Access to this full-text is provided by MDPI.
Content available from Applied Sciences
This content is subject to copyright.
Citation: D’Amico, E.; Pierfelice, T.V.;
Iezzi, G.; Di Pietro, N.; Lepore, S.;
Lorusso, F.; Scarano, A.; Pandolfi, A.;
Piattelli, A.; Petrini, M. Apigenin
Promotes Proliferation and
Mineralization of Human Osteoblasts
and Up-Regulates Osteogenic
Markers. Appl. Sci. 2022,12, 8510.
https://doi.org/10.3390/
app12178510
Academic Editor: Andrea Scribante
Received: 2 August 2022
Accepted: 23 August 2022
Published: 25 August 2022
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
Copyright: © 2022 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
applied
sciences
Article
Apigenin Promotes Proliferation and Mineralization of Human
Osteoblasts and Up-Regulates Osteogenic Markers
Emira D’Amico 1, † , Tania Vanessa Pierfelice 1 ,† , Giovanna Iezzi 1, Natalia Di Pietro 1,2 , Stefania Lepore 1,
Felice Lorusso 3, Antonio Scarano 3, Assunta Pandolfi 1,2 , Adriano Piattelli 4,5,6,7 and Morena Petrini 1, *
1Department of Medical, Oral and Biotechnological Sciences, University G. d’Annunzio of Chieti-Pescara,
66100 Chieti, Italy
2Center for Advanced Studies and Technology-CAST, University G. d’Annunzio of Chieti-Pescara,
66100 Chieti, Italy
3
Department of Innovative Technologies in Medicine & Dentistry, University G. d’Annunzio of Chieti-Pescara,
66100 Chieti, Italy
4School of Dentistry, Saint Camillus International University of Health and Medical Sciences, Via di
Sant’Alessandro 8, 00131 Rome, Italy
5Dental School, University of Belgrade, 11000 Belgrade, Serbia
6Fondazione Villa Serena per la Ricerca, 65013 CittàSant’Angelo, Italy
7Casa di Cura Villa Serena del Dott. L. Petruzzi, 65013 CittàSant’Angelo, Italy
*Correspondence: morena.petrini@unich.it; Tel.: +39-0871-355-4083
† These authors contributed equally to this work.
Abstract:
Apigenin (APG), a natural flavonoid compound with anti-inflammatory and antioxidative
properties, was found to promote
in vitro
osteogenic differentiation and to accelerate
in vivo
bone
formation, indicating APG as a promising molecule in bone repair, with potential clinical application
in bone-deficient conditions. In particular, in dentistry, it is fundamental to increase the available
bone volume for implant placement in the maxilla. Therefore, this study aims to investigate the
APG effects on osteoblasts (hOBs) obtained from a human jaw. hOBs were incubated with increasing
concentrations of APG (5, 10, 20
µ
M) to assess cell viability and morphology at 24 h and proliferation
at 48 and 72 h. Upon establishing the absence of cytotoxicity and any morphological changes, APG
showed a stimulating effect on cell growth, with significative results using 5
µ
M (5-APG) at 48 h.
Thus, 5-APG was chosen for further investigations in order to assess alkaline phosphate (ALP) at
7 days, mineralization at 14 days and expression of ALP, Osteocalcin (OCN) and Collagen 1 (COL1)
genes at 7 days. Our results showed that 5-APG accelerated osteoblast mineralization activities and
significantly upregulated ALP and COL1 gene expression. Hence, this study demonstrated that APG
is able to promote human oral osteoblasts proliferation and mineralization, suggesting its potential
usefulness in dentistry.
Keywords:
ALP; apigenin; calcium deposition; human oral osteoblasts; phenolic compounds;
proliferation
1. Introduction
Flavonoids are a group of natural polyphenol substances abundant in vegetables
and fruits. Flavonoids are common in human diets and have bioactive effects, such as
antimicrobial, anti-inflammatory and antioxidant properties, which reduce the risk of
disease. Apigenin (APG), a natural bioactive molecule (4
0
,5,7-trihydroxyflavone), is a
270 Da flavonoid widely distributed in many fruits and vegetables, such as oranges, parsley,
celery and garlic, and mostly in aromatic plants, such as chamomile, tea, mint and lotus [
1
].
APG is a substance contained in vegetables and plants in water-soluble glycosylated form,
but after a purification process, it appears as a chemically unstable yellow powder, insoluble
in water, moderately soluble in hot alcohol and soluble in dimethyl sulfoxide (DMSO) [
2
,
3
].
For this reason, APG needs to be stored in the dark at
−
20
◦
C. Apigenin has different
Appl. Sci. 2022,12, 8510. https://doi.org/10.3390/app12178510 https://www.mdpi.com/journal/applsci
Appl. Sci. 2022,12, 8510 2 of 12
biological effects, including improvement in the cancer cell response to chemotherapy,
anti-cancer effects, anti-platelet activity and modulation of the immune cell function
[4–7].
Studies showed that APG decreases inflammation and pain by inhibiting different cellular
processes and pro-inflammatory pathways [
8
–
10
]. Significant evidence has shown the
protective role of apigenin against metabolic disease and diabetes [
11
]. In particular,
apigenin significantly decreases lipid accumulation, total intracellular cholesterol (TC) and
intracellular triglyceride (TG) levels, through different mechanisms.
Firstly, APG is able to contrast obesity by up-regulating the expression of anorexigenic
neuropeptides pro-opiomelanocortin (POMC) and cocaine- and amphetamine-related
transcript (CART), which inhibit the food consumption [
11
,
12
]. APG is able to activate
lipolysis-related genes and to induce fatty acid oxidation [
11
]. Moreover,
in vitro
and
in vivo
studies have shown that APG regulates lipid metabolism by stimulation of PPAR
γ
signaling that inhibits adipocyte differentiation and the subcutaneous injection of this
molecule in obese mouse models reduced visceral fat mass [12–14].
The positive effects of APG against metabolic disease are also connected to beneficial
effects of this molecule in type 2 diabetes mellitus (T2DM), obesity and inflammation [
15
].
In particular, APG is able to decrease insulin resistance, to reduce abnormal glycolipid
metabolism, and to alleviate oxidative stress [
11
,
16
]. Moreover, APG blocks the progression
of T2DM by promoting
α
-amylase inhibition, with a consequent reduction in dietary
carbohydrate digestion and glucose absorption delay [17].
The anti-oxidative effects of APG are exerted by the induction of catalase, the inhibition
of advanced glycation end products (AGEs), and the Regulation of Keap1-Nrf2 signal-
ing [
18
]. Catalase is an enzyme that catalyzes the decomposition of hydrogen peroxide into
water and molecular oxygen. Other effects of APG are beneficial for hypertension, such as
the reduction in oxidative stress, the inhibition of NF-
κ
B activation, the improvement in
NO bioactivity, the regulation of apoptosis-related mitochondrial genes and the promotion
of vasodilation in vascular endothelium [11,19].
In the oral cavity, APG accelerated the healing of oral mucositis induced in hamsters
through the application of 5-fluorouracil [20].
Another important action of APG is the inhibitory effect on cell survival and apoptotic
effect in oral cancer cells. The apoptosis in squamous cell carcinoma of the oral tongue
(SCC-25) cells by APG, also determined the cell cycle arrest acting as a CDK1 inhibitor and
inducing a decrease in cyclin D1 expression [
21
]. Further, Silvan et al. showed the inhibitory
action of APG against induced oral carcinogenesis using topical application of 0.5% DMBA
on hamsters [
22
]. The effects of APG were improvements in antioxidant defense mechanism
and the modulation of the activities of phase I and phase II detoxification cascade toward
increased excretion of active metabolites of DMBA [22].
Concerning the bone physiology, apigenin seems to exhibit various functions [
23
].
Interestingly, in an animal study, APG had a protective effect counteracting osteoporosis
progress, indicating its role in the skeletal system [
24
]. Among natural compounds that
showed positive effects on bone metabolism, APG was also found to improve new bone
formation and accelerate fracture healing
in vivo
[
25
,
26
]. Previously, it was reported
that APG increased the growth and differentiation of osteoblastic MC3T3-E1 cells and
decreased the TNF-
α
-induced production of IL-6 and nitric oxide (NO) in osteoblasts [
9
]. It
appears that APG affects all stages of osteoclastogenesis, including inhibition of osteoclast
differentiation, osteoclast survival and bone resorption [
27
].
In vitro
results suggested that
this molecule attenuated oxidative-induced cell damage in osteoblastic cells, showing a
protective effect [
28
]. Moreover, a recent study reported that APG facilitated reparative
dentin formation through the modulation of inflammation and the activation of signaling
regulations, revealing its potential therapeutic aspect for regenerating dentin in exposed
pulp caused by dental caries and traumatic injury [29].
Thus, apigenin is a bioactive flavonoid with multiple functions toward bone metabolism
that could be a potential therapeutic candidate for clinical challenges where the availability
of an adequate quantity of bone is a prerequisite. Inadequate alveolar bone height is a
Appl. Sci. 2022,12, 8510 3 of 12
common problem for dental implant placement in posterior maxilla [
30
]. A variety of
surgical techniques has been applied and various bone substitutes have been developed to
reconstruct the posterior maxilla when bone volume is insufficient [
31
]. Considering the
multiple effects previously described on bone metabolism, APG might represent a promis-
ing active agent to enhance the formation of new bone in maxillary surgery and might
offer a new strategy for clinical bone regeneration. Nevertheless, having different crucial
implications on bone health, there are a limited number of
in vitro
studies on apigenin
and even less on the effects of apigenin in oral apparatus. Considering the implication of
bone-related diseases in dentistry fields and that the bone regeneration as well as good
osseintegration represent a challenge, a study on the effects of molecules, such as apigenin,
on oral osteoblasts might be a good starting point for developing new tools, considering
that apigenin is a natural safe molecule. Thus, the aim of this work was to evaluate the
effects of different concentrations of APG on human oral osteoblasts (hOBs).
In the present study, hOBs were isolated from human biopsies, cultured
in vitro
and
incubated with APG to assess the viability, the proliferation, the morphology, calcium
deposition and the ALP activity in cells. Then, to confirm the mineralization activity of
hOBs, the gene expression of key osteoblastic genes, such as osteocalcin (OCN), collagen 1
(COL1) and alkaline phosphate (ALP), was further investigated.
2. Materials and Methods
2.1. Experimental Design
Human oral osteoblasts were extracted from bone biopsies, obtained from n
o
12 vol-
unteers managed at the dental clinic of the G. D’Annunzio University according to the
protocol approved by Ethics Committee of University of Chieti-Pescara (reference numbers:
BONEISTO N. 22-10.07.2021). Inclusion criteria were as follows: patients aged between
18 and 60 with controlled oral hygiene subjected to routine dental practice, while exclu-
sion criteria were patients with systemic diseases, with an history of osteoporosis and
subjected to a therapy that interferes with bone metabolism and heavy smokers (more
than 10 cigarettes/day). The cells were incubated with APG at different concentrations
(5, 10, 20
µ
M). The effects of APG were assessed on lactate dehydrogenase (LDH) release,
morphology, cell proliferation, ALP levels, mineralization activity and gene expression of
ALP, OCN and COL-1.
2.2. Cell Culture and Treatments
The protocol used to extract primary oral osteoblasts (hOBs) from bone biopsies was
based on the study of Pierfelice TV et al., 2022 [
32
]. Briefly, after sampling, bone fragments
were subjected to three enzymatic digestions at 37
◦
C for 20, 30 and 60 min using a solution
consisting of collagenase type 1A (Sigma-Aldrich, St. Louis, MO, USA) and trypsin-EDTA
0.25% (Sigma-Aldrich, St. Louis, MO, USA) dissolved in Dulbecco’s Modified Eagle’s
medium (DMEM, Corning, New York, NY, USA) at 10% fetal bovine serum (FBS, Gibco-
Life Technologies, Monza, Italy). This solution was centrifuged at 1200 rpm for 10 min and
the pellet obtained was transferred into a T25 culture flask with low-glucose (1 g/L) DMEM
supplemented with 10% FBS, 1% antibiotics (100
µ
g/mL
−1
streptomycin and 100 IU/mL
−1
penicillin) and 1% L-glutamine (Corning, New York, NY, USA) at 5% CO
2
and 37
◦
C. Cells
were used between the 3rd and the 5th passage upon the characterization by cytometric
analysis. After the seeding, cells were treated with APG (apigenin
≥
95.0% (HPLC) Sigma-
Aldrich, St. Louis, MO, USA) at 5
µ
M (5-APG), 10
µ
M, 20
µ
M concentrations. Because
of poor aqueous solubility, APG was previously dissolved in DMSO (Sigma-Aldrich, St.
Louis, MO, USA) to achieve these concentrations. Treated cells with dimethyl sulfoxide
(DMSO) were considered as control (CTRL). DMSO final concentration was established at
0.1% in all tested samples.
Appl. Sci. 2022,12, 8510 4 of 12
2.3. Cytotoxicity Assay
Cells were seeded into 96-well plates at a density of 1
×
10
4
cells/well and treated
with 5, 10, 20
µ
M of APG for 24 h. The supernatant was collected from each well and the
activity of released LDH was determined using cytotoxicity detection kit LDH (Roche,
Basilea, Swiss) according to manufacturer’s protocol. Cytotoxicity was calculated as follows:
cytotoxicity (%) = (test substance −low control) / (high control −low control) ×100.
2.4. Toluidine Blue Staining
Next, 2
×
10
4
cells/well were seeded and incubated with 5
µ
M of APG for 24 h. Before
staining, cells were fixed with ice-cold 70% ethanol for 10 min and after rinsing three times
with distilled water, cells were stained with toluidine blue (1 mg/mL) (Sigma-Aldrich, St.
Louis, MO, USA) and 1% borax ((Sigma-Aldrich, St. Louis, MO, USA) for 7 min. Then, the
cells were washed with distilled water several times and were examined under microscope.
Images were taken using a stereo microscopy connected with a camera at 6
×
and 40
×
(Leica, Wild Heer-brugg, Wetzlar, Germany).
2.5. Proliferation Assay
The proliferation of hOB cells was determined by CellTiter96-assay (MTS, Promega,
Madison, WI, USA). In brief, cells were plated at a density of 1
×
10
4
cells/well in 96-well
plates and incubated overnight. Next day, cells were treated with APG at previously indi-
cated concentrations for 48 h and 72 h. To examine cell proliferation, 10
µ
L of MTS solution
was added to each well. The absorbance was recorded at 490 nm with a spectrometer
(Synergy H1 Hybrid BioTek Instruments, Winooski, VT, USA) and the cell proliferation rate
was calculated as percentages with respect to control.
2.6. ALP Assay
ALP assay kit colorimetric AB83369 (Abcam Inc, Cambridge, UK) was used to evaluate
ALP activity. Thus, 5
×
10
4
cells/well were seeded in 24-well culture plates and treated
with 5
µ
M of APG. Cell lysate was obtained after 7 days of culture washing three times
with PBS, resuspending in assay buffer and finally homogenizing cell suspension through
Tissue Rupture device (QIAGEN, Hilden, Germany). This solution was centrifugated at
10,000
×
gfor 15 min and the supernatant was collected. Then, the relative ALP activity
was measured according to manufacturer instructions. The absorbance was measured at
450 nm by a microplate reader (Synergy H1 Hybrid BioTek Instruments, Winooski, VT,
USA).
2.7. Alizarin Red Staining and Quantification of Calcium Deposition
Next, 5
×
10
4
cells/well were seeded into 24-well culture plate and after 14 days of
culture, hOBs were fixed with glutaraldehyde solution (2.5%) for 2 h. Calcium deposition
was evaluated in adherent cells, by adding to the culture, the Alizarin Red staining solution
(Sigma-Aldrich, St. Louis, MO, USA) for 1 h at room temperature. The excess dye was
removed using deionized water. The intensity of the red color pointed to the presence of
calcium deposits. Images were taken by a stereomicroscope connected with a camera at a
magnification of 3
×
(Leica, Wetzlar, Germany). Furthermore, Cetylpyridinium Chloride
(CPC) was used to quantify calcium nodules. Then, 1 mL of 10% CPC solution was added
to the cells (Sigma-Aldrich, St. Louis, MO, USA) for 1 h to chelate calcium ions. After
incubation, the absorbance was read at 540 nm by a microplate reader (Synergy H1 Hybrid
BioTek Instruments).
2.8. Gene Expression
Total RNA was isolated in cells (1
×
10
6
cells) treated with 5
µ
M of APG for 7 days
using Trifast reagent (EuroClone, Pero (MI), Italy) according to the manufacturer. GoTaq®
2 Step RT-qPCR Kit (Promega, Madison, WI, USA) was used to obtain complementary
DNA (cDNA) in accordance with the manufacturer’s instructions. RT-qPCR was carried
Appl. Sci. 2022,12, 8510 5 of 12
out using SYBR Green (GoTaq
®
2 Step RT-qPCR Kit, Promega). The mixes were prepared
by combining each cDNA sample with 1
µ
L cDNA, 0.2
µ
L of primers mixture and 5
µ
L of
master mix in a final volume of 10
µ
L. Then, mixes were plated in 96-well plate and gene
expression was determined using Quant Studio 7 Pro Real-Time PCR System (ThermoFisher,
Waltham, MA, USA). The results were normalized to
β
-actin (
β
ACT) using the 2
−∆∆Ct
method. Primer sequences are reported in Table 1.
Table 1. Primer sequences used in RT-qPCR.
Gene Forward Primer (50-30) Reverse Primer (50-30)
ALP
OCN
COL1
AATGAGTGAGTGACCATCCTGG
TCAGCCAACTCGTCACAGTC
AGTCAGAGTGAGGACAGTGAATTG
GCACCCCAAGACCTGCTTTAT
GGCGCTACCTGTATCAATGG
CACATCACACCAGGAAGTGC
βACT CCAGAGGCGTACAGGGATAG GAGAAGATGACCCAGGACTCTC
2.9. Statistical Analysis
GraphPad Prism8 (GraphPad Software, San Diego, CA, USA) was used for statistical
analysis of the results. Differences between groups were assessed with one-way analysis
of variance (ANOVA) for cytotoxicity and proliferation assays. For the further experi-
ments t-test was performed to compare the statistical differences between test group and
control group. A p< 0.05 was considered statistically significant. Data are presented as
mean ±standard deviation (SD) from at least three biologically repeated experiments.
3. Results
3.1. Apigenin Showed No Significant Effects on Cell Viability and Morphology of hOBs
The exposition to increasing concentrations of APG (5, 10 and 20
µ
M) for 24 h resulted
in no cytotoxicity for osteoblasts (Figure 1).
Figure 1.
Effects of APG treatment (24 h) on LDH release. Values represent mean
±
SD expressed in
percentages compared to control (CTRL).
APG at 5
µ
M produced a lower level of LDH release compared to untreated cells
(CTRL) and compared to the other concentrations. However, the result for 5
µ
M was
not statistically significant. The results of LDH assay were confirmed from the analysis
of morphology, which was investigated only for the concentration of 5
µ
M (5-APG) at
24 h, because LDH release showed no differences at higher concentrations 10 and 20
µ
M.
Microscopically no morphological differences (Figure 2B) were seen in comparison to the
control cells (Figure 2A). As illustrated in Figure 2, cells appeared spindle shaped and well
spread, better seen at higher magnification 40×(Figure 2C,D).
Appl. Sci. 2022,12, 8510 6 of 12
Figure 2.
Effects of APG at 5
µ
M (5-APG) for 24 h on cell morphology, evaluated by toluidine blue
staining. Cells were observed using a stereomicroscope at the magnification of 6
×
(
A
,
B
) and 40
×
(
C
,
D
).
3.2. Apigenin Promoted Proliferation of hOBs
Based on the results of LDH assay and morphology observations, proliferative rate of
cells treated with APG was evaluated at 48 h and 72 h. At 48 h, APG stimulated cell growth
at all concentrations. In addition, the response of the cells was inversely proportional to the
concentrations. In particular, the highest and most statistically significant rate was found
when hOBs were treated with 5
µ
M compared to CTRL. A similar trend was observed
when cells were incubated with APG for 72 h. However, just at 5
µ
M, cell growth resulted
were enhanced, while at the higher 10 and 20
µ
M concentrations, cell growth appeared like
the control; thus, any increment in the proliferation was observed at these concentrations
(Figure 3).
Figure 3.
Effects of APG, used at increasing concentration for 48 h and 72 h, on hOBs proliferation
determined using MTS assay. Data are expressed as percentages with respect to the control. Statistical
analysis was performed by ANOVA test (* p< 0.05 compared to CTRL).
3.3. Apigenin Increased ALP Activity
Considering the results of LDH, morphology and cellular proliferation, ALP activity
was evaluated only for APG at 5
µ
M (5-APG). The effects of 5-APG on hOBs were analyzed
Appl. Sci. 2022,12, 8510 7 of 12
by cellular ALP activity. As shown in Figure 4, when the enzymatic activity of the cellular
lysates was estimated at 7 days, a statistically significant increment was observed in hOBs
treated with 5-APG with respect of CTRL.
Figure 4.
Effects of apigenin at 5
µ
M (5-APG) for 7 days on the alkaline phosphatase activity (ALP).
Data are presented as the mean
±
SD and are expressed as percentages over the control (cells not
treated with APG) (*** p< 0.0001).
3.4. Apigenin Stimulated Mineral Deposition
When hOBs were incubated with 5
µ
M of APG, mineralization appeared stimulated
with more mineralized nodules that can be well observed. These results were confirmed by
the quantification of the calcium deposition. The images of the Alizarin Red staining (ARS)
showed that a significant higher calcium nodule formation was found with 5
µ
M-APG. At
14 days, the calcified nodules appeared denser in wells where osteoblasts were incubated
with 5-APG (Figure 5B) than in CTRL (Figure 5A). Moreover, quantitative analysis showed
that treatment with APG significantly increased calcium deposition compared to CTRL
(Figure 5C).
Figure 5.
Effects of APG at 5
µ
M (5-APG) for 14 days on mineralization (
A
,
B
). Calcium nodules
appeared bright red in color by Alizarin Red staining. (
C
) Calcium deposition was quantified by CPC.
The comparison of data between controls and test group showed significant difference (*** p< 0.0001).
3.5. Apigenin Up-Regulated Mineralization-Related Markers
The expression of osteoblast marker genes ALP, OCN and COL1, evaluated by RT-
qPCR, resulted in significantly higher hOBs treated with APG (5
µ
M) than in CTRL, as
shown in Figure 6. The ALP expression resulted in the most up-regulated (Figure 6A)
followed by COL1 (Figure 6C) and then by OCN (Figure 6B).
Appl. Sci. 2022,12, 8510 8 of 12
Figure 6.
Effects of 5
µ
M of APG (5-APG) on gene expression. ALP (alkaline phosphate) (
A
), OCN
(osteocalcin) (
B
), COL1 (collagen 1) (
C
) gene expression was evaluated after 7 days of treatment.
Results are reported as mean expression values normalized on the housekeeping
β
-actin in triplicate
with error bars representing the SD (** p< 0.001; *** p< 0.0001).
4. Discussion
In the present study, the biological effects of APG, a natural flavone with antioxidant
and anti-inflammatory properties [
9
,
10
,
28
], were explored on oral osteoblasts cultured from
human biopsies.
APG, thereby, might be considered as a potential active phytochemical compound to
develop a therapeutic strategy for clinical practice. The bioactivity and biological effects of
APG are dependent on its chemical structure: the inhibition of
α
-glucosidase and
α
-amylase
is induced by the double bonds in the two aromatic rings and hydroxyl groups on C-7 and
C-4
0
[
33
]; the immunomodulatory properties are exerted by the C-4
0
hydroxyl group in ring
B [
34
]; the Liver X receptor activation is induced by the hydroxyl radicals at position 5, 7
and 4
0
[
35
]. The aim of this study was to evaluate whether APG could be further considered
as a bioactive agent capable of promoting bone regeneration for clinical applications in
dentistry. In particular, APG could be beneficial to increase the osteoinductive properties
in a bone graft mixed with other heterologous biomaterials. Treatment with APG (5, 10,
20
µ
M) did not affect the viability of hOBs, indicating that apigenin has no cytotoxicity for
these cells. This result was confirmed by the images of the morphology study at 24 h, in
which any morphological changes were detected in osteoblasts, which appeared typically
shaped. Moreover, 5
µ
M APG slightly enhanced the cell metabolic activity, indicating a
pro-proliferative effect at this concentration. Therefore, a proliferation study was performed
at 48 h and 72 h after the hOBs were incubated with APG at concentrations of 5, 10 and
20
µ
M. At 48 h, APG stimulated cell proliferation at all concentrations, in a dose-dependent
manner, where the response resulted inversely to the concentration and the highest and
most statistically significant growth was observed in hOBs incubated with 5
µ
M APG
compared to control cells. These results are in accordance with previous studies; indeed,
APG was found to promote osteogenic differentiation
in vitro
and accelerate bone formation
in vivo
, indicating that APG may be a promising activator for bone repair [
25
]. APG has
been reported to improve bone loss in ovariectomized rats [
24
]. In addition, 5
µ
M APG
was able to stimulate cell proliferation also at 72 h, but the result was not significative.
Thus, the lower concentration, 5
µ
M apigenin, seems to be the suitable concentration and
this represents a strength to prevent potential adverse side effects related to higher-dose
administration [
36
]. In a study with a murine model, higher doses of apigenin (100 or
200 mg/kg) caused damage to the the liver histoarchitecture, increased ALT, AST, ALP, ROS,
ratio of oxidized to reduced glutathione (GSSG/GSH) and LPO [
37
]. A previous
in vitro
study reported that higher concentrations (>50
µ
M) of apigenin induced intracellular ROS
accumulation with consequent cell death [38].
Based upon the results of cytotoxicity, morphology and proliferation study, APG at
a concentration of 5
µ
M (5-APG) was selected for further investigations concerning the
formation of the mineralized extracellular matrix. Thus, the activity of the ALP was as-
sessed as the early phenotypic marker for mature osteoblasts, while the mineralized nodule
Appl. Sci. 2022,12, 8510 9 of 12
formation as a phenotypic marker for the later stage. The results indicated that APG (5
µ
M)
significantly increased activity of ALP at 7 days and the mineralized nodule formation at
14 days, suggesting that apigenin accelerates mineralization in osteoblasts. Based on the
results of ALP activity and mineralized nodule formation, APG was verified to promote
marker genes that are involved in the bone mineralization, OCN, COL1 and ALP. It was
found that other phenolic compounds favored bone preservation and repair by increasing
the expression of genes related to osteoblastogenesis, including RUNX-2, OSX, COL1, OSC
and ALP [
39
]. In the present study, the expression of examined genes, mainly ALP and
COL1, resulted in up-regulation after treatment with 5
µ
M APG. Considering that other
phenolic compounds were found to stimulate bone tissue regeneration by acting on the
bone morphogenetic protein (BMP) signaling pathway and that BMPs, in turn, act on the
expression of bone-related genes, such as ALP [
40
–
42
], this pathway might be a possible
molecular mechanism underlying the activity of apigenin in bone. Recently, the correlation
between nutrients and bone health focused the attention of researchers to highlight the
flavonoids from diet as important factors able to affect bone physiology [
26
,
43
]. Taken
together, the data in the present study suggest that apigenin, a flavonoid compound, may
have a beneficial effect on oral bone physiology, favoring osteoblast activities. These find-
ings suggest that apigenin might provide insights into the development of tools useful
for bone formation during clinical procedures, such as maxillary sinus floor elevation. In
dentistry fields, apigenin might be taken into account for different aspects considering that
the ideal periodontal biomaterials should fight against pathogenic bacteria and promote
bone regeneration in bone reconstruction lesions or in bone defects. The antibacterial
activities of apigenin against various Gram-negative and -positive bacterial species were
reported [
44
]. Studies strongly recommend apigenin because of its antibacterial activities
for the treatment of oral bacteria. These studies also showed the better effectiveness of
antibiotics in combination with apigenin against these bacteria as compared to antibiotic
treatment alone, indicating a synergic effect between apigenin and antibiotics [
44
,
45
]. An-
tiviral activities of apigenin were reported against different viruses [
46
,
47
]. Apigenin, due
to its multiple properties, might be taken into account also for tissue engineering scaffolds
in maintaining space, in supporting cell attachment and proliferation after being grafted
to a bone defect. Indeed, tissue engineering scaffolds are developed in combination with
growth factors or stem cells, as well as antibacterial components to improve osteoinduction,
osteogenesis and antibacterial activity of bone grafting [48].
The beneficial effects of apigenin, on oral osteoblasts, here demonstrated, in addition
to the already known other biological properties of apigenin [
1
,
7
], might potentially make
apigenin a multifunctional bioactive agent, helping different situations in the dentistry field,
considering that apigenin is a natural molecule, safe, with a very low risk of toxicity. Current
treatment options for bone-related diseases, consisting of antiresorptive agents (such as
bisphosphonates, hormone-replacement therapy, selective estrogen-receptor modulators
and anti-RANKL antibodies) and/or anabolic agents (such as intermittent low doses of
teriparatide and antisclerostin antibodies), are not free from adverse effects that limit their
use [
49
]. Thus, the beneficial properties of apigenin on oral osteoblasts include that it is a
natural molecule, safe, representing its strength for future use in the dentistry field, in which
bone regeneration and new bone formation represent a challenge. The limit of APG clinical
application is its poor solubility. At present, to overcome this limit, some approaches to
nanoparticle drug carriers have been formulated to improve the solubility, dissolution and
the oral bioavailability of APG [
50
]. In the dentistry field, this limit of apigenin might not
represent an obstacle, in the development of tools useful to improve osteoconductivity and
osseointegration, for example, as coatings on dental implant surfaces or to favor dental
restorations by incorporating apigenin into dental composites. A strength of our study
is that the lowest concentration here used, 5
µ
M, resulted in a suitable concentration to
improve the biological functions of oral osteoblasts and this represents a strength to prevent
potential adverse side effects related to higher doses [
36
–
38
]. Further
in vitro
investigation
is required to clarify the detailed molecular mechanisms underlying the activity of apigenin
Appl. Sci. 2022,12, 8510 10 of 12
in the bone of the oral cavity and further
in vivo
investigations are needed to verify a
possible clinical application.
5. Conclusions
In conclusion, this study showed that apigenin promotes bone-forming osteoblasts
through stimulating proliferative and mineralization activities and up-regulating osteogenic
markers. Thus, the next step in our research will be to test apigenin as a dental implant
coating to favor osseointegration, which represents a challenge in the dentistry field.
Author Contributions:
Conceptualization, M.P., G.I.; methodology, T.V.P., E.D.; validation, M.P., G.I.,
A.P. (Adriano Piattelli); formal analysis, N.D.P., F.L., A.S.; investigation, T.V.P., E.D., S.L.; resources,
G.I., M.P., A.P. (Assunta Pandolfi); data curation, T.V.P., E.D.; writing—original draft preparation,
T.V.P., E.D., M.P.; writing—review and editing, G.I., A.P. (Adriano Piattelli), A.P. (Assunta Pandolfi),
A.S., N.D.P., F.L.; supervision, M.P., G.I., A.P. (Adriano Piattelli). All authors have read and agreed to
the published version of the manuscript.
Funding:
This work was supported by G.I., M.P. FAR GRANT University of Chieti–Pescara Fund; by
Assunta Pandolfi PON-MISE Sustainable Growth Funding-DD 27 September 2018 (Grant Number:
21, ex 230).
Institutional Review Board Statement:
The study was conducted in accordance with the Declaration
of Helsinki and approved by Ethics Committee of University G. d’Annunzio of Chieti-Pescara
(reference numbers: BONEISTO N. 22-10.07.2021).
Informed Consent Statement:
Informed consent was obtained from all subjects involved in the
study.
Data Availability Statement: Not applicable.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
Abid, R.; Ghazanfar, S.; Farid, A.; Sulaman, S.M.; Idrees, M.; Amen, R.A.; Muzammal, M.; Shahzad, M.K.; Mohamed, M.O.;
Khaled, A.A.; et al. Pharmacological Properties of 4
0
,5,7-Trihydroxyflavone (Apigenin) and Its Impact on Cell Signaling Pathways.
Molecules 2022,27, 4304. [CrossRef]
2.
Saldanha, E.; Pai, R.J.; George, T.; D’Souza, S.; Adnan, M.; Pais, M.; Naik, T.; D’Souza, R.C.C.; D’Cunha, R.; Shrinath Baliga, M.
Health Effects of Various Dietary Agents and Phytochemicals (Therapy of Acute Pancreatitis). Ther. Probiotic Unconv. Foods
2018
,
303–314. [CrossRef]
3.
Švehlíková, V.; Bennett, R.N.; Mellon, F.A.; Needs, P.W.; Piacente, S.; Kroon, P.A.; Bao, Y. Isolation, Identification and Stability of
Acylated Derivatives of Apigenin 7-O-Glucoside from Chamomile (Chamomilla recutita [L.] Rauschert). Phytochemistry
2004
,65,
2323–2332. [CrossRef]
4.
Yan, X.; Qi, M.; Li, P.; Zhan, Y.; Shao, H. Apigenin in Cancer Therapy: Anti-Cancer Effects and Mechanisms of Action. Cell Biosci.
2017,7, 50. [CrossRef]
5.
Jang, J.Y.; Sung, B.; Kim, N.D. Role of Induced Programmed Cell Death in the Chemopreventive Potential of Apigenin. Int. J. Mol.
Sci. 2022,23, 3757. [CrossRef]
6.
Navarro-Núñez, L.; Lozano, M.L.; Palomo, M.; Martínez, C.; Vicente, V.; Castillo, J.; Benavente-García, O.; Diaz-Ricart, M.; Escolar,
G.; Rivera, J. Apigenin Inhibits Platelet Adhesion and Thrombus Formation and Synergizes with Aspirin in the Suppression of
the Arachidonic Acid Pathway. J. Agric. Food Chem. 2008,56, 2970–2976. [CrossRef]
7.
Salehi, B.; Venditti, A.; Sharifi-Rad, M.; Kr˛egiel, D.; Sharifi-Rad, J.; Durazzo, A.; Lucarini, M.; Santini, A.; Souto, E.B.; Novellino, E.;
et al. The Therapeutic Potential of Apigenin. Int. J. Mol. Sci. 2019,20, 1305. [CrossRef]
8.
Rezai-Zadeh, K.; Ehrhart, J.; Bai, Y.; Sanberg, P.R.; Bickford, P.; Tan, J.; Douglas, R.D. Apigenin and Luteolin Modulate Microglial
Activation via Inhibition of STAT1-Induced CD40 Expression. J. Neuroinflamm. 2008,5, 41. [CrossRef]
9.
Hu, W.; Wang, X.; Wu, L.; Shen, T.; Ji, L.; Zhao, X.; Si, C.L.; Jiang, Y.; Wang, G. Apigenin-7-O-
β
-D-Glucuronide Inhibits LPS-
Induced Inflammation through the Inactivation of AP-1 and MAPK Signaling Pathways in RAW 264.7 Macrophages and Protects
Mice against Endotoxin Shock. Food Funct. 2016,7, 1002–1013. [CrossRef]
10.
Yano, S.; Umeda, D.; Maeda, N.; Fujimura, Y.; Yamada, K.; Tachibana, H. Dietary Apigenin Suppresses IgE and Inflammatory
Cytokines Production in C57BL/6N Mice. J. Agric. Food Chem. 2006,54, 5203–5207. [CrossRef]
11.
Xu, Y.; Li, X.; Wang, H. Protective Roles of Apigenin Against Cardiometabolic Diseases: A Systematic Review. Front. Nutr.
2022
,9,
875826. [CrossRef]
Appl. Sci. 2022,12, 8510 11 of 12
12.
Su, T.; Huang, C.; Yang, C.; Jiang, T.; Su, J.; Chen, M.; Fatima, S.; Gong, R.; Hu, X.; Bian, Z.; et al. Apigenin Inhibits STAT3/CD36
Signaling Axis and Reduces Visceral Obesity. Pharmacol. Res. 2020,152, 104586. [CrossRef]
13.
Ono, M.; Fujimori, K. Antiadipogenic Effect of Dietary Apigenin through Activation of AMPK in 3T3-L1 Cells. J. Agric. Food
Chem. 2011,59, 13346–13352. [CrossRef]
14.
Guo, X.; Liu, J.; Cai, S.; Wang, O.; Ji, B. Synergistic Interactions of Apigenin, Naringin, Quercetin and Emodin on Inhibition of
3T3-L1 Preadipocyte Differentiation and Pancreas Lipase Activity. Obes. Res. Clin. Pract. 2016,10, 327–339. [CrossRef]
15.
Solini, A.; Suvan, J.; Santini, E.; Gennai, S.; Seghieri, M.; Masi, S.; Petrini, M.; D’Aiuto, F.; Graziani, F. Periodontitis Affects
Glucoregulatory Hormones in Severely Obese Individuals. Int. J. Obes. 2019,43, 1125–1129. [CrossRef]
16. Taylor, R. Type 2 Diabetes. Diabetes Care 2013,36, 1047–1055. [CrossRef]
17.
Zhang, B.; Li, X.; Sun, W.; Xing, Y.; Xiu, Z.; Zhuang, C.; Dong, Y. Dietary Flavonoids and Acarbose Synergistically Inhibit
α-Glucosidase and Lower Postprandial Blood Glucose. J. Agric. Food Chem. 2017,65, 8319–8330. [CrossRef]
18.
Lee, J.N.; Dutta, R.K.; Maharjan, Y.; Liu, Z.; Lim, J.-Y.; Kim, S.-J.; Cho, D.-H.; So, H.-S.; Choe, S.-K.; Park, R. Catalase Inhibition
Induces Pexophagy through ROS Accumulation. Biochem. Biophys. Res. Commun. 2018,501, 696–702. [CrossRef]
19.
Ren, B.; Qin, W.; Wu, F.; Wang, S.; Pan, C.; Wang, L.; Zeng, B.; Ma, S.; Liang, J. Apigenin and Naringenin Regulate Glucose and
Lipid Metabolism, and Ameliorate Vascular Dysfunction in Type 2 Diabetic Rats. Eur. J. Pharmacol. 2016,773, 13–23. [CrossRef]
20.
Molina Prats, P.; Gómez Garcia, F.; Martinez Diaz, F.; Amaral Mendes, R.; Lopez-Jornet, P. The Therapeutic Effects of Apigenin
and Dexamethasone on 5-Fluorouracil-Induced Oral Mucositis—A Pilot Study Using a Syrian Hamster Model. J. Oral Pathol.
Med. 2017,46, 142–147. [CrossRef]
21.
Maggioni, D.; Garavello, W.; Rigolio, R.; Pignataro, L.; Gaini, R.; Nicolini, G. Apigenin Impairs Oral Squamous Cell Carcinoma
Growth in Vitro Inducing Cell Cycle Arrest and Apoptosis. Int. J. Oncol. 2013,43, 1675–1682. [CrossRef]
22.
Silvan, S.; Manoharan, S.; Baskaran, N.; Anusuya, C.; Karthikeyan, S.; Prabhakar, M.M. Chemopreventive Potential of Apigenin
in 7,12-Dimethylbenz(a)Anthracene Induced Experimental Oral Carcinogenesis. Eur. J. Pharmacol.
2011
,670, 571–577. [CrossRef]
23.
Ramesh, P.; Jagadeesan, R.; Sekaran, S.; Dhanasekaran, A.; Vimalraj, S. Flavonoids: Classification, Function, and Molecular
Mechanisms Involved in Bone Remodelling. Front. Endocrinol. 2021,12, 1564. [CrossRef]
24.
Park, J.A.; Ha, S.K.; Kang, T.H.; Oh, M.S.; Cho, M.H.; Lee, S.Y.; Park, J.H.; Kim, S.Y. Protective Effect of Apigenin on Ovariectomy-
Induced Bone Loss in Rats. Life Sci. 2008,82, 1217–1223. [CrossRef]
25.
Pan, F.F.; Shao, J.; Shi, C.J.; Li, Z.P.; Fu, W.M.; Zhang, J.F. Apigenin Promotes Osteogenic Differentiation of Mesenchymal Stem
Cells and Accelerates Bone Fracture Healing via Activating Wnt/
β
-Catenin Signaling. Am. J. Physiol. Endocrinol. Metab.
2021
,320,
E760–E771. [CrossRef]
26.
Mandatori, D.; Penolazzi, L.; Pelusi, L.; Lambertini, E.; Michelucci, F.; Porreca, A.; Cerritelli, P.; Pipino, C.; di Iorio, A.; Bruni, D.;
et al. Three-Dimensional Co-Culture System of Human Osteoblasts and Osteoclast Precursors from Osteoporotic Patients as an
Innovative Model to Study the Role of Nutrients: Focus on Vitamin K2. Nutrients 2021,13, 2823. [CrossRef]
27.
Bandyopadhyay, S.; Lion, J.M.; Mentaverri, R.; Ricupero, D.A.; Kamel, S.; Romero, J.R.; Chattopadhyay, N. Attenuation of
Osteoclastogenesis and Osteoclast Function by Apigenin. Biochem. Pharmacol. 2006,72, 184–197. [CrossRef]
28.
Jung, W.W. Protective Effect of Apigenin against Oxidative Stress-Induced Damage in Osteoblastic Cells. Int. J. Mol. Med.
2014
,
33, 1327–1334. [CrossRef]
29.
Aryal, Y.P.; Yeon, C.Y.; Kim, T.Y.; Lee, E.S.; Sung, S.; Pokharel, E.; Kim, J.Y.; Choi, S.Y.; Yamamoto, H.; Sohn, W.J.; et al. Facilitating
Reparative Dentin Formation Using Apigenin Local Delivery in the Exposed Pulp Cavity. Front. Physiol.
2021
,12, 2157. [CrossRef]
30.
Avila-Ortiz, G.; Neiva, R.; Galindo-Moreno, P.; Rudek, I.; Benavides, E.; Wang, H.L. Analysis of the Influence of Residual Alveolar
Bone Height on Sinus Augmentation Outcomes. Clin. Oral Implant. Res. 2012,23, 1082–1088. [CrossRef]
31.
Bathla, S.C.; Fry, R.R.; Majumdar, K. Maxillary Sinus Augmentation. J. Indian Soc. Periodontol.
2018
,22, 468–473. [CrossRef]
[PubMed]
32.
Pierfelice, T.V.; D’amico, E.; Iezzi, G.; Piattelli, A.; di Pietro, N.; D’arcangelo, C.; Comuzzi, L.; Petrini, M. Nanoporous Titanium
Enriched with Calcium and Phosphorus Promotes Human Oral Osteoblast Bioactivity. Int. J. Environ. Res. Public Health
2022
,19,
6212. [CrossRef] [PubMed]
33.
Li, K.; Yao, F.; Xue, Q.; Fan, H.; Yang, L.; Li, X.; Sun, L.; Liu, Y. Inhibitory Effects against
α
-Glucosidase and
α
-Amylase of the
Flavonoids-Rich Extract from Scutellaria Baicalensis Shoots and Interpretation of Structure–Activity Relationship of Its Eight
Flavonoids by a Refined Assign-Score Method. Chem. Cent. J. 2018,12, 82. [CrossRef] [PubMed]
34.
Kilani-Jaziri, S.; Mustapha, N.; Mokdad-Bzeouich, I.; el Gueder, D.; Ghedira, K.; Ghedira-Chekir, L. Flavones Induce Immunomod-
ulatory and Anti-Inflammatory Effects by Activating Cellular Anti-Oxidant Activity: A Structure-Activity Relationship Study.
Tumor Biol. 2016,37, 6571–6579. [CrossRef]
35.
Fouache, A.; Zabaiou, N.; de Joussineau, C.; Morel, L.; Silvente-Poirot, S.; Namsi, A.; Lizard, G.; Poirot, M.; Makishima, M.; Baron,
S.; et al. Flavonoids Differentially Modulate Liver X Receptors Activity—Structure-Function Relationship Analysis. J. Steroid
Biochem. Mol. Biol. 2019,190, 173–182. [CrossRef]
36.
Birkett, D.J. Pharmacokinetics Made Easy 10 Pharmacodynamics—The Concentration-Effect Relationship. Aust. Prescr.
1995
,18,
102–104. [CrossRef]
37.
Singh, P.; Mishra, S.K.; Noel, S.; Sharma, S.; Rath, S.K. Acute Exposure of Apigenin Induces Hepatotoxicity in Swiss Mice. PLoS
ONE 2012,7, e31964. [CrossRef]
Appl. Sci. 2022,12, 8510 12 of 12
38.
Miyoshi, N.; Naniwa, K.; Yamada, T.; Osawa, T.; Nakamura, Y. Dietary Flavonoid Apigenin Is a Potential Inducer of Intracellular
Oxidative Stress: The Role in the Interruptive Apoptotic Signal. Arch. Biochem. Biophys. 2007,466, 274–282. [CrossRef]
39.
Melguizo-Rodríguez, L.; Manzano-Moreno, F.J.; Illescas-Montes, R.; Ramos-Torrecillas, J.; de Luna-Bertos, E.; Ruiz, C.; García-
Martínez, O. Bone Protective Effect of Extra-Virgin Olive Oil Phenolic Compounds by Modulating Osteoblast Gene Expression.
Nutrients 2019,11, 1722. [CrossRef]
40.
Liang, W.; Lin, M.; Li, X.; Li, C.; Gao, B.; Gan, H.; Yang, Z.; Lin, X.; Liao, L.; Yang, M. Icariin Promotes Bone Formation via the
BMP-2/Smad4 Signal Transduction Pathway in the HFOB 1.19 Human Osteoblastic Cell Line. Int. J. Mol. Med.
2012
,30, 889–895.
[CrossRef]
41.
Xu, B.; Wang, X.; Wu, C.; Zhu, L.; Chen, O.; Wang, X. Flavonoid Compound Icariin Enhances BMP-2 Induced Differentiation
and Signalling by Targeting to Connective Tissue Growth Factor (CTGF) in SAMP6 Osteoblasts. PLoS ONE
2018
,13, e0200367.
[CrossRef]
42.
Rawadi, G.; Vayssière, B.; Dunn, F.; Baron, R.; Roman-Roman, S. BMP-2 Controls Alkaline Phosphatase Expression and Osteoblast
Mineralization by a Wnt Autocrine Loop. J. Bone Miner. Res. 2003,18, 1842–1853. [CrossRef]
43.
Movassagh, E.Z.; Vatanparast, H. Current Evidence on the Association of Dietary Patterns and Bone Health: A Scoping Review.
Adv. Nutr. 2017,8, 1–16. [CrossRef]
44.
Nayaka, H.B.; Londonkar, R.L.; Umesh, M.K.; Tukappa, A. Antibacterial Attributes of Apigenin, Isolated from Portulaca Oleracea
L. Int. J. Bacteriol. 2014,2014, 175851. [CrossRef]
45.
Adamczak, A.; O˙
zarowski, M.; Karpi´nski, T.M. Antibacterial Activity of Some Flavonoids and Organic Acids Widely Distributed
in Plants. J. Clin. Med. 2019,9, 109. [CrossRef]
46.
Zhang, W.; Qiao, H.; Lv, Y.; Wang, J.; Chen, X.; Hou, Y.; Tan, R.; Li, E. Apigenin Inhibits Enterovirus-71 Infection by Disrupting
Viral RNA Association with Trans-Acting Factors. PLoS ONE 2014,9, e110429. [CrossRef]
47.
Shibata, C.; Ohno, M.; Otsuka, M.; Kishikawa, T.; Goto, K.; Muroyama, R.; Kato, N.; Yoshikawa, T.; Takata, A.; Koike, K. The
Flavonoid Apigenin Inhibits Hepatitis C Virus Replication by Decreasing Mature MicroRNA122 Levels. Virology
2014
,462–463,
42–48. [CrossRef]
48.
Liao, Y.; Li, H.; Shu, R.; Chen, H.; Zhao, L.; Song, Z.; Zhou, W. Mesoporous Hydroxyapatite/Chitosan Loaded with Recombinant-
Human Amelogenin Could Enhance Antibacterial Effect and Promote Periodontal Regeneration. Front. Cell. Infect. Microbiol.
2020,10, 180. [CrossRef]
49.
Wong, S.K.; Chin, K.Y.; Ima-Nirwana, S. Quercetin as an Agent for Protecting the Bone: A Review of the Current Evidence. Int. J.
Mol. Sci. 2020,21, 6448. [CrossRef]
50.
Nozhat, Z.; Heydarzadeh, S.; Memariani, Z.; Ahmadi, A. Chemoprotective and Chemosensitizing Effects of Apigenin on Cancer
Therapy. Cancer Cell Int. 2021,21, 574. [CrossRef]
Available via license: CC BY 4.0
Content may be subject to copyright.
