ArticlePDF Available

Fast-tracking antibody maturation using a B cell-based display system

Authors:

Abstract and Figures

Affinity maturation, an essential component of antibody engineering, is crucial for developing therapeutic antibodies. Cell display system coupled with somatic hypermutation (SHM) initiated by activation-induced cytidine deaminase (AID) is a commonly used technique for affinity maturation. AID introduces targeted DNA lesions into hotspots of immunoglobulin (Ig) gene loci followed by erroneous DNA repair, leading to biased mutations in the complementary determining regions. However, systems that use an in vivo mimicking mechanism often require several rounds of selection to enrich clones possessing accumulated mutations. We previously described the human ADLib® system, which features autonomous, AID-mediated diversification in Ig gene loci of a chicken B cell line DT40 and streamlines human antibody generation and optimization in one integrated platform. In this study, we further engineered DT40 capable of receiving exogenous antibody genes and examined whether the antibody could be affinity matured. The Ig genes of three representative anti-hVEGF-A antibodies originating from the human ADLib® were introduced; the resulting human IgG1 antibodies had up to 76.4-fold improvement in binding affinities (sub-picomolar KD) within just one round of optimization, owing to efficient accumulation of functional mutations. Moreover, we successfully improved the affinity of a mouse hybridoma-derived anti-hCDCP1 antibody using the engineered DT40, and the observed mutations remained effective in the post-humanized antibody as exhibited by an 8.2-fold increase of in vitro cytotoxicity without compromised physical stability. These results demonstrated the versatility of the novel B cell-based affinity maturation system as an easy-to-use antibody optimization tool regardless of the species of origin. Abbreviations: ADLib®: Autonomously diversifying library, ADLib® KI-AMP: ADLib® knock-in affinity maturation platform, AID: activation-induced cytidine deaminase, CDRs: complementary-determining regions, DIVAC: diversification activator, ECD: extracellular domain, FACS: fluorescence-activated cell sorting, FCM: flow cytometry, HC: heavy chainIg: immunoglobulin, LC: light chain, NGS: next-generation sequencing, PBD: pyrrolobenzodiazepine, SHM: somatic hypermutation, SPR: surface plasmon resonance
Schematic representation of the construction of the cells expressing the exogenous antibodies and the standard workflow of affinity maturation using the ADLib® KI-AMP. (a). Genetic engineering of the immunoglobulin HC locus of DT40. The functional chicken V gene (VH) and constant region of the endogenous chicken Cμ1 gene of wild type DT40 were replaced by the selection marker gene thymidine kinase (TK) and the HC constant region of human IgG1 gene (hCH). Exogenous human VH was knocked-in to the TK region of the ADLib® KI-AMP cell. The drug resistant gene was excised by Cre recombinase transient expression at the same time as the removal of the light chain drug resistance genes, resulting in the expression of the exogenous Ig genes. TK was known as negative selectable marker but was not used for selection of the exogenous VH knocked-in cell for this study, because introduction of the attempted VH gene resulted in Ig expression. (b). Genetic engineering of the immunoglobulin LC locus of DT40. The chicken V gene (VL) and constant region (CLλ) of wtDT40 were replaced with the expression marker gene hCD4ΔC and human kappa constant region (hCLκ). DT40 have two LC alleles (i.e., VJ rearranged and unrearranged alleles). We confirmed that the replacement occurs only at the rearranged allele. Exogenous VL and human CLκ/λ genes on the VL-CL KI vector were knocked-in to the hCD4ΔC and hCLκ region of the ADLib® KI-AMP, resulting in elimination of human CD4 on the cell surface. After selection by G418 and blasticidin, the drug resistant genes were excised by Cre recombinase transient expression. "T" shown at immediate downstream of hCD4ΔC indicates transcriptional terminator. (c). The V genes of the antibodies subjected to maturation were knock-in in a step wise manner into the platform cells using the vectors shown in the panel A and B. The cells harboring the knocked-in V genes were obtained by sorting the IgG-Fc positive and antigen reactivity positive cells using FACS. The clones expressing the attempted antibodies were cultured to diversified sequence and the affinity-matured clones were isolated by single cell sorting by antigen reactivity.
… 
Content may be subject to copyright.
Full Terms & Conditions of access and use can be found at
https://www.tandfonline.com/action/journalInformation?journalCode=kmab20
mAbs
ISSN: (Print) (Online) Journal homepage: https://www.tandfonline.com/loi/kmab20
Fast-tracking antibody maturation using a B cell-
based display system
Hitomi Masuda, Atsushi Sawada, Shu-ichi Hashimoto, Kanako Tamai, Ke-Yi
Lin, Naoto Harigai, Kohei Kurosawa, Kunihiro Ohta, Hidetaka Seo & Hiroshi
Itou
To cite this article: Hitomi Masuda, Atsushi Sawada, Shu-ichi Hashimoto, Kanako Tamai, Ke-
Yi Lin, Naoto Harigai, Kohei Kurosawa, Kunihiro Ohta, Hidetaka Seo & Hiroshi Itou (2022) Fast-
tracking antibody maturation using a B cell-based display system, mAbs, 14:1, 2122275, DOI:
10.1080/19420862.2022.2122275
To link to this article: https://doi.org/10.1080/19420862.2022.2122275
© 2022 Chiome Bioscience Inc. Published
with license by Taylor & Francis Group, LLC.
View supplementary material
Published online: 06 Oct 2022.
Submit your article to this journal
View related articles
View Crossmark data
REPORT
Fast-tracking antibody maturation using a B cell-based display system
Hitomi Masuda
a
*, Atsushi Sawada
a
, Shu-ichi Hashimoto
a
, Kanako Tamai
a
, Ke-Yi Lin
a
, Naoto Harigai
a
,
Kohei Kurosawa
a
, Kunihiro Ohta
b
, Hidetaka Seo
b
, and Hiroshi Itou
a
a
Research Laboratories, Chiome Bioscience Inc, Tokyo, Japan;
b
Department of Life Sciences, Graduate School of Arts and Sciences, The University of
Tokyo, Tokyo, Japan
ABSTRACT
Anity maturation, an essential component of antibody engineering, is crucial for developing therapeutic
antibodies. Cell display system coupled with somatic hypermutation (SHM) initiated by activation-induced
cytidine deaminase (AID) is a commonly used technique for anity maturation. AID introduces targeted DNA
lesions into hotspots of immunoglobulin (Ig) gene loci followed by erroneous DNA repair, leading to biased
mutations in the complementary determining regions. However, systems that use an in vivo mimicking
mechanism often require several rounds of selection to enrich clones possessing accumulated mutations. We
previously described the human ADLib® system, which features autonomous, AID-mediated diversication in Ig
gene loci of a chicken B cell line DT40 and streamlines human antibody generation and optimization in one
integrated platform. In this study, we further engineered DT40 capable of receiving exogenous antibody genes
and examined whether the antibody could be anity matured. The Ig genes of three representative anti-hVEGF
-A antibodies originating from the human ADLib® were introduced; the resulting human IgG1 antibodies had
up to 76.4-fold improvement in binding anities (sub-picomolar K
D
) within just one round of optimization,
owing to ecient accumulation of functional mutations. Moreover, we successfully improved the anity of
a mouse hybridoma-derived anti-hCDCP1 antibody using the engineered DT40, and the observed mutations
remained eective in the post-humanized antibody as exhibited by an 8.2-fold increase of in vitro cytotoxicity
without compromised physical stability. These results demonstrated the versatility of the novel B cell-based
anity maturation system as an easy-to-use antibody optimization tool regardless of the species of origin.
Abbreviations: ADLib®: Autonomously diversifying library, ADLib® KI-AMP: ADLib® knock-in anity
maturation platform, AID: activation-induced cytidine deaminase, CDRs: complementary-determining
regions, DIVAC: diversication activator, ECD: extracellular domain, FACS: uorescence-activated cell
sorting, FCM: ow cytometry, HC: heavy chainIg: immunoglobulin, LC: light chain, NGS: next-generation
sequencing, PBD: pyrrolobenzodiazepine, SHM: somatic hypermutation, SPR: surface plasmon resonance
ARTICLE HISTORY
Received 22 May 2022
Revised 21 August 2022
Accepted 5 September 2022
KEYWORDS
Affinity maturation; DT40;
somatic hypermutation;
activation-induced cytidine
deaminase; hotspot;
coldspot; therapeutic
antibodies; deep sequencing
Introduction
Monoclonal antibodies are becoming an indispensable therapeu-
tic modality owing to their remarkable clinical benefits.
1,2
Advances in antibody discovery and engineering technologies
have allowed for highly rapid and efficient therapeutic antibody
generation.
3
Affinity maturation is a key step for developing
antibodies exhibiting therapeutic properties. Many techniques,
including in vitro display-based approaches combined with ran-
dom- or targeted-mutagenesis and chain shuffling and in silico
computational approaches, have been established and widely
adopted.
4
These well-researched techniques, however, require in-
depth knowledge of antibody engineering for artificial mutation
library design and involve complicated experimental procedures,
including reformatting of antibody fragments into full-length
antibodies. Thus, these techniques are usually unsuccessful at
processing multiple antibodies simultaneously. The limitations
of these approaches can potentially delay further downstream
processes of drug development.
An alternative approach for in vitro affinity maturation
mimics the in vivo antibody maturation mechanism. In animals,
antibody affinity maturation occurs in B cells by somatic hyper-
mutation (SHM). In activated B cells, mutations occur in the
immunoglobulin (Ig) loci at a frequency of 10
−5
–10
−3
per base,
which is 10
6
-fold more frequent than spontaneous mutations
occurring in other non-immunoglobulin genes.
5
Activation-
induced cytidine deaminase (AID) is an initiator for the SHM
process (Figure 1a). AID preferentially deaminates cytosine in
DNA to uracil under the context of WRC/GYW DNA motifs
(W = A/T, R = A/G, Y = C/T), called “AID hotspots”, whereas
SYC (S = G/C) and the third C in the trinucleotides GAC, GGC,
CAC and TTC are rarely deaminated and are known as “AID
coldspots”.
6,7
These hotspots and coldspots are expected to be
spread on Ig genes to maximize mutations at complementary-
determining regions (CDRs) and minimize mutations at structu-
rally important framework regions (FRs).
8,9
Numerous affinity-
enhancing mutations artificially introduced using methods such
CONTACT Hitomi Masuda hmasuda@chiome.co.jp Research Laboratories, Chiome Bioscience Inc, Sumitomo-Fudosan Nishi-shinjuku bldg. No. 6, 3-12-1
Honmachi, Shibuya-ku, Tokyo 151-0071, Japan; Hiroshi Itou hito@chiome.co.jp Research Laboratories, Chiome Bioscience Inc, Sumitomo-Fudosan Nishi-
shinjuku bldg. No. 6, 3-12-1, Honmachi, Shibuya-ku, Tokyo 151-0071 Japan
*Lead contact
Supplemental data for this article can be accessed online at https://doi.org/10.1080/19420862.2022.2122275
MABS
2022, VOL. 14, NO. 1, e2122275 (19 pages)
https://doi.org/10.1080/19420862.2022.2122275
© 2022 Chiome Bioscience Inc. Published with license by Taylor & Francis Group, LLC.
This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits
unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
as random mutagenesis and saturation mutagenesis have unex-
pectedly reduced antigen specificity and/or manufacturability of
antibodies.
10–12
However, mutations generated via an in vivo
mechanism can prevent such drawbacks, and the process can be
conducted without a priori knowledge of antibody engineering.
13
Although SHM is capable of efficiently introducing functional
mutations, including unique mutations with amino acid length
changes and/or multiple amino acid replacements that are diffi-
cult to obtain using site-directed mutagenesis or in silico
approaches, mutations occur stochastically in an AID activity-
dependent manner. Multiple rounds of the mutation accumula-
tion process are usually required to obtain the final antibodies.
14–
21
Therefore, introduction and accumulation of functional muta-
tions in a short amount of time and with subsequent effective
enrichment and isolation of the best candidate from the cell pool
are critical to performing antibody maturation efficiently using an
in vivo mechanism.
The chicken pre-B cell line DT40 has been used for a wide
range of applications in de novo antibody generation,
22–27
affinity
maturation,
15,20,22
and molecular evolution of non-
immunoglobulin proteins.
28–30
In DT40 cells, AID mediates
SHM and gene conversion, a gene shuffling mechanism occurring
between the functional antibody genes in Ig loci and the antibody
pseudogenes upstream of the functional genes (Figure 1a).
31
Gene
conversion plays an indispensable role in diversifying B cell reper-
toires in chickens.
31
Autonomously diversifying library (ADLib®)
is an antibody discovery and optimization platform fully utilizes
the antibody gene diversification machinery of chicken B cell line
DT40.
22–25,32,33
The original ADLib®, our first platform, expresses
chicken IgM (Figure 1b); the human version ADLib® expresses
full-length human IgG1 as an in vitro antibody discovery
platform.
22
Both ADLib® systems are capable of generating target
antigen-specific monoclonal antibodies. Notably, the cloned cells
expressing the target-specific antibodies retain the ability to
further diversify their endogenous Ig genes; therefore, the plat-
form uniquely enables seamless transition from antibody discov-
ery to subsequent antibody maturation. Owing to its short
doubling time (7–8 hours),
33
this unique in vitro affinity matura-
tion process using DT40 is highly efficient and can generate
antibodies exhibiting tens to thousands-fold enhanced antigen-
binding capacity within just one or two rounds of maturation
cycles (Table S1).
22
However, straightforward affinity maturation
has only been demonstrated with clones derived from the ADLib®
system per se.
Here, we describe the ADLib® knock-in affinity maturation
platform (ADLib® KI-AMP), in which DT40 cells are further
engineered to be capable of receiving V regions of attempted
antibody genes and enhancing their antigen reactivity. The Ig
Figure 1. Schematic representations of the Ig gene diversification mechanism in DT40 and the ADLib® platforms. (a). Molecular mechanism of Ig diversification in DT40.
Gene conversion and SHM are both triggered by AID-mediated deamination of cytosine. (b). The original ADLib® expresses chicken IgM diversified by gene conversion
occurring among the functional V genes and the pseudo-V genes in a copy-and-paste manner (upper panel). In the human ADLib®, the functional Ig genes and the
endogenous pseudo-chicken V genes of DT40 were replaced by the human synthetic pseudo V genes so that the cells expressed human IgG1 antibodies. The antibody
genes are diversified by gene conversion similarly to that in the original ADLib® (middle panel). In the ADLib® KI-AMP, the chicken constant regions of DT40 have been
replaced by the human counterparts and various functional V genes can be introduced into the Ig loci. The antibody subjected to maturation is expressed as a human
IgG1 format. Although the platform cell possesses the chicken pseudogenes, gene conversion is not expected to occur unless the functional V genes are highly
homologous with the chicken pseudogenes (lower panel).
e2122275-2 H. MASUDA ET AL.
genes subjected to maturation are knocked-in to the endogenous
Ig loci of DT40 in this platform. The cells in the ADLib® KI-
AMP do not contain synthetic human antibody pseudogenes,
unlike those in the human ADLib®;
22
instead, these cells possess
endogenous chicken pseudogenes upstream of the functional
V. It has been reported that the deletion of pseudogenes in
DT40 abolishes gene conversion and activates SHM,
34
and trans-
genes inserted into the Ig loci without gene conversion donors
readily available nearby can be diversified by SHM induced by
AID.
29
Therefore, we hypothesize that low homologies between
functional V and pseudogenes can impede gene conversion and
promote SHM in DT40 without altering the endogenous chicken
pseudogenes (Figure 1b). As a result, mutations found in the
artificially inserted Ig genes were predominantly introduced by
SHM, instead of gene conversion in the ADLib® KI-AMP. Using
this novel platform, we demonstrated successful affinity matura-
tion of the desired antibodies regardless of their species of origin
while maintaining binding specificity and physical stability.
Results
Design and construction of the ADLib® KI-AMP
For affinity maturation of antibody candidates using DT40,
endogenous chicken Ig genes must be replaced by desired Ig
genes. Knockout of the endogenous Ig genes and subsequent
knock-in of the desired Ig genes into the cell was performed
using gene targeting. To enable the easy construction of cells in
which exogenous Ig genes are knocked-in using fluorescence-
activated cell sorting (FACS), we generated modified DT40
cells for the ADLib® KI-AMP. In these platform cells, the
heavy chain (HC) constant region of the endogenous chicken
Cμ1 gene was replaced by the HC constant region of human
IgG1 gene as in the human ADLib® (Figure 2a).
22
The endo-
genous light chain (LC) constant region of the chicken LCλ
(CLλ) gene was also replaced by the LC constant region of
human LCκ (CLκ) (Figure 2b). The V regions of the endogen-
ous chicken HC and LC were replaced by the marker genes. As
a result, the knock-in platform cells expressed the marker
molecules instead of endogenous antibodies. The Ig genes to
be optimized were cloned into the knock-in vectors and the LC
gene and the HC gene were sequentially introduced into the
platform cells (Figure 2c). Once the exogenous Ig genes were
successfully introduced into cells, they expressed full-length
antibodies on the cell surface instead of the marker proteins.
The cells containing exogenous Ig genes were cultured to
introduce mutations to their V regions, and subsequently, the
clones exhibiting improved antigen reactivity were enriched
and isolated from the mutant library using FACS (Figure 2c).
ADLib® KI-AMP can introduce mutations in desired
antibodies, resulting in improved antigen reactivity
We examined whether mutations occur in the desired Ig gene
introduced into the ADLib® KI-AMP cells and whether these
mutations could affect antibody affinity. Three anti-human
VEGF-A (hVEGF-A) antibody sequences previously obtained
from the human ADLib®,
22
VEGF_A033 (A033), VEGF_D018
(D018), and VEGF_D058 (D058), were used as the model
human antibody sequences and introduced to the platform
cells (Table 1). A033 was used as a positive control because
the binding affinity of this antibody was successfully improved
in the previous research.
22
The clones expressing hVEGF-
A-specific human IgG on the cell surface were isolated using
FACS (Figure S1A). We confirmed that the Ig V region
sequences of the isolated clones were identical to those of the
original clones obtained from human ADLib® using genomic
DNA sequencing. We also confirmed that the antibody
secreted by the clones showed identical antigen reactivity to
that of the original antibodies (Figures S1B and S1C).
Each clone expressing the introduced A033, D018, and
D058 Ig genes was cultured for 2 weeks, and mutations were
accumulated. Flow cytometry (FCM) analysis showed
a scattered distribution of cell populations exhibiting variable
antigen reactivity (Figure 3a). Up to 96 cells were sorted into
independent wells using FACS from a small cell population
with increased antigen reactivity. Notably, most of the viable
sorted clones showed higher antigen reactivity than the par-
ental clones (Table 2). Genomic DNA sequence analysis
revealed that all the sampled clones contained mutations
resulting in amino acid changes (Figures 3b, 3c and Table 2),
and most of these mutations were found in their CDRs. Amino
acid mutations occurring in CDRs were likely to affect antigen-
binding capacity. Surface plasmon resonance (SPR) analysis
confirmed that all of the unique clones, including those with
amino acid length changes and/or multiple amino-acid repla-
cement, exhibited improved antigen reactivity up to 76.4-fold
(Table 3 and Figure S2).
In the case of A033, among all viable clones (26 clones) with
improved antigen reactivity, nine unique antibodies were
obtained. These affinity-matured clones had different amino
acid mutations from those obtained previously.
22
In the D018
clones, 37.9% of the viable clones (25 of 66 clones) exhibited
improved antigen reactivity, and seven unique antibodies were
obtained. The D018_H6L0 clone coincidentally had both
mutations that were separately found in the D018_H3L0 and
D018_H1L0 clones. Mutations conferring antibody affinity
improvement may not be limited to a single position; thus,
clones containing functional mutations at multiple sites were
successfully obtained within a single round of the affinity
maturation process. The SPR analysis showed that the double-
mutated D018_H6L0 clone had slightly higher antigen binding
affinity than the single-mutation clones D018_H3L0 and
D018_H1L0. It is possible that the combination of single muta-
tions synergistically affects the affinity for the antigen.
In the case of D058, 42.5% of the viable clones (31 of 72
clones) exhibited improved antigen reactivity and 15 anti-
bodies with unique V regions were obtained. Amino acid
insertions and deletions were frequently observed in VH
CDR2 of the clones. A tandem repeat in the corresponding
region was identified and the insertion and deletion of the
amino acids were found near the repeated sequence (Figure
S3). Such tandem repeats promote intermediate loop forma-
tion resulting in nucleotide deletions and duplications dur-
ing repair.
35
As multiple AID hotspots are identified in this
region, AID deamination is likely to accelerate this deletion
and duplication. Indeed, such mutations have been reported
in human immune system
35
and other cell-based affinity
MABS e2122275-3
maturation platforms utilizing AID-mediated SHM.
17
Thus,
the deletion and insertion observed in VH CDR2 of D058 are
in line with the mutational characteristics resulting from
AID-mediated SHM.
Collectively, these results show that the ADLib® KI-AMP is
capable of inducing SHM onto the exogenous Ig genes intro-
duced into the cell and improving antibody affinities. Of note,
decreased binding specificity due to mutations is another
Figure 2. Schematic representation of the construction of the cells expressing the exogenous antibodies and the standard workflow of affinity maturation using the
ADLib® KI-AMP. (a). Genetic engineering of the immunoglobulin HC locus of DT40. The functional chicken V gene (VH) and constant region of the endogenous chicken
Cμ1 gene of wild type DT40 were replaced by the selection marker gene thymidine kinase (TK) and the HC constant region of human IgG1 gene (hCH). Exogenous
human VH was knocked-in to the TK region of the ADLib® KI-AMP cell. The drug resistant gene was excised by Cre recombinase transient expression at the same time as
the removal of the light chain drug resistance genes, resulting in the expression of the exogenous Ig genes. TK was known as negative selectable marker but was not
used for selection of the exogenous VH knocked-in cell for this study, because introduction of the attempted VH gene resulted in Ig expression. (b). Genetic engineering
of the immunoglobulin LC locus of DT40. The chicken V gene (VL) and constant region (CLλ) of wtDT40 were replaced with the expression marker gene hCD4ΔC and
human kappa constant region (hCLκ). DT40 have two LC alleles (i.e., VJ rearranged and unrearranged alleles). We confirmed that the replacement occurs only at the
rearranged allele. Exogenous VL and human CLκ/λ genes on the VL-CL KI vector were knocked-in to the hCD4ΔC and hCLκ region of the ADLib® KI-AMP, resulting in
elimination of human CD4 on the cell surface. After selection by G418 and blasticidin, the drug resistant genes were excised by Cre recombinase transient expression. “T”
shown at immediate downstream of hCD4ΔC indicates transcriptional terminator. (c). The V genes of the antibodies subjected to maturation were knock-in in a step
wise manner into the platform cells using the vectors shown in the panel A and B. The cells harboring the knocked-in V genes were obtained by sorting the IgG-Fc
positive and antigen reactivity positive cells using FACS. The clones expressing the attempted antibodies were cultured to diversified sequence and the affinity-matured
clones were isolated by single cell sorting by antigen reactivity.
e2122275-4 H. MASUDA ET AL.
concern during the antibody engineering process.
10–12
We
evaluated antigen-binding specificity of the affinity-matured
clones using ELISA and confirmed that all clones maintain
target-binding specificity (Figure S4A). In addition, no poly-
reactivity against three different types of cell lines was observed
by FCM (Figure S4B). These results further verify that
improved binding affinity of the affinity-matured antibody
derived from the ADLib® KI-AMP is not accompanied by
increased nonspecificity or poly-reactivity.
AID-mediated SHM enhances antigen reactivity of desired
antibodies in the ADLib® KI-AMP
To gain more insights into sequence diversity and analyze
mutation frequencies and preferences, we performed next-
generation sequencing (NGS) of each cell population derived
from the knocked-in parental clones of anti-VEGF model
antibodies. In this experiment, the HC and LC V region
sequences of each clone in three cell populations emerged
after 2 weeks of cell culture and characterized by different
antigen reactivities in the FCM plots (named “high,” “middle,”
and “low” in Figure 4a) were analyzed for comparison. The
average number of quality-filtered sequences used in the ana-
lysis for each group was 37,135 (Table S2). As the Ig genes of
DT40 are constantly mutated, we also analyzed the sequences
before starting cell culture (Day 0), and they were used as the
control sequences for comparison among those obtained at the
end of the culturing. On Day 14, combined sequence diversity
for the HC and LC genes of all cells before cell sorting (referred
herein as Day 14 whole) increased by 2.5%–9.5% from Day 0
(Table 4). The combined mutation rates for the HC and LC
genes on Day 14 whole in A033, D018, and D058 were esti-
mated as 9.18 × 10
−6
, 2.42 × 10
−6
, and 9.33 × 10
−6
mutations
per base pair and division, respectively. The mutation patterns
identified using the NGS analysis were diverse (Table 4).
Although the most common type of mutation was a single-
base substitution, mutational characteristics of AID-mediated
SHM, such as consecutive substitution of multiple bases and
amino acid chain length change mutations, were also observed
among all three model antibody sequences. The observed base
substitutions were biased toward G and C (Figures 4b and
S5A), consistent with the characteristic of AID-induced base
substitutions in DT40 reported previously.
36,37
These mutation
patterns are indicative of an operating AID-mediated mutation
mechanism.
The NGS analysis revealed that more mutations occurred in
the HC than in the LC and in CDRs than in FRs (Table 4,
Figures 4c and S5B). A comparison among all data sets on Day
14 showed that the average sequence diversity of CDRs was
markedly higher than that of FRs in the antigen reactivity
“high” and “low” populations, whereas the sequence diversities
of the CDRs and FRs in the “middle” population were similar.
This result suggests that the mutations occurring in CDRs
affect antigen-binding capacity more significantly than muta-
tions in FR.
We further investigated the mutation frequencies of all cell
populations on Day 14 in both FRs and CDRs grouped by
known motifs of AID hotspot, coldspot, and the remaining (here-
inafter referred to as “neutral”), respectively. On Day 14, although
the averaged mutation frequencies (per base) calculated for each
group of Day 14 whole showed large variations, they were higher
in the hotspots in CDRs than in FRs (Figures 5a and S6A). This
tendency became apparent in both HC and LC of the antigen
reactivity “high” population. These results suggest that the hot-
spots in CDRs are preferred as a target of AID than those in FRs,
and that mutations at the hotspots in CDRs contribute to the
alteration of antigen reactivity. Conversely, while more mutations
were observed at coldspots in CDRs than in FRs among the whole
cells (Day 14 whole), the coldspots in CDRs were less frequently
mutated than those in FRs in the antigen reactivity “high” popula-
tion (Figures 5a and S6A). Moreover, we also analyzed the fre-
quency of mutations introduced to each group per read
(Figures 5b and S6B) and found that the mutation distribution
observed in each group in FRs was similar before and after the
antigen reactivity-based cell sorting (Figure 5b, left panel), whereas
those observed in CDRs showed larger variations (Figure 5b, right
panel). Indeed, the mutation frequencies of the populations with
altered antigen reactivities (the “high” and “low” populations)
increased on Day 14. In contrast, the “middle” population, with
an insignificant change in antigen reactivity, showed decreased
mutation frequencies across all groups. Notably, the frequency at
the coldspots in CDRs of the antigen reactivity “high” population
alone decreased, whereas that of the antigen reactivity “low”
population showed the largest increase from Day 14 whole
(Figures 5b and S6B, right panel). These observations clearly
indicate that the mutations occurring at the hotspots in CDRs
contribute to antigen reactivity change, whereas the mutations
occurring at the coldspots in CDRs seem to be unfavorable for
enhancing antigen reactivity.
We then compared the mutations found in the NGS read-
ings from the Day 14 antigen reactivity “high” population with
those observed in the affinity-matured clones exhibiting the
highest antigen reactivity, which were sorted into a 96-well
plate as described in the previous section (Table 5). All muta-
tions that frequently appeared in the NGS readings (>10%)
were found in the affinity-matured clones whose affinities were
verified using antigen-binding SPR (Table 3). The comparison
also showed that matured clones containing rare mutations in
the NGS readings (e.g., 0.1%–0.4% appearance) can be isolated.
Because more stringent FCM gating criteria on the flow cyt-
ometer in terms of antigen reactivity were applied during the
isolation of potentially affinity-matured clones than the cell
Table 1. Summary of the model antibody profiles used in the study.
Clone ID Antigen Species Heavy chain Light chain K
D
(M)
VEGF_A033 hVEGF-A Human V
H
1-69/ D
H
2-21/J
H
6b V
λ
2–14/J
λ
2 6.96E-09
VEGF_D018 hVEGF-A Human V
H
3-23/ D
H
3-22/J
H
3b Vκ1-39/Jκ2 1.00E-09
VEGF_D058 hVEGF-A Human V
H
3-23/ D
H
2-21/J
H
3b Vκ1-39/Jκ2 3.00E-09
CDCP1_12A041 hCDCP1 Mouse V
H
8-13/ D
H
1-1/J
H
2 Vκ1-117/Jκ1 6.21E-07
MABS e2122275-5
Figure 3. Affinity maturation against the model human antibodies using ADLib® KI-AMP. (a). FCM plots of the ADLib® KI-AMP clones harboring anti-hVEGF-A antibody
genes VEGF_A033 (left panels), VEGF_D018 (middle panels) and VEGF_D058 (right panels). The cells after 14 days of culture were stained with 30 nM hVEGF-A and
sorted using a cell sorter. Top 0.1–0.3% cells exhibiting highest reactivity against the antigen were sorted with a diagonal gating (gate “P4”) according to the IgG
expression level (upper panels). Representation of antigen reactivity of the sorted clones (red) shown in comparison with their parental cells (blue) (lower panels) with
the antigen staining at appropriate concentrations (5 nM or 10 nM hVEGF-A). (b). and (c) Amino acid sequences of VH and VL regions of the affinity improved anti-hVEGF
-A clones generated by the ADLib® KI-AMP. The parental sequences of the clones before maturation are shown at the top of each panel. CDR sequences (highlighted in
gray) were defined according to the Kabat numbering scheme. The amino acids highlighted in other colors indicate insertions (yellow) and deletions (green),
respectively.
e2122275-6 H. MASUDA ET AL.
populations for NGS analysis, our results demonstrated that an
appropriate FCM gating approach can effectively acquire
clones containing mutations important for enhanced antigen
reactivity, even if such mutations are rare in the diversified cell
pool of the ADLib® KI-AMP.
Antigen reactivity of a therapeutic antibody lead derived
from mouse hybridoma is improved using the ADLib® KI-AMP
With the successful verification of the ADLib® KI-AMP using
three anti-hVEGF-A hIgG1 sequences as a model case, we
aimed to extend its applicability to a potential therapeutic
antibody candidate obtained using the conventional hybri-
doma method to further improve its affinity. We focused on
in-house established mouse monoclonal antibodies against
human CUB domain containing protein 1 (hCDCP1),
a novel therapeutic target against cancer.
38
One anti-
hCDCP1 antibody, 12A041, exhibited moderate antigen-
binding activity (K
D
< 10
−7
nM, Table 1). The V gene of
12A041 was cloned into the knock-in vector and introduced
into the ADLib® KI-AMP cells (Figure S7A). As 12A041
originated from mouse, the resulting cells express mouse-
human chimeric antibodies. The hCDCP1/human IgG Fc-
positive DT40 clone was isolated using FACS and specific
Table 2. Summary of affinity maturation against the model human antibodies, anti-hVEGF-A, using the ADLib® KI-AMP.
Clone ID VEGF_A033 VEGF_D018 VEGF_D058
H L H L H L
Sorted cell 61 96 96
Viable clone 26/61 (42.6%) 66/96 (68.8%) 73/96 (76.0%)
Reactivity improved clone (FCM) 26/26 (100%) 25/66 (37.9%) 31/73(42.5%)
Clone with amino acid mutation 26/26 (100%) 25/25 (100%) 31/31 (100%)
Affinity improved clone (SPR) 26/26 (100%) 25/25 (100%) 31/31 (100%)
Unique nucleotide sequence 12 1 6 1 15 3
Unique amino acid sequence 8 1 6 1 12 3
Unique antibody 9 7 15
Unique amino
acid mutation
CDR1 4 - - 1 3 2
CDR2 - 1 3 - 9 1
CDR3 1 - 1 - - -
FR 2 - 2 - 1 -
Total 8 7 16
Table 3. Summary of binding affinities, kinetics, and amino acid mutations generated using affinity maturation against anti-hVEGF-A antibodies using the ADLib® KI-
AMP.
Clone ID k
a
(1/Ms) k
d
(1/s) K
D
(M) Parental/Mutant K
D
ratio Mutation sites
VEGF_A033 H0L0(parental) 3.48E+05 2.48E-03 7.13E-09 - -
H0L1 4.85E+05 9.98E-04 2.06E-09 3.5 L-CDR2:KN
H1L0 1.76E+06 9.25E-04 5.25E-10 13.6 H-CDR1:AS
H2L0 6.77E+05 5.52E-04 8.15E-10 8.7 H-CDR1:SD
H3L0 7.85E+05 5.24E-04 6.68E-10 10.7 H-CDR1:SD, H-CDR3:GA
H4L0 3.45E+06 3.22E-04 9.33E-11 76.4 H-CDR1:AE
H5L0 1.77E+06 9.00E-04 5.07E-10 14.1 H-FW1:VE, H-CDR1:AS
H6L0 4.48E+05 2.05E-03 4.58E-09 1.6 H-CDR3:GA
H7L0 4.45E+06 4.65E-04 1.05E-10 67.9 H-CDR1:AD, H-FW3:RD, H-CDR3:GA
H8L0 2.36E+06 1.35E-03 5.73E-10 12.4 H-CDR1:AS, H-CDR3:GA
VEGF_D018 H0L0(parental) 5.29E+06 5.06E-03 9.57E-10 - -
H0L1 4.69E+06 2.14E-03 4.56E-10 2.1 L-CDR1:SN
H1L0 4.74E+06 1.74E-03 3.67E-10 2.6 H-CDR2:ST
H2L0 2.97E+06 1.66E-03 5.60E-10 1.7 H-FW1:EA, QT
H3L0 3.40E+06 1.48E-03 4.36E-10 2.2 H-CDR2:GD
H4L0 2.28E+06 6.72E-04 2.94E-10 3.3 H-CDR3:HY
H5L0 3.49E+06 1.59E-03 4.57E-10 2.1 H-FW1:ST, H-CDR2:ST
H6L0 1.82E+06 5.65E-04 3.10E-10 3.1 H-CDR2:ST, GD
VEGF_D058 H0L0(parental) 1.93E+06 6.07E-03 3.14E-09 - -
H0L1 1.67E+06 1.92E-03 1.15E-09 2.7 L-CDR1:AV
H0L2 1.17E+06 1.77E-03 1.52E-09 2.1 L-CDR2:LV
H0L3 1.32E+06 8.67E-04 6.55E-10 4.8 L-CDR1:ND
H1L0 4.48E+06 2.30E-03 5.15E-10 6.1 H-CDR2:GA
H2L0 2.71E+06 2.42E-03 8.94E-10 3.5 H-CDR1:SI
H3L0 3.35E+06 1.19E-03 3.55E-10 8.9 H-CDR2: deletion I
H4L0 2.70E+06 2.14E-03 7.91E-10 4.0 H-CDR1:SD
H5L0 1.32E+06 1.75E-03 1.32E-09 2.4 H-CDR2: AP
H6L0 3.53E+06 2.55E-03 7.22E-10 4.4 H-CDR2: insertion G
H7L0 2.17E+06 1.21E-03 5.57E-10 5.6 H-FW1:LV, H-CDR1:SD
H8L0 1.75E+06 4.01E-03 2.29E-09 1.4 H-CDR2:SA, GS
H9L0 2.66E+06 9.24E-04 3.47E-10 9.1 H-CDR2:GY
H10L0 3.83E+06 1.50E-03 3.91E-10 8.0 H-CDR2: insertion S
H11L0 3.40E+06 4.93E-03 1.45E-09 2.2 H-CDR2: deletion S
H12L0 3.61E+06 3.32E-03 9.19E-10 3.4 H-CDR2: insertion SGS
MABS e2122275-7
binding to recombinant hCDCP1 of secreted antibodies was
confirmed using ELISA (Figure S7B).
The DT40 clone expressing 12A041 was cultured for
2 weeks to accumulate mutations, and cells exhibiting
improved affinity against a soluble hCDCP1-extracellular
domain (ECD) were isolated using FACS (Figure 6a). The
sequence analysis showed five unique clones. Among muta-
tions contained in these antibody sequences, only the H32Y
mutation in the VL CDR1 and S32F mutation in VH CDR1
were thought to confer the affinity improvement (Figures 6b
and S7C). We attempted an additional round of affinity
maturation using the clones obtained from the first round as
the starting clones and could obtain cells exhibiting increased
antigen reactivity only from 12A041_H3L0. The sequence
analysis revealed two unique additional mutations, both of
which were in the LC (Figure 6b). One was the identical
mutation to the one observed in the first maturation cycle
(sequence L1), and the other one was newly observed
(sequence L2). The best clone generated after two maturation
cycles (12A041_H3L2) showed 27.4-fold reduction in the K
D
value in SPR analysis in comparison with the parental antibody
(12A041_H0L0, Figure 6c).
ADLib® KI-AMP derived mutations enhance the potency of
post-humanized therapeutic antibody leads
As the affinity-enhancing mutations in CDRs described in the
previous section are thought to be involved in stabilizing the
interaction between CDR structure and epitope of the antigen,
it is plausible that these mutations can enhance the affinity even
when the framework regions are humanized. To this end, we
humanized the variable domain of 12A041 using a CDR grafting
method (h12A041VH/VL), and mutations described in the pre-
vious section were introduced to the corresponding residues of
Figure 4. In-depth sequence analysis of the clones obtained from the ADLib® KI-AMP using NGS. (a). FACS sampling gates for NGS analysis. At the end of 14 days cell
culture, the cells were stained with 30 nM hVEGF-A and the cell populations exhibiting different antigen reactivity were appeared (VEGF_A033 (left panel), VEGF_D018
(middle panel) and VEGF_D058 (right panel)). The “middle (gate P6)” corresponds to the main population appeared in the plot, “high (gate P5)” and “low (gate P7)”
involved the clones exhibiting stronger or weaker antigen reactivity than the main population, respectively. Each population was gated and bulk-sorted for genomic
DNA isolation. (b). Summary of mutations in the HC and LC V regions of the antigen reactivity “high” (upper panel), “middle” (middle panel) and “low” (lower panel)
populations. The values indicate the averaged ratio of each mutation to all mutations. (c). Bar chart representations of the averaged diversity calculated for each heavy
V domain of the clones generated by the ADLib® KI-AMP. The averaged diversity indicates the percentage of the mutated sequences appeared in the quality filtered
sequence. The values were integrated separately by the CDRs and FRs. Error bars represent ± s.d. for the integrated values (*P < 0.5, **P < 0.05 using a two-tailed
t-test).
e2122275-8 H. MASUDA ET AL.
Table 4. Summary of NGS analysis against the anti-hVEGF-A clones generated using the ADLib® KI-AMP.
Changes from Day 0
Clone ID Genome
sampling H/L Diversity
(%)
a
Total
mutation
Substitution
DEL INS
Unique nucleotide
mutation
Unique amino acid
mutation
Number of mutation
(/seq)
Mutation rate
b
(mutation/bp/division)
x10
−6
1bp 2bp 3bp 4bp >5bp
VEGF_A033 day14 whole H 9.5 2659 2594 52 0 4 1 9 4 176 166 0.109 6.68
day14 middle H 2.3 810 850 0 0 0 0 0 0 0 0 0.029 1.79
day14 low H 81.6 22597 21542 951 12 0 0 55 38 1014 899 0.989 60.82
day14 high H 58.4 11009 9275 353 1392 0 0 0 0 612 544 0.735 45.25
VEGF_D018 day14 whole H 1.6 156 140 8 0 1 0 6 4 34 28 0.017 1.08
day14 middle H 0.3 68 68 0 0 1 0 7 3 0 10 0 0
day14 low H 30.3 2225 2125 37 37 2 0 15 9 187 150 0.379 24.65
day14 high H 31.5 9060 7909 1043 0 20 0 85 9 779 575 0.413 26.85
VEGF_D058 day14 whole H 4.5 1907 1731 115 7 0 35 13 8 34 31 0.087 5.64
day14 middle H 1.1 0 0 21 0 0 0 0 0 0 0 0.018 1.14
day14 low H 36.8 29704 26716 1769 152 77 948 37 5 1206 920 1.145 73.91
day14 high H 21.5 13230 11816 150 227 0 3 447 589 943 519 0.612 39.51
VEGF_A033 day14 whole L 0 0 0 3 0 0 0 34 23 29 0 0 0
day14 middle L 0 2220 2034 19 0 0 2 166 4 115 45 0.001 0.04
day14 low L 2.9 5085 4601 0 35 0 2 277 180 194 113 0.034 2.46
day14 high L 30.2 9230 9090 200 0 0 1 0 0 562 439 0.348 24.89
VEGF_D018 day14 whole L 0.9 0 0 0 0 0 0 0 0 0 0 0.009 0.68
day14 middle L 1.0 1473 1463 0 0 0 0 16 1 57 24 0.014 1.06
day14 low L 8.0 8764 8598 4 0 0 0 91 71 232 180 0.086 6.32
day14 high L 13.7 6197 5999 172 2 2 0 24 0 369 228 0.151 11.10
VEGF_D058 day14 whole L 1.5 2026 1975 0 0 0 0 52 1 90 55 0.016 1.14
day14 middle L 0.2 1565 1480 0 0 0 0 89 2 96 51 0.002 0.14
day14 low L 20.5 21515 21135 47 0 0 36 167 131 678 533 0.229 16.81
day14 high L 17.9 8318 8193 74 8 7 0 35 1 500 352 0.200 14.66
a: Percentage of quality-filtered sequences that is different from parental sequence.
b: Mutation rates were calculated using the generation time for DT40 as 8 h.
MABS e2122275-9
h12A041VH/VL. All mutated antibodies exhibited superior bind-
ing activity to hCDCP1 stably expressed on Ba/F3 cell surfaces
than the parental h12A041VH/VL and maintained low nonspe-
cific binding to non-transfected Ba/F3 cells (Figure 7a). Antigen-
binding specificity was also confirmed using ELISA (Figure S8A).
The binding kinetics of these antibodies were analyzed using SPR.
Introduction of the mutations led to an 18.7-fold reduction in K
D
values compared with those of the parental antibody (Figures 7b
and S8B). To evaluate the potency of these affinity-matured anti-
hCDCP1 antibodies as antibody-drug conjugates, we performed
a secondary immunotoxin assay using the human prostate carci-
noma cell-line DU145. DU145 cells were cultured with the anti-
hCDCP1 antibodies together with pyrrolobenzodiazepine
(PBD)-conjugated anti-human IgG-Fc antibodies. The results
showed that the matured antibodies exhibited enhanced cytotoxi-
city compared with that of the parental antibody (Figure 7c).
Figure 5. Comparison of AID hotspot mutations in HC among populations exhibiting different antigen reactivities. (a). Bar chart representations of the averaged
mutation frequencies (per base) observed in the AID hotspot groups in the VH FRs and CDRs on Day14. The frequencies calculated for whole cells (upper left panel),
“high” (lower left panel), “middle (upper right panel) and “low” populations (lower right panel) are respectively shown. Error bars represent ± s.d. (**P < 0.05,
**P < 0.005 using a two-tailed t-test). (b). Comparison of the mutation frequency observed in the AID hotspot groups in the VH FRs and CDRs. The upper panels
represent a proportion of the mutations observed in each hotspot groups in the stacked bar chart. The lower panels summarize the mutation frequencies (per read) with
the ratio of each hotspot groups in comparison with those on Day 14 whole in parentheses.
e2122275-10 H. MASUDA ET AL.
Finally, we analyzed the stability of the affinity-matured antibody
because introduction of mutations often deteriorates physico-
chemical properties of antibodies.
10–12
A thermal shift assay
showed that the matured antibodies exhibit identical melting
temperature to the parental antibody (Table S3). Size exclusion
chromatography revealed that all antibodies bearing affinity-
enhancing mutations maintain 95% monomeric purity, one of
the generally accepted criteria for antibody developability (Table
S4).
39
Although h12A041VH/VLam1 showed slightly higher level
of aggregates compared to the parental antibody, the double
mutant h12A041VHam1/VLam1, which possesses an additional
mutation in the VH to afford improved affinity, had a similar
degree of aggregation as the parental antibody. Furthermore, all
matured antibodies showed comparable or negligible increases in
aggregates relative to the parental clone after three freeze/thaw
cycles (Table S4).
Discussion
A cell display system coupled with AID-mediated SHM is
a commonly used technique for in vitro affinity maturation,
and several examples of antibody affinity maturation applied to
single-chain variable fragment (scFv), IgM, and IgG using
DT40 have been reported.
14,15,20,22
These studies took advan-
tage of DT40ʹs Ig gene diversification mechanism and success-
fully showed the utility of the cells for de novo antibody
generation and affinity maturation. However, in previous stu-
dies, the antibodies subjected to maturation were obtained
from DT40 platform cells; thus, their applicability is limited.
Therefore, we developed an antibody maturation platform
capable of receiving attempted antibody genes and improving
their antigen reactivity. This novel platform, the ADLib® KI-
AMP, described herein could enhance antigen-binding affinity
of the antibodies discovered from other platforms, such as the
human ADLib® and mouse hybridoma. Owing to easier genetic
manipulation and rapid growth of DT40 in comparison to
other mammalian cells,
33
it takes approximately a month
from cloning the model antibody genes into the knock-in
vectors to isolation of the clones expressing these antibodies
by applying a simplified knock-in process with FACS. Using
the platform, binding affinities of antibodies sourced from
different origins were efficiently enhanced to sub-picomolar
Table 5. Comparison among the isolated affinity-matured clones and their appearances in NGS readings.
Data set Frequency
ranking
Amino acid position corresponding to
parental sequence Domain Amino acid
change
% quality-filtered
sequence
Corresponding mutation found in
affinity matured clones
VEGF_A033_VH
Day 14 high
1 33 CDR1 A > S 50.2% H1
2 104 CDR3 G > A 14.4% H3,6,7,8
3 31 CDR1 S > D 11.8% H2,3
4 120 FW4 G > D 3.7%
5 27 FW1 G > A 3.2%
9 33 CDR1 A > D 1.1% H7
11 87 FW3 R > T 0.6% H7
VEGF_A033_VL
Day 14 high
1 56 CDR2 K > N 73.6% L1
2 12 FW1 G > E 4.5%
3 56 CDR2 K > I 1.7%
4 97 CDR3 S > T 0.9%
5 41 FW2 H > Y 0.7%
VEGF_D018_VH
Day 14 high
1 57 CDR2 S > T 56.1% H1,5,6
2 113 CDR3 G > S 6.6%
3 3 FW1 Q > T 6.0% H2
4 54 CDR2 G > D 2.9% H3,6
5 30 FW1 S > I 1.6%
21 102 CDR3 H > Y 0.4% H4
VEGF_D018_VL
Day 14 high
1 28 CDR1 S > N 45.1% L1
2 93 CDR3 S > Y 3.2%
3 104 FW4 L > V 2.6%
4 38 FW2 Q>- 2.1%
5 93 FW4 S > N 1.5%
VEGF_D058_VH
Day 14 high
1 31 CDR1 S > I 28.4% H2
2 57 CDR2 S > G 7.1% H1
3 114 FW4 G > S 6.1%
4 55 CDR2 G > S 5.1% H12
5 56 CDR2 G > A 5.0% H1
6 61 CDR2 A > P 4.5% H5
8 31 CDR1 S > D 2.0% H4,7
9 51 CDR2 I>- 1.9% H3
10 56 CDR2 G > S 1.8% H8
15 54 CDR2 S> SG 1.1% H6
19 4 FW1 L > V 0.9% H7
35 51 CDR2 I> IS 0.4% H10
65 53 CDR2 GS>G 0.1% H11
VEGF_D058_VL
Day 14 high
1 25 CDR1 A > V 54.1% L1
2 25 CDR1 A > P 1.6%
3 51 CDR2 A > V 1.5%
4 52 CDR2 S > I 1.5%
5 54 CDR2 L > V 1.4% L2
MABS e2122275-11
K
D
without compromising target specificity by just a single
round of cell culture lasting 2 weeks followed by cell sorting.
This is the first report demonstrating successful antibody
maturation against the attempted exogenous antibodies
exploiting the Ig gene diversification mechanism of DT40,
regardless of the species of origin.
As the ADLib® KI-AMP cells do not possess pseudogenes
homologous to the functional V region, affinity maturation
against the desired antibody genes is expected to be driven by
SHM rather than gene conversion. A previous study has shown
that the disruption of pseudogene loci resulted in the inhibition
of gene conversion and activation of SHM.
34
This finding has
Figure 6. Affinity maturation against therapeutic lead antibodies generated by mouse hybridoma method using the ADLib® KI-AMP. (a). FCM plots of the ADLib® KI-AMP
clones harboring the anti-hCDCP1 after the first and second round of the maturation cycle (upper and lower panels, respectively). The second-round maturation cycle
was performed against the clones obtained from the first cycle (CDCP1_12A041_H3L0). After 14 days of culture, the top 0.1% of the hIgG expressing cells those
exhibited highest reactivity against the antigen, hCDCP1-ECD, were sorted by a diagonal gating (gate “P5”) as shown in the left panels. The right panels represent
antigen reactivity of the clones before and after the maturation process using FCM (blue, parental; red, the clones after the maturation process). The cells were stained
with the PE-labeled anti-hIgG-Fc and the AlexaFluor 647-labeled hVEGF-A, respectively. (b). Amino acid sequence of the VH and VL regions of the affinity-improved anti-
hCDCP1 generated by the ADLib® KI-AMP. (c). SPR sensorgrams (upper panel) and summary of the kinetics parameters (lower panel) of the affinity-improved antibodies
secreted to the culture supernatants in comparison with the parental anti-hCDCP1 antibody.
e2122275-12 H. MASUDA ET AL.
been applied to successful engineering of non-antibody
molecules
29,30
and scFv
15
using DT40. In these works, the
DT40 cells we used did not harbor target molecule-
corresponding pseudogenes but endogenous chicken ones,
which show no or low homologies to the introduced non-
antibody gene or scFv genes. Here, we similarly observed
SHM in human V genes, which were knocked-in to the Ig
loci of DT40 harboring chicken pseudogenes. Most
importantly, we demonstrated that AID-mediated SHM is
capable of improving the antigen reactivity of antibodies intro-
duced into the ADLib® KI-AMP cells as full-length IgGs.
Effective introduction and accumulation of functional muta-
tions are critical to efficient antibody affinity maturation. In
our platform, affinity-matured clones can be quickly enriched
and isolated from the diversified cell pool using FACS. Using
the model human antibody sequences, 37.9–100% of the viably
Figure 7. Functional validation of the humanized anti-hCDCP1 antibody involving the mutations generated by the ADLib® KI-AMP. (a). Validation of antigen-binding
activity and specificity using FCM analysis. The Ba/F3 cells stably expressing hCDCP1 (right panel) and its parental cells (left panel) were stained with the series of the
humanized anti-CDCP1 monoclonal antibodies containing the mutations. (b). Validation of the humanized anti-CDCP1 monoclonal antibodies containing the mutations
using SPR. The binding kinetics of the humanized antibodies are shown. (c). Immunotoxicity assay using human prostate carcinoma cell line, PC3 and DU145. Cells were
incubated with the serially diluted humanized anti-hCDCP1 monoclonal antibodies and the PBD dimer-conjugated anti-human IgG Fc antibody was added. After
incubation at 37°C for 7 (PC3) or 3 (DU145) days, cell viability was measured. The luminescent signal was proportional to the number of cells in the culture. Data are
presented as mean ± s.d.
MABS e2122275-13
sorted clones exhibited improved binding affinity in the SPR
analysis. This result illustrates that the platform is capable of
introducing mutations to enhance antigen reactivity to the
level that enables the discrimination between high-affinity
clones and low-affinity ones using FACS within a single
round of the maturation process. The overall mutation rate
observed in the ADLib® KI-AMP was moderate in comparison
to that of other platforms.
15,16,29,40
Thus, the estimated fre-
quency of mutagenesis of target genes cannot fully account
for our successful antibody maturation.
A comprehensive sequence analysis against the cell popula-
tions generated in the diversified cell pool revealed that AID-
mediated SHM in DT40 was biased toward G- and C-bases.
Mutations in CDRs and AID hotspots were frequently intro-
duced, and the comparison among the cell populations exhi-
biting different antigen reactivity showed that such mutations
became prominent in the clones with altered antigen reactivity.
Moreover, the cell population exhibiting increased antigen
reactivity contained more mutations at AID hotspots and
fewer mutations at coldspots in their CDRs. This observation
clearly demonstrates that the biased mutations correlated with
improved antigen reactivity. Based on these results, the plat-
form utilizing AID-mediated SHM is a rational option for
effective antibody affinity maturation. Besides B cells, non-B
cells overexpressing AID can generate mutations if the target
sequences are highly transcribed,
41
and successful examples of
affinity maturation using non-B cells overexpressing AID have
been reported.
16,17,19
We demonstrated that affinity maturation of antibody can
be readily achieved within a single round of the process using
the ADLib® KI-AMP, in contrast to the notion that AID-
mediated SHM occurs stochastically and thus generally
requires multiple maturation cycles. Our platform features
naïve Ig gene diversification mechanism of DT40 cells. Not
only AID but also other factors such as translesion DNA
polymerases,
37,42,43
error-prone DNA polymerases,
37,42,43
and
the diversification activator (DIVAC)
44–47
have been impli-
cated in the introduction of hypermutations in DT40.
Although the initiation of AID-mediated SHM has not yet
been fully understood, the intrinsic gene diversification
mechanism itself is expected to be the key element supporting
successful antibody maturation. This mechanism might also
contribute to antibody maturation without compromising
binding specificity and physical stability.
13
It is plausible to improve the affinity more effectively by
adjusting the culture period or performing iterative process of
cell culture and sorting. In this study, we empirically set the
culture period as 14 days per round and subsequently verified
that a 14-day culture was able to yield high-affinity antibodies
with K
D
values in the picomolar range. As the potential for
affinity increase is sequence-dependent, defining an optimal
culture period to be applied for all different clones can be
challenging. It would be best to determine the timing of isola-
tion of potentially affinity-matured clones from each parental
clone by monitoring the distribution of cell population on
FCM indicative of effective accumulation of functional muta-
tions over the course of cell culture. Nevertheless, we believe
the results of this study serve as a good starting point for setting
the culture period for the ADLib® KI-AMP in general.
In-depth sequence analysis using NGS also provides several
insights into further understanding of antibody maturation
driven by AID-mediated SHM. Our results showed that more
mutations occurred at AID hotspots than at either coldspots or
neutral, and that the mutation frequencies observed at the
hotspots in CDRs were particularly higher than those in FRs.
While it has been reported that some hotspot overlapping
(WGCW motif) in CDRs exhibit exceptionally high mutation
rates in humans,
48
this phenomenon was not observed in our
study. This suggests that additional factors may have contrib-
uted to a biased mutation in CDRs. One potential cis-acting
factor other than the conventional AID hotspot/coldspot is the
WA/TW motifs preferentially mutated by DNA polymerase η,
an error-prone DNA polymerase that is also involved in SHM
processing.
49,50
The longer motif covering the additional
region upstream and downstream of the conventional AID
hotspot has also been recently proposed.
51
As multiple transle-
sion DNA polymerases, including DNA polymerase η, have
been reported to be involved in SHM of DT40,
37,42,52
the over-
lapped unknown “preferences” of these polymerases might
result in the biased mutation in CDRs. We also found that
the mutation frequency of coldspots in CDRs was significantly
decreased in the cell population exhibiting increased antigen
reactivity, whereas the mutation frequency was increased in the
antigen reactivity-reduced population. This finding suggests
that mutations occurring in this region do not contribute to
enhanced antigen-binding capacity; rather, such mutations are
unfavorable to maintaining antigen reactivity. It is possible that
the positions where mutations favoring or not favoring antigen
reactivity can occur have been fixed as AID hotspots and cold-
spots, respectively, during molecular evolution.
While NGS was used to examine the mutational character-
istics of AID-mediated SHM in the ADLib® KI-AMP, the
possibility of integrating NGS into the workflow of screening
affinity-matured clones by retrieving comprehensive VH and
VL sequences can also be envisioned. Indeed, affinity-
improving mutations described in this study, which were
detected by Sanger sequencing following single-cell sorting of
DT40, have also been identified in our NGS analysis. Tailoring
antibody affinity or stability can therefore be achievable by
exploiting NGS data. With the aid of additional VH:VL pairing
information, the consequence of each observed mutation can
be more precisely interpreted in terms of antibody maturation.
This will allow us to further explore the potential of ADLib® KI-
AMP in the future.
Materials and methods
Cell culture
DT40 cells were cultured at 39.5°C in 5% CO
2
with Iscove’s
modified Dulbecco’s medium (Thermo Fisher Scientific) con-
taining 10% fetal bovine serum (FBS; Cytiva), 1% chicken
serum (Thermo Fisher Scientific), 1% penicillin/streptomycin
(Nacalai Tesque), and 50 µM monothioglycerol (FUJIFILM
Wako pure chemical). Ba/F3 cells were cultured at 37°C in 5%
CO
2
with RPMI1640 (Merck) containing 10% FBS, 1% peni-
cillin/streptomycin, 50 µM monothioglycerol, and 1 ng/mL
mouse IL-3 (R&D systems, #403-ML-050). PC3 cells were
e2122275-14 H. MASUDA ET AL.
cultured at 37°C in 5% CO
2
with Ham’s F-12 K (FUJIFILM
Wako pure chemical) containing 7% FBS and 1% penicillin/
streptomycin. DU145 cells were cultured at 37°C in 5% CO
2
with RPMI1640 containing 10% FBS and 1% penicillin/
streptomycin.
Antigen preparation
The Flag-tagged recombinant proteins used in this study,
FLAG-hVEGF-A (UniProt: P15692-4), FLAG-hHer2-ECD
(P04626), and hCDCP1-ECD-His-FLAG (9QH5V8), were
transiently expressed using FreeStyle 293-F cells (Thermo
Fisher Scientific) and purified using anti-FLAG M2 affinity
chromatography (Merck, #A2220) followed by gel filtration
chromatography (HiLoad 26/600 Superdex 200 pg; Cytiva).
To prepare the labeled antigens for affinity maturation, the
purified FLAG-hVEGF-A and FLAG-hHer2 were biotinylated
using an EZ-Link NHS-PEG4 biotinylation kit (Thermo Fisher
Scientific, #A39259).
Plasmid construction for the ADLib® KI-AMP
To construct the ADLib® KI-AMP, the knock-in vectors pre-
viously generated for human ADLib® construction
22
were used
with modifications for the present purpose. The HC constant
region knock-in vector was used for replacing the HC constant
region of an endogenous chicken Cμ1 gene of DT40 by the HC
constant region of human IgG1 gene. To introduce thymidine
kinase gene to the HC V region of DT40, the targeting vector
(thymidine kinase knock-in vector) was constructed by assem-
bling a CMV promoter, thymidine kinase (GenBank:
KM222725.1, synthesized by Azenta Life Sciences), and SV40
promoter followed by a puromycin resistance gene in reverse
orientation flanked by loxPRE (5’-ATAACTTCGTAT
AATGTATGCTATACGAACGGTA-3’) and loxPLE (5’-
ATAACTTCGTATAATGTATGCTATACGAACGGTA-3’) to
replace the V region and CAG promoter-blasticidin (reverse
orientation) flanked by Vlox sequences (VloxM1;
TCAATTTCC- GAGAATGACAGTTCTCGGAAATTGA) of
the human HC V region knock-in vector. For introduction of
hCD4ΔC marker gene to the LC V region of DT40, the gene of
the human CD4 lacking a cytoplasmic domain (hCD4ΔC) was
cloned from a pMACS4.1 vector (Miltenyi Biotech, #130-091-
886) and fused with an extra sequence to express the
N-terminal 2 × FLAG-tag (DYKDDDDK)-fused hCD4ΔC pro-
tein. We constructed the hCD4ΔC and kappa LC constant
region targeting vector in which the V region of the LC
V and constant region knock-in vector with neomycin resis-
tance and blasticidin resistance genes were replaced by a CMV
promoter-2 × FLAG-hCD4ΔC followed by a BGH terminator.
Construction of the exogenous Ig gene knock-in vectors
Genomic DNA of VEGF_A033, D018, and D058 was extracted
from the DT40 clones previously obtained from human
ADLib®.
22
The Ig genes of CDCP1_12A0416 were synthesized
(by Azenta Life Sciences) based on the sequence determined
from the mouse hybridoma cDNA. To introduce the exogen-
ous HC V genes, the synthesized CDCP1_12A041 HC V gene
and VEGF_A033, D018, and D058 HC V genes amplified using
the primer F1(5’-CCCCACAGGGCTGATGGCGGAGGTG
-3’) and R1 (5’- GAACGGTAGGGGATCCATAAAATCG
−3’) were assembled with SV40 promoter-puromycin flanked
by loxm7LE and loxm7RE and cloned into the EcoRV and
BamHI sites of the HC V region knock-in vector. To introduce
the exogenous LC V and constant region genes, the synthesized
CDCP1_12A041 LC V gene and VEGF_A033, D018, and D058
LC V genes were amplified using the primer F1(5’-
TTGCAGCATGAGCCCTTTGTTGTC −3’) and R1 (5’-
TTCTATGAAGGGAGCCATAGCCTG −3’) and cloned into
the BmgBI – NdeI site of the hCD4ΔC and kappa LC constant
region targeting vector. Furthermore, the kappa LC constant
region of VEGF_A033 LC V knock-in vector was replaced with
human lambda LC constant region amplified from the human
lambda LC V and constant region knock-in vector of human
ADLib®.
DNA Transfection
All plasmids were linearized before transfection. The restric-
tion enzymes used in this study were purchased from New
England Biolabs. The exogenous HC V region knock-in vector
and the thymidine kinase knock-in vector were linearized
using NotI and KpnI. The exogenous LC V region knock-in
vector and the hCD4ΔC knock-in and kappa LC constant
region targeting vector were linearized using NotI and AscI.
The HC constant region knock-in vector was linearized using
SalI. Further, 30 µg of the linearized vectors were transfected
with 1.0 × 10
7
DT40 cells by electroporation (Bio-rad
GenePulser equipped with 24-well electroporation plate at
420 V and 125 µF). After 16 h, transfected clones were selected
with the medium containing 0.5 μg/mL puromycin (Merck) to
obtain the clones knocked-in the HC V region and thymidine
kinase, or the medium containing 2 mg/mL geneticin®
(Thermo Fisher Scientific) to obtain the clones knocked-in
the hCD4ΔC and the LC V and constant region and the HC
constant region, respectively. To excise the drug resistance
genes, a total of 3 × 10
6
cells were collected and transfected
with 10 µg of a vector expressing an EGFP-Cre recombinase
fusion protein by Nucleofector 2b (Lonza) using Cell Line
Nucleofector Kit T (Lonza). After 16 h of incubation, trans-
fected cells were sorted using BD FACSAria fusion (BD bios-
ciences) based on green fluorescent protein expression.
Flow cytometry
Cells (up to 5 × 10
5
cells) were stained with the appropriate
antigen and/or antibodies diluted in FCM buffer (phosphate-
buffered saline (PBS)/0.5% bovine serum albumin (BSA)/2 mM
EDTA) for 30 min on ice at each staining step. The cells were
washed using PBS after every staining step and the stained cells
were diluted with FCM buffer and analyzed using BD
FACSCantoII (BD Biosciences). FCM plots were generated
using FlowJo software (BD Biosciences).
MABS e2122275-15
Surface human CD4 expression was analyzed by staining
with phycoerythrin (PE)-conjugated anti-human CD4
Antibody (Biolegend, #317410). Surface human IgG expression
was analyzed by staining with R-PE-conjugated goat anti-
human IgG (gamma chain specific; SouthernBiotech, #2040-
09). Binding to hVEGF-A was analyzed using the staining with
AlexaFluor 647-labeled streptavidin (Thermo Fisher Scientific,
#S21374) via biotinylated recombinant FLAG-hVEGF-A.
Human CDCP1-ECD-His-FLAG bound by biotinylated anti-
FLAG M2 antibody (Merck, #F9291) was stained with
AlexaFluor 647-labeled streptavidin.
For the poly-reactivity analysis using FCM, the antibody
secreted in the culture supernatant or Human IgG1 Kappa-
UNLB (SouthernBiotech, #0151 K-01) were adjusted to 3 μg/
mL in the medium and reacted with Ba/F3, HEK293, and
HUVEC, respectively. Antibodies that reacted with these cells
were detected with R-PE-conjugated goat anti-human IgG
antibody (gamma chain specific). As positive control antibo-
dies, PE-conjugated anti-mouse CD45 antibody (Biolegend,
#103106) was used for Ba/F3, and mouse anti-human EGFR
antibody (Thermo Fisher Scientific, #MS-268-PABX) followed
by PE-conjugated goat anti-mouse Ig antibody (BD
Biosciences, #550589) was used for both HEK293 and HUVEC.
For the analysis using hCDCP1-expressing Ba/F3 cells, surface
hCDCP1 expression was detected by staining with R-PE-
conjugated goat anti-human IgG (gamma chain specific) followed
by staining with serially diluted humanized hCDCP1 antibodies.
ELISA
ELISA was performed as previously described.
22
Briefly, anti-
gens were immobilized onto MaxiSorp 384-well plates
(Thermo Fisher Scientific) at 62.5 ng/well overnight at 4°C
and then blocked with PBS containing 1% BSA. The cell culture
supernatants or the diluted antibodies at 2.5 µg/mL in PBS/1%
BSA subjected to analysis were added to the wells and incu-
bated for 1 h at room temperature. The human IgG1 specifi-
cally bound to the immobilized antigens were detected by
mouse anti-hIgG-Fc HRP-conjugated (SouthernBiotech,
#9040-05). The assay was developed with TMB substrate
(Dako), and the reaction was stopped with 1 N sulfuric acid
(Nacalai Tesque). The absorbance at 450 nm was acquired
using Infinite M1000 instrument (TECAN).
Anity maturation
The ADLib® KI-AMP clones harboring the desired antibody
genes were cultured in the medium for 2 weeks. At the end of
the culture, the cells exhibiting improved antigen reactivity
were isolated using FACS. Subsequently, 1.0 × 10
7
cells were
stained with 30 nM biotinylated FLAG-Her2-ECD, an irrele-
vant antigen, as negative control and further stained with
AlexaFluor 488-labeled streptavidin (Thermo Fisher
Scientific, #S11223). The cells were subsequently incubated
with 30 nM target antigens and/or biotinylated anti-FLAG
M2 antibody followed by staining with AlexaFluor 647-
labeled streptavidin and mouse anti-hIgG-Fc PE-conjugated
(SouthernBiotech, #9040-09). The cells that did not react to
the negative control and exhibited higher reactivity against the
target antigens at the given IgG expression levels were sorted
using BD FACSAria Fusion (BD Biosciences) onto the 96-well
plate. The antigen reactivity of each viable clone was confirmed
using FCM, and antibody sequences of the affinity-matured
clones were determined.
SPR analysis
SPR analysis was performed as previously described.
23
Briefly,
anti-hIgG capture antibodies (Cytiva, #BR100839) were immo-
bilized onto the surface of a CM5 sensor chip (Cytiva,
#BR100530) via amine coupling. For kinetic analysis, the cul-
ture supernatants or the purified antibodies were obtained. The
purified antigens serially diluted with HBS-EP+ (hVEGF-A:
100 and 25 nM, hCDCP1-ECD: 300, 100, 33.3, 11.1, 3.7, and
1.23 nM) were injected for 240 s at a flow rate of 30 µL/min
followed by 300 s of dissociation. Data were fitted with Biacore
T200 evaluation software (Cytiva) using a 1:1 binding model.
Next-generation sequence
Genomic DNA was isolated from ~5,000 to 1,000,000 cells
before and after the affinity maturation process. The VL
regions were amplified using PCR with the sense primer 5’-
CAAGCAGAAGACGGCATACGAGATNNNNNNGTGAC-
TGGAGTTCAGACGTGTGCTCTTCCGATCTCTCCAGGT-
TCCCTGGTGCAGGC-3’ (where N indicates index
sequences) and antisense primer 5’-AATGATACGGCG
ACCACCGAGATCTACACNNNNNNNNACACTCTTTCC-
CTACACGACGCTCTTCCGATCTCATATGAGCGACTCA-
C-3’. The VH regions were amplified with the sense primer 5’-
CAAGCAGAAGACGGCATACGAGATNNNNNNGTGAC-
TGGAGTTCAGACGTGTGCTCTTCCGATCTTCAGCGCT-
CTCTGTCCTTCC-3’ and antisense primer 5’-
AATGATACGGCGACCACCGAGATCTACACNNNNNN-
NNACACTCTTTCCCTACACGACGCTCTTCCGATCT
CCAAAATCGCCGCGGC-3’. The PCR products were
cleaned with left-side size selectin using SPRIselect (0.8
×, Beckman Coulter). The final products were pooled
with different indexes and sequenced on Illumina MiSeq
(by Azenta Life Sciences) to obtain 2 × 300 base pairs read
chemistry. The index sequences for the PCR amplifications
are listed in Table S5.
Analysis of NGS data
The raw NGS sequence readings were cleaned up using the
quality filtration protocol with Trimmomatic.
53
Briefly, the
leading and trailing positions with quality < 4 (low quality)
and the readings with an average quality per base < 15 at
the scanning in a 4-base wide sliding window were
trimmed, and readings with the lengths less than 36 bp
were rejected. The remaining read pairs were merged into
a single sequence using FLASH
54
and the merged
sequences that did not contain PCR primer sequence
were filtered out. The primer sequences that did not over-
lap to the antibody framework regions were trimmed and
the remaining sequence was defined as the qualified
e2122275-16 H. MASUDA ET AL.
sequence. The qualified sequences were aligned to the
reference sequences of each strain and sectioned into the
immunoglobulin framework and CDR according to the
Kabat numbering scheme. Sequences of each strain before
maturation (Day 0) were used as controls and sequence
changes generated by affinity maturation were analyzed as
changes from the control sequences.
Antibody humanization and purication
Humanized VH and VL amino acid sequences were designed
according to the general procedure previously described.
55
The
humanized VH and VL sequences were synthesized (by Azenta
Life Sciences) and cloned into the antibody expression vectors,
pFUSE-CHIg-hG1 and pFUSE2-CLIg-mk, respectively.
Antibodies were transiently expressed using Freestyle 293-F cells
and purified using Protein A affinity chromatography (Cytiva)
followed by buffer exchange to PBS using PD-10 desalting col-
umns (Cytiva).
Protein thermal shift assay
Thermal shift assay was carried out in a 96-well format using
a StepOne plus real-time PCR system (Thermo Fisher
Scientific). The antibodies were diluted to be 50 µg/mL in 1%
methionine, 150 mM NaCl, 20 mM histidine with the fluor-
escent dye SYPRO Orange (1/5000, Thermo Fisher Scientific,
#S6650). Data were collected at 1°C/min intervals from 25°C to
99°C; the Tm for the Fab domain was calculated from the
measured melting curve which was analyzed using Protein
Thermal Shift Software (Thermo Fisher Scientific).
Freeze-thaw study using size exclusion chromatography
Aliquot of antibody underwent three freeze-thaw cycles
between −80 and 25°C and aggregation/fragmentation profiles
of the antibodies were analyzed by size exclusion chromato-
graphy using an ACQUITY UPLC H-Class PLUS system
(Waters) equipped with an ACQUITY UPLC Protein BEH
SEC Column (200 Å, 1.7 µm, 4.6 mm×150 mm, Waters).
Antibody solutions were diluted to be 0.2 mg/mL in 1%
methionine, 150 mM NaCl, 20 mM histidine and the mobile
phase consisted of 50 mM Na-phosphate, 300 mM NaCl, pH
7.0. Each sample was injected (8 μL) at a flow rate of 0.35 mL/
min. UV absorption was measured at a wavelength of 220 nm.
Immunotoxicity assay
The cytotoxicity was examined using a cell viability assay. PC3
cells and DU145 cells were seeded at 2.0 × 10
3
cells/well in 96-
well plates and incubated overnight at 37°C. Humanized anti-
hCDCP1 monoclonal antibodies were added at the concentra-
tions of 100, 20, 5, 1, 0.2 or 0.05 ng/mL, and the cells were
incubated 5 min at R.T. Next, anti-Human IgG, PBD-
conjugated IgGs with Cleavable Linker (Moradec, #AH-
106PB-50) were added at the final concentration of 1 µg/mL.
The cells were cultured in the medium for an additional 3 days
(DU145) or 7 days (PC3). The viability of the cells was
examined with a CellTiter-Glo Luminescent Cell Viability
Assay (Promega). Statistical analysis was performed using
Graphpad Prism software v. 9.3.0 (Graphpad software Inc.).
Acknowledgments
The authors gratefully thank Dr. Yoshiharu Sato (DNA Chip Research
Inc.) for assistance with NGS data analysis; Kenro Shinagawa for assis-
tance with immunotoxicity assay.
Disclosure statement
H.M., A.S., S.H., K.T., K.-Y.L., N.H., K.K., and H.I. are employees of
Chiome Bioscience Inc. S.H., K.K., K.O., and H.S. hold stocks of
Chiome Bioscience Inc. The authors have no additional financial interests.
Funding
Financial supports were provided in part by a Core Research for
Evolutional Science and Technology (CREST) grant from the Japan
Science and Technology Corporation (JPMJCR18S3) for K.O.
ORCID
Atsushi Sawada http://orcid.org/0000-0002-6081-8643
Ke-Yi Lin http://orcid.org/0000-0001-7868-7904
Hidetaka Seo http://orcid.org/0000-0002-8676-8955
Author contributions
Conceptualization: H.I. Project administration: H.I., H.M. Methodology:
H.M., A.S. Investigation: Vector design and knock-in cell generation - H.
M., A.S. Performing affinity maturation - K.T., H.M., N.H. ELISA and
thermal shift assay - H.M. FCM analysis and immunotoxicity assay - H.
M., S.H. Sanger sequencing - N.H., H.M. NGS analysis - H.M., H.S., K.K.
SPR analysis - H.M., K.-Y.L. Antibody stability analysis - H.M. Writing:
Original draft - H.M. Review and editing - H.I., K.-Y.L., S.H., H.S., K.O.
References
1. Lu RM, Hwang YC, Liu IJ, Lee CC, Tsai HZ, Li HJ, Wu HC.
Development of therapeutic antibodies for the treatment of
diseases. J Biomed Sci. 2020;27:1–30. doi:10.1186/s12929-019-
0592-z.
2. Kaplon H, Muralidharan M, Schneider Z, Reichert JM. Antibodies
to watch in 2020. MAbs. 2020;12:1–24. doi:10.1080/19420862.2019.
1703531.
3. Valldorf B, Hinz SC, Russo G, Pekar L, Mohr L, Klemm J,
Doerner A, Krah S, Hust M, Zielonka S. Antibody display technol-
ogies: selecting the cream of the crop. Biol Chem.
2021:000010151520200377. doi:10.1515/hsz-2020-0377.
4. Chan DTY, Groves MAT. Affinity maturation: highlights in the
application of in vitro strategies for the directed evolution of
antibodies. Emerg Top Life Sci. 2021;5:601–08. doi:10.1042/
ETLS20200331.
5. Rajewsky K, Förster I, Cumano A. Evolutionary and somatic selec-
tion of the antibody repertoire in the mouse. Science.
1987;238:1088–94. PMID: 3317826. doi:10.1126/science.3317826.
6. Pham P, Bransteitter R, Petruska J, Goodman MF. Processive
AID-catalysed cytosine deamination on single-stranded DNA
simulates somatic hypermutation. Nature. 2003;424:103–07.
doi:10.1038/nature01760.
7. Yu K, Huang FT, Lieber MR. DNA substrate length and surround-
ing sequence affect the activation-induced deaminase activity at
MABS e2122275-17
cytidine. J Biol Chem. 2004;279:6496–500. doi:10.1074/jbc.
M311616200.
8. Wagner SD, Milstein C, Neuberger MS. Codon bias targets
mutation. Nature. 1995;376:732–732. doi:10.1038/376732a0.
9. Kepler TB. Codon bias and plasticity in immunoglobulins. Mol Biol
Evol. 1997;14:637–43. doi:10.1093/oxfordjournals.molbev.a025803.
10. Julian MC, Li L, Garde S, Wilen R, Tessier PM. Efficient affinity
maturation of antibody variable domains requires co-selection of
compensatory mutations to maintain thermodynamic stability. Sci
Rep. 2017;7:1–13. doi:10.1038/srep45259.
11. Julian MC, Lee CC, Tiller KE, Rabia LA, Day EK, Schick AJ,
Tessier PM. Co-evolution of affinity and stability of grafted
amyloid-motif domain antibodies. Protein Eng Des Sel.
2015;28:339–50. doi:10.1093/protein/gzv050.
12. Rabia LA, Desai AA, Jhajj HS, Tessier PM. Understanding and
overcoming trade-offs between antibody affinity, specificity, stabi-
lity and solubility. Biochem Eng J. 2018;137:365. doi:10.1016/j.bej.
2018.06.003.
13. Tiler KE, Chowdhury R, Li T, Ludwig SD, Sen S, Maranas CD,
Tessier PM. Facile affinity maturation of antibody variable
domains using natural diversity mutagenesis. Front Immunol.
2017:8. doi:10.3389/fimmu.2017.00986.
14. Cumbers SJ, Williams GT, Davies SL, Grenfell RL, Takeda S,
Batista FD, Sale JE, Neuberger MS. Generation and iterative affinity
maturation of antibodies in vitro using hypermutating B-cell lines.
Nat Biotechnol. 2002;20:1129–34. doi:10.1038/nbt752.
15. Lim AWY, Williams GT, Rada C, Sale JE. Directed evolution of
human scFvs in DT40 cells. Protein Eng Des Sel. 2015;29(2):39–48.
doi:10.1093/protein/gzv058.
16. Chen C, Wang J, Zhao Y, Chen S, Hu Z, Chen L, Hang H.
Enhancers improve the AID-induced hypermutation in episomal
vector for antibody affinity maturation in mammalian cell display.
Antibodies. 2018;7(4):42. doi:10.3390/antib7040042.
17. Bowers PM, Horlick RA, Neben TY, Toobian RM,
Tomlinson GL, Dalton JL, Jones HA, Chen A, Altobell L III,
Zhang X, et al. Coupling mammalian cell surface display with
somatic hypermutation for the discovery and maturation of
human antibodies. Proc Natl Acad Sci USA. 2011;108:20455.
doi:10.1073/pnas.1114010108.
18. Yin Y, Quinlan BD, Ou T, Guo Y, He W, Farzan M. In vitro affinity
maturation of broader and more-potent variants of the
HIV-1-neutralizing antibody CAP256-VRC26.25. Proc Natl Acad
Sci USA. 2021;118:e2106203118. doi:10.1073/pnas.2106203118.
19. Wellner A, McMahon C, Gilman MSA, Clements JR, Clark S,
Nguyen KM, Ho MH, Hu VJ, Shin J-E, Feldman J, et al. Rapid
generation of potent antibodies by autonomous hypermutation in
yeast. Nat Chem Biol. 2021;2021:1–8. doi:10.1101/2020.11.11.378778.
20. Kajita M, Okazawa T, Ikeda M, Todo K, Magari M,
Kanayama N, Ohmori H. Efficient affinity maturation of anti-
bodies in an engineered chicken B cell line DT40-SW by
increasing point mutation. J Biosci Bioeng. 2010;110:351–58.
doi:10.1016/j.jbiosc.2010.03.006.
21. Chen S, Qiu J, Chen C, Liu C, Liu Y, An L, Jia J, Tang J, Wu L,
Hang H. Protein & cell affinity maturation of anti-TNF-alpha scFv
with somatic hypermutation in non-B cells. Protein Cell.
2012;460–69. doi:10.1007/s13238-012-2024-7.
22. Seo H, Masuda H, Asagoshi K, Uchiki T, Kawata S, Sasaki G,
Yabuki T, Miyai S, Takahashi N, Hashimoto S, et al. Streamlined
human antibody generation and optimization by exploiting
designed immunoglobulin loci in a B cell line. Cell Mol
Immunol. 2021;18:1545–61. doi:10.1038/s41423-020-0440-9.
23. Seo H, Masuoka M, Murofushi H, Takeda S, Shibata T, Ohta K. Rapid
generation of specific antibodies by enhanced homologous
recombination. Nat Biotechnol. 2005;23:731–35. doi:10.1038/nbt1092.
24. Seo H, Ichi HS, Tsuchiya K, Lin W, Shibata T, Ohta K. An ex vivo
method for rapid generation of monoclonal antibodies (ADLib®
system). Nat Protoc. 2006;1:1502–06. doi:10.1038/nprot.2006.248.
25. Hashimoto K, Kurosawa K, Murayama A, Seo H, Ohta K. B
Cell-based seamless engineering of antibody Fc domains. PLoS
ONE. 2016:1–22. doi:10.1371/journal.pone.0167232.
26. Schusser B, Yi H, Collarini EJ, Izquierdo SM, Harriman WD,
Etches RJ, Leighton PA. Harnessing gene conversion in chicken
B cells to create a human antibody sequence repertoire. PLoS One.
2013;8:e80108. doi:10.1371/journal.pone.0080108.
27. Leighton PA, Schusser B, Yi H, Glanville J, Harriman W. A diverse
repertoire of human immunoglobulin variable genes in a chicken
B cell line is generated by both gene conversion and somatic
hypermutation. Front Immunol. 2015;6:126. doi:10.3389/fimmu.
2015.00126.
28. Kanayama N, Todo K, Takahashi S, Magari M, Ohmori H. Genetic
manipulation of an exogenous non-immunoglobulin protein by
gene conversion machinery in a chicken B cell line. Nucleic Acids
Res. 2006;34:1–9. doi:10.1093/nar/gnj013.
29. Arakawa H, Kudo H, Batrak V, Caldwell RB, Rieger MA,
Ellwart JW, Buerstedde J-M. Protein evolution by hypermutation
and selection in the B cell line DT40. Nucleic Acids Res.
2008;36:1–11. doi:10.1093/nar/gkm616.
30. Brindle NPJ, Sale JE, Arakawa H, Buerstedde JM, Nuamchit T,
Sharma S, Steele KH. Directed evolution of an angiopoietin-2
ligand trap by somatic hypermutation and cell surface display.
J Biol Chem. 2013;288:33205. doi:10.1074/jbc.M113.510578.
31. Buerstedde JM, Reynaud CA, Humphries EH, Olson W, Ewert DL,
Weill JC. Light chain gene conversion continues at high rate in an
ALV-induced cell line. EMBO J. 1990;9:921–27. doi:10.1002/j.
1460-2075.1990.tb08190.x.
32. Lin W, Hashimoto SI, Seo H, Shibata T, Ohta K. Modulation
of immunoglobulin gene conversion frequency and distribu-
tion by the histone deacetylase HDAC2 in chicken DT40.
Genes to Cells. 2008;13:255–68. doi:10.1111/j.1365-2443.2008.
01166.x.
33. Seo H, Yamada T, Hashimoto SI, Lin W, Ohta K. Modulation of
immunoglobulin gene conversion incChicken DT40 by enhancing
histone acetylation, and its application to antibody engineering.
Biotechnol Genet Eng Rev. 2013;24:179–94. PMID: 18059633.
doi:10.1080/02648725.2007.10648099.
34. Arakawa H, Saribasak H, Buerstedde JM. Activation-induced cyti-
dine deaminase initiates immunoglobulin gene conversion and
hypermutation by a common intermediate. PLoS Biol. 2004:2.
doi:10.1371/journal.pbio.0020179.
35. Wilson PC, De Bouteiller O, Liu Y-J, Potter K, Banchereau J,
Capra JD, Pascual V. Somatic hypermutation introduces insertions
and deletions into immunoglobulin V genes. J Exp Med.
1998;187:59–70. doi:10.1084/jem.187.1.59.
36. Saberi A, Nakahara M, Sale JE, Kikuchi K, Arakawa H,
Buerstedde J-M, Yamamoto K, Takeda S, Sonoda E. The 9-1-1
DNA clamp is required for immunoglobulin gene conversion.
Mol Cell Biol. 2008;28:6113–22. doi:10.1128/MCB.00156-08.
37. Kohzaki M, Nishihara K, Hirota K, Sonoda E, Yoshimura M,
Ekino S, Butler JE, Watanabe M, Halazonetis TD, Takeda S.
DNA polymerases ν and θ are required for efficient immunoglo-
bulin V gene diversification in chicken. J Cell Biol.
2010;189:1117–27. doi:10.1083/jcb.200912012.
38. Wortmann A, He Y, Deryugina EI, Quigley JP, Hooper JD. The cell
surface glycoprotein CDCP1 in gancer—Insights, opportunities, and
challenges. IUBMB Life. 2009;61:723–30. doi:10.1002/iub.198.
39. Bachl J, Carlson C, Gray-Schopfer V, Dessing M, Olsson C.
Predicting antibody developability profiles through early stage
discovery screening. MAbs. 2020;12:e1743053. doi:10.1080/
19420862.2020.1743053.
40. Bachl J, Carlson C, Gray-Schopfer V, Dessing M, Olsson C.
Increased transcription levels induce higher mutation rates in
a hypermutating cell line. J Immunol. 2001;166:5051–57. doi:10.
4049/jimmunol.166.8.5051.
41. Martin A, Scharff MD. Somatic hypermutation of the AID trans-
gene in B and non-B cells. Proc Natl Acad Sci USA.
2002;99:12304–08. doi:10.1073/pnas.192442899.
42. Abe T, Branzei D, Hirota K. DNA damage tolerance mechanisms
revealed from the analysis of immunoglobulin V gene diversifica-
tion in Avian DT40 cells. Genes. 2018;2018(9):614. doi:10.3390/
genes9120614.
e2122275-18 H. MASUDA ET AL.
43. Kawamoto T, Araki K, Sonoda E, Yamashita YM, Harada K,
Kikuchi K, Masutani C, Hanaoka F, Nozaki K, Hashimoto N,
et al. Dual roles for DNA polymerase η in homologous DNA
recombination and translesion DNA synthesis. Mol Cell.
2005;20:793–99. doi:10.1016/j.molcel.2005.10.016.
44. Blagodatski A, Batrak V, Schmidl S, Schoetz U, Caldwell RB,
Arakawa H, Buerstedde JM. A cis-acting diversification activator
both necessary and sufficient for AID-mediated hypermutation.
PLoS Genet. 2009:5. doi:10.1371/journal.pgen.1000332.
45. Kohler KM, McDonald JJ, Duke JL, Arakawa H, Tan S,
Kleinstein SH, Buerstedde J-M, Schatz DG. Identification of core
DNA elements that target somatic hypermutation. J Immunol.
2012;189:5314. doi:10.4049/jimmunol.1202082.
46. Buerstedde JM, Alinikula J, Arakawa H, McDonald JJ, Schatz DG.
Targeting of somatic hypermutation by immunoglobulin enhancer
And enhancer-like sequences. PLoS Biol. 2014:12. doi:10.1371/
journal.pbio.1001831.
47. McDonald JJ, Alinikula J, Buerstedde J-M, Schatz DG. A critical
context-dependent role for E boxes in the targeting of somatic
hypermutation. J Immunol. 2013;191:1556. doi:10.4049/jimmunol.
1300969.
48. Wei L, Chahwan R, Wang S, Wang X, Pham PT,
Goodman MF, Bergman A, Scharff MD, MacCarthy T.
Overlapping hotspots in CDRs are critical sites for V region
diversification. Proc Natl Acad Sci USA. 2015;112:728–37.
doi:10.1073/pnas.1500788112.
49. Matsuda T, Bebenek K, Masutani C, Rogozin IB, Hanaoka F,
Kunkel TA. Error rate and specificity of human and murine
DNA polymerase η. J Mol Biol. 2001;312:335–46. doi:10.1006/
jmbi.2001.4937.
50. Mayorov R VI, IB ALR, Gearhart PJ. DNA Polymerase η contributes
to strand bias of mutations of A versus T in immunoglobulin genes.
J Immunol. 2005;174:7781–86. doi:10.4049/jimmunol.174.12.7781.
51. Tang C, Krantsevich A, MacCarthy T. Deep learning model of
somatic hypermutation reveals importance of sequence context
beyond targeting of AID and Polη hotspots. bioRxiv. 2021:1–44.
doi:10.1101/2021.08.03.453264.
52. Hirota K, Sonoda E, Kawamoto T, Motegi A, Masutani C,
Hanaoka F, Szüts D, Iwai S, Sale JE, Lehmann A, et al.
Simultaneous disruption of two DNA polymerases, Polη and
Polζ, in Avian DT40 cells unmasks the role of Polη in cellular
response to various DNA lesions. PLoS Genet. 2010;6:1–13.
doi:10.1371/journal.pgen.1001151.
53. Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer
for Illumina sequence data. Bioinformatics. 2014;30:2114–20.
doi:10.1093/bioinformatics/btu170.
54. Magoč T, Salzberg SL. FLASH: fast length adjustment of short
reads to improve genome assemblies. Bioinformatics.
2011;27:2957–63. doi:10.1093/bioinformatics/btr507.
55. Tsurushita N, Hinton PR, Kumar S. Design of humanized anti-
bodies: from anti-Tac to Zenapax. Methods. 2005;36:69–83. doi:10.
1016/j.ymeth.2005.01.007.
MABS e2122275-19
ResearchGate has not been able to resolve any citations for this publication.
Article
Full-text available
B cells undergo somatic hypermutation (SHM) of the Immunoglobulin (Ig) variable region to generate high-affinity antibodies. SHM relies on the activity of activation-induced deaminase (AID), which mutates C>U preferentially targeting WRC (W=A/T, R=A/G) hotspots. Downstream mutations at WA Polymerase η hotspots contribute further mutations. Computational models of SHM can describe the probability of mutations essential for vaccine responses. Previous studies using short subsequences (k-mers) failed to explain divergent mutability for the same k-mer. We developed the DeepSHM (Deep learning on SHM) model using k-mers of size 5-21, improving accuracy over previous models. Interpretation of DeepSHM identified an extended WWRCT motif with particularly high mutability. Increased mutability was further associated with lower surrounding G content. Our model also discovered a conserved AGYCTGGGGG (Y=C/T) motif within FW1 of IGHV3 family genes with unusually high T>G substitution rates. Thus, a wider sequence context increases predictive power and identifies features that drive mutational targeting.
Preprint
Full-text available
B-cells undergo somatic hypermutation (SHM) of the Immunoglobulin (Ig) variable region to generate high-affinity antibodies. SHM relies on the activity of activation-induced deaminase (AID), which mutates C>U preferentially targeting WRC (W=A/T, R=A/G) hotspots. Downstream mutations at WA Polymerase η hotspots contribute further mutations. Computational models of SHM can describe the probability of mutations essential for vaccine responses. Previous studies using short subsequences (k-mers) failed to explain divergent mutability for the same k-mer. We developed the DeepSHM (Deep learning on SHM) model using k-mers of size 5-21, improving accuracy over previous models. Interpretation of DeepSHM identified an extended DWRCT (D=A/G/T) motif with particularly high mutability. Increased mutability was further associated with lower surrounding G content. Our model also discovered a conserved AGYCTGGGGG (Y=C/T) motif within FW1 of IGHV3 family genes with unusually high T>G substitution rates. Thus, a wider sequence context increases predictive power and identifies novel features that drive mutational targeting.
Article
Full-text available
The predominant approach for antibody generation remains animal immunization, which can yield exceptionally selective and potent antibody clones owing to the powerful evolutionary process of somatic hypermutation. However, animal immunization is inherently slow, not always accessible and poorly compatible with many antigens. Here, we describe ‘autonomous hypermutation yeast surface display’ (AHEAD), a synthetic recombinant antibody generation technology that imitates somatic hypermutation inside engineered yeast. By encoding antibody fragments on an error-prone orthogonal DNA replication system, surface-displayed antibody repertoires continuously mutate through simple cycles of yeast culturing and enrichment for antigen binding to produce high-affinity clones in as little as two weeks. We applied AHEAD to generate potent nanobodies against the SARS-CoV-2 S glycoprotein, a G-protein-coupled receptor and other targets, offering a template for streamlined antibody generation at large. Autonomous hypermutation yeast surface display (AHEAD) mimics the process of somatic hypermutation in animals to enable the rapid in vitro evolution of antibodies, including nanobodies targeting the RBD of SARS-CoV-2.
Article
Full-text available
Antibody display technologies enable the successful isolation of antigen-specific antibodies with therapeutic potential. The key feature that facilitates the selection of an antibody with prescribed properties is the coupling of the protein variant to its genetic information and is referred to as genotype phenotype coupling. There are several different platform technologies based on prokaryotic organisms as well as strategies employing higher eukaryotes. Among those, phage display is the most established system with more than a dozen of therapeutic antibodies approved for therapy that have been discovered or engineered using this approach. In recent years several other technologies gained a certain level of maturity, most strikingly mammalian display. In this review, we delineate the most important selection systems with respect to antibody generation with an emphasis on recent developments.
Article
Full-text available
Affinity maturation is a key technique in protein engineering which is used to improve affinity and binding interactions in vitro, a process often required to fulfil the therapeutic potential of antibodies. There are many available display technologies and maturation methods developed over the years, which have been instrumental in the production of therapeutic antibodies. However, due to the inherent limitations in display capacity of these technologies, accommodation of expansive and complex library builds is still a challenge. In this article, we discuss our recent efforts in the affinity maturation of a difficult antibody lineage using an unbiased approach, which sought to explore a larger sequence space through the application of DNA recombination and shuffling techniques across the entire antibody region and selections using ribosome display. We also highlight the key features of several display technologies and diversification methods, and discuss the strategies devised by different groups in response to different challenges. Particular attention is drawn to examples which are aimed at the expansion of sequence, structural or experimental diversity through different means and approaches. Here, we provide our perspectives on these methodologies and the considerations involved in the design of effective strategies for the directed evolution of antibodies.
Article
Full-text available
Monoclonal antibodies (mAbs) are widely utilized as therapeutic drugs for various diseases, such as cancer, autoimmune diseases, and infectious diseases. Using the avian-derived B cell line DT40, we previously developed an antibody display technology, namely, the ADLib system, which rapidly generates antigen-specific mAbs. Here, we report the development of a human version of the ADLib system and showcase the streamlined generation and optimization of functional human mAbs. Tailored libraries were first constructed by replacing endogenous immunoglobulin genes with designed human counterparts. From these libraries, clones producing full-length human IgGs against distinct antigens can be isolated, as exemplified by the selection of antagonistic mAbs. Taking advantage of avian biology, effective affinity maturation was achieved in a straightforward manner by seamless diversification of the parental clones into secondary libraries followed by single-cell sorting, quickly affording mAbs with improved affinities and functionalities. Collectively, we demonstrate that the human ADLib system could serve as an integrative platform with unique diversity for rapid de novo generation and optimization of therapeutic or diagnostic antibody leads. Furthermore, our results suggest that libraries can be constructed by introducing exogenous genes into DT40 cells, indicating that the ADLib system has the potential to be applied for the rapid and effective directed evolution and optimization of proteins in various fields beyond biomedicine.
Article
Full-text available
Monoclonal antibodies play an increasingly important role for the development of new drugs across multiple therapy areas. The term ‘developability’ encompasses the feasibility of molecules to successfully progress from discovery to development via evaluation of their physicochemical properties. These properties include the tendency for self-interaction and aggregation, thermal stability, colloidal stability, and optimization of their properties through sequence engineering. Selection of the best antibody molecule based on biological function, efficacy, safety, and developability allows for a streamlined and successful CMC phase. An efficient and practical high-throughput developability workflow (100 s-1,000 s of molecules) implemented during early antibody generation and screening is crucial to select the best lead candidates. This involves careful assessment of critical developability parameters, combined with binding affinity and biological properties evaluation using small amounts of purified material (<1 mg), as well as an efficient data management and database system. Herein, a panel of 152 various human or humanized monoclonal antibodies was analyzed in biophysical property assays. Correlations between assays for different sets of properties were established. We demonstrated in two case studies that physicochemical properties and key assay endpoints correlate with key downstream process parameters. The workflow allows the elimination of antibodies with suboptimal properties and a rank ordering of molecules for further evaluation early in the candidate selection process. This enables any further engineering for problematic sequence attributes without affecting program timelines.
Article
Full-text available
It has been more than three decades since the first monoclonal antibody was approved by the United States Food and Drug Administration (US FDA) in 1986, and during this time, antibody engineering has dramatically evolved. Current antibody drugs have increasingly fewer adverse effects due to their high specificity. As a result, therapeutic antibodies have become the predominant class of new drugs developed in recent years. Over the past five years, antibodies have become the best-selling drugs in the pharmaceutical market, and in 2018, eight of the top ten bestselling drugs worldwide were biologics. The global therapeutic monoclonal antibody market was valued at approximately US$115.2 billion in 2018 and is expected to generate revenue of $150 billion by the end of 2019 and $300 billion by 2025. Thus, the market for therapeutic antibody drugs has experienced explosive growth as new drugs have been approved for treating various human diseases, including many cancers, autoimmune, metabolic and infectious diseases. As of December 2019, 79 therapeutic mAbs have been approved by the US FDA, but there is still significant growth potential. This review summarizes the latest market trends and outlines the preeminent antibody engineering technologies used in the development of therapeutic antibody drugs, such as humanization of monoclonal antibodies, phage display, the human antibody mouse, single B cell antibody technology, and affinity maturation. Finally, future applications and perspectives are also discussed.
Article
Significance Broadly neutralizing antibodies (bNAbs) can prevent new HIV-1 infections, but most are insufficiently broad or potent to protect from the diverse pool of circulating viruses. V2-glycan/apex bNAbs are exceptionally potent, but their breadth is limited. Their neutralizing activity requires tyrosine sulfation, a posttranslational modification that precludes their improvement with phage or yeast display. Here, we demonstrate the utility of a mammalian display approach whereby the heavy- and light-chain loci of a B cell line are CRISPR edited to encode the apex bNAb CAP256-VRC26.25. These loci were iteratively diversified through homology-directed repair with a library of DNA templates and through in vitro somatic hypermutation and selected with diverse envelope glycoprotein trimers. This approach can identify broader and more-potent apex bNAbs.
Preprint
The predominant approach for antibody generation remains animal immunization, which can yield exceptionally selective and potent antibody clones owing to the powerful evolutionary process of somatic hypermutation. However, animal immunization is inherently slow, has poor compatibility with certain antigens ( e . g ., integral membrane proteins), and suffers from self-tolerance and immunodominance, which limit the functional spectrum of antibodies that can be obtained. Here, we describe A utonomous H ypermutation y E ast surf A ce D isplay (AHEAD), a synthetic recombinant antibody generation technology that imitates somatic hypermutation inside engineered yeast. In AHEAD, antibody fragments are encoded on an error-prone orthogonal DNA replication system, resulting in Saccharomyces cerevisiae populations that continuously mutate surface-displayed antibody repertoires. Simple cycles of yeast culturing and enrichment for antigen binding drive the evolution of high-affinity antibody clones in a readily parallelizable process that takes as little as 2 weeks. We applied AHEAD to generate nanobodies against the SARS-CoV-2 S glycoprotein, a GPCR, and other targets. The SARS-CoV-2 nanobodies, concurrently evolved from an open-source naïve nanobody library in 8 independent experiments, reached subnanomolar affinities through the sequential fixation of multiple mutations over 3-8 AHEAD cycles that saw ∼580-fold and ∼925-fold improvements in binding affinities and pseudovirus neutralization potencies, respectively. These experiments highlight the defining speed, parallelizability, and effectiveness of AHEAD and provide a template for streamlined antibody generation at large with salient utility in rapid response to current and future viral outbreaks.