The Role of ZAP and TRIM25 RNA Binding in Restricting Viral Translation

Abstract

The innate immune response controls the acute phase of virus infections; critical to this response is the induction of type I interferon (IFN) and resultant IFN-stimulated genes to establish an antiviral environment. One such gene, zinc finger antiviral protein (ZAP), is a potent antiviral factor that inhibits replication of diverse RNA and DNA viruses by binding preferentially to CpG-rich viral RNA. ZAP restricts alphaviruses and the flavivirus Japanese encephalitis virus (JEV) by inhibiting translation of their positive-sense RNA genomes. While ZAP residues important for RNA binding and CpG specificity have been identified by recent structural studies, their role in viral translation inhibition has yet to be characterized. Additionally, the ubiquitin E3 ligase tripartite motif-containing protein 25 (TRIM25) has recently been uncovered as a critical co-factor for ZAP’s suppression of alphavirus translation. While TRIM25 RNA binding is required for efficient TRIM25 ligase activity, its importance in the context of ZAP translation inhibition remains unclear. Here, we characterized the effects of ZAP and TRIM25 RNA binding on translation inhibition in the context of the prototype alphavirus Sindbis virus (SINV) and JEV. To do so, we generated a series of ZAP and TRIM25 RNA binding mutants, characterized loss of their binding to SINV genomic RNA, and assessed their ability to interact with each other and to suppress SINV replication, SINV translation, and JEV translation. We found that mutations compromising general RNA binding of ZAP and TRIM25 impact their ability to restrict SINV replication, but mutations specifically targeting ZAP CpG-mediated RNA binding have a greater effect on SINV and JEV translation inhibition. Interestingly, ZAP-TRIM25 interaction is a critical determinant of JEV translation inhibition. Taken together, these findings illuminate the contribution of RNA binding and co-factor interaction to the synergistic inhibition of viral translation by ZAP and TRIM25.

Full text

The Role of ZAP and TRIM25
RNA Binding in Restricting
Viral Translation
Emily Yang
1,2†
, LeAnn P. Nguyen
1,2†
, Carlyn A. Wisherop
2
, Ryan L. Kan
1,3
and Melody M.H. Li
1,2,4
*
1
Molecular Biology Institute, University of California, Los Angeles, Los Angeles, CA, United States,
2
Department of
Microbiology, Immunology and Molecular Genetics, University of California, Los Angeles, Los Angeles, CA, United States,
3
Department of Biological Chemistry, David Geffen School of Medicine, University of California, Los Angeles, Los Angeles,
CA, United States,
4
AIDS Institute, David Geffen School of Medicine, University of California, Los Angeles, CA, United States
The innate immune response controls the acute phase of virus infections; critical to this
response is the induction of type I interferon (IFN) and resultant IFN-stimulated genes to
establish an antiviral environment. One such gene, zinc finger antiviral protein (ZAP), is a
potent antiviral factor that inhibits replication of diverse RNA and DNA viruses by binding
preferentially to CpG-rich viral RNA. ZAP restricts alphaviruses and the flavivirus Japanese
encephalitis virus (JEV) by inhibiting translation of their positive-sense RNA genomes.
While ZAP residues important for RNA binding and CpG specificity have been identified by
recent structural studies, their role in viral translation inhibition has yet to be characterized.
Additionally, the ubiquitin E3 ligase tripartite motif-containing protein 25 (TRIM25) has
recently been uncovered as a critical co-factor for ZAP’s suppression of alphavirus
translation. While TRIM25 RNA binding is required for efficient TRIM25 ligase activity, its
importance in the context of ZAP translation inhibition remains unclear. Here, we
characterized the effects of ZAP and TRIM25 RNA binding on translation inhibition in
the context of the prototype alphavirus Sindbis virus (SINV) and JEV. To do so, we
generated a series of ZAP and TRIM25 RNA binding mutants, characterized loss of their
binding to SINV genomic RNA, and assessed their ability to interact with each other and to
suppress SINV replication, SINV translation, and JEV translation. We found that mutations
compromising general RNA binding of ZAP and TRIM25 impact their ability to restrict SINV
replication, but mutations specifically targeting ZAP CpG-mediated RNA binding have a
greater effect on SINV and JEV translation inhibition. Interestingly, ZAP-TRIM25 interaction
is a critical determinant of JEV translation inhibition. Taken together, these findings
illuminate the contribution of RNA binding and co-factor interaction to the synergistic
inhibition of viral translation by ZAP and TRIM25.
Keywords: ZAP, TRIM25, RNA binding, CpG sensing, translation inhibition, co-factors, alphavirus, Japanese
encephalitis virus
Frontiers in Cellular and Infection Microbiology | www.frontiersin.org June 2022 | Volume 12 | Article 8869291
Edited by:
Gulam Hussain Syed,
Institute of Life Sciences (ILS), India
Reviewed by:
Kun Zhang,
Virginia Commonwealth University,
United States
Alessia Zamborlini,
Universite
´Paris-Sud,
France
*Correspondence:
Melody M.H. Li
ManHingLi@mednet.ucla.edu
†
These authors have contributed
equally to this work and share
first authorship
Specialty section:
This article was submitted to
Microbes and Innate Immunity,
a section of the journal
Frontiers in Cellular and
Infection Microbiology
Received: 01 March 2022
Accepted: 23 May 2022
Published: 21 June 2022
Citation:
Yang E, Nguyen LP, Wisherop CA,
Kan RL and Li MMH (2022) The Role of
ZAP and TRIM25 RNA Binding in
Restricting Viral Translation.
Front. Cell. Infect. Microbiol. 12:886929.
doi: 10.3389/fcimb.2022.886929
ORIGINAL RESEARCH
published: 21 June 2022
doi: 10.3389/fcimb.2022.886929

INTRODUCTION
The type I interferon (IFN) response is one of the first lines of
cellular defense against invading pathogens. The IFN-induced
zinc finger antiviral protein (ZAP) is a potent inhibitor of diverse
RNA and DNA viruses (Yang and Li, 2020;Ficarelli et al., 2021).
ZAP encodes at least four splice isoforms, two of which, ZAPS
(short) and ZAPL (long) are well characterized (Charron et al.,
2013;Li et al., 2019;Schwerk et al., 2019). ZAPS and ZAPL share
the N-terminal CCCH zinc fingers (ZnFs) that mediate RNA
binding while ZAPL has an additional C-terminal catalytically
inactive poly(ADP-ribose) polymerase (PARP)-like domain,
which contributes to its greater antiviral activity compared to
the IFN-inducible ZAPS (Yang and Li, 2020;Ficarelli et al.,
2021). Two primary mechanisms of ZAP antiviral activity
include targeting viral RNA for degradation and suppressing
viral translation (Yang and Li, 2020). However, it remains largely
unclear how ZAP is able to coordinate multiple means of viral
antagonism while lacking enzymatic activity on its own. These
mechanisms appear to be dependent on viral context. For
example, ZAP is thought to inhibit human immunodeficiency
virus-1 (HIV-1) primarily by targeting its RNA for degradation
(Zhu et al., 2011). On the other hand, ZAP inhibits alphavirus
replication by suppressing translation of incoming viral genomes
and inhibits replication of Japanese encephalitis virus (JEV) by
both RNA degradation and translation suppression (Bick et al.,
2003;Chiu et al., 2018;Zhu et al., 2012). In addition to inhibiting
viral replication by binding directly to viral RNA, ZAP also
recruits cellular co-factors, such as exosome components, the
putative endoribonuclease KHNYN, and the E3 ligase tripartite
motif containing protein 25 (TRIM25) (Guo et al., 2007;Li et al.,
2017;Zheng et al., 2017;Ficarelli et al., 2019).
Earlier efforts to elucidate ZAP RNA binding activity showed
that ZAP binds RNA with its four N-terminal CCCH ZnFs, and
mutations of ZnFs 2 and 4 most dramatically reduce ZAP
antiviral activity (Guo et al., 2004). The first structural study of
only the N-terminal region of ZAP (NZAP) posited that the four
ZnFs form two distinct RNA binding cavities; however, this
study did not directly show ZAP bound to RNA (Chen et al.,
2012). In recent years, much focus has been given to the
discovery of ZAP as a CpG dinucleotide sensor in the context
of HIV-1 infection (Takata et al., 2017;Ficarelli et al., 2019).
Since then, two studies have elucidated the structure of ZAP
complexed with CpG-containing RNA and identified critical
residues responsible for its CpG binding specificity (Meagher
et al., 2019;Luo et al., 2020). While several studies have
characterized ZAP RNA binding activity, they have done so in
the context of only NZAP or only ZAPL and not ZAPS, and
primarily focused on the mechanism of RNA degradation (Chen
et al., 2012;Meagher et al., 2019;Luo et al., 2020;Goncalves-
Carneiro et al., 2021). Moreover, most did not utilize full-length
viral RNA for measuring ZAP RNA binding activity, instead
assaying with only a ZAP-sensitive fragment (Chen et al., 2012;
Luo et al., 2020). Meanwhile, it has been suggested that
translation inhibition may be preceded by and required for
ZAP-mediated mRNA degradation (Zhu et al., 2012).
Furthermore, these ZAP RNA binding studies have mostly
expressed RNA binding mutants against the background of
endogenous ZAP and TRIM25.
While much attention has been given to characterizing ZAP
RNA binding, less has been given to its critical co-factors such as
TRIM25. TRIM25 was identified as a ZAP co-factor in the
context of inhibiting alphavirus translation (Li et al., 2017;
Zheng et al., 2017). However, it remains unclear whether
TRIM25 modulates the RNA binding activity or specificity of
ZAP. Like ZAP, TRIM25 is also an RNA binding protein
(Choudhury et al., 2017;Sanchez et al., 2018;Garcia-Moreno
et al., 2019). TRIM25 RNA binding has been mapped to two
separate motifs: a 39-amino acid stretch in the C-terminal PRY-
SPRY domain (Choudhury et al., 2017), and a lysine-rich
sequence (7K) within the L2 linker connecting the coiled-coil
and PRY-SPRY domains (Sanchez et al., 2018). TRIM25 appears
to preferentially bind G- and C-rich sequences, and prefers
mRNAs and long intergenic non-coding RNAs (Choudhury
et al., 2017). TRIM25 RNA binding is required for its ubiquitin
ligase activity (Choudhury et al., 2017), which in turn is required
for its function in ZAP antiviral activity (Li et al., 2017;Zheng
et al., 2017). Both TRIM25 and ZAP directly bind SINV RNA,
and have been demonstrated to associate more strongly with
SINV RNA during infection (Guo et al., 2004;Garcia-Moreno
et al., 2019). TRIM25 and ZAP also associate with one another,
with the ZAP interaction motif within TRIM25 mapped to its C-
terminal PRY-SPRY domain (Li et al., 2017). Meanwhile, the
TRIM25 interaction motif for ZAP is thought to reside within its
N-terminal ZnFs (Goncalves-Carneiro et al., 2021), though the
additional PARP-like domain within ZAPL may contribute to
TRIM25 binding as well by modulating proper localization
(Kmiec et al., 2021).
While some have attempted to illuminate the contribution of
ZAP or TRIM25 RNA binding to the ZAP-TRIM25 interaction,
these studies have focused on only a few select mutations. Still,
most agree that RNA binding in either ZAP or TRIM25 is not
required for the ZAP-TRIM25 interaction. One group
demonstrated not only that RNase A treatment has little effect
on the ZAPL-TRIM25 interaction, but also that an example
ZAPL RNA binding mutant retains and even increases its
interaction with TRIM25 (Goncalves-Carneiro et al., 2021).
Another showed the TRIM25 mutant in which the 7K motif is
replaced with alanines (abbreviated as 7KA) associates more
strongly with ZAP (Goncalves-Carneiro et al., 2021), while a
third found that the TRIM25 mutant with a deletion of the 39-
amino acid sequence in the PRY-SPRY domain (abbreviated as
DRBD) fails to bind ZAP at all (Choudhury et al., 2017). Still, it is
important to note that the RNA binding motif deleted in
TRIM25 DRBD is located within the same PRY-SPRY domain
that TRIM25 uses to interact with ZAP, complicating these
findings, and that the same study corroborated previous
findings that RNase A treatment has little impact on the ZAP-
TRIM25 interaction (Choudhury et al., 2017).
In light of the recent novel structural insights, we asked how
different ZAP and TRIM25 RNA binding mutations affect the
ability of ZAP and TRIM25 to interact with one another and to
restrict SINV and JEV translation. We curated a panel of ZAP
and TRIM25 RNA binding mutants from prior studies,
Yang et al. ZAP and TRIM25 RNA Binding
Frontiers in Cellular and Infection Microbiology | www.frontiersin.org June 2022 | Volume 12 | Article 8869292

including mutants with a range of RNA binding and antiviral
capabilities (Guo et al., 2004;Chen et al., 2012;Meagher et al.,
2019;Luo et al., 2020). We first characterized these ZAP and
TRIM25 mutants’direct binding to SINV RNA. We then asked
how their ability to bind RNA affects their ability to interact
with one another. Generally, we observed that ZAP mutants
that fail to bind SINV RNA interact more strongly with
TRIM25. In contrast, we observed that the KHNYN TRIM25
7KA mutant binds both SINV RNA and ZAP more strongly
than TRIM25 wild-type (WT), and that the TRIM25 DRBD
mutant is too unstable to have any detectable interaction with
ZAP. Moreover, we generally found that mutants that fail to
bindSINVRNAalsofailtoinhibitSINVreplicationand
translation, with residues important for CpG recognition
playing a critical role in ZAP translation inhibition.
Surprisingly, when we tested the ability of ZAP and TRIM25
RNA binding mutants to inhibit translation of a JEV replicon,
some mutants demonstrate increased antiviral activity, while
those with mutations in residues important for CpG
recognition have reduced activity. We then performed a
correlation analysis to determine which ZAP properties are
necessary for its antiviral activity against SINV and JEV. We
found a significant negative correlation between ZAP SINV
RNA binding and ZAP-TRIM25 interaction. We also found a
significant positive correlation between ZAP SINV RNA
binding and SINV replication inhibition, as well as between
ZAP-TRIM25 interaction and JEV translation inhibition. These
data together suggest that ZAP RNA binding and interaction
with TRIM25 may form two distinct determinants for ZAP
antiviral mechanisms in different viral contexts, even while they
appear to be inversely correlated in the context of binding to
SINV RNA. Altogether, this study furthers our understanding
of how viral RNA binding and interaction with co-factors may
modulate translation inhibition by ZAP.
RESULTS
ZAP and TRIM25 RNA Binding Mutants
Show a Range of Binding to SINV
Genomic RNA
To investigate the role of ZAP and TRIM25 RNA binding in the
context of viral translation, we generated a panel of constructs
with mutations previously demonstrated to impact RNA
binding. For ZAP, each of the following mutations was
introduced in both ZAPS and ZAPL to probe potential isoform
differences in RNA binding and antiviral function. These
mutations fall into two general categories: 1) ZnF mutants that
individually disrupt each CCCH motif and 2) CpG RNA binding
cavity mutants. We made four individual mutations to disrupt
each N-terminal CCCH ZnF: H86K, C88R, C168R, and H191R,
which are located in ZnF 1, 2, 3, and 4, respectively (Guo et al.,
2004). Two putative RNA binding cavities were previously
identified based on a crystallized NZAP structure without
bound RNA (Chen et al., 2012). Based on this study, we also
made two triple mutations in the two predicted RNA binding
cavities contained within the ZnFs: V72A/Y108A/F144A
(abbreviated as VYF), found within ZnFs 2-3, and H176A/
F184A/R189A (abbreviated as HFR), found within ZnF 4
(Chen et al., 2012). More recent studies have elucidated
structures of NZAP bound to CpG-containing RNA (Meagher
et al., 2019;Luo et al., 2020). Building on this work, we made two
double mutations and one triple mutation within the ZnFs that
mediate CpG dinucleotide-specific binding. These mutations are
C96A/Y98A (abbreviated as CY) and K107A/Y108A
(abbreviated as KY) within ZnF 2, and E148A/K151A/R170A
(abbreviated as EKR) within ZnF 3, which demonstrate a range
of RNA binding and antiviral activities (Meagher et al., 2019;Luo
et al., 2020). NZAP mutants CY, KY, and EKR previously
demonstrated loss of antiviral activity against a SINV NanoLuc
luciferase reporter virus, with EKR exhibiting the least defect as
compared to NZAP WT (Luo et al., 2020). Notably, the
individual mutations Y108A/F and F144A/Y appear to be
critical for ZAP recognition of CpG-rich RNA, wherein they
completely or partially abolish ZAP’s ability to discriminate
between CpG-rich and CpG-deficient strains of HIV-1,
respectively (Meagher et al., 2019;Luo et al., 2020).
For TRIM25, we generated two constructs, one in which we
replaced the lysine-rich motif in the L2 linker with alanines
(TRIM25 7KA) and one in which we deleted the previously
identified RNA binding domain in the PRY/SPRY domain
(TRIM25 DRBD) (Choudhury et al., 2017;Sanchez et al., 2018).
We cloned each of these ZAP and TRIM25 WT or RNA
binding mutants into a pcDNA3.1-3XFLAG or -myc plasmid,
allowing for transient expression of each construct following
transfection into ZAP or TRIM25 KO 293T cells. We titrated the
amount of plasmid to transfect for each construct to ensure even
expression across constructs for ZAPS, ZAPL, and TRIM25 WT
(Supplemental Figure 1). Because the ZAP CpG RNA binding
cavity mutants generally express at higher levels than the ZnF
mutants (Supplemental Figure 1), we decided to transfect two
amounts of ZAPS and ZAPL WT in our assays to match these
two expression patterns. We then assessed the ability of the ZAP
and TRIM25 mutants to bind SINV genomic RNA by an in vitro
RNA pull-down assay. We incubated lysates of cells transfected
with ZAP or TRIM25 mutants with biotin-labeled SINV
(Toto1101 strain) genomic RNA, allowing for RNA and bound
protein to be immunoprecipitated using streptavidin beads and
probed for the presence of bound ZAP or TRIM25. As a
negative control, we also assessed the ability of the WT
constructs to bind firefly luciferase (Fluc) RNA. We quantified
the resultant ZAP and TRIM25 bound to RNA and normalized
to input ZAP and TRIM25 protein levels with ImageJ
(Davarinejad, 2015). The ZnF mutations in both ZAPS and
ZAPL drastically reduce all SINV RNA binding, with only the
ZAPS and ZAPL ZnF 1 mutant (H86K) and the ZAPS ZnF 3
mutant (C168R) showing low levels of binding (Figure 1A). In
contrast, mutations in the CpG RNA binding cavities result in a
range of binding phenotypes. For both ZAPS and ZAPL, the
VYF, CY, and KY mutants show complete to near complete loss
of SINV RNA binding, while the HFR and EKR mutants show
similar or increased RNA binding relative to ZAPS and ZAPL
WT (Figure 1B).
Yang et al. ZAP and TRIM25 RNA Binding
Frontiers in Cellular and Infection Microbiology | www.frontiersin.org June 2022 | Volume 12 | Article 8869293

The TRIM25 mutants demonstrate diverging RNA binding
phenotypes. The 7KA mutant not only has increased binding to
SINV RNA relative to WT, but also to the Fluc negative control
(Figure 1C). Consistent with previous findings, the DRBD
mutation abolishes binding to SINV RNA (Figure 1C).
Together, our findings indicate that the different RNA binding
residues of ZAP and TRIM25 contribute in varying degrees to
viral RNA binding.
RNA Binding Mutations Generally Increase
ZAP-TRIM25 Association
Given that TRIM25 RNA binding has been purported to
stimulate its interaction with ZAP (Choudhury et al., 2017),
and that the ZAP ZnFs responsible for RNA binding are also
thought to mediate its interaction with TRIM25 (Goncalves-
Carneiro et al., 2021), we hypothesized that abolishing ZAP RNA
binding would negatively impact ZAP association with TRIM25,
A
B
C
FIGURE 1 | Association of ZAP and TRIM25 RNA binding mutants with SINV RNA. (A, B) ZAP KO or (C) TRIM25 KO 293T cells were transfected with (A) ZAP zinc
finger (ZnF) mutants, (B) ZAP CpG RNA binding cavity mutants, or (C) TRIM25 mutants. ZAP or TRIM25 pulled down (IP) with Sindbis virus (SINV) or firefly luciferase
(Fluc) RNA and in whole cell lysate (WCL) were assayed by immunoblot (IB). Blots were quantified with ImageJ. Data are representative of two independent
experiments.
Yang et al. ZAP and TRIM25 RNA Binding
Frontiers in Cellular and Infection Microbiology | www.frontiersin.org June 2022 | Volume 12 | Article 8869294

and vice versa. We also aimed to capture any ZAP isoform-
specific characteristics for association with TRIM25, given
previous reports that TRIM25 preferentially interacts with
ZAPL (Li et al., 2017;Kmiec et al., 2021). Therefore, we
expected that ZAP RNA binding mutants would display
decreased enrichment in the presence of TRIM25 co-
immunoprecipitation (co-IP) compared to ZAP WT. In
accordance with prior work and our observation of
different RNA binding activities of the TRIM25 mutants
(Figure 1C), we also expected that TRIM25 7KA and DRBD
would behave differently.
To test this hypothesis, we transfected ZAP KO 293T cells
with either FLAG-tagged ZAPS or ZAPL RNA binding mutants
and myc-tagged TRIM25 WT. Given that the ZAP ZnFs 2-4
display approximately equal, near complete loss of RNA binding
(Figure 1A), and that ZnFs 2 and 4 are more important for
mediating ZAP antiviral activity against alphaviruses and for
CpG specificity (Bick et al., 2003;Meagher et al., 2019;Luo et al.,
2020), we proceeded with testing only ZnF mutants 2 and 4 in
addition to the complete panel of CpG RNA binding cavity
mutants. We then performed a myc IP to enrich for TRIM25 and
probed for the presence of associated ZAPS or ZAPL, quantifying
resultant ZAP pulldown with ImageJ (Davarinejad, 2015).
Surprisingly, we found that both ZnF mutants (C88R and
H191R) in both ZAPS and ZAPL display increased association
with TRIM25 (Figures 2A, B). Of the remaining RNA binding
mutants, VYF, CY, and KY with near complete loss of RNA
binding (Figure 1B) display similar to increased TRIM25
association for both ZAPS and ZAPL, though to a lesser extent
than the ZnF mutants (Figures 2A, B). Only HFR with
unaffected or mildly reduced RNA binding (Figure 1B)
exhibits diminished interaction with TRIM25 as compared to
ZAPS and ZAPL WT (Figures 2A, B), while EKR which mostly
retains or even gains binding to SINV RNA (Figure 1B) binds to
TRIM25 to a similar degree as compared to ZAP WT
(Figures 2A, B).
To test the ability of TRIM25 RNA binding mutants to
interact with ZAP, we transfected TRIM25 KO 293T cells with
myc-tagged TRIM25 RNA binding mutants and FLAG-tagged
ZAPS or ZAPL WT. When we transfected amounts that would
yield similar levels of TRIM25 expression (Figure 1C), we found
that these levels are too low to visualize previously demonstrated
interactions between TRIM25 WT and ZAPS or ZAPL (data not
shown). In our hands, the TRIM25 DRBD mutant is markedly
less stable than the other TRIM25 constructs. Therefore, we
maximized the transfected amounts of all TRIM25 forms to
better visualize any differences in TRIM25 association with ZAP,
normalizing the TRIM25 co-IP to input lysates and quantifying
with ImageJ (Davarinejad, 2015). As expected, we observed that
TRIM25 7KA binds more robustly than TRIM25 WT to both
ZAPS and ZAPL, while the TRIM25 DRBD levels are likely too
low to be detected in the ZAP co-IP (Figure 2C).
Together, these data suggest that ZAP RNA binding may
compete with ZAP-TRIM25 interaction likely because ZAP
interacts with TRIM25 through its N-terminal ZnFs.
Moreover, there do not appear to be ZAP isoform-specific
differences for the RNA binding mutants as a whole, with
trends of increased or decreased TRIM25 association holding
true for each mutant in ZAPS and ZAPL.
RNA Binding Is Required for Both ZAP and
TRIM25 Inhibition of SINV Replication
Next, we asked how loss of RNA binding would affect the ability
of ZAP and TRIM25 to inhibit SINV replication. Given the
centrality of RNA binding to ZAP antiviral activity and to
TRIM25 ligase activity, we hypothesized that mutations with
near complete loss of RNA binding would abolish antiviral
activity completely, while mutations with moderate loss of
RNA binding would exhibit an intermediate phenotype. We
transfected ZAP KO 293T cells with ZAP RNA binding mutants
and infected with the SINV luciferase reporter virus Toto1101/
luc. As expected, the mutant EKR which retains its ability to bind
SINV RNA as compared to ZAPS and ZAPL WT (Figure 1B)
also remains capable of inhibiting SINV replication (Figures 3A,
B). Both ZAPS and ZAPL ZnF mutants display reduced antiviral
activity, and all other CpG RNA binding cavity mutants display
differing degrees of loss of antiviral activity (Figures 3A, B). We
observed significant differences in viral replication between ZnF
mutants and WT for ZAPL (Figure 3B) but not for ZAPS
(Figure 3A), likely due to ZAPL’s greater viral inhibition. In
ZAPS, mutants CY and KY have the most significant increase in
viral replication compared to ZAPS WT (Figure 3A), while
ZAPL HFR has the most significant increase in viral replication
compared to ZAPL WT (Figure 3B).
Meanwhile, we transfected TRIM25 KO 293T cells with
TRIM25 RNA binding mutants to assess their ability to inhibit
SINV replication. TRIM25 7KA, which binds SINV RNA more
robustly than TRIM25 WT (Figure 1C) exhibits a similar degree
of SINV inhibition (Figure 3C). On the other hand, TRIM25
DRBD, which fails to bind SINV RNA at all, restores viral
replication to TRIM25 KO levels (Figure 3C). Finally, we
asked whether the observed loss of antiviral activity for any of
the ZAP and TRIM25 RNA binding mutants tested was due to a
decrease in protein expression. To test this, we assayed protein
expression both before and after SINV infection and found that
with the exception of the ZAPL ZnF mutants, protein expression
for all ZAP and TRIM25 variants increases to varying degrees
during infection (Supplemental Figure 2). Still, almost all of the
ZAP RNA binding mutants express more highly than ZAP-WT
(Supplemental Figures 2A, B), supporting our hypothesis that it
is mutation of these RNA binding residues and not overall
protein levels that determines degree of antiviral activity.
Together, these data point strongly to the primacy of RNA
binding in both ZAP and TRIM25 inhibition of
SINV replication.
ZAP CpG-Mediated RNA Binding but Not
TRIM25 RNA Binding Is Required for
Inhibition of SINV Translation
Following our characterization of ZAP and TRIM25 RNA
binding mutants’ability to inhibit SINV replication, we asked
Yang et al. ZAP and TRIM25 RNA Binding
Frontiers in Cellular and Infection Microbiology | www.frontiersin.org June 2022 | Volume 12 | Article 8869295

A
B
C
FIGURE 2 | Interaction of ZAP or TRIM25 RNA binding mutants with TRIM25 or ZAP WT. (A, B) Western blot of ZAP KO 293T cells transfected with myc-tagged
TRIM25 and (A) FLAG-tagged ZAPS RNA binding mutants or (B) FLAG-tagged ZAPL RNA binding mutants. Different amounts of (A) ZAPS and (B) ZAPL WT were
transfected to match protein expression levels for each subset of ZnF mutants and CpG RNA binding cavity mutants. Blots were quantified with ImageJ. Data are
representative of two independent experiments. (C) Western blot of TRIM25 KO 293T cells transfected with FLAG-tagged ZAPS or ZAPL and myc-tagged TRIM25
RNA binding mutants; n.d. stands for not detectable by western blot. Blots were quantified with ImageJ. Data are representative of two independent experiments.
Yang et al. ZAP and TRIM25 RNA Binding
Frontiers in Cellular and Infection Microbiology | www.frontiersin.org June 2022 | Volume 12 | Article 8869296

whether this antiviral activity stems from a block in alphavirus
translation, given that ZAP blocks SINV translation and that
TRIM25 is absolutely required for this inhibition (Bick et al.,
2003;Li et al., 2017). These prior studies readily measure SINV
translation with a replication-deficient temperature-sensitive
luciferase reporter virus, Toto1101/luc:ts6, such that any
luciferase activity would reflect translation of the incoming
viral genome (Rice et al., 1987). Here, we decided to omit the
ZnF 4 mutant (H191R) due to its similarity in behavior to the
ZnF 2 mutant (C88R), and the CpG RNA binding mutant EKR
due to its lack of antiviral activity (Figures 3A, B). We
transfected ZAP KO 293T cells with ZAPS or ZAPL ZnF 2 and
CpG RNA binding cavity mutants and infected with Toto1101/
luc:ts6. Here, we found that while transfection of mutants VYF
and KY significantly restores SINV translation in both ZAPS and
ZAPL (Figures 4A, B), HFR only significantly restores SINV
translation in the context of ZAPL (Figure 4B), in line with its
antiviral activity against SINV replication (Figure 3B). Given
that the residue Y108 is mutated in both VYF and KY and has
previously been implicated in determining ZAP CpG specificity
(Meagher et al., 2019), our data suggest that Y108 is very
important for ZAP inhibition of SINV translation. Moreover,
given that HFR largely retains RNA binding in both ZAPS and
ZAPL (Figure 1B), these data point suggest that mechanisms in
addition to RNA binding may modulate ZAP translation
inhibition. No dramatic restoration of viral translation is seen
for the ZnF 2 mutant (C88R) in either isoform (Figures 4A, B),
nor does any TRIM25 RNA binding mutant impact TRIM25
inhibition of viral translation when transfected into TRIM25 KO
cells (Figure 4C), though the lack of effect could be attributed to
low protein expression of TRIM25 DRBD. Interestingly, we
observed that there appear to be two distinct translation
phenotypes in the presence of the TRIM25 DRBD mutant,
wherein half of the replicate wells exhibit inhibited translation
similar to TRIM25 WT and the other half have partially restored
SINV translation (Figure 4C).
We also asked here whether the observed loss of inhibition of
viral translation for any of the ZAP and TRIM25 RNA binding
mutants tested was due to a decrease in protein expression.
Similar to the replication competent SINV Toto1101/luc,
infection with the replication-deficient SINV Toto1101/luc:ts6
generally results in higher expression of ZAP and TRIM25
variants (Supplemental Figure 3), though the phenotype for a
6 hour infection is not as robust as a 24 hour infection.
Interestingly, we observed a mild decrease in expression for
ZAPS CY, ZAPS VYF and ZAPL ZnF 2 mutant (C88R)
(Supplemental Figures 3A, B). Still, most ZAP and TRIM25
RNA binding mutants exhibit similar, if not slightly higher
protein expression as compared to ZAP and TRIM25 WT.
Together, these data suggest that CpG recognition by ZAP is
critical for its alphavirus translation inhibition and this is
independent of ZAP isoforms.
ZAP CpG-Mediated RNA Binding but Not
TRIM25 RNA Binding Is Required for
Inhibition of JEV Translation, While
ZAP ZnF Mutations Enhance JEV
Translation Inhibition
Because we observed that specific residues involved in ZAP CpG
recognition are more important for SINV translation inhibition,
rather than RNA binding in general, we next asked if this trend
holds true for ZAP translation inhibition of other viruses. JEV is
another virus that is translationally inhibited by ZAP (Chiu et al.,
2018). To assess if ZAP and TRIM25 RNA binding play a similar
role in blocking JEV translation as they do in blocking alphavirus
translation, we assessed the ability of our constructs to inhibit a
replication-defective JEV replicon expressing Renilla luciferase
A
BC
FIGURE 3 | Inhibition of SINV replication by ZAP and TRIM25 RNA binding mutants. (A, B) ZAP KO 293T cells or (C) TRIM25 KO 293T cells were transfected with
(A) ZAPS RNA binding mutants, (B) ZAPL RNA binding mutants, or (C) TRIM25 RNA binding mutants, infected with SINV Toto1101/luc at an MOI of 0.01 PFU/cell,
and lysed 24 hours post infection (h.p.i.) for measurement of luciferase activity. Different amounts of (A) ZAPS and (B) ZAPL WT were transfected to match protein
expression levels for each subset of ZnF mutants and CpG RNA binding cavity mutants. Data from triplicate wells are representative of two independent
experiments. Asterisks indicate statistically significant differences as compared to (A, B) ZAP WT or (C) TRIM25 WT within each subset of RNA binding mutants (by
one-way ANOVA and Dunnett’s multiple comparisons test: *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001). Unlabeled comparisons are not significant.
Yang et al. ZAP and TRIM25 RNA Binding
Frontiers in Cellular and Infection Microbiology | www.frontiersin.org June 2022 | Volume 12 | Article 8869297

(Rluc) (Li et al., 2016). Because ZAP can also mediate
degradation of JEV RNA, we measured luciferase activity 4
hours after transfecting the JEV replicon reporter to capture a
time point that is early enough to see ZAP primarily functioning
through translation inhibition, but also long enough to see
significant luciferase expression from the replicon. Previous
work has shown that there is a minimal decrease in JEV
replicon RNA at this time (Chiu et al., 2018). We attempted to
co-transfect the JEV replicon with Fluc RNA as a transfection
control, but found that ZAPL also restricts Fluc expression
(Supplemental Figure 4), as previously demonstrated (Li
et al., 2019).
We found that the ZAP and TRIM25 RNA binding mutants
inhibit JEV translation to varying degrees (Figure 5).
Surprisingly, we observed that the ZAPS and ZAPL ZnF 4
mutants (H191R) are significantly more inhibitory than their
WT counterparts, while the ZAPL ZnF 2 mutant (C88R) is more
inhibitory than ZAPL WT (Figures 5A, B). Given that these
mutants show increased association with TRIM25 (Figure 2B),
these data suggest a positive relationship between ZAP-TRIM25
interaction and JEV translation inhibition. The ZAP CpG RNA
binding cavity mutants either show similar inhibition to ZAPS
and ZAPL WT or, in the case of the ZAPS KY and ZAPL HFR
and KY mutants, decreased inhibition (Figures 5A, B). Taken
together with the SINV translation inhibition data, these data
further point to the importance of the RNA binding cavities in
ZAP inhibition of viral translation, including CpG-specific
binding by the residue Y108.
Upon assaying TRIM25 variants, we found that TRIM25
DRBD inhibits JEV translation similarly to TRIM25 WT
(Figure 5C), as we observed with SINV translation inhibition
(Figure 4C). Surprisingly, the TRIM25 7KA mutant loses its
ability to inhibit JEV translation (Figure 5C), in contrast to its
ability to inhibit SINV translation similarly to TRIM25 WT
(Figure 4C). Given the diverging phenotypes of the 7KA mutant,
we were curious if the TRIM25 mutants show a different pattern
of binding to SINV versus JEV replicon RNA that would explain
the differences in translation inhibition. We found that the
TRIM25 7KA mutant binds JEV replicon RNA to a greater
degree than TRIM25 WT, while the TRIM25 DRBD mutant loses
the ability to bind JEV replicon RNA (Figure 5D). These
findings recapitulate the TRIM25 SINV RNA binding
phenotypes (Figure 1C)andsuggestthatRNAbindingby
TRIM25 is not an important determinant for its ability to
inhibit JEV translation.
ZAP SINV RNA Binding Negatively
Correlates With ZAP-TRIM25 Interaction
and Positively Correlates With SINV
Replication Inhibition, While ZAP-TRIM25
Interaction Positively Correlates With JEV
Translation Inhibition
Given our wide panel of ZAPS and ZAPL RNA binding mutants,
we sought to look for significant correlations between any pairs
of ZAP phenotypes. To facilitate this, we quantified the
immunoblots for ZAP SINV RNA binding and ZAP-TRIM25
co-IPs and calculated fold inhibition relative to empty plasmid
transfection for the viral inhibition assays (Table 1). Using these
values, we calculated Pearson correlation coefficients and
p-values for each pairwise phenotype comparison. When
analyzing our data for the ZnF 2 and 4 mutants and the
complete panel of CpG RNA binding cavity mutants
(Figure 6A), we found a significant negative correlation
(r = -0.63, p<0.01) between ZAP SINV RNA binding and
ZAP-TRIM25 interaction (Figure 6B), lending further support
A
CB
FIGURE 4 | Inhibition of SINV translation by ZAP and TRIM25 RNA binding mutants. (A, B) ZAP KO 293T cells or (C) TRIM25 KO 293T cells were transfected with
(A) ZAPS RNA binding mutants, (B) ZAPL RNA binding mutants, or (C) TRIM25 RNA binding mutants, infected with SINV Toto1101/luc:ts6 at an MOI of 1 PFU/cell,
and lysed 6 h.p.i. for measurement of luciferase activity. Data from triplicate wells are combined from two independent experiments. Asterisks indicate statistically
significant differences as compared to (A, B) ZAP WT, wherein different amounts of (A) ZAPS and (B) ZAPL WT were transfected to match protein expression levels
for each subset of ZnF mutants and CpG RNA binding cavity mutants, or (C) TRIM25 WT within each subset of RNA binding mutants (by one-way ANOVA and
Dunnett’s multiple comparisons test: *p < 0.05; ***p < 0.001; ****p < 0.0001). Unlabeled comparisons are not significant.
Yang et al. ZAP and TRIM25 RNA Binding
Frontiers in Cellular and Infection Microbiology | www.frontiersin.org June 2022 | Volume 12 | Article 8869298

to the idea that ZAP RNA binding competes with its ability to
associate with TRIM25. We also observed a significant positive
correlation (r = 0.78, p<0.001) between ZAP SINV RNA binding
and SINV replication inhibition (Figure 6C), but interestingly,
no correlation between ZAP SINV RNA binding and SINV
translation inhibition (Table 1). This suggests that while
general ZAP RNA binding is important for its antiviral
activity, it is not as critical for the specific step of translation
inhibition. Finally, we found a significant positive correlation (r =
0.64, p<0.05) between ZAP-TRIM25 interaction and JEV
translation inhibition (Figure 6D), further suggesting that ZAP
interaction with TRIM25 potentiates its ability to inhibit JEV
translation. Because we had a limited number of mutants for
TRIM25, we were not able to find significant correlations
between any pair of TRIM25 phenotypes (data not shown).
DISCUSSION
Though the RNA binding functions of ZAP and TRIM25 have
been previously dissected, in this study we placed these functions
in a wider context of viral translation inhibition. We found that
ZAP and TRIM25 RNA binding domains contribute in varying
degrees to their ability to bind SINV genomic RNA. We also
observed that reduction of RNA binding by ZAP and TRIM25
generally increases their ability to interact with each other while
reducing both of their abilities to inhibit SINV replication. When
looking at viral translation inhibition more specifically, we found
that the function of the ZAP CpG RNA binding cavities is most
important for SINV and JEV translation inhibition, while general
ZAP RNA binding and TRIM25 RNA binding is less critical.
Some of our findings diverge from those observed previously,
demonstrating the importance of studying ZAP and TRIM25
functions in a more biologically relevant context with the
presence of full-length viral RNA.
Our SINV genomic RNA binding assays mostly recapitulate
the results of prior studies, which investigated binding to
synthetic viral RNA fragments or RNA constructs. Notably, we
showed that all four ZnFs are individually required for efficient
ZAP binding to SINV RNA (Figure 1A), while previously, only
ZnF 2 has been demonstrated to be required for binding to SINV
RNA fragments (Guo et al., 2004;Wang et al., 2010). Our
A
D
BC
FIGURE 5 | Inhibition of JEV translation by ZAP and TRIM25 RNA binding mutants. (A, B) ZAP KO 293T cells or (C) TRIM25 KO 293T cells were transfected with
(A) ZAPS RNA binding mutants, (B) ZAPL RNA binding mutants, or (C) TRIM25 RNA binding mutants, transfected with a replication-defective Japanese encephalitis
virus (JEV) replicon RNA reporter, and lysed 4 hours post-reporter transfection for measurement of luciferase activity. Data from triplicate wells are representative of
two independent experiments. Asterisks indicate statistically significant differences as compared to (A, B) ZAP WT or (C) TRIM25 WT within each subset of RNA
binding mutants (by one-way ANOVA and Dunnett’s multiple comparisons test: *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001). Unlabeled comparisons are not
significant. (D) TRIM25 KO 293T cells were transfected with TRIM25 mutants. TRIM25 pulled down with RNA and in WCL were assayed by western blot. Blots were
quantified with ImageJ. Data are representative of two independent experiments.
Yang et al. ZAP and TRIM25 RNA Binding
Frontiers in Cellular and Infection Microbiology | www.frontiersin.org June 2022 | Volume 12 | Article 8869299

findings also diverge from previous studies for the ZAP EKR
CpG binding cavity mutant, which has reduced binding to a 6-nt
single-stranded RNA probe (Luo et al., 2020); we showed that the
ZAPS and ZAPL EKR mutants bind SINV RNA to a greater
degree than their WT counterparts (Figure 1B). These
contrasting findings may be a result of the different assays used
in our studies and suggest that the function of the CpG-specific
binding residues within ZnF 3 varies based on its specific RNA
target. We also found that impairing ZAP RNA binding results in
increased association with TRIM25 (Figures 2A, B,Figure 6B),
consistent with previous findings (Goncalves-Carneiro et al.,
2021). Given that ZAP has also been shown to interact with
TRIM25 through its N-terminal ZnFs, we hypothesize that RNA
binding may compete with ZAP-TRIM25 interaction, though
further experiments are required to test this hypothesis.
As expected, we found that the ZAP RNA binding mutants
show deficiencies in their ability to inhibit SINV viral replication
and translation (Figures 3,4) recapitulating previous findings on
their inhibition of SINV viral production and luciferase
expression from reporters containing ZAP-sensitive fragments
(Guo et al., 2004;Chen et al., 2012;Luo et al., 2020). When
looking at SINV translation inhibition specifically, certain
residues appear to be more critical for inhibition, particularly
the CpG RNA binding mutants with the mutation Y108A
(Figures 4A, B). Taken with our finding of a significant
positive correlation between ZAP SINV RNA binding and
SINV replication inhibition (Figure 6B), but no correlation
between SINV RNA binding and SINV translation inhibition
(Table 1), our data suggests that general ZAP RNA binding is
less important than binding by particular residues for the specific
step of translation inhibition. We observed a similar rescue of
JEV translation inhibition with certain CpG RNA binding cavity
mutants (Figures 5A, B), pointing to the importance of the ZAP
CpG RNA binding cavities in facilitating translation inhibition of
diverse viruses.
Deletion of all four ZnFs eliminates ZAP’s ability to restrict
JEV (Chiu et al., 2018), but our data suggests that mutation of
ZnF 2 (C88R) and 4 (H191R) individually increases antiviral
activity (Figures 5A, B), potentially due to these mutants’
increased ability to interact with TRIM25 (Figures 2A, B).
Consistent with this, we found a significant positive correlation
between ZAP’s ability to interact with TRIM25 and its inhibition
of JEV translation (Figure 6D). We speculate that ZAP-TRIM25
interaction might potentiate TRIM25 recruitment and
ubiquitination of cellular substrates important for mediating
JEV translation inhibition and/or RNA degradation, since ZAP
can also mediate degradation of JEV RNA (Chiu et al., 2018).
One possible such substrate is KHNYN, which functions in viral
RNA degradation by ZAP and requires TRIM25 for its antiviral
activity (Ficarelli et al., 2019). Additional studies are needed to
evaluate these hypotheses.
By studying ZAP RNA binding mutations in both full-length
ZAPS and ZAPL, we uncovered isoform differences in their
effects on viral inhibition. The HFR CpG RNA binding cavity
mutant shows an impaired ability to inhibit replication of SINV
and translation of SINV and JEV in ZAPL, but not in ZAPS
(Figures 3–5). ZAPL contains a catalytically inactive C-terminal
PARP-like domain (Kerns et al., 2008) and a prenylation motif
within this domain that targets it to endosomal membranes
(Schwerk et al., 2019;Kmiec et al., 2021), which together may
alter the ability of ZAPL to bind RNA, interact with other cellular
or viral proteins, and inhibit viral translation in different viral
contexts. Additional mutagenesis studies targeting the PARP-like
domain are needed to tease out its role in mediating RNA
binding. Because we introduced our mutants into ZAP KO
cells, further work is also needed to address the possibility that
TABLE 1 | Quantified values for ZAP RNA binding mutant phenotypes.
Isoform Mutant SINV RNA binding ZAP-TRIM25
interaction
SINV replication
inhibition
SINV translation
inhibition
JEV translation
inhibition
ZAPS WT for ZnF mutants 161.914 0.131 4.545 1.252 1.446
ZAPS C88R 9.083 0.450 1.395 1.295 1.676
ZAPS H191R 15.452 1.052 1.951 N/A 2.184
ZAPS WT for cavity mutants 40.011 0.304 4.542 1.613 1.684
ZAPS V72A/Y108A/F144A 1.444 0.792 1.777 1.033 1.598
ZAPS H176A/Y184A/R189A 20.797 0.205 1.706 1.305 1.381
ZAPS C96A/Y98A 0.408 0.550 1.361 1.166 1.260
ZAPS K107A/Y108A 11.959 0.330 1.190 1.023 0.780
ZAPS E148A/K151A/R170A 95.909 0.189 5.015 N/A 1.226
ZAPL WT for ZnF mutants 93.414 0.055 12.652 1.574 2.416
ZAPL C88R 0.034 1.126 2.756 1.253 5.191
ZAPL H191R 0.761 0.899 3.043 N/A 9.046
ZAPL WT for cavity mutants 281.812 0.076 18.090 1.580 2.444
ZAPL V72A/Y108A/F144A 119.441 0.574 4.590 0.878 2.281
ZAPL H176A/F184A/R189A 125.392 0.030 1.396 0.922 1.357
ZAPL C96A/Y98A 68.060 0.329 4.774 1.257 3.551
ZAPL K107A/Y108A 93.185 0.086 3.071 0.969 1.138
ZAPL E148A/K151A/R170A 188.614 0.196 8.828 N/A 2.165
Immunoblots for ZAP SINV RNA binding assays and ZAP-TRIM25 co-IPs were quantified in ImageJ, with higher values indicating increased RNA or TRIM25 interaction. Fold inhibition
values for viral inhibition assays were calculated relative to empty plasmid transfection, with higher values indicating greater viral replication or translation inhibition. N/A: SINV translation
inhibition data on ZAP H191R and EKR mutants were not collected for analysis. Data are combined from two independent experiments.
Yang et al. ZAP and TRIM25 RNA Binding
Frontiers in Cellular and Infection Microbiology | www.frontiersin.org June 2022 | Volume 12 | Article 88692910

the function of ZAP RNA binding mutants could be modulated
by interactions between ZAPS and ZAPL, as well as with the
additional isoforms ZAPM and ZAPXL (Li et al., 2019).
For TRIM25, we found that the DRBD mutant has lost the
ability to bind SINV and JEV replicon RNA (Figures 1C,5D).
On the other hand, the TRIM25 7KA mutant shows increased
binding to SINV and JEV replicon RNA, as well as the Fluc
control RNA that is not bound by TRIM25 WT (Figures 1C,
5D). Previously, the TRIM25 7KA mutant was shown to be
deficient in binding to a short double-stranded RNA probe
(Sanchez et al., 2018). Similar to the ZAPS EKR mutant, we
speculate that our divergent findings on the TRIM25 7KA
mutant may result from differences in assays, and that the
binding function of the 7K motif may depend on the specific
RNA target. In our hands, the TRIM25 DRBD mutant is less
stable than the other TRIM25 constructs, and so its expression is
likely too low to be detected in the ZAP co-IP (Figure 2C). We
did observe that the TRIM25 7KA mutant shows a more robust
interaction with ZAPS and ZAPL than TRIM25 WT
(Figure 2C). Taken together with the increased binding of this
A
B
C
E
D
FIGURE 6 | Correlation analysis of ZAP RNA binding mutant phenotypes. Pearson correlation coefficients (r) and p-values (p) were calculated using the SciPy
package in Python and plotted using the Matplotlib and Seaborn packages. Pearson correlation coefficients are summarized in a heat map (A). Boxed coefficients
have statistically significant p-values (p < 0.05). Pairwise correlations with significant p-values from (A) are shown in (B–E).
Yang et al. ZAP and TRIM25 RNA Binding
Frontiers in Cellular and Infection Microbiology | www.frontiersin.org June 2022 | Volume 12 | Article 88692911

mutant to SINV RNA, our results suggest that RNA and ZAP
binding are not inversely related for TRIM25, unlike for ZAP.
While the TRIM25 DRBD mutant has lost its ability to restrict
SINV replication (Figure 3C), it is still able to inhibit SINV
translation similarly to TRIM25 WT despite some variability
across replicates (Figure 4C). We hypothesize that these
divergent phenotypes for SINV replication and translation
result from the variations in the TRIM25 DRBD mutant
expression, rather than a defect in activity. While the 7K motif
has been shown to be required for TRIM25 inhibition of dengue
virus (Sanchez et al., 2018), which is not sensitive to ZAP
inhibition (Chiu et al., 2018), our observations suggest that it is
dispensable in the context of ZAP-mediated viral translation
inhibition. In fact, given that the TRIM25 7KA mutant loses the
ability to inhibit JEV translation (Figure 5C) and binds JEV
replicon RNA more robustly than TRIM25 WT (Figure 5D),
excess binding of TRIM25 to its target RNA may even impede
viral translation inhibition in certain contexts. It is possible that
an increased presence of TRIM25 may hinder RNA or TRIM25
interactions with co-factors that function in JEV translation
inhibition, but not SINV translation inhibition; further work is
required to test this hypothesis. Taken together, our results
indicate that while RNA binding is important for TRIM25’s
general ability to inhibit SINV replication, it is likely not required
for translation inhibition specifically.
Overall, our findings suggest while ZAP RNA binding is
required for its antiviral activity, its ability to specifically
recognize CpG dinucleotides in viral RNA is more critical in
the process of viral translation inhibition. Additionally, ZAP
RNA binding and interaction with TRIM25 may represent two
distinct determinants for ZAP antiviral activity in varying viral
contexts. Altogether, our study has shed more light on the roles
of viral RNA binding and co-factor dependency in the
mechanism of ZAP translation inhibition and raised
interesting questions on the requirement of specific residues
for ZAP and TRIM25 RNA binding, protein-protein interaction,
and antiviral activity.
MATERIALS AND METHODS
Cell Culture, Viruses, and Infections
Dr. Akinori Takaoka at Hokkaido University generously
provided ZAP KO 293T cells (clone 89) and its parental 293T
lines (Hayakawa et al., 2011). TRIM25 KO 293T cells were
generated using CRISPR-Cas9 as previously described (Li et al.,
2017; unpublished data). Cells were cultured in Dulbecco’s
Modified Eagle Medium (DMEM, Thermo Fisher Scientific)
with 10% fetal bovine serum (FBS) added.
Infections with SINV expressing firefly luciferase (Toto1101/
Luc) and temperature-sensitive SINV (Toto1101/Luc:ts6) have
been previously described (Rice et al., 1987;Bick et al., 2003).
Each independent experiment included triplicate wells of
biological replicates per condition. BHK-21 cells were used to
generate viral stocks and titers for multiplicity of infection
calculations (Bick et al., 2003).
Plasmids and Transfections
The replication-defective JEV replicon plasmid was generously
provided by Dr. Bo Zhang at the Wuhan Institute of Virology (Li
et al., 2016). The plasmid pcDNA3.1-3XFLAG was kindly gifted
to us by Dr. Oliver Fregoso at UCLA. To generate pcDNA3.1-
myc, a myc tag was swapped in for the 3XFLAG tag using BamHI
and HindIII restriction sites. ZAPS and ZAPL were cloned into
pcDNA3.1-3XFLAG from pTRIP-TagRFP-hZAPS and pTRIP-
TagRFP-hZAPL (Li et al., 2017), respectively, using NotI and
XbaI restriction sites. Dr. Jae U. Jung at the University of
Southern California generously provided full-length TRIM25
(Gack et al., 2007). TRIM25 was cloned into both pcDNA3.1-
3XFLAG and pcDNA3.1-myc using XhoI and XbaI restriction
sites. All ZAP and TRIM25 constructs are myc- or 3XFLAG-
tagged on the N-terminal end.
Point mutations in ZAPS and ZAPL were generated using the
Q5 Site-Directed Mutagenesis Kit (New England Biolabs) and all
plasmids were verified by sequencing (Genewiz). Primers for
mutations were synthesized by Integrated DNA Technologies
(Supplementary Table 1). The TRIM25 DRBD mutant
(Choudhury et al., 2017) was generated by overlapping PCR
(Supplementary Table 1). The TRIM25 7KA mutant was
generated by ordering a gBlocks Gene Fragment from IDT
with all lysines in
381
KKVSKEEKKSKK
392
mutated to alanines
(Sanchez et al., 2018), and utilizing innate restriction sites in
TRIM25 “BsrGI and BamHI (underlined)”, to replace wild-type
sequence in TRIM25. The 7KA mutated sequence is bolded in
the below gene block, and nonessential nucleotides on the 5’and
3’ends are written in lowercase.
5’gtttTGTACAGTCAGATCAACGGGGCGTCGAGAGCACT
GGATGATGTGAGAAACAGGCAGCAGGATGTGCGGAT
GACTGCAAACAGAAAGGTGGAGCAGCTACAACAAGA
ATACACGGAAATGAAGGCTCTCTTGGACGCCTCAGAG
ACCACCTCGACAAGGAAGATAAAGGAAGAGGAGAAGA
GGGTCAACAGCAAGTTTGACACCATTTATCAGATTCTC
CTCAAGAAGAAGAGTGAGATCCAGACCTTGAAGGAGG
AGATTGAACAGAGCCTGACCAAGAGGGATGAGTTCGA
GTTTCTGGAGAAAGCATCAAAACTGCGAGGAATCTCAA
CAAAGCCAGTCTACATCCCCGAGGTGGAACTGAACCAC
AAGCTGATAAAAGGCATCCACCAGAGCACCATAGACCT
CAAAAACGAGCTGAAGCAGTGCATCGGGCGGCTCCAG
GAGCCCACCCCCAGTTCAGGTGACCCTGGAGAGCATG
ACCCAGCGTCCACACACAAATCCACACGCCCTGTG
GCAGCAGTCTCCGCAGAGGAAGCAGCATCCGCAGCA
CCTCCCCCTGTCCCTGCCTTACCCAGCAAGCTTCCCA
CGTTTGGAGCCCCGGAACAGTTAGTGGATTTAAAACA
AGCTGGCTTGGAGGCTGCAGCCAAAGCCACCAGCTCA
CATCCGAACTCAACATCTCTCAAGGCCAAGGTGCTGGA
GACCTTCCTGGCCAAGTCCAGACCTGAGCTCCTGGAGT
ATTACATTAAAGTCATCCTGGACTACAACACCGCCCAC
AACAAAGTGGCTCTGTCAGAGTGCTATACAGTAGCTTC
TGTGGCTGAGATGCCTCAGAACTACCGGCCGCATCCCC
AGAGGTTCACATACTGCTCTCAGGTGCTGGGCCTGCAC
TGCTACAAGAAGGGGATCCgttt-3’
Yang et al. ZAP and TRIM25 RNA Binding
Frontiers in Cellular and Infection Microbiology | www.frontiersin.org June 2022 | Volume 12 | Article 88692912

X-tremeGENE9 DNA Transfection Reagent (Roche Life Science)
was used to transfect cells at a ratio of 3 mLto1mg DNA
according to the manufacturer’s instructions. To keep the total
plasmid amount in co-transfections constant, empty vectors
pcDNA3.1-myc or 3XFLAG were transfected as necessary (6
well plate, 2 mg total input; 24 well plate, 250 ng total input).
In vitro Transcription
SINV DNA templates for transcription were generated by XhoI
linearization of pToto1101 (Rice et al., 1987). SINV RNA was
transcribed in vitro by Sp6 RNA polymerase (New England
Biolabs) in the presence of the cap analog [m7G(5’)ppp(5’)G]
(New England Biolabs). Fluc DNA templates for transcription
were amplified from the pGL3-Control plasmid (Promega). Fluc
RNA was transcribed in vitro using the mMESSAGE
mMACHINE T7 Transcription Kit (Invitrogen). Biotin-labeled
RNAs were generated by adding 10mM biotin-16-UTP (Roche
Life Science) to in vitro transcription reactions. JEV replicon
DNA templates for transcription were generated by XhoI
linearization and transcribed in vitro using the mMESSAGE
mMACHINE T7 Transcription Kit (Invitrogen). Transcribed
RNAs were purified using the Quick-RNA Miniprep Kit (Zymo
Research) and biotinylation was confirmed by streptavidin dot
blot (Chan et al., 2020).
In vitro RNA Pull-Down Assay
0.4 pmol of biotin-labeled SINV or Fluc RNA probes were heated
for 2 min at 90°C, chilled on ice for 2 min, and incubated with 50
mL 2x RNA structure buffer for 30 min at room temperature to
ensure proper secondary RNA structure formation, as previously
described (Bai et al., 2016). In vitro RNA pull-down was then
performed as previously described (Chiu et al., 2018). In brief,
RNA probes were incubated with 100 mg of lysates from ZAP or
TRIM25 KO 293T cells transfected with ZAP or TRIM25
constructs for 48 hours. Cell extracts were lysed by CHAPS
lysis buffer [10 mM Tris-HCl (pH 7.4), 1 mM MgCl
2
,1mM
EGTA,0.5%CHAPS,10%glycerol,and5mM2-
mercaptoethanol] with complete protease inhibitor cocktail
(Roche Life Science) and incubated with RNA probes in a final
volume of 100 mL RNA binding buffer supplemented with 1 unit/
mL RNAseOUT (Thermo Fisher Scientific), 1 mg/mL heparin
(Sigma-Aldrich), and 100 ng/mL yeast tRNA (ThermoFisher) for
30 min at 30°C. Lysate-RNA mixtures were then incubated with
300 mL of Dynabeads M-280 Streptavidin (Invitrogen) for
30 min at room temperature on a shaker. Protein-RNA
complexes were washed three times by RNA binding buffer,
and proteins were eluted by incubation with 30 mL of 4x Laemmli
Sample Buffer (Bio-Rad) for 5 min at 95°C. The proteins were
further analyzed by immunoblot and quantified by ImageJ as
previously described (Davarinejad, 2015). Briefly, to calculate the
quantity of ZAP or TRIM25 bound to RNA relative to input ZAP
or TRIM25 protein, the net value of the FLAG (ZAP or TRIM25)
band in the whole cell lysate was divided by the net value of the
b-actin loading control band in the whole cell lysate, giving a
normalized input value. The net value of the FLAG band in the
RNA IP band was then divided by the normalized input value.
Immunoblot Analysis
Proteins were resolved through SDS-PAGE using NuPAGE
MOPS SDS running buffer (Thermo Fisher Scientific) and 4-
15% precast Mini-PROTEAN TGX Gels (Bio-Rad) before
transferring to a PVDF membrane (Bio-Rad). Immunodetection
was achieved with 1:2,500 anti-myc (Cell Signaling Technology),
1:20,000 anti-FLAG (Sigma-Aldrich), and 1:20,000 anti-actin-HRP
(Sigma-Aldrich). Primary antibodies were detected with 1:20,000
goat anti-mouse HRP (Jackson ImmunoResearch) or 1:20,000 goat
anti-rabbit HRP (Thermo Fisher Scientific). Proteins were
visualized on a ChemiDoc (Bio-Rad) using ProSignal Pico ECL
Reagent (Genesee Scientific). ImageJ was used to quantify western
blots as previously described (Davarinejad, 2015). Briefly, protein
band intensities for each blot were measured by taking the net grey
mean value of each band. The net grey mean value is defined as the
inverted pixel density (255 –grey mean value) of a band with the
inverted pixel density of the background (defined as an equivalent
area of the blot above or below the band) subtracted.
Co-Immunoprecipitation Assay
To assess ZAP or TRIM25 co-immunoprecipitation (co-IP) with
RNA binding mutants of TRIM25 or ZAP, respectively, cells were
transfected in 6-well plates, collected, and then lysed by rotating in
FLAG IP buffer (100 mM Tris-HCl 8.0, 150 mM NaCl, 5 mM
EDTA, 1 mM DTT, 5% glycerol, 0.1% NP-40) supplemented with a
complete protease inhibitor cocktail (Roche Life Science) at 4°C for
30 min, before spinning down at 14,000 rpm at 4°C for 15 min. To
equilibrate beads prior to use, anti-FLAG beads (EZview™Red
ANTI-FLAG M2 Affinity Gel, Sigma-Aldrich) or anti-myc beads
(EZview™Red Anti-c-Myc Affinity Gel, Sigma-Aldrich) were
washed 3 times in FLAG IP buffer. Three hundred mLofwhole
cell lysate (WCL) were incubated with 30 mLofanti-FLAGor-myc
beads rotating at 4˚C for 45 minutes. FLAG IP buffer was used to
wash immunoprecipitates 3 times before eluting bound proteins
with SDS loading buffer, and boiling for 5 minutes for immunoblot
analysis. Western blot ImageJ analysis was performed as previously
described (Davarinejad, 2015). Briefly, to calculate the relative
quantity of ZAP RNA binding mutants in the myc (TRIM25)
co-IP, the net value of the FLAG (ZAP) IP band, defined as the net
grey mean value of ZAP alone subtracted from each mutant band,
was divided by the net value of the myc IP for each mutant. To
calculate the relative quantity of TRIM25 RNA binding mutants in
theFLAG(ZAP)co-IP,thenetvalueofthemyc(TRIM25)IP
band, defined as the net grey mean value of TRIM25 alone
subtracted from each mutant band, was divided by the net value
of the FLAG IP for each mutant. To account for the different
expression levels of TRIM25 mutants, the myc IP band was first
divided by the net grey mean value of the myc WCL band for each
mutant, normalized to the value of the band for TRIM25 alone.
JEV Replicon Reporter Assay
Following transfection of ZAP or TRIM25 constructs into ZAP
or TRIM25 KO 293T for 48 hours, JEV replicon RNA was
transfected by TransIT-mRNA Transfection Kit (Mirus Bio).
Cells were lysed 4 hours post-transfection of replicon RNA and
luciferase activity was measured by Dual-Luciferase Reporter
Yang et al. ZAP and TRIM25 RNA Binding
Frontiers in Cellular and Infection Microbiology | www.frontiersin.org June 2022 | Volume 12 | Article 88692913

Assay (Promega). Each independent experiment included
triplicate wells of biological replicates per condition.
Statistical Analysis
Statistical analyses in Figures 3–5were performed on biological
replicates from triplicate wells using GraphPad Prism. Statistical
analyses in Figure 6 were performed using the SciPy package in
Python and visualized using the Matplotlib and Seaborn
packages (Hunter, 2007;Virtanen et al., 2020;Waskom, 2021).
DATA AVAILABILITY STATEMENT
The original contributions presented in the study are included in
the article/Supplementary Material. Further inquiries can be
directed to the corresponding author.
AUTHOR CONTRIBUTIONS
EY, LN, and ML conceptualized and designed the study. CW and
RK assisted in cloning ZAP and TRIM25 RNA binding mutants.
LN performed RNA binding and JEV replicon experiments,
while EY performed co-IP and SINV replication and
translation experiments. LN performed the correlation analysis.
EY and LN co-wrote the first draft of the manuscript. ML
provided critical feedback. All authors contributed to
manuscript revision, read, and approved the submitted version.
FUNDING
This work was supported in part by NIH R01AI158704 (ML),
UCLA AIDS Institute and Charity Treks 2019 Seed Grant (ML),
Ruth L. Kirschstein Multidisciplinary Training Grant in
Microbial Pathogenesis (NRSA AI007323; EY), Ruth L.
Kirschstein Cellular and Molecular Biology Training Program
(NRSA GM007185; LN), Warsaw Fellowship (EY), and
Whitcome Fellowship (EY, LN).
ACKNOWLEDGMENTS
We thank Dr. Keriann Backus, Dr. Jian Cao, and Ashley Julio at
the University of California, Los Angeles, for technical help with
the streptavidin dot blot.
SUPPLEMENTARY MATERIAL
The Supplementary Material for this article can be found online
at: https://www.frontiersin.org/articles/10.3389/fcimb.2022.
886929/full#supplementary-material
Supplementary Figure 1 | Expression of ZAP and TRIM25 mutants. (A-E) Final
transfected DNA amounts for each mutant written below, where 1k = 1 mg of DNA.
(A) Western blot of ZAPS zinc finger (ZnF) mutants. (B) Western blot of ZAPL ZnF
mutants. (C) Western blot of ZAPS CpG RNA binding cavity mutants. (D) Western
blot of ZAPL CpG RNA binding cavity mutants. Yellow highlighted cells indicate the
selected amount to transfect for subsequent experiments. (E) Western blot of
TRIM25 RNA binding mutants.
Supplementary Figure 2 | Effect of SINV infection on ZAP and TRIM25 protein
expression. (A, B) ZAP KO 293T cells or (C) TRIM25 KO 293T cells were
transfected with (A) ZAPS RNA binding mutants, (B) ZAPL RNA binding mutants, or
(C) TRIM25 RNA binding mutants. Lysates were harvested at 0 and 24 h.p.i. with
SINV Toto1101/luc infection at an MOI of 0.01 PFU/cell. Data from triplicate wells
are representative of two independent experiments
Supplementary Figure 3 | Effect of replication-deficient SINV infection on ZAP
and TRIM25 protein expression. (A, B) ZAP KO 293T cells or (C) TRIM25 KO 293T
cells were transfected with (A) ZAPS RNA binding mutants, (B) ZAPL RNA binding
mutants, or (C) TRIM25 RNA binding mutants. Lysates were harvested at 0 and
6 h.p.i. with SINV Toto1101/luc:ts6 infection at an MOI of 1 PFU/cell. Data from
triplicate wells are representative of two independent experiments.
Supplementary Figure 4 | Sensitivity of the firefly luciferase control RNA to ZAP.
(A, B) ZAP KO 293T cells or (C) TRIM25 KO 293T cells were transfected with (A)
ZAPS RNA binding mutants, (B) ZAPL RNA binding mutants, or (C) TRIM25 RNA
binding mutants, transfected with firefly luciferase (Fluc) RNA, and lysed 4 hours
post-RNA transfection for measurement of luciferase activity. Data from triplicate
wells are representative of two independent experiments. Asterisks indicate
statistically significant differences as compared to (A, B) ZAP WT or (C) TRIM25 WT
within each subset of RNA binding mutants (by one-way ANOVA and Dunnett’s
multiple comparisons test: *p<0.05; **p<0.01; ***p<0.001). Unlabeled comparisons
are not significant.
REFERENCES
Bai, Q., Bai, Z., Xu, S., and Sun, L. (2016). Detection of RNA-Binding Proteins by
In Vitro RNA Pull-Down in Adipocyte Culture. JoVE (J Visualized
Experiments) 113, e54207. doi: 10.3791/54207
Bick, M. J., Carroll, J.-W. N., Gao, G., Goff, S. P., Rice, C. M., and MacDonald, M.
R. (2003). Expression of the Zinc-Finger Antiviral Protein Inhibits Alphavirus
Replication. J. Virol. 77, 11555–11562. doi: 10.1128/JVI.77.21.11555-
11562.2003
Chan, D., Feng, C., England, W., Wyman, D., Flynn, R. A., Wang, X., et al. (2020).
Transcriptome-Wide Combinatorial RNA Structure Probing in Living Cells.
bioRxiv 2020, 3.24.006866. doi: 10.1101/2020.03.24.006866
Charron, G., Li, M. M. H., MacDonald, M. R., and Hang, H. C. (2013). Prenylome
Profiling Reveals S-Farnesylation is Crucial for Membrane Targeting and
Antiviral Activity of ZAP Long-Isoform. Proc. Natl. Acad. Sci. 110, 11085–
11090. doi: 10.1073/pnas.1302564110
Chen, S., Xu, Y., Zhang, K., Wang, X., Sun, J., Gao, G., et al. (2012). Structure of N-
Terminal Domain of ZAP Indicates How a Zinc-Finger Protein Recognizes
Complex RNA. Nat. Struct. Mol. Biol. 19, 430–435. doi: 10.1038/nsmb.2243
Chiu, H.-P., Chiu, H., Yang, C.-F., Lee, Y.-L., Chiu, F.-L., Kuo, H.-C., et al. (2018).
Inhibition of Japanese Encephalitis Virus Infection by the Host Zinc-Finger
Antiviral Protein. PloS Pathog. 14, e1007166. doi: 10.1371/journal.ppat.1007166
Choudhury, N. R., Heikel, G., Trubitsyna, M., Kubik, P., Nowak, J. S., Webb, S.,
et al. (2017). RNA-Binding Activity of TRIM25 is Mediated by its PRY/SPRY
Domain and is Required for Ubiquitination. BMC Biol. 15, 105. doi: 10.1186/
s12915-017-0444-9
Davarinejad, H. (2015). Quantifications of Western Blots With ImageJ. Univ.
York.
Ficarelli, M., Neil, S. J. D., and Swanson, C. M. (2021). Targeted Restriction of
Viral Gene Expression and Replication by the ZAP Antiviral System. Annu.
Rev. Virol. 8, 265–283. doi: 10.1146/annurev-virology-091919-104213
Ficarelli, M., Wilson, H., Pedro Galão, R., Mazzon, M., Antzin-Anduetza, I.,
Marsh, M., et al. (2019). KHNYN is Essential for the Zinc Finger Antiviral
Protein (ZAP) to Restrict HIV-1 Containing Clustered CpG Dinucleotides.
eLife 8, e46767. doi: 10.7554/eLife.46767
Gack, M. U., Shin, Y. C., Joo, C.-H., Urano, T., Liang, C., Sun, L., et al. (2007).
TRIM25 RING-Finger E3 Ubiquitin Ligase is Essential for RIG-I-Mediated
Antiviral Activity. Nature 446, 916–920. doi: 10.1038/nature05732
Yang et al. ZAP and TRIM25 RNA Binding
Frontiers in Cellular and Infection Microbiology | www.frontiersin.org June 2022 | Volume 12 | Article 88692914

Garcia-Moreno, M., Noerenberg, M., Ni, S., Järvelin, A. I., Gonzalez-Almela, E.,
Lenz, C. E., et al. (2019). System-Wide Profiling of RNA-Binding Proteins
Uncovers Key Regulators of Virus Infection. Mol. Cell 74, 196–211.e11.
doi: 10.1016/j.molcel.2019.01.017
Goncalves-Carneiro, D., Takata, M. A., Ong, H., Shilton, A., and Bieniasz, P. D.
(2021). Origin and Evolution of the Zinc Finger Antiviral Protein. PloS Pathog.
17, e1009545. doi: 10.1371/journal.ppat.1009545
Guo, X., Carroll, J.-W. N., MacDonald, M. R., Goff, S. P., and Gao, G. (2004). The
Zinc Finger Antiviral Protein Directly Binds to Specific Viral mRNAs Through
the CCCH Zinc Finger Motifs. J. Virol. 78, 12781–12787. doi: 10.1128/
JVI.78.23.12781-12787.2004
Guo, X., Ma, J., Sun, J., and Gao, G. (2007). The Zinc-Finger Antiviral Protein
Recruits the RNA Processing Exosome to Degrade the Target mRNA. Proc.
Natl. Acad. Sci. 104, 151–156. doi: 10.1073/pnas.0607063104
Hayakawa, S., Shiratori, S., Yamato, H., Kameyama, T., Kitatsuji, C., Kashigi, F.,
et al. (2011). ZAPS is a Potent Stimulator of Signaling Mediated by the RNA
Helicase RIG-I During Antiviral Responses. Nat. Immunol. 12, 37–44.
doi: 10.1038/ni.1963
Hunter, J. D. (2007). Matplotlib: A 2d Graphics Environment. Computing Sci. Eng.
9, 90–95. doi: 10.1109/MCSE.2007.55
Kerns, J. A., Emerman, M., and Malik, H. S. (2008). Positive Selection and
Increased Antiviral Activity Associated With the PARP-Containing Isoform
of Human Zinc-Finger Antiviral Protein. PloS Genet. 4, e21. doi: 10.1371/
journal.pgen.0040021
Kmiec, D., Lista, M. J., Ficarelli, M., Swanson, C. M., and Neil, S. J. D. (2021). S-
Farnesylation is Essential for Antiviral Activity of the Long ZAP Isoform
Against RNA Viruses With Diverse Replication Strategies. PloS Pathog. 17,
e1009726. doi: 10.1371/journal.ppat.1009726
Li, M. M. H., Aguilar, E. G., Michailidis, E., Pabon, J., Park, P., Wu, X., et al. (2019).
Characterization of Novel Splice Variants of Zinc Finger Antiviral Protein
(ZAP). J. Virol. 93, e00715-19,/jvi/93/18/JVI.00715-19.atom. doi: 10.1128/
JVI.00715-19
Li, X.-D., Deng, C.-L., Ye, H.-Q., Zhang, H.-L., Zhang, Q.-Y., Chen, D.-D., et al.
(2016). Transmembrane Domains of NS2B Contribute to Both Viral RNA
Replication and Particle Formation in Japanese Encephalitis Virus. J. Virol 90,
5735-5749. doi: 10.1128/JVI.00340-16
Li, M. M. H., Lau, Z., Cheung, P., Aguilar, E. G., Schneider, W. M., Bozzacco, L.,
et al. (2017). TRIM25 Enhances the Antiviral Action of Zinc-Finger Antiviral
Protein (ZAP). PloS Pathog. 13, e1006145. doi: 10.1371/journal.ppat.1006145
Luo, X., Wang, X., Gao, Y., Zhu, J., Liu, S., Gao, G., et al. (2020). Molecular
Mechanism of RNA Recognition by Zinc-Finger Antiviral Protein. Cell Rep. 30,
46–52.e4. doi: 10.1016/j.celrep.2019.11.116
Meagher, J. L., Takata, M., Goncalves-Carneiro, D., Keane, S. C., Rebendenne, A.,
Ong, H., et al. (2019). Structure of the Zinc-Finger Antiviral Protein in
Complex With RNA Reveals a Mechanism for Selective Targeting of CG-
Rich Viral Sequences. Proc.Natl.Acad.Sci.U.S.A.116, 24303–24309.
doi: 10.1073/pnas.1913232116
Rice, C. M., Levis, R., Strauss, J. H., and Huang, H. V. (1987). Production of
Infectious RNA Transcripts From Sindbis Virus cDNA Clones: Mapping of
Lethal Mutations, Rescue of a Temperature-Sensitive Marker, and In Vitro
Mutagenesis to Generate Defined Mutants. J. Virol. 61, 3809–3819. doi:
10.1128/jvi.61.12.3809-3819.1987
Sanchez, J. G., Sparrer, K. M. J., Chiang, C., Reis, R. A., Chiang, J. J., Zurenski, M.
A., et al. (2018). TRIM25 Binds RNA to Modulate Cellular Anti-Viral Defense.
J. Mol. Biol. 430, 5280–5293. doi: 10.1016/j.jmb.2018.10.003
Schwerk, J., Soveg, F. W., Ryan, A. P., Thomas, K. R., Hatfield, L. D., Ozarkar, S.,
et al. (2019). RNA-Binding Protein Isoforms ZAP-S and ZAP-L Have Distinct
Antiviral and Immune Resolution Functions. Nat. Immunol. 20, 1610–1620.
doi: 10.1038/s41590-019-0527-6
Takata, M. A., Goncalves-Carneiro, D., Zang, T. M., Soll, S. J., York, A., Blanco-
Melo, D., et al. (2017). CG Dinucleotide Suppression Enables Antiviral Defence
Targeting non-Self RNA. Nature 550, 124–127. doi: 10.1038/nature24039
Virtanen, P., Gommers, R., Oliphant, T. E., Haberland, M., Reddy, T., Cournapeau,
D., et al. (2020). SciPy 1.0: Fundamental Algorithms for Scientific Computing in
Python. Nat. Methods 17, 261–272. doi: 10.1038/s41592-019-0686-2
Wang, X., Lv, F., and Gao, G. (2010). Mutagenesis Analysis of the Zinc-Finger
Antiviral Protein. Retrovirology 7, 19. doi: 10.1186/1742-4690-7-19
Waskom, M. L. (2021). Seaborn: Statistical Data Visualization. J. Open Source
Softw 6, 3021. doi: 10.21105/joss.03021
Yang, E., and Li, M. M. H. (2020). All About the RNA: Interferon-Stimulated
Genes That Interfere With Viral RNA Processes. Front. Immunol. 11.
doi: 10.3389/fimmu.2020.605024
Zheng, X., Wang, X., Tu, F., Wang, Q., Fan, Z., and Gao, G. (2017). TRIM25 Is
Required for the Antiviral Activity of Zinc Finger Antiviral Protein. J. Virol. 91,
e00088-17,/jvi/91/9/e00088-17.atom. doi: 10.1128/JVI.00088-17
Zhu, Y., Chen, G., Lv, F., Wang, X., Ji, X., Xu, Y., et al. (2011). Zinc-Finger
Antiviral Protein Inhibits HIV-1 Infection by Selectively Targeting Multiply
Spliced Viral mRNAs for Degradation. Proc. Natl. Acad. Sci. 108, 15834–15839.
doi: 10.1073/pnas.1101676108
Zhu, Y., Wang, X., Goff, S. P., and Gao, G. (2012). Translational Repression
Precedes and is Required for ZAP-Mediated mRNA Decay: ZAP-Mediated
Translational Repression Versus mRNA Decay. EMBO J. 31, 4236–4246.
doi: 10.1038/emboj.2012.271
Conflict of Interest: The authors declare that the research was conducted in the
absence of any commercial or financial relationships that could be construed as a
potential conflict of interest.
Publisher’s Note: All claims expressed in this article are solely those of the authors
and do not necessarily represent those of their affiliated organizations, or those of
the publisher, the editors and the reviewers. Any product that may be evaluated in
this article, or claim that may be made by its manufacturer, is not guaranteed or
endorsed by the publisher.
Copyright © 2022Yang, Nguyen, Wisherop, Kan and Li. This is an open-access article
distributed under the terms of the Creative Commons Attribution License (CC BY).
The use, distribution or reproduction in other forums is permitted, provided the
original author(s) and the copyright owner(s) are credited and that the original
publicationin thisjournal is cited, in accordance with accepted academic practice. No
use, distribution or reproduction is permitted which does not comply with these terms.
Yang et al. ZAP and TRIM25 RNA Binding
Frontiers in Cellular and Infection Microbiology | www.frontiersin.org June 2022 | Volume 12 | Article 88692915