Access to this full-text is provided by Hindawi.
Download available
Content available from Mediators of Inflammation
This content is subject to copyright. Terms and conditions apply.
Research Article
Mitochondrial Transplantation Promotes Remyelination and
Long-Term Locomotion Recovery following Cerebral Ischemia
Tao Chen ,
1,2
Yuanyuan Zhu ,
3
Jia Jia ,
4
Han Meng ,
3
Chao Xu ,
3
Panpan Xian ,
3
Zijie Li ,
3
Zhengang Tang ,
2
Yin Wu ,
5
and Yan Liu
1,6
1
Branch of Cerebral Vascular Diseases, Department of Neurosurgery, General Hospital of Southern Theater Command, The First
School of Clinical Medicine, Southern Medical University, PLA, No. 111, Liuhua Road, Guangzhou, 510515 Guangdong, China
2
Institute of Neurology, Renmin Hospital, Hubei University of Medicine, Shiyan, Hubei, China
3
Department of Neurobiology and Institute of Neurosciences, School of Basic Medicine, Fourth Military Medical University,
169 Chang Le Xi Road, Xi’an, Shaanxi, China
4
Department of Gastroenterology, Renmin Hospital, Hubei University of Medicine, Shiyan, Hubei, China
5
Department of Pharmacy, Xi’an Gaoxin Hospital, No. 16, Tuanjie Road, Hi-Tech Zone, Xi’an, Shaanxi 710075, China
6
Department of Neurology, Foresea Life Insurance Guangzhou General Hospital, Guangzhou, Guangdong, China
Correspondence should be addressed to Yin Wu; wuyin_2005@126.com and Yan Liu; liuyanneurodoctor@163.com
Received 28 July 2022; Accepted 25 August 2022; Published 15 September 2022
Academic Editor: Feng Zhang
Copyright © 2022 Tao Chen et al. This is an open access article distributed under the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Cerebral ischemia usually leads to axonal degeneration and demyelination in the adjacent white matter. Promoting remyelination
still remains a challenging issue in the field. Considering that ischemia deprives energy supply to neural cells and high metabolic
activities are required by oligodendrocyte progenitor cells (OPCs) for myelin formation, we assessed the effects of transplanting
exogenous healthy mitochondria on the degenerating process of oligodendrocytes following focal cerebral ischemia in the
present study. Our results showed that exogenous mitochondria could efficiently restore the overall mitochondrial function and
be effectively internalized by OPCs in the ischemic cortex. In comparison with control cortex, there were significantly less
apoptotic and more proliferative OPCs in mitochondria-treated cortex. More importantly, higher levels of myelin basic protein
(MBP) and more morphologically normal myelin-wrapped axons were observed in mitochondria-treated cortex at 21 days
postinjury, as revealed by light and electron microscope. Behavior assay showed better locomotion recovery in mitochondria-
treated mice. Further analysis showed that olig2 and lipid synthesis signaling were significantly increased in mitochondria-
treated cortex. In together, our data illustrated an antidegenerating and myelination-promoting effect of exogenous
mitochondria, indicating mitochondria transplantation as a potentially valuable treatment for ischemic stroke.
1. Introduction
Stroke is one of the leading causes of disability and dementia
around the world [1]. Approximately 80% of stroke is cere-
bral ischemia, which usually leads to permanent loss of neu-
rons and oligodendrocytes in the injury area. In the past
decades, numerous researches focused on and developed
various treatments for neuroprotection [2, 3]. Relatively,
there still lacks effective strategy for preventing the degener-
ation of oligodendrocytes and demyelination following
ischemia.
One pathological feature of cerebral ischemia is the dis-
ruption of energy supply, which usually leads to mitochon-
dria dysfunction [4]. Mitochondria damage is thought as
the major cause of cell death and oxidative stress [5]. Restor-
ing or promoting mitochondria function has been regarded
as promising for reducing the secondary injury following
ischemia [6]. Recently, in vivo transplantation of healthy
Hindawi
Mediators of Inflammation
Volume 2022, Article ID 1346343, 8 pages
https://doi.org/10.1155/2022/1346343
mitochondria has been proposed as an effective way to boost
mitochondria function and exert neuroprotection [7, 8]. For
example, mitochondrial transplantation exerted remarkable
beneficial effects in preventing secondary injury in traumatic
brain injury and cognitive decline in aging [9, 10]. High met-
abolic requirement was observed during the myelination
process of oligodendrocyte precursor cells (OPCs) [11].
Whether mitochondria transplantation could exert protec-
tive effects on oligodendrocyte lineage cells remains interest-
ing to be explored.
In this study, we investigated this issue by evaluating the
survival and proliferation of oligodendrocyte progenitor
cells (OPCs) and myelination in ischemic cortex following
mitochondria transplantation.
2. Methods
2.1. Photochemical Ischemia Model. Adult C57BL/6J male
mice (body weight: 20-23 g) with 8-10 weeks of age were
adopted. All mice were specific pathogen-free and housed
under 12 light/12 dark cycle, controlled temperature (22-
24
°
C) with free access to water and standard rodent chaw.
All animal experiments were carried out according to the
protocols approved by the Animal Care and Use Commit-
tees of Fourth Military Medical University (license num-
ber: 20211024). Focal cortical ischemia was induced as
described with minor modification [12]. Rose bengal
(Sigma) was injected i.v. at 20-25 mg/kg. A skull window
was made ranging from 0.4 to 2.4 mm anterior to the
Bregma and 0.7 to3.2 mm right to the midline. The brain
was illuminated for 15-18 minutes using a cold light
source (Zeiss FL2000 LCD).
2.2. Mitochondria Preparation and ATP Measurement.
Mitochondria were purified from allogeneic mouse liver
as described [10]. Liver tissue was homogenated on ice
by mitochondria isolation buffer, and the tissue lysate
was centrifuged at 1000 g for 5-8 min. The supernatant
was centrifuged at 3500 g for 12 min. The resulting precip-
itate was resuspended with 15% Percoll and centrifuged at
21000 g to precipitate mitochondria. For mitochondria
quantification, mtDNA was isolated and quantified as
described [13]. Briefly, plasmids containing ND1 (a mito-
chondria gene) were diluted into graded concentrations
(1, 10, 10
2
,10
3
,10
4
,10
5
,10
6
,10
7
, and 10
8
copies per
ml) to make standard curve. qPCR was performed using
the following ND1 primers. ND1-F: CCGAGCATCTT
ATCCACGCT; ND1-R: ATGGTGGTACTCCCGCTGTA.
mtDNA copies were calculated according to the standard
curve. Before transplantation, freshly isolated mitochondria
were labeled with Mito-Tracker (Mito-Tracker Red
CMXRos, M9940, Solarbio) and transplanted immediately
after isolation. For mitochondrial transplantation, two
bilateral injections with 1 mm distance to lesion center
were made. Approximately 2×10
7mitochondria were
injected for each site with 50 nl/min at the depth of
0.75 mm and 1.5 mm from dura mater, respectively.
For ATP measurement, brain tissues (including lesion
center and brain regions 3 mm within the lesion boarder)
were dissected and homogenized. ATP levels were measured
by using an ATP assay kit (BC0300, Solarbio Life Sciences).
The activity of mitochondrial complex was measured by
using assay kits (BC1445, BC3240, BC0945, BC3235,
BC0515, and BC0305, Solabio Life Sciences).
2.3. Immunohistochemistry. Animals were sacrificed, and
serial sections (18-24 μm in thickness) were prepared. Sec-
tions were blocked by PBS containing 0.3% Triton X-100
and 5% bovine serum albumin (BSA) for 1.5 h. Primary
antibodies were incubated overnight as the followings: rab-
bit anti-NG2 antibody (1 : 200, Millipore), rabbit anti-
CNPase (1 : 200, Millipore) , rabbit anti-MBP antibody
(1 : 200, GeneTex), rabbit anti-Ki67 antibody (1 : 200, Gen-
eTex), rat anti-PDGFRα(1 : 500, Abcam), rabbit anticleaved
caspase-3 (1 : 200, GeneTex), and goat anti-Sox10 antibody
(1 : 100, Santa Cruz Biotech). After washing, sectio ns were
incubated with secondary antibodies conjugated with
Alexa Fluor 488 (donkey anti-rabbit, 1 : 400, Molecular
probes) or Alexa Fluor 594 (donkey anti-goat or anti-rat
IgG, 1 : 800, Molecular probes) for 2-4 h at room tempera-
ture. The nuclei were stained by DAPI (1 : 1500, Sigma).
Images were taken by using confocal microscope
(FV3000, Olympus) with same setting to reduce variation.
2.4. Electron Microscopic Study. At 21 d after mitochondria
transplantation, the mice were perfusion fixed with 2%
glutaraldehyde. Sections (50 μm in thickness) were pre-
pared and fixed again with 1% osmium tetroxide. Then,
sections were subsequently dehydrated with graded etha-
nol and embedded in Epon 812. Ultrathin sections were
cut by using an LKB Nova Ultratome (Bromma). Final
counterstaining was performed with uranyl acetate and
lead citrate. After that, sections were observed, and images
were taken by using a JEM-1230 electron microscope
(JEM, Tokyo). The g-ratio was measured as the ratio of
the inner to the outer radius of the myelin sheath of the
cross section of axons as described [14].
2.5. Western Blotting. Ischemic cortex was dissected and
homogenized. SDS-PAGE was conducted and protein trans-
ferred to PVDF membrane. Rabbit anti-MBP antibody
(1 : 1000, GeneTex) and mouse anti-β-actin antibody (1 : 6000,
Proteintech) were incubated with protein-loaded membrane
at 4
°
C overnight. HRP-conjugated anti-rabbit or anti-mouse
secondary antibodies (1 : 10000; Pierce) were incubated for 1 h
at room temperature. Bands were visualized with an ECL kit
(Pierce) and images analyzed by Image J.
2.6. Locomotion Assay. Glass sliding test was carried out at
1 d, 3 d, 7 d, and 21 d posttransplantation as described
[15]. Mice were videotaped in glass cylinder for 15 min.
The numbers of contacts and the numbers of sliding
movements of each forelimb at the wall of the cylinder
for every spontaneous stand-up were scored. The sliding
index was calculated as: the number of sliding/ðnumber of
contact + number of slidingÞ× 100.
Rotarod test was conducted at 1 d, 3 d, 7 d, and 21 d post-
transplantation. Mice were lowered onto the rotating roller,
and the timer was started immediately upon the release
2 Mediators of Inflammation
of the tail. The rod was accelerated 5-50 rpm during the
course of 5 min. The latency to fall in each trial was
recorded. Three trials were performed daily for 3 days.
2.7. RNA Sequencing and Quantitative PCR. At 7 days after
transplantation, injured tissue in the control mice and
mitochondria-treated mice were dissected, and total RNA
was isolated. After quality check, RNA sequencing was
carried out by Gene Denovo Biotechnology Co., Ltd.
(Guangzhou, China). For quantitative PCR, the following
primers were used:
FABP-5-F: TGAAAGAGCTAGGAGTAGGACTG
FABP-5-R: CTCTCGGTTTTGACCGTGATG
FABP-7-F: GGACACAATGCACATTCAAGAAC
FABP-7-R: CCGAACCACAGACTTACAGTTT
Olig2-F: TCCCCAGAACCCGATGATCTT
Olig2-R: CGTGGACGAGGACACAGTC
FASN-F: GGAGGTGGTGATAGCCGGTAT
FASN-R: TGGGTAATCCATAGAGCCCAG
2.8. Statistical Analysis. At least 3 biological repeats were car-
ried out for each immunohistochemistry and Western blotting
experiment. For morphological quantification, all the double-
stained cells in lesion area and in the adjacent region 300 μm
around the lesion boarder were counted from at least 6 sec-
tions of each mouse. The percentages were calculated by divid-
ing the number of total OPCs with double-positive OPCs. For
behavior assays, there were at least 10 mice in each group. The
data were presented as means ± S:E:and analyzed by Student’s
ttest or one-way ANOVA, followed by Dunnett post hoc [16].
Pvalues less than 0.05 were considered as statistically signifi-
cant. SPSS16.0 was adopted to perform statistical analysis.
3. Results
3.1. Internalization of Exogenous Mitochondria by
Oligodendrocyte Progenitor Cells (OPCs) in Ischemic Cortex.
Previous studies have demonstrated dysfunction of mito-
chondria following ischemia [17]. We first explored if
0
200
400
800
600
Mitochondrial activity (U/g)
I
⁎⁎
II
⁎
III
⁎⁎
IV V
Vehicle
Mito-treated
(a)
0
4
2
6
10
8
ATP (𝜇mol/g)
Vehicle Mito-treated
⁎
(b)
24 h 3 d
NG2/Mito/DAPICNPase/Mito/DAPI
(c)
Figure 1: Restoration of mitochondrial function in ischemic cortex by exogenous mitochondria. (a) Mitochondrial complex activity in
control and mitochondria-treated cortex. (b) ATP levels in control and mitochondria-treated cortex. (c) Combination of NG2 and
CNPase staining with Mito-Tracker (Mito) labeling in ischemic cortex at 24 h and 3d posttransplantation. Images in the frames were
magnified. Notice the internalized mitochondria by NG2- and CNPase-positive cells. Notice the increase of mitochondrial complex
activity and ATP level in mitochondria-treated mice. One way ANOVA for (a). Student’s t test for (b). n=5 mice per group in (a, b). N
=3mice per group in (c). ∗P<0:05.∗∗P<0:01.Bars = 50 μm.
3Mediators of Inflammation
transplanting healthy mitochondria could enhance the oval
mitochondria function in the ischemic cortex. As the liver
is the organ contains the largest number of mitochondria,
mitochondria were isolated from allogeneic liver as reported
[10]. 2×10
7mitochondria were injected for each ischemic
site. Three days later, the activity of complexes І, II, and III
and the levels of ATP were increased significantly in
mitochondria-treated cortex, as compared with vehicle-
treated cortex (Figures 1(a) and 1(b)). Then, we explored
whether OPCs could uptake exogenous mitochondria. Inter-
nalization of Mito-Tracker labeled mitochondria was evalu-
ated at 24 h and 3 d following transplantation. At 24 h after
grafting, approximately 58% NG2-positive cells (OPCs)
and 40% CNPase-positive cells (immature oligodendrocytes)
Vehicle
(a)
(b)
Mito-treated
NG2/TUNEL
0
40
20
60
80
TUNEL+NG2+/NG2 (%)
⁎⁎
Vehicle Mito-treated
CC-3/Sox10
0
40
20
60
100
80
CC-3+Sox10+/Sox10 (%)
⁎⁎⁎⁎
Vehicle Mito-treated
Figure 2: Effects of grafted mitochondria on the survival of OPCs. (a) Combination of TUNEL and NG2 staining at 3 d posttransplantation.
(b) Double immunostaining of cleaved caspase-3 (CC-3) and Sox10 at 3 d posttransplantation. TUNEL/NG2- and CC-3/Sox10-positive cells
were significantly decreased in mitochondria-treated mice, as compared to control. Representative images were taken from lesion boarder.
Student’sttest. N=5mice per group. ∗∗P<0:01.∗∗∗ P<0:001.∗∗∗∗P<0:0001.Bars = 50 μm.
Vehicle Mito-treated
Ki67/PDGFRa
0
30
20
10
40
50
Ki67+PDGFRa+/
PDGFRa (%)
⁎⁎⁎⁎
Vehicle Mito-treated
Ki67/Sox10
0
5
15
10
Ki67+Sox10+/Sox10 (%)
⁎⁎⁎
Vehicle Mito-treated
(a)
(b)
Figure 3: Effects of exogenous mitochondria on the proliferation of OPCs. (a) Double immunostaining of Ki67/PDGFRαat 5 d
posttransplantation. (b) Double immunostaining of Ki67/Sox10 at 5 d posttransplantation. Ki67/PDGFRα- and Ki67/Sox10-positive cells
significantly increased in mitochondria-treated mice, as compared to control. Representative images were taken from lesion boarder.
Student’sttest. N=5mice per group. ∗∗P<0:01.∗∗∗ P<0:001.∗∗∗∗P<0:0001.Bars = 50 μm.
4 Mediators of Inflammation
Vehicle
MBP
Mito-treated
(a)
0
1
2
3
Relative MBP/𝛽-actin
⁎⁎
Vehicle Mito-treated
MBP
𝛽-actin
Vehicle Mito-treated
(b)
Vehicle Mito-treated
(c)
0.0
0.2
0.6
0.8
0.4
1.0
g-ratio
⁎⁎
Vehicle Mito-treated
(d)
–80
20
0
–20
–40
–60
0 5 10
FLA
(d)21731
Forelimb activity to baseline (%)
15 20 25
Vehicle
Mito-treated
⁎
⁎⁎
⁎⁎
⁎⁎
–100
300
200
100
0
0 5 10 (d)21731
Sliding score to baseline (%)
15 20 25
Vehicle
Mito-treated
⁎
⁎
⁎⁎
⁎⁎
(e)
0
150
100
50
0 5 10
Rotarod test performance
21 (d)731
Rotarod latency (seconds)
15 20 25
Vehicle
Mito-treated
⁎
⁎
⁎⁎
⁎
(f)
Figure 4: Effects of grafted mitochondria on myelination and locomotion recovery. (a, b) Immunostaining and Western blotting of MBP in
control and mitochondria-treated mice at 3 w posttransplantation. Notice the higher levels of MBP expression in mitochondria-treated mice.
(c, d) Representative EM images of myelin in control and mitochondria-treated mice at 3 w posttransplantation and g-ratio of myelin.
Notice the loose and degenerating myelin in control group and the compact and morphologically normal myelin in mitochondria-
treated group. (e) Forelimb activity (glass sliding) assay. (f) Rotarod assay. Notice the better locomotion recovery in mitochondria-
treated mice. Student’sttest for (b, d). One-way ANOVA for (e, f). N=3 mice per group in (a–d). N=10 mice per group in (e, f ). ∗P
<0:05.∗∗P<0:01.Bars = 50 μmin (a, b) and 500 nm in (c).
5Mediators of Inflammation
in a zone within 300 μm from the margin of lesion boarder
were Mito-Tracker positive. At 3 d postgrafting, approxi-
mately 52% NG2-positive cells and 43% CNPase-positive
cells in this region were Mito-Tracker labeled (Figure 1(c)).
No Mito-Tracker-labeled MBP-positive cells (mature oligo-
dendrocytes) were detected (data not shown). These data
indicated grafted mitochondria could be internalized effi-
ciently by OPCs in ischemic cortex.
3.2. Promotion of OPC Survival and Proliferation by
Exogenous Mitochondria. We next examined if exogenous
mitochondria could prevent the death of OPCs. Combination
of TUNEL and NG2-staining showed that the TUNEUL/
NG2-positive cells in the ischemic region decreased by
approximately 45% in mitochondria-grafted cortex at 3 d
posttransplantation (Figure 2(a)). In addition, double immu-
nostaining of cleaved caspase-3 (CC-3) with Sox10 (a marker
of OPC) showed that CC-3/Sox10-positive cells reduced by
approximately 49% at 3 d posttransplantation, as compared
with that in vehicle control (Figure 2(b)). These data demon-
strated that grafted mitochondria promoted the survival of
OPCs in ischemic cortex.
As the development of OPCs is closely associated with
their internal metabolic condition, we assessed if mito-
chondria transplantation could affect the proliferation of
OPCs. Double immunostaining of Ki67 (a marker of cell-
cycle entry) with two OPC markers PDGFRαand Sox10
showed that there were significantly more Ki67/PDGFRα-
positive and Ki67/Sox10-positive cells in mitochondria-
treated cortex as compared with that of control group
(Figures 3(a) and 3(b)).
3.3. Improvement of Myelination and Locomotion by
Exogenous Mitochondria. We then evaluated if mitochon-
dria transplantation could attenuate the demyelination in
ischemic cortex and the subcortical corpus callosum at 21 d
posttransplantation. Both immunostaining and Western
blotting demonstrated significantly higher levels of myelin
basic protein (MBP) in mitochondria-treated cortex, as
compared with vehicle control (Figures 4(a) and 4(b)). In
addition, under electron microscope, demyelinated axons
with thin and loose myelin could be frequently detected in
vehicle-treated cortex, while more axons with thick and
intact myelin were observed in mitochondria-treated cortex
(Figure 4(c)). The g-ratio of myelin was significantly lower
in the mitochondria-treated than that in vehicle-treated cor-
tex (Figure 4(d)). These data indicated that mitochondrial
transplantation was beneficial for myelin preservation in
ischemic cortex.
In the end, we examined if mitochondria transplantation
could affect the locomotion recovery after ischemia. Glass
sliding assay which evaluates forelimb activity was con-
ducted. From 3 d posttransplantation, the total activity of
affected forelimbs significantly increased in mitochondria-
treated group, as compared with that in vehicle-treated
group (Figure 4(e)). Accordingly, the sliding activity of
affected forelimb reduced significantly in mitochondria-
treated group (Figure 4(e)). In addition, Rotarod assay which
accesses motor coordination and balance demonstrated that
mitochondria-treated mice exhibited significantly longer
running time on the rod (Figure 4(f)). These data indicated
that exogenous mitochondria was beneficial for promoting
functional recovery of ischemic stroke.
FABP5
FABP7
FASN
Olig2
PDS
Wnt3
Acaa1b
Cabp2
Mybpc3
II17rb
Ckmt1
Cpa3
Ccl24
Spag5
Tnfrsf13b
Cd48
Ctse
Fcris
Lcori
Cd46
Con Mito
2.2
0.29
–1.62
(a)
0.0
0.5
1.5
1.0
Relative FABP5 mRNA
expression
Con Mito
⁎
0.0
0.5
2.0
1.5
1.0
Relative FABP7 mRNA
expression
Con Mito
⁎
0.0
0.5
2.0
1.5
1.0
Relative FAS mRNA
expression
Con Mito
⁎
0
2
6
4
Relative Olig2 mRNA
expression
Con Mito
⁎
(b)
Figure 5: Transcriptome analysis of mitochondria-treated cortex and validation of top increased genes. (a) Heatmap of top changed genes.
(b) qPCR validation of top increased genes. Notice that the mRNA levels of FABP5, FABP7, FASN, and Olig2 were significantly increased in
mitochondria-treated cortex. Student’sttest for (b). N=3mice per group. ∗P<0:05.
6 Mediators of Inflammation
3.4. Upregulation of Lipid Synthesis Signaling and Olig2 by
Exogenous Mitochondria. To explore how exogenous mito-
chondria stimulated OPC proliferation and myelination,
we performed transcriptome analysis of ischemic cortex treated
with mitochondria or vehicle control at 7 days after transplan-
tation. The results showed that 179 genes were upregulated and
196 genes downregulated in mitochondria-treated cortex, as
compared to that of control. Among the top 10 increased genes,
we noticed the presence of fatty acid binding protein 5
(FABP5), fatty acid binding protein 7 (FABP7), fatty acid syn-
thase (FASN), Olig2, Wnt3, and acetyl-Coenzyme A acyltrans-
ferase 1B (Acaa1b) (Figure 5(a)). Reportedly, these genes are
involved in multiple stages of OPC development [18–21].
We validated the expression of these genes by real-time RT-
PCR. The results showed that the mRNA levels of FABP5,
FABP7, FASN, and Olig2 were significantly increased in
mitochondria-treated cortex (Figure 5(b)). As FABP5, FABP7,
and FASN play important roles in lipid metabolism, these data
indicated that exogenous mitochondria might stimulate
remyelination via activating lipid synthesis signaling and
Olig2-mediated gene transcription.
4. Discussion
In this study, we explored the effects of transplantation of
exogenous mitochondria on the survival, proliferation, and
myelin formation of OPCs. First, we demonstrated the effi-
cient endocytosis of exogenous mitochondria by OPCs. By
apoptosis and cell proliferation analysis, we revealed that
mitochondria grafting promoted the survival and prolifera-
tion of OPCs. More importantly, our data showed that,
mitochondria transplantation promoted remyelination in
the ischemic cerebral cortex and facilitated long-term func-
tional recovery.
As the “energy powerhouse”of every cell which highly
needs oxygen, mitochondria were very vulnerable to ische-
mia. Following cerebral ischemia, astrocytes transfer mito-
chondria to neurons for emergent energy supplement [22].
This observation inspired mitochondria transplantation as
a promising therapy for various ischemic diseases, such as
ischemia-infusion-induced heart and kidney injury [23,
24]. So far, as we know, only two groups examined the
effects of exogenous mitochondria on ischemic stroke by
using muscle or mesenchymal stem cell-derived mitochon-
dria and reported reduced infarction size and decreased
astrocytic and microglial activation [25, 26]. The very short
in vitro and extracellular life span of mitochondria may limit
the application of mitochondrial transplantation on oligo-
dendrocyte degeneration and remyelination, which persists
long after ischemia. However, our data showed exogenous
mitochondria could be efficiently endocytosed by OPCs.
Internalized mitochondria may either fuse with endogenous
mitochondria or function independently. As the life span of
mitochondria is about 2-4 weeks in cytoplasm, therefore, it
is feasible to use mitochondrial transplantation to rescue
energy failure in ischemia-attacked OPCs.
During development, OPCs require active mitochondria
for proliferation and subsequent myelin formation ([11, 27].
Our data that NG2-positive and CNPase-positive cells inter-
nalize exogenous mitochondria reflected the metabolic
requirement of OPCs. The increase of proliferation was
consistent with the high energy requirement by OPCs and
the boosting of energy supply by exogenous mitochondria.
In detail, exogenous mitochondria may restore oxidative
phosphorylation, thereby increasing ATP production. In
addition, exogenous mitochondria may enhance the
buffering of intracellular Ca2+ signaling, which helps to
stop the activation of apoptotic signaling cascade promoted
cell survival [28].
Interestingly, our data showed that exogenous mito-
chondria stimulated the expression of multiple lipid syn-
thetic genes. As myelin is extremely lipid rich, and recent
studies reported requirement of fatty acid and cholesterol
synthesis for oligodendrocyte differentiation and myelina-
tion [19, 29], it is possible that exogenous mitochondria
may steer lipid metabolism towards the direction more
favorable for myelin formation [30]. How exogenous mito-
chondria rebalanced the lipid metabolism is worthy to be
further investigated. In the present study, we cannot exclude
other cells which internalized mitochondria may also exert
beneficial effects. Nevertheless, our data provided a novel
strategy for promoting myelination in ischemic stroke and
other neurological disorders.
Data Availability
The data used to support the findings of this study are
included within the article.
Conflicts of Interest
The authors claim no conflicts of interests.
Authors’Contributions
Tao Chen, Yuanyuan Zhu, Jia Jia, and Han Meng contribute
equally to this paper and co-first authors.
Acknowledgments
This work was supported by the basic research project of
Shaanxi Natural Science Foundation (2020JM-722) to Dr.
Yin Wu and National Nature Science Foundation of China
(81471172) to Dr. Yan Liu.
References
[1] O. A. Sveinsson, O. Kjartansson, and E. M. Valdimarsson,
“Cerebral ischemia/infarction - epidemiology, causes and
symptoms,”Laeknabladid, vol. 100, no. 5, pp. 271–279, 2014.
[2] P. D. Lyden, “Cerebroprotection for acute ischemic stroke:
looking ahead,”Stroke, vol. 52, no. 9, pp. 3033–3044, 2021.
[3] E. Sekerdag, I. Solaroglu, and Y. Gursoy-Ozdemir, “Cell death
mechanisms in stroke and novel molecular and cellular treat-
ment options,”Current Neuropharmacology, vol. 16, no. 9,
pp. 1396–1415, 2018.
[4] F. Liu, J. Lu, A. Manaenko, J. Tang, and Q. Hu, “Mitochondria
in ischemic stroke: new insight and implications,”Aging and
Disease, vol. 9, no. 5, pp. 924–937, 2018.
7Mediators of Inflammation
[5] E. Area-Gomez, C. Guardia-Laguarta, E. A. Schon, and
S. Przedborski, “Mitochondria, OxPhos, and neurodegenera-
tion: cells are not just running out of gas,”The Journal of Clin-
ical Investigation, vol. 129, no. 1, pp. 34–45, 2019.
[6] Z. He, N. Ning, Q. Zhou, S. E. Khoshnam, and M. Farzaneh,
“Mitochondria as a therapeutic target for ischemic stroke,”
Free Radical Biology & Medicine, vol. 146, pp. 45–58, 2020.
[7] Y. Nakamura, J. H. Park, and K. Hayakawa, “Therapeutic use
of extracellular mitochondria in CNS injury and disease,”
Experimental Neurology, vol. 324, article 113114, 2020.
[8] L. D. Popov, “One step forward: extracellular mitochondria
transplantation,”Cell and Tissue Research, vol. 384, no. 3,
pp. 607–612, 2021.
[9] Z. Zhang, D. Wei, Z. Li, H. Guo, Y. Wu, and J. Feng, “Hippo-
campal mitochondrial transplantation alleviates age-
associated cognitive decline via enhancing Wnt signaling and
neurogenesis,”Computational Intelligence and Neuroscience,
vol. 2022, Article ID 9325302, 7 pages, 2022.
[10] J. Zhao, D. Qu, Z. Xi et al., “Mitochondria transplantation pro-
tects traumatic brain injury via promoting neuronal survival
and astrocytic BDNF,”Translational Research, vol. 235,
pp. 102–114, 2021.
[11] N. Meyer and J. E. Rinholm, “Mitochondria in myelinating oli-
godendrocytes: slow and out of breath?,”Metabolites, vol. 11,
no. 6, p. 359, 2021.
[12] J. Yang, Y. Zhao, L. Zhang et al., “RIPK3/MLKL-mediated
neuronal necroptosis modulates the M1/M2 polarization of
microglia/macrophages in the ischemic cortex,”Cerebral Cor-
tex, vol. 28, no. 7, pp. 2622–2635, 2018.
[13] A. Reyes, J. He, C. C. Mao et al., “Actin and myosin contribute
to mammalian mitochondrial DNA maintenance,”Nucleic
Acids Research, vol. 39, no. 12, pp. 5098–5108, 2011.
[14] L. A. Pasquini, V. Millet, H. C. Hoyos et al., “Galectin-3 drives
oligodendrocyte differentiation to control myelin integrity and
function,”Cell Death and Differentiation, vol. 18, no. 11,
pp. 1746–1756, 2011.
[15] D. Sweetnam, A. Holmes, K. A. Tennant et al., “Diabetes
impairs cortical plasticity and functional recovery following
ischemic stroke,”The Journal of Neuroscience, vol. 32, no. 15,
pp. 5132–5143, 2012.
[16] H. Fan, X. Liu, H. B. Tang, P. Xiao, Y. Z. Wang, and G. Ju,
“Protective effects of Batroxobin on spinal cord injury in rats,”
Neuroscience Bulletin, vol. 29, no. 4, pp. 501–508, 2013.
[17] A. Mayevsky, H. Kutai-Asis, and M. Tolmasov, “Mitochon-
drial function and brain metabolic score (BMS) in ischemic
stroke: evaluation of "neuroprotectants" safety and efficacy,”
Mitochondrion, vol. 50, pp. 170–194, 2020.
[18] A. Cheng, W. Jia, I. Kawahata, and K. Fukunaga, “A novel fatty
acid-binding protein 5 and 7 inhibitor ameliorates oligoden-
drocyte injury in multiple sclerosis mouse models,”eBioMedi-
cine, vol. 72, article 103582, 2021.
[19] P. Dimas, L. Montani, J. A. Pereira et al., “CNS myelination
and remyelination depend on fatty acid synthesis by oligoden-
drocytes,”eLife, vol. 8, 2019.
[20] D. H. Meijer, M. F. Kane, S. Mehta et al., “Separated at birth?
The functional and molecular divergence of OLIG1 and
OLIG2,”Nature Reviews. Neuroscience, vol. 13, no. 12,
pp. 819–831, 2012.
[21] S. Zhang, Y. Wang, X. Zhu et al., “The Wnt effector TCF7l2
promotes oligodendroglial differentiation by repressing auto-
crine BMP4-mediated signaling,”The Journal of Neuroscience,
vol. 41, no. 8, pp. 1650–1664, 2021.
[22] K. Hayakawa, E. Esposito, X. Wang et al., “Transfer of mito-
chondria from astrocytes to neurons after stroke,”Nature,
vol. 535, no. 7613, pp. 551–555, 2016.
[23] M. Kosieradzki and W. Rowiński, “Ischemia/reperfusion
injury in kidney transplantation: mechanisms and preven-
tion,”Transplantation Proceedings, vol. 40, no. 10, pp. 3279–
3288, 2008.
[24] A. Masuzawa, K. M. Black, C. A. Pacak et al., “Transplantation
of autologously derived mitochondria protects the heart from
ischemia-reperfusion injury,”American Journal of Physiology.
Heart and Circulatory Physiology, vol. 304, no. 7, pp. H966–
H982, 2013.
[25] Z. Pourmohammadi-Bejarpasi, A. M. Roushandeh, A. Saberi
et al., “Mesenchymal stem cells-derived mitochondria trans-
plantation mitigates I/R-induced injury, abolishes I/R-induced
apoptosis, and restores motor function in acute ischemia
stroke rat model,”Brain Research Bulletin, vol. 165, pp. 70–
80, 2020.
[26] Z. Zhang, Z. Ma, C. Yan et al., “Muscle-derived autologous
mitochondrial transplantation: a novel strategy for treating
cerebral ischemic injury,”Behavioural Brain Research,
vol. 356, pp. 322–331, 2019.
[27] L. Rosko, V. N. Smith, R. Yamazaki, and J. K. Huang, “Oligo-
dendrocyte bioenergetics in health and disease,”The Neurosci-
entist, vol. 25, no. 4, pp. 334–343, 2019.
[28] J. L. Yang, S. Mukda, and S. D. Chen, “Diverse roles of mito-
chondria in ischemic stroke,”Redox Biology, vol. 16,
pp. 263–275, 2018.
[29] L. Montani, “Lipids in regulating oligodendrocyte structure
and function,”Seminars in Cell & Developmental Biology,
vol. 112, pp. 114–122, 2021.
[30] J. E. Rinholm, K. Vervaeke, M. R. Tadross et al., “Movement
and structure of mitochondria in oligodendrocytes and their
myelin sheaths,”Glia, vol. 64, no. 5, pp. 810–825, 2016.
8 Mediators of Inflammation
Available via license: CC BY 4.0
Content may be subject to copyright.
