217, Gorochov, 2017: 81, Campos, Souza-Dias & Nihei,
2020: 333, Campos & Desutter-Grandcolas, 2020: 356,
Paroecanthina Gorochov, 2011:218, Gorochov, 2017: 81,
Campos & Desutter-Grandcolas, 2020: 393.
Type genus: Paroecanthus Saussure, 1859.
Distribution: Neotropics.
Diagnosis: Small to medium-sized, body somewhat
flattened dorso-ventrally, FWs well developed bearing
stridulatory apparatus (Fig. 17A). TI inner tympanum
generally profound, sometimes covered by a sclerotized
tab (Supporting Information, Fig. S5I); FWs
stridulatory file bisinuous (Supporting Information,
Fig. S3Bc) with stridulatory teeth on proximal region;
hv divided into two or more clusters (Fig. 17B); lateral
field forming a > 90° angle with dorsal field (observed
in posterior view, Supporting Information, Fig. S2J2).
Male genitalia: generally reduced, mainly ectophallic
invagination and endophallus (Fig. 17C; Supporting
Information, Fig. S8B) (except Adenophallusia
de Mello & de Camargo e Mello, 1996); MedLophi
frequently absent; r two or more times longer than
pseudepiphallic sclerite (Figs 17C, 20H, I; Supporting
Information, Fig. S8B).
Included genera: Adenophallusia de Mello & de
Camargo e Mello, 1996 (transferred from Tafaliscina),
Angustitrella Gorochov, 2011, Bofana Otte &
Perez-Gelabert, 2009, Ectotrypa Saussure, 1874,
Paroecanthus Saussure, 1859, Prodiatrypa Desutter,
1988 (transferred from Tafaliscina), Selvagryllus Otte,
2006, Siccotrella Gorochov, 2011
Remarks: This tribe, recently transferred to
Oecanthinae (Campos & Desutter-Grandcolas, 2020),
was previously considered a tribe of Tafaliscinae
(Desutter, 1988), corroborating in part with our
results. The genus Prodiatrypa Desutter, 1988 has
all the diagnostic characteristics of Paroecanthini,
Figure 17. Angustitrella sp., male: A, dorsal habitus; B, right FW. C, Paroecanhtus aztecus, male genitalia, dorsal view.
Scales: 1 mm. Abbreviations: see Material and methods.

28 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
such as stridulatory veins bisinuous and regressed
genital structures of males. Because of this, it is
transferred to this tribe. Adenophallusia also has
several Paroecanthini characters, like the bisinuous
stridulatory file, the tip of the apex of the ovipositor
rounded and the dorsal valves surface wrinkled.
Besides, the phylogeny presented herein shows
Adenophallusia belonging to the Paroecanthini clade.
This relationship is not well supported. However, the
morphological evidence indicates a close relationship
between Adenophallusia and Paroecanthini crickets.
Tribe neomeTrypini desuTTer, 1988
Neometrypini Desutter, 1988:367. Otte, 1994: 68.
Neometrypina Gorochov, 2010: 207.
Type genus: Neometrypus Desutter, 1988.
Distribution: Neotropics, only in South America.
Diagnosis: Small to medium-sized crickets with
elongated body, fusiform. Pronotum longer than
wide; median projection of metanotum present,
generally single (Fig. 18B; Supporting Information,
Fig. S4E); apterous (Supporting Information, Fig.
S2A), brachypterous (Supporting Information, Fig.
S2B) or with-developed wings (Fig. 18A), but without
stridulatory apparatus, only with longitudinal
veins; TI tympana absent. Apex of dorsal valves
of ovipositor wrinkled. Male genitalia: MedLophi
absent; pseudepiphallic apodeme present (Fig. 18C;
Supporting Information, Fig. S8H); apex of PsP
bilobate; endophallic sclerite flattened dorsoventrally.
Included genera: Apterotrypa Gorochov, 2017,
defin. nov., Brazitrypa Gorochov, 2011, Cylindrogryllus
Saussure, 1878, Dicerorostrum Gorochov, 2017
(transferred from Podoscirtinae), Neometrypus
Desutter, 1988, Nessa Walker, 1869 (transferred from
Podoscirtinae).
Remarks: This group is re-established with the
presented results corroborating its initial placement
(Desutter, 1988). There is no evidence of acoustic
communication in this group. FW veins are not
modified for sound production; they are reduced
(brachypterous), or absent, and tympana are absent.
The description of the genus Nessa seems to be
remarkably similar to Brazitrypa. However, as the
type species of the genus could not be examined, the
genus is still considered valid, but it is transferred
Figure 18. A, Brazitrypa paulista, male; B, Cylindrogryllus pitanga, male, FWs and metanotum; C, Neometrypus badius,
male genitalia, ventral view. Scales: 1 mm. Abbreviations: see Material and methods.

THE FIFTH FAMILY OF TRUE CRICKETS 29
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
here from Podoscirtini to Neometrypini due to its
morphological similarity with Brazitrypa and to its
Neotropical distribution. A similar situation happens
with Dicerorostrum, which has the characteristics
of Neometrypini crickets, i.e. FWs with longitudinal
veins, MedLophi of male genitalia absent, apex of PsP
bilobate, endophallic sclerite flattened dorso-ventrally;
it is also Neotropical in distribution. These features
allow transferring Dicerorostrum from Podoscirtinae
incertae sedis to Neometrypini.
According to the phylogenetic analysis results
presented herein, the two subgenera of Cylindrogryllus
are actually different genera, i.e. Cylindrogryllus and
Apterotrypa. In the same way, the genus Neometrypus,
previously considered a subgenus of Cylindrogryllus
(Gorochov, 2017), was recently reassigned to the
genus level (Campos & Souza-Dias, 2021), which is
supported by our topology. The phylogenetic analysis
also shows that Tafalisca bahiensis (Saussure, 1878)
belongs to the genus Brazitrypa, resulting in the new
combination here proposed, Brazitrypa bahiensis
(Saussure, 1878) comb. nov. Taxonomists frequently
mixed up Brazitrypa and Tafalisca identifications
(Campos & Desutter-Grandcolas, 2020) due to their
similar external morphology, with longitudinal veins
on FWs. The morphological characters, such as the
lack of ocelli, ovipositor apex pointed, copulatory
papilla triangular and flattened dorso-ventrally,
separate Brazitrypa from Tafalisca and corroborate
the nomenclatural act.
superTribe TAfAlIsCIDI desuTTer, 1988
supErTrIb. NOv.
Tafaliscini Desutter, 1988: 367. Otte, 1994: 68.
Gorochov, 1995: 1–213.
Tafaliscina Gorochov, 2011: 254. Gorochov, 2017:
87. Campos et al., 2020: 333. Campos & Desutter-
Grandcolas, 2020: 393.
Type genus: Tafalisca Walker, 1869.
Distribution: Neotropics.
Diagnosis: Medium to large-sized crickets, body
fusiform. Lateral ocelli rounded, larger than central one;
Figure 19. A, Tafalisca elongata elongata, male, dorsal habitus; B, Amblyrhethus sp., male, right FW; C, Tafalisca sp., apex
of ovipositor: a, dorsal view, b, ventral view; D, Tafalisca furfurosa, male genitalia, ventral view. Scales: 1 mm. Abbreviations:
see Material and methods.

30 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
FWs well developed with longitudinal veins (Fig. 19A)
or with stridulatory apparatus developed (Fig. 19B;
Supporting Information, Fig. S2C). When stridulatory
apparatus developed: anal field bulged, sinuosity of
PCu vein close to lateral field (Fig. 19B) and apical field
longer than mirror. TI with tympanum, except for the
majority of Tafalisca species. TIII subapical spurs and
spines strong (Supporting Information, Fig. S6B). Tip of
dorsal and ventral valves of ovipositor truncated (Fig.
19C; Supporting Information, Fig. S5B) Male genitalia:
MedLophi and LLophi connected by a membrane; lateral
margins of endophallic sclerite folded in ventral view
(Figs.19D; Supporting Information, Figs S7A, C; S8A).
Included genera: Amblyrhethus Kirby, 1906,
Eubezverkhovia Gorochov & Izerskyy, 2020, Mexitrypa
Gorochov, 2011, Perutrella Gorochov, 2011, Stenaphonus
Saussure, 1878 (transferred from Podoscirtini),
Tafalisca Walker, 1869, Veredatrypa Campos, 2020.
Remarks: This clade is elevated from subtribe to tribe
based on the phylogenetic results and the taxonomic
organization presented here. There are only two
genera of Tafaliscidi without a developed stridulatory
apparatus, i.e. Tafalisca and Stenaphonus. However,
most of the species of Tafalisca have a curved PCu
vein and stridulatory teeth on ventral face of this
vein. This condition suggests that Tafalisca could use
acoustic communication or produce vibration using
its FWs (Campos & Desutter-Grandcolas, 2020) since
there are no structures to propagate the sound like
a mirror or harp veins. The genus Stenaphonus has
characteristics in common with Tafaliscidi, mainly
with Tafalisca crickets. Several characters support
the transfer of Stenaphonus from Podoscirtini to
Tafaliscidi, i.e. lateral ocelli large and rounded; TIII
subapical spurs 5/4; FWs bearing longitudinal veins;
ovipositor flattened dorsoventrally; Neotropical
distribution (Saussure, 1878).
idenTificaTion key To oecanThidae subfamilies, superTribes and Tribes
1. Fastigium truncated in frontal and lateral views (Fig. 5B; Supporting Information, Fig. S1G), male
anterolateral region of metanotum not inflated, tarsal claws inner margin serrulated (Fig. 5C; Supporting
Information, Fig. S6Gb), TIII bearing six or more inner subapical spurs (Supporting Information, Fig.
S6Gb) ............................................................................................................................................... Euscyrtinae
- Fastigium not truncated in frontal and lateral views (Supporting Information, Fig. S1A–C, I), male
anterolateral region of metanotum inflated (Supporting Information, Fig. S4C–E), TIII bearing maximum
six inner subapical spurs (except some Podoscirtinae taxa bearing more than six), claws inner margins not
serrulated (Supporting Information, Fig. S6Ga) .............................................................................................. 2
2. Ventral inner apical spur of TIII reduced or absent (Supporting Information, Fig. S6E), FWs lateral field
with an angle less than 90° related to dorsal field in posterior view (Supporting Information, Fig. S2J2),
ovipositor straight in lateral view (Supporting Information, Fig. S4Jb), tip of ovipositor dorsal valves
forked (Supporting Information, Figs S4Ja, S5C). Male genitalia: rami two or more times longer than
pseudepiphallic sclerite ............................................................................................................Oecanthinae…4
- Ventral inner apical spur of TIII developed (Supporting Information, Fig. S6D), FWs lateral field with an
angle ~90° related to dorsal field in posterior view (Supporting Information, Fig. S2J1), ovipositor up or
downcurved in lateral view (Supporting Information, Fig. S4K, L), tip of ovipositor dorsal valves single.
Male genitalia: rami slightly longer or shorter than pseudepiphallic sclerite ...............................................3
3. Posterior margin of pronotum convex in the middle (Supporting Information, Fig. S4Aa). TIII with 5/5
subapical spurs or more. Ovipositor not flattened (Supporting Information, Fig. S4J, L), apex of dorsal
valves covering ventral valves laterally and sometimes ventrally (Fig. 9B, C; Supporting Information,
S5A, D, E, G), generally strongly sclerotized, laterals strongly serrulate, laterals of apex of ventral valves
generally smooth. Male genitalia: inner margin of LLophi not membranous; ectophallic fold single or
bilobate, posterior projection of endophallic sclerite, when present, bilobate (Fig. 9A); endophallic apodeme,
when present, flattened laterally (Fig. 9A, 12E; Supporting Information, Fig. S9A) ...........Podoscirtinae…6
- Posterior margin of pronotum entirely convex (Supporting Information, Fig. S4Ab). TIII with 5/4 subapical
spurs (4/3 in Perutrella and 4/4 in some Paroecanthini). Ovipositor flattened dorso-ventrally (Fig. 16B;
Supporting Information, Fig. S4K), apex of dorsal valves above ventral valves (Fig. 16C; Supporting
Information, Fig. S5B, F, H), same sclerotization as the entire ovipositor, laterals slightly or not serrulate;
laterals of apex of ventral valves generally serrulate. Male genitalia: inner margin of LLophi generally
membranous (Figs 18C, 19D; Supporting Information, Fig. S7A); ectophallic fold single, posterior projection
of endophallic sclerite, when present, single; endophallic apodeme, when present, not flattened laterally
(Supporting Information, Fig. S8L–N) .................................................................................... Tafaliscinae…12

THE FIFTH FAMILY OF TRUE CRICKETS 31
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
4. Specimens hypognathous (Fig. 8B); TI and TII ventral inner apical spurs present (Supporting Information,
Fig. S5O, P); FIII proximal portion wider than distal portion in lateral view (Figs S4K, S6A); first tarsomere
of leg III with dorsal spines (Fig. 12C, D); tarsal claws not bifurcated (Fig. S6Ga). Tip of ventral valves of
ovipositor forked. Male FW: mirror not occupying more than half of FW (Supporting Information, Fig. S2E,
G), with one dividing vein; apical field present (Supporting Information, Figs S5J, S6C, D). Male genitalia:
ectophallic arc curved posteriorly; ventral valves present, larger than the entire genitalia (Supporting
Information, Fig. S9C); endophallic sclerite two times or longer than pseudepiphallic sclerite (Supporting
Information, Fig. S7D). Neotropical distribution ........................................................... Diatrypidi/Diatrypini
- Specimens prognathous (Fig. 6A; Supporting Information, S1K); TI and TII ventral inner apical spurs
absent; FIII proximal portion similarly thin to distal portion in lateral view; first tarsomere of leg III
without spines (Fig. 7B, C); tarsal claws bifurcated (Fig. 6C; Supporting Information, Fig. S6Gc). Tip of
ventral valves of ovipositor not forked. Male FW (when developed): large mirror occupying almost or more
than half of FW, with two dividing veins (Fig. 6B; Supporting Information, Fig. S3H); apical field absent or
almost no discernible (Supporting Information, Fig. S3H). Male genitalia: ectophallic arc curved anteriorly
(Supporting Information, Fig. S8G); ventral valves poorly developed or absent; endophallic sclerite short
(Supporting Information, Fig. S8G). Worldwide distribution ....................................................Oecanthidi…5
5. Cerci short, shorter than FII (Supporting Information, Fig. S4G); ventral outer apical spur of TII
present; subapical spurs of TIII absent (Fig. 7A); ventral outer and inner apical spurs of TIII absent (2/2)
(Fig. 7B, C), first tarsomere apical spurs of leg III absent. Male genitalia: distal prolongation of ectophallic
arc absent ................................................................................................................................................Xabeini
- Cerci long, longer than FII (Supporting Information, Fig. S4H); ventral outer apical spur of TII absent;
subapical spurs of TIII present, generally 3/3; ventral outer and inner apical spurs of TIII present (3/3);
first tarsomere apical spurs of leg III present. Male genitalia: distal prolongation of ectophallic arc present
(Supporting Information, Fig. S8G) ................................................................................................. Oecanthini
6. Median and lateral ocelli generally aligned (Fig. 11A; Supporting Information, Fig. S1B); fifth article
of maxillary palpi upcurved 90° (Figs 11B, 12B; Supporting Information, Fig. S1Lc). Male FWs: PCu
vein curved more than 90°, sinuous (Figs 14B, 15B; Supporting Information, Fig. S3Bb, G); CuPa not
parallel to proximal region of PCu (Figs 14B, 15B; Supporting Information, Fig. S3G); harp veins, when
present, parallel to PCu vein (Figs 14B, 15B; Supporting Information, Fig. S3G). New world distribution
........................................................................................................................................................Hapithidi…7
- Median and lateral ocelli not aligned; fifth article of maxillary palpi slightly upcurved (Supporting
Information, Fig. S1Lb). Male FWs: PCu vein curved 90°, not sinuous (Fig. 10C; Supporting Information,
Fig. S3Ba, F); CuPa parallel to proximal region of PCu (Fig. 10C; Supporting Information, Fig. S3F);
harp veins, when present, diagonal (Fig. 10C; Supporting Information, Fig. S3F). Old world distribution
.................................................................................................................................................. Podoscirtidi…10
7. Veins of lateral field parallel to dorsal field (Supporting Information, Fig. S2Ia). Male FWs: stridulatory
apparatus absent (Supporting Information, Fig. S3A); apical field not delimited .........................................8
- Veins of lateral field perpendicular to dorsal field (Supporting Information, Fig. S2Ib). Male FWs:
stridulatory apparatus present; apical field delimited (Supporting Information, Fig. S3F, G) .....................9
8. Eyes posterior margin concave in lateral view (Fig. 12B; Supporting Information, Fig. S1Eb), with one
horizontal band or without bands; TI outer tympana generally present, inner absent; first tarsomere apical
spurs of leg III longer than the tarsomere (Fig. 12C, D). Male genitalia: ectophallic arc not connected (Fig.
12E; Supporting Information, Fig. S9A); endophallus U-shaped (Fig. 12E; Supporting Information, Fig.
S9A), endophallic apodeme two or more times longer than PsP (Fig. 12E; Supporting Information, Fig.
S9A); rami not connected .........................................................................................................Aphonomorphini
- Eyes posterior margin straight in lateral view (Supporting Information, Fig. S1Ea); eyes with two or
three horizontal bands (Figs 11A, 13A; Supporting Information, Fig. S1F); TI outer tympana absent, inner
present; apical spurs of first tarsomere of leg III generally same size or shorter than the tarsomere. Male
genitalia: ectophallic arc connected (Fig. 13B; Supporting Information, Fig. S8I); endophallus not U-shaped,
endophallic apodeme same shorter or slightly longer than PsP; rami connected (Fig. 13B; Supporting
Information, Fig. S8I) .................................................................................................................... Cearacesaini

32 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
9. Median and lateral ocelli distant, not connected. FWs lateral and dorsal field same-sized (Supporting
Information, Fig. S2H1). Pronotum caudal margin entirely convex (Fig. 14A; Supporting Information, Fig.
S4Ab). Dorsal valves of ovipositor lateral margins slightly serrulate, same colour as the entire ovipositor.
Male genitalia: MedLophi present (Fig. 14C; Supporting Information, Fig. S8C); anterior margin of
pseudepiphallic sclerite not folded; ectophallic arc reduced or absent ............................................ Hapithini
- Median and lateral ocelli remarkably close, sometimes connected (Fig. 15C; Supporting Information, Fig.
S1B, D). FWs lateral field shorter than dorsal field (Supporting Information, Fig. S2H2). Dorsal valves of
ovipositor lateral margins strongly serrulate, darker than the entire ovipositor (Supporting Information,
Fig. S5A, E). Pronotum caudal margin convex on the middle (Figs 15A; Supporting Information, Fig. S4Aa).
Male genitalia: MedLophi absent; anterior margin of pseudepiphallic sclerite folded dorsally (Fig. 15D;
Supporting Information, Fig. S8F); ectophallic arc present .......................................................Phyllogryllini
10. Male FWs without stridulatory apparatus, only longitudinal veins, anal area not delimited; male genitalia
PsP not cylindrical; endophallus asymmetric; apex of dorsal valves of ovipositor generally wider than
entire ovipositor in dorsal and ventral views ................................................................................ Aphonoidini
- Male FWs generally bearing stridulatory apparatus sometimes harp veins or mirror lacking (or both), anal
area delimited; male genitalia PsP frequently cylindrical; endophallus frequently symmetrical; apex of
dorsal valves of ovipositor generally same width of the entire ovipositor in dorsal and ventral view .......11
11. TI inner tympanum usually not covered by a sclerotized tab; pronotum DD not flattened in lateral view;
male genitalia generally capsular (Supporting Information, Fig. S7F); arc and ventral projection of
ectophallic invagination short, endophallic sclerite well developed .............................................Podoscirtini
- TI inner tympanum covered by a sclerotized tab; pronotum DD not flattened in lateral view; male genitalia
not capsular; arc and ventral projection of ectophallic invagination elongated (Fig. 10E), endophallic
sclerite sometimes regressed or absent ............................................................................................ Truljaliini
12. Body not robust, pronotum longer than wide in dorsal view. Apex of ovipositor pointed or rounded
(Fig. 16C; Supporting Information, Fig. S5F). Male genitalia: MedLophi absent; endophallus flattened
dorso-ventrally (Supporting Information, Fig. S8H) or strongly reduced (Supporting Information, Fig.
S8B), lateral margins not folded; endophallic apodeme absent .........................................Paroecanthidi…13
- Body robust, pronotum as wide as long or wider than long in dorsal view. Apex of ovipositor truncated (Fig.
19C; Supporting Information, Fig. S5B, H). Male genitalia: MedLophi present; endophallus not flattened,
lateral margins folded (Fig. 19D; Supporting Information, Fig. S8L); endophallic apodeme generally present
.................................................................................................................................. Tafaliscidi/Tafaliscini…14
13. TI tympana present. FWs covering abdomen partially or totally, stridulatory apparatus present; PCu vein
curved, generally bisinuous, rarely sinuous (Supporting Information, Fig. S3C); apical field delimited.
Structures of male genitalia generally regressed, mainly from ectophallic invagination and endophallus
(except Adenophallusia and Ectotrypa) (Supporting Information, Fig. S8B) .................... Paroecanthini…19
- TI tympana absent. FWs absent (Supporting Information, Fig. S2A), only covering the metanotum
(Supporting Information, Fig. S2B) or covering the abdomen with longitudinal veins (Fig. 18A), stridulatory
apparatus absent; PCu vein not curved or absent; apical field, when present, not delimited. Structures of
male genitalia not regressed ................................................................................................ Neometrypini…25
idenTificaTion key To Tafaliscinae genera (adapTed from campos et al., 2020 and campos &
desuTTer-grandcolas, 2020)
This key contains all Tafaliscinae genera, except for the following genera, that must be reviewed: Bofana, Nessa
and Stenaphonus. These genera have similar features to Angustitrella, Brazitrypa and Tafalisca, respectively
and it is not possible to separate them in this key. Simultaneously, it is not possible to synonymize these genera
because their types were not examined. Nessa and Stenaphonus are transferred to Tafaliscinae due to their
morphological characteristics, from the original descriptions, and distribution. Both genera require revision.
14. FWs not bearing stridulatory apparatus, sometimes with PCu vein curved and stridulatory teeth ventrally,
TI tympana generally absent (present in some species of Tafalisca) .......................................................... 15
- FWs bearing stridulatory apparatus, at least one tympanum present on TI .............................................. 17
15. Median ocellus absent, metanotum with projections; TI and TII without proximal protuberance; PCu vein
without stridulatory teeth. Male genitalia: LLophi present, MedLophi absent .......................................... 16

THE FIFTH FAMILY OF TRUE CRICKETS 33
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
- Median ocellus present, metanotum generally without projections, sometimes with two median projections;
TI and TII with proximal protuberance (Supporting Information, Fig. S5N); PCu vein generally curved and
sometimes with stridulatory teeth ventrally. Male genitalia: LLophi and MedLophi present (Supporting
Information, Fig. S7A, B) ..................................................................................................................... Tafalisca
16. Male metanotum without a central fossa. Male genitalia: PsP well developed, almost same size of LLophi;
rami curved inwards ................................................................................................................. Eubezverkhovia
- Male metanotum with a central fossa. Male genitalia: PsP short, notably shorter than LLophi; rami
straight ................................................................................................................................................Mexitrypa
17. Pronotum with a median inverted band y-shaped dark brown or black (Fig. 20A); male metanotum without
projections; TIII subapical spurs 4/3; FIII longer than TIII (Supporting Information, Fig. S6A) ..Perutrella
- Pronotum without a median inverted band y-shaped; male metanotum with projections; TIII subapical
spurs 5/4; FIII same size as TIII or slightly longer ........................................................................................18
18. Male FWs covering the entire abdomen, stridulatory file not surrounded by strong sclerotization, apical
field developed; TI with auditory tympanum on both faces; LLophi well developed, endophallic apodeme
not bifid. Female apex of ovipositor without protuberances in dorsal and ventral valves ...... Amblyrhethus
- Male FWs not covering the entire abdomen, stridulatory file surrounded by strong sclerotization
(Supporting Information, Fig. S3D), apical field not developed; TI with auditory tympanum on outer face,
inner face absent; MLophi well developed, endophallic apodeme bifid (Supporting Information, Fig. S8M).
Female apex of ovipositor with two protuberances in dorsal and ventral valves (Fig. 20B) ...... Veredatrypa
19. PCu vein with a sinuosity close to lateral field (Fig. 20C). Male genitalia: PsP well developed; rami slightly
longer or same-sized then pseudepiphallic sclerite; ectophallic invagination not reduced .........................20
- PCu vein bisinuous (Fig. 17B). Male genitalia: PsP regressed or absent; rami two times or longer than
pseudepiphallic sclerite; ectophallic invagination generally regressed (Fig. 17C; Supporting Information,
Fig. S7B) (except Prodiatrypa) ........................................................................................................................21
20. Pronotum as long as wide; TI outer tympanum absent; HWs shorter than FWs; apical field absent; supra-
anal plate of the male with a median projection (Fig. 20D); apex of ovipositor rounded; TIII subapical spurs
5/4. Male genitalia: apex of LLophi bifid (Fig. 20E) ................................................................ Adenophallusia
- Pronotum longer than wide; TI both tympana present; HWs longer than FWs; apical field present; supra-
anal plate of the male without median projection; apex of ovipositor triangular (Fig. 20F); TIII subapical
spurs 3/3, close to distal margin of TIII (some species 5/4). Male genitalia: apex o LLophi single .Ectotrypa
21. Median ocellus reduced, smaller than lateral ocelli; HWs shorter or same size of FWs; apical field shorter
than mirror (Fig. 20G). Male genitalia: PsP absent .......................................................................................22
- Median ocellus not reduced or absent; HWs longer than FWs; apical field longer or same-sized than mirror
(Fig. 17B). Male genitalia: PsP present, regressed .........................................................................................23
22. TI inner and outer tympana both present. Male genitalia: LLophi not finger-shaped, distal to pseudepiphallic
sclerite (Fig. 20H) ............................................................................................................................Selvagryllus
- TI inner tympanum reduced or absent, outer tympanum present. Male genitalia: LLophi finger-shaped
located at the base of pseudepiphallic sclerite (Fig. 20I) .................................................................Siccotrella
23. TI inner tympanum not elongated. Male genitalia: LLophi absent; ectophallic invagination and endophallic
sclerite well developed .....................................................................................................................Prodiatrypa
- TI inner tympanum elongated (Supporting Information, Fig. S5I). Male genitalia: LLophi generally present;
ectophallic invagination and endophallic sclerite strongly regressed (Fig. 17C; Supporting Information,
Fig. S8B) ...........................................................................................................................................................24
24. Median ocellus absent; pronotum longer than wide (Fig. 17A); TI inflated, inner tympanum covered by a
sclerotized tab (Supporting Information, Fig. S5I); TIII subapical spurs 4/4. Male genitalia: LLophi absent,
when present directed posteriorly (except A. mataraku) .............................................................Angustitrella
- Median ocellus present; pronotum wider than long or as long as wide; TI not inflated, inner tympanum
not covered by a sclerotized tab; TIII subapical spurs 5/4 or 5/5. Male genitalia: LLophi generally present,
directed anteriorly (Fig. 17C) ....................................................................................................... Paroecanthus
25. Ocelli generally present; FWs absent or brachypterous; when FWs present generally without longitudinal
veins, sometimes with maximum six longitudinal veins not reticulated .....................................................26
- Ocelli generally absent; FWs present, covering the abdomen entirely or almost entirely, with more than six
longitudinal veins reticulated .........................................................................................................................28

34 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
26. FWs absent (Supporting Information, Fig. S2A); posterior margin of pronotum covering metanotum
..........................................................................................................................................................Apterotrypa
- FWs present; posterior margin of pronotum not covering metanotum .........................................................27
27. FWs wider than long, covering only metanotum (Supporting Information, Fig. S2B). Male genitalia: LLophi
inner margin membranous (Fig. 18C) ..........................................................................................Neometrypus
- FWs longer than wide, covering the two first abdominal tergites (Fig. 18B). Male genitalia: LLophi
completely sclerotized ............................................................................................................... Cylindrogryllus
28. Body cylindrical (Fig. 18A); fastigium without tubercle; first abdominal tergite with projections (Supporting
Information, Fig. S4E) ....................................................................................................................... Brazitrypa
- Body flattened dorso-ventrally; fastigium with a tubercle apically (Fig. 20J); first abdominal tergite without
projections ....................................................................................................................................Dicerorostrum
DISCUSSION
In this work, we provide the first well-supported
phylogeny of a large clade of true crickets (Grylloidea).
The worldwide distributed Oecanthidae is the second
most species-rich family of Grylloidea with ~1400
species, just behind Gryllidae, its sister-family
(Cigliano et al., 2022). All analyses (BI, ML and MP)
support the same relationships across subfamilies,
supertribes and tribes, even though a few species
switch their phylogenetic positions, probably due to
incomplete sampling for some clades. Molecular and
morphological matrices were also tested in separate
analyses (ML and MP). The results were similar to the
concatenated matrices but with lower node supports.
Because of this, we decided not to include and discuss
these data here.
Molecular data are provided for the first time for
the Xabeini tribe (Oecanthinae: Oecanthidi) and for
the genus Diatrypa (Diatrypidi). The terminal named
‘Diatrypa sp_FGu’ (voucher LDG 092, re-examined) in
clade F3 of Chintauan-Marquier et al. (2016) actually
belongs to the genus Angustitrella (Paroecanthidi:
Tafaliscinae). Therefore, it is included herein as
‘Angustitrella aff. vicina 1’ (Table 1).
Our results corroborate the monophyly and
sistership relation of the clades F + G proposed by
Chintauan-Marquier et al. (2016). The whole clade F +
G is highly supported (Fig. 3; Supporting Information,
Figs S13, S14), including the suprageneric taxa
(posterior probability = 1). As a consequence of our
study, Chintauan-Marquier et al.’s (2016) clade G is
here redefined as Gryllidae, including the following
subfamilies: Gryllinae, Gryllomiminae, Eneopterinae,
Itarinae, Landrevinae, Pentacentrinae and
Sclerogryllinae; (Cigliano et al., 2022). The monophyly
and relationships of these groups should be checked in
a phylogenetic framework. For example, some genera
of Gryllomorphinae gathered in the phalangopsid
subfamily Cachoplistinae Saussure, 1877 in Chintaun-
Marquier et al.’s (2016) phylogeny. Moreover, our
results confirm that Pentacentrinae, gathered in
the ‘Subfamily Group Podoscirtinae’ in Cigliano
et al. (2022), should be moved to Gryllidae following
Chintauan-Marquier et al. (2016). As for clade F, the
limits, diagnoses and relationships of these taxa have
been revised here through phylogenetic studies and
are discussed below.
phylogeneTic relaTionships of oecanThidae
Here, we provide evidence to (1) separate two
monophyletic cricket families, i.e. Gryllidae and
Oecanthidae, and (2) subdivide the Oecanthidae into
four subfamilies, i.e. Euscyrtinae + ((Oecanthinae
+ Podoscirtinae) + Tafaliscinae). Consequently, our
results clarify the phylogenetic relationships across
this diverse clade and stabilize its taxonomy.
Initially separated as ‘Euscyrtus species group’
within a Podoscirtini tribe (sensu Otte & Alexander,
1983), Euscyrtinae has been considered a valid
subfamily since its creation (Gorochov, 1985). Its
monophyly was confirmed based on molecular
data (Chintaun-Marquier et al., 2016), and our
morphological data support previous results (see Table
1). In our analyses, Euscyrtinae is the sister-group of
the other subfamilies of Oecanthidae. Euscyrtinae is
the less diverse lineage of Oecanthidae with ~60 species
(Cigliano et al., 2022), which live in leafy environments,
including disturbed places. Our results indicate that
this subfamily has diversified more recently than the
other Oecanthidae (~23 Mya). According to Cigliano
et al. (2022), Euscyrtinae are distributed through
all tropical regions, except South America (Fig. 4).
However, individuals with Euscyrtinae characteristics
from Brazil were found in the MNHN collection (LDC
pers. obs.). A paper with this new significant record is
in progress (Campos, in prep.).
A sister-group relationship between Oecanthinae
and Podoscirtinae was first proposed by Otte (1994),
but it was limited to the genus Oecanthus and its
closest relatives, early isolated by crickets taxonomists
because of its specialized morphology. For example,
in Chopard’s 1967–68 catalogue, this was the only

THE FIFTH FAMILY OF TRUE CRICKETS 35
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
Figure 20. A, Perutrella septentrionalis, male, head and pronotum, dorsal view; B, Veredatrypa rosai, apex of ovipositor,
dorsal view (black arrows indicate the protuberances); Adenophallusia legendrei, male: C, right FW; D, supra-anal plate;
E, genitalia, dorsal view; F, Ectotrypa olmeca, apex of ovipositor, dorsal view; G, Siccotrella modesta, male, right FW; H,
Selvagryllus sp., male genitalia, dorsal view; I, Siccotrella managua, male genitalia, dorsal view; J, Dicerorostrum diceros,
fastigium, dorsal view (figure from Gorochov, 2017) (black arrow indicates the fastigium's modification). Scales: 1mm.
Abbreviations: see Material and methods.

36 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
group set apart from all crickets as a ‘family’ [but
see Chopard’s (1968) introduction to the catalogue
to understand this choice]. As shown in Figure 3,
Oecanthinae is the sister-group of Podoscirtinae and
includes the supertribes Diatrypidi (Neotropical) and
Oecanthidi (worldwide) (Fig. 4).
The supertribe Diatrypidi was initially proposed as
a tribe of Tafaliscinae with two genera, i.e. Diatrypa
and Prodiatrypa (Desutter, 1988): Diatrypa was
transferred into a subtribe (Diatrypina) of the tribe
Aphonoidini in the subfamily Podoscirtinae (Gorochov,
2013), while Prodiatrypa was included in the subtribe
Tafaliscina (Gorochov, 2017). Based on morphological
characters (see Systematics section), Prodiatrypa
is here transferred to the Paroecanthini tribe of the
Tafaliscinae.
With a worldwide distribution (Cigliano et al., 2022)
(Fig. 4), Oecanthidi have two tribes, Oecanthini and
Xabeini. Only three genera compose Oecanthini (see
Diagnoses), of which Oecanthus, with more than 70
species, is a relatively well-studied genus, used as a
model group for behavioural studies (e.g. Costello
& Symes, 2014; Orci et al., 2016), bioacoustics (e.g.
Sismondo, 1993; Walker & Collins, 2010; Collins
et al., 2019), biophysics (e.g. Mhatre et al., 2009,
2017) and cytogenetics (Milach et al., 2016). Xabeini
is characterized by the lack of subapical spurs of
posterior tibia; it includes one genus in the Neotropics,
one genus in Asia–Oceania, and has a remarkable
ecomorphological radiation in the Hawaiian
archipelago, with three genera and 68 species (Otte,
1994, Cigliano et al., 2022).
Podoscirtinae is the most diverse subfamily of
Oecanthidae, with more than 80 genera and 650
species (Cigliano et al., 2022). Although worldwide
in distribution (Fig. 4), it is divided here into the
southern Nearctic and Neotropical Hapithidi, on
the one hand, and Afrotropical, Australasian, Indo-
Malayan, Oceanian and Palaearctic Podoscirtidi, on
the other. This geographical separation was not evident
in previous classifications. It was first observed by
Chintauan-Marquier et al. (2016), who recovered the
subfamily with 19 terminals and is corroborated by
our broad taxon sampling (Table 1).
According to our results, Hapithidi have four tribes,
including Phyllogryllini, sister to Aphonomorphini,
Hapithini and Cearacesaini (Fig. 3; Supporting
Information, Figs S13, S14; Diagnoses). Podoscirtidi is
composed of three tribes, in which Truljaliini is elevated
from subtribe to tribe (Gorochov, 2020). Prozvenella
bangaloriensis appears as a sister to Aphonoidini +
Podoscirtini in the ML and MP trees, but is nested in
Podoscirtini in the BI tree. We decided to maintain this
species in Podoscirtini for now, following our results
of BI. Further studies focused on Podoscirtidi are
required to elucidate the phylogenetic relationships
of this taxon, as our sampling of Podoscirtidi is low
compared to the group diversity.
The subfamily Tafaliscinae is strictly Neotropical
(Fig. 4), occurring from southern Mexico and southern
Florida to southern Brazil and northern Argentina
(Cigliano et al., 2022). Unlike the Chintauan-Marquier
et al.’s (2016) tree, which was based on only four
tafaliscine terminals, our results show Tafaliscinae
as the sister of Oecanthinae + Podoscirtinae (Fig.
3; Supporting Information, Figs S13, S14). With 42
species sampled, our results reveal, with high node
supports, that Tafaliscinae is a diverse monophyletic
lineage divided into two supertribes: Paroecanthidi
and Tafaliscidi (Fig. 3; Table 3; Supporting Information,
Figs S13, S14).
Paroecanthini and Neometrypini compose
Paroecanthidi. The low support of Paroecanthini
in ML and MP trees suggests that the position
of Adenophallusia legendrei Campos & Desutter-
Grandcolas, 2020, varies with different dataset or
more taxa of Paroecanthini. Nevertheless, we decided
to maintain this species inside Paroecanthini for now.
Neometrypini tribe is strongly supported and defined
morphologically (Fig. 3; Supporting Information, Figs
S13, S14; Diagnoses). In this work, we decided to elevate
the subgenera of Cylindrogryllus sensu Gorochov
(2017) to genera based on the obtained topologies and
morphological characters. As recently proposed for
Neometrypus with morphological characters (Campos
& Souza-Dias, 2021), Cylindrogryllus, Neometrypus
and Apterotrypa are all taxonomically well established
and morphologically delimited as monophyletic
genera now.
The identification of the genera Brazitrypa and
Tafalisca is often confusing (Campos & Desutter-
Grandcolas, 2020). According to our results, Tafalisca
bahiensis (Saussure, 1878) should be transferred
to Brazitrypa, as supported by molecular and
morphological characters: we propose the new
combination Brazitrypa bahiensis (Saussure, 1878)
comb. nov. for that species. Interestingly, Brazitrypa
was never considered close to Neometrypus, probably
because of its developed forewings (Neometrypus
is apterous or micropterous). However, other
morphological characters, such as the median
metanotal projection and genital characters, are
similar in both genera (Campos & Souza-Dias, 2021).
Tafaliscidi includes only one tribe, Tafaliscini.
Initially proposed as a tribe of the Tafaliscinae
subfamily (Desutter, 1988), this group was later
considered a subtribe with several genera that,
according to our results, actually belongs to
Paroecanthidi, i.e. Adenophallusia, Brazitrypa,
Cylindrogryllus and Prodiatrypa (Gorochov, 2017;
Cigliano et al., 2022). The genus Eubezverkhovia
Gorochov & Izerskyy, 2020, could not be sampled for

THE FIFTH FAMILY OF TRUE CRICKETS 37
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
the present study, but its morphological features and
descriptions (Gorochov, 2017, 2018) are similar to
Tafalisca. Examination of the types of Eubezverkhovia
is required prior synonymizing these genera. In the
same way, the genus Stenaphonus Saussure, 1878 will
have to be checked for a synonymy with Tafalisca. As
mentioned in the Systematics section, we transfer this
genus from Podoscirtini to Tafaliscidi, according to its
morphological features and Neotropical distribution.
divergence Times of oecanThidae
According to our results, Oecanthidae dates back to
the Lower Cretaceous, around 130 Mya, well before
another time-calibration hypothesis not explicitly
designed for ‘Gryllidae’ (Vicente et al., 2017; ~58 Mya).
The estimated origin of the fifth family of Grylloidea
was in a similar period to the early rise of flowering
plants in the Lower Cretaceous (145–100 Mya)
(Ramírez-Barahona et al., 2020). Because oecanthid
crickets inhabit plants exclusively (except for some
few taxa), our estimation prompts the possibility of
an evolutionary association, in which angiosperm
diversification might have provided habitats and food
(flower parts, fruits and seeds) for those crickets. The
overlap of divergence times also suggests Oecanthidae
as the first group of crickets to use flowering plants
as a habitat. The most ancient fossils of other crickets
whose extant representatives live on plants belong
to Mogoplistidae (Upper Cretaceous; Gorochov, 2010)
and Trigonidiinae (Trigonidiidae) (Upper Cretaceous;
Xu et al., 2020; Desutter-Grandcolas et al., 2021); the
subfamily Eneopterinae (Gryllidae) is dated from the
Palaeocene (Vicente et al., 2017), ~66.2 Mya according
to our results (Fig. 3).
The lineage-through-time plot (Fig. 3A) shows
a sharp increase in the diversity of Oecanthidae
starting around 60 Mya, during the Palaeocene. This
pattern is present in most tribes of the family (Fig. 3).
This period is just after the last great extinction
of the Cretaceous–Palaeogene (~65 Mya) and during
the widespread of angiosperms across biomes around
the World (66–56 Mya) (Ramírez-Barahona et al., 2020).
Accordingly, we raise two non-excluding hypotheses on
their evolution: (1) these crickets survived the mass
extinction, as also documented for spiders (Penney
et al., 2003), with subsequent speciation related to
newly available ecological niches; and (2) the evolution
of Oecanthidae might be related to the expansion of
flowering plants based on diversification of resources
and habitats.
Only three fossils are unambiguously attributed to
Oecanthidae. All belong to the subfamily Podoscirtinae
(Cigliano et al., 2022): Allopterites multilineatus
Cockerell, 1920 (Eocene, incomplete hindwing),
Madasumma europensis Chopard, 1936 (Oligocene,
adult female) and Stenogryllodes brevipalpis Chopard,
1936 (Oligocene, anterior part of a male juvenile).
The last two were included in our divergence-time
analysis as stem fossils based on their morphological
characters. The discovery of a new, complete fossil of
Podoscirtinae from the Mid-Cretaceous, Upper Albian
(Desutter-Grandcolas et al., submitted), closer to
the divergence of Oecanthidae, better supports our
results.
Differently from other oecanthids, the Euscyrtinae
crickets are known for inhabiting grasses mainly. This
subfamily dates back to ~27 Mya, which coincides with
the expansion of grasslands in the Late Oligocene
and Early Miocene (Edwards et al., 2010), suggesting
that Euscyrtinae’s diversification is particularly
related to grass expansion. Further studies combining
phylogenetic data for more Euscyrtinae taxa and
speciation/diversification rates are required to test
this hypothesis properly, especially taking into
account new taxa that could widen the definition of
this clade (LDC. pers. obs.). The diversification of the
Neotropical Tafaliscinae (~109 Mya) probably occurred
before the split between Hapithidi and Podoscirtidi,
suggesting that this group started to diversify before
the separation of Neotropics and Palaeotropics.
The divergence of the sister-groups Hapithidi (~84
Mya) and Podoscirtidi (~91 Mya) probably occurred
after the separation of the American and African
continents (~100 Mya), indicating a possible vicariant
event, as observed in other organisms such as beetles
(Toussaint et al., 2017; Short et al., 2021) and lizards
(Gamble et al., 2008).
The tribe Xabeini (Oecanthinae) started to diverge
about 51.3 Mya. With a particular distribution, this tribe
includes the genus Xabea through Asia and Oceania,
the genus Neoxabea in the Nearctic and Neotropical
regions, and the other three genera (Leptogryllus,
Prognathogryllus and Thamatogryllus) endemic to
the Hawaiian Islands. The current distribution of
Xabea and Neoxabea can be explained by the early
divergence of Xabeini during the Eocene, when
continents were separated, with a southern connection
between South America, Antarctica, Australia and
New Guinea (Sanmartín & Ronquist, 2004). In our
analysis, Prognathogryllus + Thaumatogryllus dates
back to ~16 Mya. Their divergence times are older than
Kauai, the oldest larger Hawaiian island in the south-
east. Nevertheless, the smaller Hawaiian Islands, also
known as the north-western islands, are older than
the emergence of these crickets. Thereby reinforcing
the hypothesis that these crickets diversified after
arriving at the Hawaiian Archipelago from the
American continent (Otte, 1994), and hopped to new
islands after they emerged and became vegetated.

38 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
habiTaT diversiTy
Oecanthid crickets are largely known for inhabiting
different kinds of vegetation and plant stratification
(Otte & Alexander, 1983; Ingrisch, 1997; Desutter-
Grandcolas et al., 2016; Labadessa & Todisco, 2016;
Campos & Desutter-Grandcolas, 2020; Campos et al.,
2020). However, there are only a few records about
what specific types of vegetation they inhabit. Some
Paroecanthini (Angustitrella spp.) or Podoscirtini
(Calscirtus, Matuanus) live in the canopy [LDC, pers.
obs. for Amazonian taxa; Desutter-Grandcolas et al.
(2016) for New Caledonia]. Species of Tafalisca and
related genera are often observed running on small
branches in low forests (LDG, pers. obs. in French
Guiana and Guadeloupe) or staying on leaves in high
canopy (Nicolas Moulin, pers. obs. in Guadeloupe).
Brazitrypa and Tafalisca (Tafaliscinae), Matuanus and
Riatina (Podoscirtinae) are also found hiding in hollow
twigs (Otte & Alexander, 1983; Desutter-Grandcolas
et al., 2016; Campos et al., 2020). The species
Veredatrypa rosai Campos et al., 2020 is found in small
trees adapted to the Brazilian Cerrado (Campos et al.,
2020), while the New Caledonian Pixipterus lives
on small trees in dry maquis vegetation. As already
mentioned, Euscyrtinae are recorded from small
bushes and grasses (Otte & Alexander, 1983; Desutter-
Grandcolas et al., 2016). Finally, the Prognathogryllus
species group, endemic to the Hawaiian Islands,
is the only oecanthid group with representatives
not inhabiting only plants, but also found under
bark (Leptogryllus), in leaf litter and even in caves
(Thaumatogryllus) (Otte, 1994), which could support
an empty niche hypothesis of diversification.
The contrasting types of vegetation, their elevational
range and the part of the plants used by the species
for their activity or refuge periods are important
information that can be used to understand how
these crickets adapted and evolved through time.
Unfortunately, available information about oecanthid
habits is still too scarce to propose general hypotheses
on habitat evolution. The records mentioned above
generally match with the production of airborne
sounds. Crickets found in higher habitats, such
as Angustitrella and Calscirtus, have an entirely
developed stridulatory apparatus, while Neometrypini
and Euscyrtinae cannot produce sounds with their
forewings and are found in smaller trees, bushes
and grasses. Losing acoustic communication could be
associated with particular environments favourable
to forewing loss in crickets (Song et al., 2020). Species
inhabiting lower habitats could be more susceptible
to predators than species in the complex canopies
of higher trees (Šipoš & Kindlmann, 2013), as they
avoid acoustically oriented predators like bats, birds
and parasites, but they keep facing spiders and frogs,
which fiercely predate on crickets.
oviposiTor diversiTy
The ovipositors in Oecanthidae, as already mentioned,
are diverse and poorly investigated by current cricket
taxonomists, although widely used by previous
authors (see, for example: Saussure, 1878). Our
results demonstrate that it is a valuable source of
phylogenetically significant characters. We managed
to define 15 characters to describe the ovipositors in
Oecanthidae (see Systematics section and Supporting
Information, File S1): they contribute to defining
several clades with exclusive synapomorphies (Tables
4, 5) and characterize clades almost at all taxonomic
levels (see Diagnoses). Moreover, ovipositor shapes
and apex forms are good indicators of ovipositing
sites (Gwynne, 2001). As Oecanthidae are almost
exclusively inhabitants of grasses, trees and bushes,
it makes sense that they will generally oviposit inside
plant tissues. The serrulate margins of the apex,
sometimes with projections, in addition to dorsal and
ventral valves movements, contribute to accessing the
internal tissues of the plants that protect the eggs
from predators and parasitoids (Huber et al., 1989).
Some crickets also bite the plant to make an opening
and facilitate oviposition (Gwynne, 2001).
As examples of the diversity of Oecanthidae
ovipositors, Euscyrtinae, Tafaliscinae and some
Oecanthinae (like Stenoecanthus planixiphus;
Campos & Desutter-Grandcolas, 2020) have flattened
dorsoventrally or laterally ovipositors used to oviposit
inside leaves. In some Oecanthinae, Aphonoidini
(Podoscirtidi: Podoscirtinae) or Ectotrypa repentina
(Rehn, 1930) (Paroecanthini: Tafaliscinae), the apex of
the ovipositor is more sclerotized and broader than the
rest of the ovipositor, and this seems to be associated
with oviposition inside the stem of plants (Huber et al.,
1989). The morphological diversity of structures in
oecanthid crickets, such as ovipositors, are essential
clues to understanding their habitat preferences and
how the use of different habitats has shaped their
evolutionary success. Detailed studies on oviposition,
ovipositors characters and mating behaviour will
be critical to answering questions about adaptation,
morphological evolution and habitat preferences of
these crickets.
CONCLUSION
Dating back to the Lower Cretaceous (~130 Mya), the
Oecanthidae were established as a fifth, monophyletic
family of true crickets (Grylloidea) based on molecular
and morphological data. Our results support a
phylogenetic hypothesis of Oecanthidae, including a
time-calibrated phylogeny used to revise and stabilize
the classification of the family and its lower taxonomic
levels, i.e. subfamilies, supertribes and tribes. In addition,

THE FIFTH FAMILY OF TRUE CRICKETS 39
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
more information on distribution and ecology will greatly
contribute to the understanding of processes related to
the diversification of this successful group of crickets.
In conclusion, this study provides a solid phylogenetic
framework for the fifth family of true crickets and
demonstrates the high potential of oecanthids as a model
group for studies focused on behaviour, biogeography,
bioacoustics and trait evolution.
ACKNOWLEDGEMENTS
We thank Dr Eliana Marques Cancello (MZSP), Dr
Marcio Luiz de Oliveira (INPA) and Dr Francisco
de Assis Ganeo de Mello (BOTU) for the loan of the
material. For financial support, we would like to
thank the Fundação de Amparo à Pesquisa do Estado
de São Paulo (FAPESP) (processes 2017/11568-9,
2018/23224-5 and 2016/50387-7), Conselho Nacional
de Desenvolvimento Científico e Tecnológico (CNPq)
(processes 140424/2017-2 and 440452/2015-5) and
the support of Orthopterist’s Society and Orthoptera
Species File. PSD thanks Fundação de Amparo à
Pesquisa do Estado do Rio de Janeiro (FAPERJ)
(Process E-26/200.096/2019). SSN fellowship CNPq
process 309192/2018-8. Finally, we thank the valuable
comments of the two anonymous reviewers. Part of
this paper was developed during LDC internship
in the MNHN in 2019/2020. LDG and SSN are both
co-last authors of this article. The authors declare no
conflicts of interest.
DATA AVAILABILITY
All molecular data (Table 1) is available in the NCBI
website (https://www.ncbi.nlm.nih.gov/genbank/).
REFERENCES
Anso J, Jourdan H, Desutter-Grandcolas L. 2016. Crickets
(Insecta, Orthoptera, Grylloidea) from Southern New
Caledonia, with descriptions of new taxa. Zootaxa 4124:
1–92.
Bailey WJ. 1991. Acoustic behaviour of insects. An evolutionary
perspective. Cambridge: Chapman and Hall.
Bethoux O, Nel A. 2001. Venation pattern of Orthoptera.
Journal of Orthoptera Research 10: 195–198.
Bouckaert R, Vaughan TG, Barido-Sottani J, Duchêne S,
Fourment M, Gavryushkina A, Heled J, Jones G,
Kühnert D, Maio ND, Matschiner M, Mendes FK,
Müller NF, Ogilvie HA, Plessis L, Popinga A, Rambaut A,
Rasmussen D, Siveroni I, Suchard MA, Wu CH, Xie D,
Zhang C, Stadler T, Drummond AJ. 2019. BEAST 2.5:
an advanced software platform for Bayesian evolutionary
analysis. PLoS Computational Biology 15: e1006650.
Campos LD de, Desutter-Grandcolas L. 2020. The
Paroecanthini crickets (Orthoptera: Grylloidea: Gryllidae:
Oecanthinae) from French Guiana. Zoosystema 42: 355–398.
Campos LD de, Souza-Dias PGB. 2021. Hidden in the bushes:
uncovering the diversity of the genus Neometrypus Desutter,
1988 n. status (Orthoptera: Gryllidae: Paroecanthini:
Tafaliscina) in Neotropical forests. Zootaxa 5060: 451–488.
Campos LD de, Souza-Dias PGB, Nihei SS. 2020.
New Brazilian Tafaliscina increase the diversity of this
Neotropical cricket clade (Orthoptera: Grylloidea: Gryllidae:
Oecanthinae: Paroecanthini). Zoosystema 42: 331–353.
Campos LD de, Souza-Dias PGB, Desutter-Grandcolas L,
Nihei SS. 2021. Colonization of different biomes drove
the diversification of the Neotropical Eidmanacris crickets
(Insecta: Orthoptera: Grylloidea: Phalangopsidae). PLoS One
16: e0245325.
Castresana J. 2000. Selection of conserved blocks from
multiple alignments for their use in phylogenetic analysis.
Molecular Biology and Evolution 17: 540–552.
Chintauan-Marquier IC, Legendre F, Hugel S,
Robillard T, Grandcolas P, Nel A, Zuccon D, Desutter-
Grandcolas L. 2016. Laying the foundations of evolutionary
and systematic studies in crickets (Insecta, Orthoptera): a
multilocus phylogenetic analysis. Cladistics 32: 54–81.
Chopard L. 1936. Orthoptères fossiles et subfossiles de
l’ambre et du copal. Annales de La Société Entomologique de
France 105(4): 375–386.
Chopard L. 1968. Gryllides. Fam. Gryllidae: subf. Mogoplistinae,
Myrmecophilinae, Scleropterinae, Cachoplistinae
Pteroplistinae, Pentacenturinae, Phalangopsinae,
Trigonidinae, Eneopierinae; fam. Oecanthidae, Gryllotalpidae.
In: Orthopterorum Catalogus. ‘s-Gravenhage: Beier, 213–500.
Cigliano MM, Braun H, Eades DC, Otte D. 2022. Orthoptera
species file, v.5.0/5.0 [WWW document]. Available at: http://
orthoptera.speciesfile.org (accessed 20 March 2022).
Collins N, González IMC, Govaerts BVA. 2019. Oecanthus
mhatreae sp. nov. (Gryllidae: Oecanthinae): a new species of
tree cricket from Mexico, with an irregular song pattern and
unique chirp-like trill configuration. Journal of Orthoptera
Research 28: 137–143.
Costello RA, Symes LB. 2014. Effects of anthropogenic noise
on male signalling behaviour and female phonotaxis in
Oecanthus tree crickets. Animal Behaviour 95: 15–22.
Desutter L. 1987. Structure et évolution du complexe
phallique des Gryllidea (Orthoptères) et classification des
genres Néotropicaux de Grylloidea. Primière Partie. Annales
de La Société Entomologique de France 23: 213–239.
Desutter L. 1988. Structure et évolution du complexe
phallique des Gryllidea (Orthoptères) et classification des
genres Nèotropicaux de Grylloidea – deuxième partie.
Annales de La Societé Entomologique de France 24: 342–373.
Desutter-Grandcolas L. 2003. Phylogeny and the evolution
of acoustic communication in extant Ensifera (Insecta,
Orthoptera). Zoologica Scripta 32: 525–561.
Desutter-Grandcolas L. 2017. Najtaecesa n. gen., a
trigonidiine-like Cearacesaini Koçak & Kemal, 2010 cricket
from the Amazonian rainforests (Grylloidea, Gryllidae,
Hapithinae). Zoosystema 39: 117–124.

40 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
Desutter-Grandcolas L, Robillard T. 2003. Phylogeny and
the evolution of calling songs in Gryllus (Insecta, Orthoptera,
Gryllidae). Zoologica Scripta 32: 173–183.
Desutter-Grandcolas L, Anso J, Jourdan H. 2016. Crickets
of New Caledonia (Insecta, Orthoptera, Grylloidea): a key to
genera, with diagnoses of extant genera and descriptions of
new taxa. Zoosystema 38: 405–452.
Desutter-Grandcolas L, Jacquelin L, Hugel S, Boistel R,
Garrouste R, Henrotay M, Warren BH, Chintauan-
Marquier IC, Nel P, Grandcolas P, Nel A. 2017. 3-D
imaging reveals four extraordinary cases of convergent
evolution of acoustic communication in crickets and allies
(Insecta). Scientific Reports 7: 1–8.
Desutter-Grandcolas L, Hugel S, Nel A, Warren BH,
Souza-Dias P, Chintauan-Marquier IC. 2021. Updated
diagnoses for the cricket family Trigonidiidae (Insecta:
Orthoptera: Grylloidea) and its subfamilies (Trigonidiinae,
Nemobiinae), with a review of the fossil record. Zoologischer
Anzeiger 294: 80–91.
Dinerstein E, Olson D, Joshi A, Vynne C, Burgess ND,
Wikramanayake E, Hahn N, Palminteri S, Hedao P,
Noss R, Hansen M, Locke H, Ellis EC, Jones B,
Barber CV, Hayes R, Kormos C, Martin V, Crist E,
Sechrest W, Price L, Baillie JEM, Weeden D,
Suckling K, Davis C, Sizer N, Moore R, Thau D, Birch T,
Potapov P, Turubanova S, Tyukavina A, De Souza N,
Pintea L, Brito JC, Llewellyn OA, Miller AG, Patzelt A,
Ghazanfar SA, Timberlake J, Klöser H, Shennan-
Farpón Y, Kindt R, Lillesø JPB, Van Breugel P,
Graudal L, Voge M, Al-Shammari KF, Saleem M.
2017. An ecoregion-based approach to protecting half the
terrestrial realm. Bioscience 67: 534–545.
Dong J, Kergoat GJ, Vicente N, Rahmadi C, Xu S,
Robillard T. 2018. Biogeographic patterns and
diversification dynamics of the genus Cardiodactylus
Saussure (Orthoptera, Grylloidea, Eneopterinae) in
Southeast Asia. Molecular Phylogenetics and Evolution 129:
1–14.
Drummond AJ, Ho SYW, Phillips MJ, Rambaut A. 2006.
Relaxed phylogenetics and dating with confidence. PLoS
Biology 4: e88.
Edwards EJ, Osborne CP, Strömberg CAE, Smith SA, C4
Grasses Consortium, Bond WJ, Christin PA, Cousins AB,
Duvall MR, Fox DL, Freckleton RP, Ghannoum O,
Hartwell J, Huang Y, Janis CM, Keeley JE, Kellogg EA,
Knapp AK, Leakey ADB, Nelson DM, Saarela JM,
Sage RF, Sala OE, Salamin N, Still CJ, Tipple B. 2010.
The origins of C4 grasslands: integrating evolutionary and
ecosystem science. Science 328: 587–591.
Ewing B, Green P. 1998. base-calling of automated sequencer
traces using Phred. II. Error probabilities. Genome Research
8: 186–194.
Ewing B, Hillier L, Wendl MC, Green P. 1998. Base-calling
of automated sequencer traces using Phred. I. Accuracy
assessment. Genome Research 8: 175–185.
Fabreti LG, Höhna S. 2021. Convergence assessment for
Bayesian phylogenetic analysis using MCMC simulation.
bioRxiv: 2021.05.04.442586.
Farris JS. 1989. The retention index and the rescaled
consistency index. Cladistics 5: 417–419.
Farris JS, Albert VA, Källersjö M, Lipscomb D, Kluge AG.
1996. Parsimony jackknifing out performs neighbor-joining.
Cladistics 12: 99–124.
Felsenstein J. 1985. Confidence limits on phylogenies: an
approach using the bootstrap. Evolution 39: 783–791.
Galtier N, Gouy M, Gautier C. 1996. SEAVIEW and
PHYLO_WIN: two graphic tools for sequence alignment and
molecular phylogeny. Bioinformatics 12: 543–548.
Gamble T, Bauer AM, Greenbaum E, Jackman TR. 2008.
Evidence for Gondwanan vicariance in an ancient clade of
gecko lizards. Journal of Biogeography 35: 88–104.
Gavryushkina A, Welch D, Stadler T, Drummond AJ.
2014. Bayesian inference of sampled ancestor trees for
epidemiology and fossil calibration. PLoS Computational
Biology 10: e1003919.
Gerhardt HC, Huber F. 2002. Acoustic communication in
insects and anurans: common problems and diverse solutions.
Chicago: University of Chicago Press.
Giribet G, Carranza S, Riutort M, Baguñà J, Ribera C.
1999. Internal phylogeny of the Chilopoda (Myriapoda,
Arthropoda) using complete 18S rDNA and partial 28S rDNA
sequences. Philosophical Transactions of the Royal Society of
London, Series B: Biological Sciences 354: 215–222.
Goloboff PA, Catalano SA. 2016. TNT v.1.5, including a full
implementation of phylogenetic morphometrics. Cladistics
32: 221–238.
Gordon D, Green P. 2013. Consed: a graphical editor for next-
generation sequencing. Bioinformatics 29: 2936–2937.
Gorochov A. 1985. On the fauna of Grylloidea (Orthoptera) of
China. Entomologicheskoe Obozrenie 64: 89–109.
Gorochov AV. 1995. System and evolution of the suborder
Ensifera (Orthoptera). Proceedings of the Zoological Institute,
Russian Academy of Sciences 260: 3–224.
Gorochov AV. 2010. New and little known orthopteroid
insects (Polyneoptera) from fossil resins: communication 3.
Paleontological Journal 44: 434–450.
Gorochov AV. 2011. Taxonomy of Podoscirtinae (Orthoptera:
Gryllidae). Part 9: the American tribe Paroecanthini.
Zoosystematica Rossica 20: 216–270.
Gorochov AV. 2013. Taxonomy of Podoscirtinae (Orthoptera:
Gryllidae). Part 10: American taxa of the tribe Aphonoidini.
Zoosystematica Rossica 22: 15–58.
Gorochov AV. 2015. Evolution and taxonomic significance
of the copulatory apparatus in Ensifera (Orthoptera). Part
2: male genitalia in Grylloidea. Zoosystematica Rossica 24:
31–41.
Gorochov AV. 2017. Taxonomy of Podoscirtinae (Orthoptera:
Gryllidae). Part 11: the tribe Hapithini and other American
taxa. Zoosystematica Rossica 26: 11–106.
Gorochov AV. 2018. The cricket subfamily Podoscirtinae
(Orthoptera: Gryllidae) in Peru. Zoosystematica Rossica 27:
77–121.
Gorochov AV. 2020. Taxonomy of Podoscirtinae (Orthoptera:
Gryllidae). Part 12: new taxa of the subtribe Truljaliina
subtrib. nov. from Africa. Zoosystematica Rossica 29:
247–257.

THE FIFTH FAMILY OF TRUE CRICKETS 41
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
Gorochov AV. 2021. Taxonomy of Podoscirtinae (Orthoptera:
Gryllidae). Part 13: new taxa of the subtribe Podoscirtina
from Africa. Zoosystematica Rossica 30: 64–77.
Grant PR, Grant BR, Huey RB, Johnson MTJ, Knoll AH,
Schmitt J. 2017. Evolution caused by extreme events.
Philosophical Transactions of the Royal Society B: Biological
Sciences 372: 20160146.
Gwynne DT. 2001. Katydids and bush-crickets: reproductive
behavior and evolution of the Tettigoniidae. Ithaca: Cornell
University Press.
Gwynne DT, Morris GK. 1983. Orthopteran mating systems.
Boulder: Westview Press.
He ZQ, Shen CZ, Wu X. 2020. The first phylogenetic study
of sword-tail crickets from China inferred from COI, 18S
and 28S genes, with the establishment of two new genera
and description of one new species (Orthoptera: Grylloidea:
Trigonidiidae). Zootaxa 4890: 119–128.
Heads SW. 2010. The first fossil spider cricket (Orthoptera:
Gryllidae: Phalangopsinae): 20 million years of
troglobiomorphosis or exaptation in the dark? Zoological
Journal of the Linnean Society 158: 56–65.
Heads SW, Penney D, Green DI. 2012. A new fossil cricket
of the genus Proanaxipha in Miocene amber from the
Dominican Republic (Orthoptera, Gryllidae, Pentacentrinae).
ZooKeys 229: 111–118.
Heath TA, Huelsenbeck JP, Stadler T. 2014. The fossilized
birth–death process for coherent calibration of divergence-
time estimates. Proceedings of the National Academy of
Sciences of the USA 111: E2957–E2966.
Hedwig B. 2014. Insect hearing and acoustic communication.
Cambridge: Springer.
Hoang DT, Chernomor O, von Haeseler A, Minh BQ,
Vinh LS. 2018. UFBoot2: improving the Ultrafast Bootstrap
Approximation. Molecular Biology and Evolution 35:
518–522.
Huang Y, Ortí G, Sutherlin M, Duhachek A, Zera A.
2000. Phylogenetic relationships of North American field
crickets inferred from mitochondrial DNA data. Molecular
Phylogenetics and Evolution 17: 48–57.
Huber F, Moore TE, Loher W. 1989. Cricket behavior and
neurobiology. Ithaca: Cornell University Press.
Ingrisch S. 1997. Taxonomy, stridulation and development of
Podoscirtinae from Thailand. Senckenbergiana Biologica 77:
47–75.
Jarvis KJ, Haas F, Whiting MF. 2004. Phylogeny of earwigs
(Insecta: Dermaptera) based on molecular and morphological
evidence: reconsidering the classification of Dermaptera.
Systematic Entomology 30: 442–453.
Kalyaanamoorthy S, Minh BQ, Wong TKF,
Von Haeseler A, Jermiin LS. 2017. ModelFinder: fast
model selection for accurate phylogenetic estimates. Nature
Methods 14: 587–589.
Kambhampati S. 1995. A phylogeny of cockroaches and
related insects based on DNA sequence of mitochondrial
ribosomal RNA genes. Proceedings of the National Academy
of Sciences of the USA 92: 2017–2020.
Katoh K, Standley DM. 2014. MAFFT: iterative refinement
and additional methods. In: Russell, D. (eds) Multiple
Sequence Alignment Methods. Methods in Molecular Biology,
Vol. 1079. Totowa, NJ: Humana Press 131-146. Available at:
https://doi.org/10.1007/978-1-62703-646-7_8.
Katoh K, Misawa K, Kuma K ichi I, Miyata T. 2002. MAFFT:
a novel method for rapid multiple sequence alignment
based on fast Fourier transform. Nucleic Acids Research 30:
3059–3066.
Kluge AG, Farris JS. 1969. Quantitative phyletics and the
evolution of Anurans. Systematic Zoology 18: 1–32.
Labadessa R, Todisco S. 2016. Patterns of ecology and
distribution of the tree crickets Oecanthus dulcisonans
and O. pellucens (Orthoptera: Gryllidae; Oecanthinae) in
southern Italy. Zootaxa 4169: 579–586.
Lake JA. 1991. The order of sequence alignment can bias the
selection of tree topology. Molecular Biology and Evolution
8: 378–385.
Larsson A. 2014. AliView: a fast and lightweight alignment
viewer and editor for large datasets. Bioinformatics 30:
3276–3278.
Lutzoni F, Wagner P, Reeb V, Zoller S. 2000. Integrating
ambiguously aligned regions of DNA sequences in
phylogenetic analyses without violating positional homology.
Systematic Biology 49: 628–651.
Maddison WP, Maddison DR. 2021. Mesquite: a modular
system for evolutionary analysis. Version 3.61. Available at:
http://www.mesquiteproject.org.
Martins-Neto RG. 1991. Sistemática dos Ensifera (Insecta,
Orthopteroida) da formação Santana, Cretáceo Inferior do
Nordeste do Brasil. Acta Geologica Leopoldensia 14: 5–162.
Matthews RW, Matthews JR. 2009. Insect behavior.
Heidelberg: Springer Science & Business Media.
Mendelson TC, Shaw KL. 2005. Rapid speciation in an
arthropod. Nature 433: 375–376.
Mhatre N, Montealegre-Z F, Balakrishnan R, Robert D.
2009. Mechanical response of the tympanal membranes of
the tree cricket Oecanthus henryi. Journal of Comparative
Physiology. A, Neuroethology, Sensory, Neural, and
Behavioral Physiology 195: 453–462.
Mhatre N, Malkin R, Deb R, Balakrishnan R, Robert D.
2017. Tree crickets optimize the acoustics of baffles to
exaggerate their mate- attraction signal. Elife 6: 1–16.
Milach EM, Kátia M, Da Costa M, De L, Martins P,
Nunes LA, Santos D, Silva M, Roberto F, Garcia M,
Centeno E, Oliveira D, Zefa E. 2016. New species of tree
cricket Oecanthus Serville, 1831 (Orthoptera: Gryllidae:
Oecanthinae) from Reserva Natural Vale, Espírito Santo,
Brazil, with chromosome complement. Zootaxa 4173:
137–146.
Nattier R, Robillard T, Desutter-Grandcolas L,
Couloux A, Grandcolas P. 2011. Older than New
Caledonia emergence? A molecular phylogenetic study of
the eneopterine crickets (Orthoptera: Grylloidea). Journal of
Biogeography 38: 2195–2209.
Nattier R, Grandcolas P, Elias M, Desutter-Grandcolas L,
Jourdan H, Couloux A, Robillard T. 2012. Secondary
sympatry caused by range expansion informs on the
dynamics of microendemism in a biodiversity hotspot. PLoS
One 7: e48047.

42 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
Nguyen LT, Schmidt HA, Von Haeseler A, Minh BQ.
2015. IQ-TREE: a fast and effective stochastic algorithm
for estimating maximum-likelihood phylogenies. Molecular
Biology and Evolution 32: 268–274.
Nixon KC. 2002. WinClada, v.1.00. 08. Ithaca: Published by
the author.
Olsen GJ, Woese CR. 1993. Ribosomal RNA: a key to
phylogeny. The FASEB Journal 7: 113–123.
Orci KM, Petróczki K, Barta Z. 2016. Instantaneous song
modification in response to fluctuating traffic noise in the
tree cricket Oecanthus pellucens. Animal Behaviour 112:
187–194.
Otte D. 1994. The crickets of Hawaii: origin, systematics, and
evolution. Philadelphia: The Orthopterists’ Society.
Otte D, Alexander RD. 1983. The Australian crickets
(Orthoptera: Gryllidae). Kansas: Allen Press.
Otte D, Pérez-Gelabert DE. 2009. Caribbean crickets.
Philadelphia: The Orthopterists’ Society.
Penney D, Wheater CP, Selden PA. 2003. Resistance of
spiders to Cretaceous-Tertiary extinction events. Evolution
57: 2599–2607.
Pollack GS, Mason AC, Popper AN, Fay RR. 2016. Insect
hearing. Switzerland: Springer International Publishing.
Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA.
2018. Posterior summarization in Bayesian phylogenetics
using Tracer 1.7. Systematic Biology 67: 901–904.
Ramírez-Barahona S, Sauquet H, Magallón S. 2020. The
delayed and geographically heterogeneous diversification
of flowering plant families. Nature Ecology & Evolution 4:
1232–1238.
Ritchie MG, Garcia CM. 2005. Evolution of species: explosive
speciation in a cricket. Heredity 95: 5–6.
Robillard T. 2021. Le rôle de la taxonomie et de l’histoire
naturelle dans l’étude de l’évolution des grillons Eneopterinae.
In: Grandcolas P, Maurel MC, eds. Systématique et exploration
du vivant. Surrey: Phi, 37–62.
Robillard T, Desutter-Grandcolas L. 2004. Phylogeny
and the modalities of acoustic diversification in
extant Eneopterinae (Insecta, Orthoptera, Grylloidea,
Eneopteridae). Cladistics 20: 271–293.
Robillard T, Desutter-Grandcolas L. 2006. Phylogeny of
the cricket subfamily Eneopterinae (Orthoptera, Grylloidea,
Eneopteridae) based on four molecular loci and morphology.
Molecular Phylogenetics and Evolution 40: 643–661.
Sanmartíin I, Ronquist F. 2004. Southern Hemisphere
biogeography inferred by event-based models: plant versus
animal patterns. Systematic Biology 53: 216–243.
Sanno R, Kataoka K, Hayakawa S, Ide K, Nguyen CN,
Nguyen TP, Le BTN, Kim OTP, Mineta K, Takeyama H,
Takeda M, Sato T, Suzuki T, Yura K, Asahi T. 2021.
Comparative analysis of mitochondrial genomes in Gryllidea
(Insecta: Orthoptera): implications for adaptive evolution
in ant-loving crickets. Genome Biology and Evolution 13:
evab222.
Saussure H de. 1878. Melanges orthopterologiques: gryllides.
VI. fascicule Gryllides. Mémoires de la Société de Physique et
d’Histoire Naturelle de Genève 25: 369–704.
Schubnel T, Desutter-Grandcolas L, Legendre F,
Prokop J, Mazurier A, Garrouste R, Grandcolas P,
Nel A. 2019. To be or not to be: postcubital vein in insects
revealed by microtomography. Systematic Entomology 45:
327–336.
Sereno PC. 2007. Logical basis for morphological characters
in phylogenetics. Cladistics 23: 565–587.
Shaw KL. 2002. Conflict between nuclear and mitochondrial
DNA phylogenies of a recent species radiation: what mtDNA
reveals and conceals about modes of speciation in Hawaiian
crickets. Proceedings of the National Academy of Sciences of
the USA 99: 16122–16127.
Shen CZ, Guo PK, He ZQ. 2020. A pilot phylogeny study
of Nemobiinae inferred from 18S, 28s and COI genes, with
descriptions of two new genera and a new species from
Hainan, China (Orthoptera: Grylloidea: Trigonidiidae).
Zootaxa 4778: 383–390.
Short AEZ, Girón JC, Toussaint EFA. 2021. Evolution
and biogeography of acidocerine water scavenger beetles
(Coleoptera: Hydrophilidae) shaped by Gondwanan
vicariance and Cenozoic isolation of South America.
Systematic Entomology 46: 380–395.
Šipoš J, Kindlmann P. 2013. Effect of the canopy complexity
of trees on the rate of predation of insects. Journal of Applied
Entomology 137: 445–451.
Sismondo E. 1993. Ultrasubharmonic resonance and
nonlinear dynamics in the song of Oecanthus nigricornis
F. Walker (Orthoptera: Gryllidae). International Journal of
Insect Morphology and Embryology 22: 217–231.
Song H, Amédégnato C, Cigliano MM, Desutter-
Grandcolas L, Heads SW, Huang Y, Otte D, Whiting MF.
2015. 300 million years of diversification: elucidating the
patterns of orthopteran evolution based on comprehensive
taxon and gene sampling. Cladistics 31: 621–651.
Song H, Béthoux O, Shin S, Donath A, Letsch H, Liu S,
McKenna DD, Meng G, Misof B, Podsiadlowski L,
Zhou X, Wipfler B, Simon S. 2020. Phylogenomic analysis
sheds light on the evolutionary pathways towards acoustic
communication in Orthoptera. Nature Communications
2020: 4939.
Souza-Dias PGB de. 2015. Análise cladística e morfologia do
complexo fálico de Phalangopsidae, com ênfase em Luzarinae
(Orthoptera, Ensifera, Grylloidea). Unpublished Ph. D.
thesis, Universidade de São Paulo - Instituto de Biociências.
Swofford DL, Olsen GJ, Waddell PJ, Hillis DM .
1996. Phylogenetic inference. In: Hillis DM, Moritz C,
Mable BK, eds. Molecular systematics. Sunderland:
Sinauer, 407–514.
Tan MK, Malem J, Legendre F, Dong J, Baroga-
Barbecho JB, Yap SA, Wahab R bin HA, Japir R,
Chung AYC, Robillard T. 2021. Phylogeny, systematics
and evolution of calling songs of the Lebinthini
crickets (Orthoptera, Grylloidea, Eneopterinae), with
description of two new genera. Systematic Entomology
46: 1060–1087.
Toussaint EFA, Bloom D, Short AEZ. 2017. Cretaceous
West Gondwana vicariance shaped giant water scavenger
beetle biogeography. Journal of Biogeography 44:
1952–1965.
Vaidya G, Lohman DJ, Meier R. 2011. SequenceMatrix:
concatenation software for the fast assembly of multi-gene

THE FIFTH FAMILY OF TRUE CRICKETS 43
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
datasets with character set and codon information. Cladistics
27: 171–180.
Vaughan TG. 2017. IcyTree: rapid browser-based visualization
for phylogenetic trees and networks. Bioinformatics 33:
2392–2394.
Vicente N, Kergoat GJ, Dong J, Yotoko K, Legendre F,
Nattier R, Robillard T. 2017. In and out of the Neotropics:
historical biogeography of Eneopterinae crickets. Journal of
Biogeography 44: 2199–2210.
Walker TJ, Collins N. 2010. New World thermometer
crickets: the Oecanthus rileyi species group and a new
species from North America. Journal of Orthoptera
Research 19: 371–376.
Wang H, Fang YN, Fang Y, Jarzembowski EA, Wang B,
Zhang HC. 2019. The earliest fossil record of true crickets
belonging to the Baissogryllidae (Insecta, Orthoptera,
Grylloidea). Geological Magazine 156: 1440–1444.
Whiting MF. 2002. Mecoptera is paraphyletic: multiple genes
and phylogeny of Mecoptera and Siphonaptera. Zoologica
Scripta 31: 93–104.
Wills MA. 1999. Congruence between phylogeny and
stratigraphy: randomization tests and the gap excess ratio.
Systematic Biology 48: 559–580.
Xu C, Zhang H, Jarzembowski EA, Fang Y. 2020. The first
ground cricket (Orthoptera: Trigonidiidae: Nemobiinae) from
mid-Cretaceous Burmese amber. Cretaceous Research 115:
104481.
Zeuner FE. 1937. Descriptions of new genera and species of fossil
Saltatoria (Orthoptera). Proceedings of the Royal Entomological
Society of London Series B Taxonomy 6: 154–159.
SUPPORTING INFORMATION
Additional Supporting Information may be found in the online version of this article at the publisher’s web-site.
File S1: Morphological character list of Oecanthidae’s phylogenies.
File S2: Morphological data matrix of Oecanthidae’s phylogenies including fossils.
File S3: Convergence of MCMC analyses using Convenience package (R).
File S4: ML and MP results.
Figure S1. Frontal head: A, Tafalisca elongata elongate; B, Phyllogryllus velutinus; C, Eneoptera surinamensis;
D, Phyllogryllus sp., eyes frontal; E, eyes, lateral view; F, Cearacesa nova, head lateral; G, Euscyrtus sp., frontal
head; H, fastigium, dorsal view; I Apterotrypa mitarakensis, frontal head; J, Neoxabea brevipes, antennal scape; K,
Neoxabea brevipes, lateral head and pronotum; maxillary palpi, fifth article lateral. Scales 1 mm.
Figure S2. Dorsal habitus: A, Neometrypus couriae; B, Neometrypus marcelae, C, Veredatrypa rosai, D, Euscyrtus
bipunctatus. Diatrypa (Diatrypa) tuberculata: E, right forewing: a, PCu vein (stridulatory file); b, harp; c, mirror;
d, apical field; e, lateral field; f, anal area; g, chordal area; h, median fan; F, dorsal habitus; G, right forewing; H,
right forewing: a, dorsal field; b, lateral field; I, lateral field, veins; J, ight and left forewings, posterior view: a,
dorsal field; b, lateral field; K, Diatrypa (Diatrypa) tuberculata, PCu vein, ventral (scale 200 µm). Abbreviations:
see Material and methods.
Figure S3. A, Tafalisca elongata elongata, dorsal forewings; B, PCu veins; C, Hapithus (Antillicharis) sp. PCu vein,
ventral; D, Veredatrypa seca, forewings proximal margin; E, Ligypterus linharensis, right forewings; F, Fryerius sp,
right forewing; G, Phyllogryllus velutinus, right forewing; H, Oecanthus sp., right forewing; I, Archenopterus sp.,
forewings proximal margin. Abbreviations: see Material and methods.
Figure S4. Pronotum: A, dorsal view; B, lateral view. Metanotum: C, Veredatrypa rosai; D, Cearacesa cearensis;
E, Brazitrypa cornuta; F, Apterotrypa mitarakensis, thorax in dorsal view. Dorsal abdômen, distal: G, Neoxabea
brevipes; H, Apterotrypa mitarakensis; I, subgenital plates; J, Diatrypa (Diatrypa) tuberculata, subgenital plate
and ovipositor: a, ventral; b, lateral. Hindleg, lateral view: K, Adenophallusia legendrei; L, Cearacesa cearensis.
Abbreviations: pron., pronotum; metanot., metanotum.
Figure S5. Ovipositor apex: A, Phyllogryllus velutinus, dorsal; B, Tafalisca elongata elongata, dorsal; C, Diatrypa
(Latispeculum) choristos, dorsal; D, Diatrypa (Latispeculum) choristos, ventral; E, Somnambula livida, ventral; F,
Brazitrypa cornuta, dorsal; G, Prozvenella bangaloriensis, dorsal; H, Perutrella septentrionalis, ventral. Foreleg: I,
Angistitrella mataraku, inner face; J, Angustitrella mataraku, outer face; K, Endecous sp., inner face; L, Ligypterus
linharensis, inner face; M, Fryerius sp., outer face; N, Tafalisca duckeana, fore and middle tibia; O, tibia I, apical;
P, tibia II, apical; tibia I, lateral. Scales 1 mm. Abbreviations: see Material and methods.
Figure S6. A, Perutrella septentrionalis, hindleg in lateral view; B, Tafalisca lineatipes, hind tibia; C, Euscyrtinae,
hind tibia; D, tibia III, apical; E and F, tibia III apical, inner face; G, claws, inner margin. Scale 1 mm. Abbreviations:
see Material and methods.
Figure S7. Male genitalia. Tafalisca vestigialis: A, dorsal; B, ventral; C, dorsal; D, Diatrypa (Latispeculum) aff.
brunnea, dorsal; E, Apterotrypa mitarakensis, lateral; F, Fryerius sp. lateral; G, Eidmanacris endophallica, lateral;
H, Aphonomorphus (Euaphonus) sp., lateral. Scales 1 mm. Abbreviations: see Material and methods.

44 L.D. CAMPOS ET AL.
© 2022 The Linnean Society of London, Zoological Journal of the Linnean Society, 2022, XX, 1–44
Figure S8. Male genitalia. A, Veredatrypa fusca, dorsal; B, Angustitrella picipes, dorsal; C, Stenogryllus sp.,
ventral; D, Hapithus (Hapithus) sp., pseudepiphallic sclerite lateral; E, Prozvenella bangaloriensis, pseudepiphallic
sclerite lateral; F, Phyllogryllus velutinus, lateral; G, Oecanthus lineolatus, dorsal; H, Brazitrypa paulista, dorsal;
I, Taroba elephantina, dorsal. Structures from ectophallic invagination: a, ventral, b, lateral: J, Stenogryllus sp.; K,
Tafalisca vestigialis. Endophallus: L, Tafalisca duckeana, ventral; M, Veredatrypa fusca, dorsal; N, Neometrypus
badius, ventral. Scales A–K 1mm, L–N 0.5 mm. Abbreviations: see Material and methods.
Figure S9. Male genitalia. A, Eneopteroides bicolor, ventral; B, Gryllus sp. dorsal; C, Diatrypa (Diatrypa)
tuberculata, lateral. Scales 1 mm. Abbreviations: see Material and methods.
Figure S10. Strict consensus tree of Oecanthidae of four most parsimonious trees based on 107 terminals, four
molecular markers, and 197 morphological characters (13 684 steps; ci 0.23; ri 0.59) under equal weights, and
morphological characters optimized (fast optimization). White circles indicate homoplastic synapomorphies, black
circles exclusive synapomorphies. Number above circle indicates the characters, above the states.
Figure S11. Summarized phylogenetic tree of Oecanthidae based on molecular and morphological characters
obtained under Bayesian Inference. Red taxa indicate included fossils placement.
Figure S12. Time-calibrated phylogenetic tree of Oecanthidae. Divergence-time analysis under Bayesian inference
based on four DNA markers and six fossil calibrating internal nodes. Bars indicate 95% highest posterior density
intervals for all nodes. Posterior probabilities are indicated in black numbers. A, lineages-through-time plot.
Figure S13. Phylogeny under maximum likelihood criteria of Oecanthidae based on 107 terminals, four molecular
markers, and 197 morphological characters. Support values (ultrafast bootstrap/bootstrap) are indicated in
the nodes.
Figure S14. Strict consensus tree of Oecanthidae of four most parsimonious trees based on 107 terminals, four
molecular markers, and 197 morphological characters (13 684 steps; ci 0.23; ri 0.59) under equal rates. Support
values (Jackknife/Bootstrap) are indicated in the nodes.