Available via license: CC BY 4.0
Content may be subject to copyright.
Citation: Saewan, N. Effect of Coffee
Berry Extract on Anti-Aging for Skin
and Hair—In Vitro Approach.
Cosmetics 2022,9, 66. https://
doi.org/10.3390/cosmetics9030066
Academic Editors: Kazuhisa Maeda
and Enzo Berardesca
Received: 25 April 2022
Accepted: 6 June 2022
Published: 16 June 2022
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
Copyright: © 2022 by the author.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
cosmetics
Article
Effect of Coffee Berry Extract on Anti-Aging for Skin and
Hair—In Vitro Approach
Nisakorn Saewan 1,2
1School of Cosmetic Science, Mae Fah Luang University, 333, Moo.1, Thasud, Muang,
Chiang Rai 57100, Thailand; nisakorn@mfu.ac.th
2Cosmetic and Beauty Innovations for Sustainable Development (CBIS) Research Group,
Mae Fah Luang University, 333, Moo.1, Thasud, Muang, Chiang Rai 57100, Thailand
Abstract:
The aging process encompasses gradual and continuous changes at the cellular level that
slowly accumulate with age. The signs of aging include many physiological changes in both skin
and hair such as fine lines, wrinkles, age spots, hair thinning and hair loss. The aim of the current
study was to investigate the anti-aging potential of coffee berry extract (CBE) on human dermal
fibroblast (HDF) and hair follicle dermal papilla (HFDP) cells. Coffee berry was extracted by 50%
ethanol and determined for chemical constituents by HPLC technique. Cytotoxicity of the extract was
examined on both cells by MTT assay. Then, HDF cells were used to evaluate antioxidant properties
by using superoxide dismutase activity (SOD) and nitric oxide inhibition as well as anti-collagenase
inhibition assays. The effectiveness of anti-hair loss properties was investigated in HFDP cells by
considering cell proliferation, 5
α
-reductase inhibition (5AR), and growth factor expression. The
results showed that caffeine and chlorogenic acid were identified as major constituents in CBE. CBE
had lower toxicity and cell proliferation than caffeine and chlorogenic acid on both cells. CBE showed
SOD and nitric oxide inhibition activities that were higher than those of caffeine but lower than
those of chlorogenic acid. Interestingly, CBE had the highest significant anti-collagenase activity,
and its 5AR inhibition activity was comparable to that of chlorogenic acid, which was higher than
caffeine. CBE also stimulated hair-related gene expression, especially insulin-like growth factor 1
(IGF-1), keratinocyte growth factor (KGF) and vascular endothelial growth factor (VEGF). The results
confirmed that CBE provided anti-aging activity on both skin and hair cells and could be beneficial
for applications in cosmeceuticals.
Keywords:
anti-aging; antioxidant; growth factor; hair growth; hair loss; superoxide dismutase;
5α-reductase inhibition
1. Introduction
Aging is a biological process defined as a gradual and continuous decline over time
in cellular and organismal function during a lifetime that ultimately leads to senescence.
Skin aging occurs as the result of intrinsic aging (natural consequence and genetics) and
extrinsic aging (skin’s response to external damage). The signs of skin aging include
hyperpigmentation, loss of elasticity and laxity, fine lines and wrinkles, telangiectasia,
uneven texture, enlarged pores, baggy eyes, keratosis, etc. [
1
]. Hair aging comprises
weathering of the hair shaft and aging of the hair follicle, which shows striking changes
in hair diameter, luster, texture, and loss [
2
]. To prevent and attenuate the aging process,
many research studies worldwide has been conducted in searching for active ingredients
with ability to restore skin elasticity, slow the formation of skin wrinkles, and reduce
hair thinning and loss. Plant extracts are popularly used in both skin and hair anti-
aging cosmetics because their wide variety of functions, including those of antioxidants
and immunostimulants, and for radical-scavenging, UV protection, 5-AR inhibition, hair
growth promotion, etc. [1,2].
Cosmetics 2022,9, 66. https://doi.org/10.3390/cosmetics9030066 https://www.mdpi.com/journal/cosmetics
Cosmetics 2022,9, 66 2 of 19
Coffee, a popular beverage worldwide, is made from the roasted coffee bean. Reg-
ularly drinking coffee has been reported to reduce the oxidation of human low-density
lipoprotein (LDL) and the risk of atherosclerosis as well as improve psychoactive responses,
neurological conditions and metabolic disorders [
3
,
4
]. Coffee berry is the fruit of coffee
plants, which when ripe is round with red and purple colors. In general, each coffee
berry contains 2 seeds (beans) that are usually green in color and known as green bean
or green coffee. The bean is mainly endosperm tissue surrounded by the endocarp and
testa (silverskin) [
5
]. In the processing of coffee, the husk and pulp are removed as waste
byproducts from the coffee beans, which are further roasted to obtain coffee aroma.
Coffee is a rich source of antioxidant and prooxidant compounds such as caffeine and
chlorogenic acids [
6
]. Recently, there has been an attempt to expand the uses of coffee
in personal care products due to its antioxidant and anti-aging properties. Caffeine is an
antioxidant that neutralizes excess free radicals, inhibits lipid peroxidation, protects cells
from free radical damage, improves cell oxygenation and microcirculation and stimulates
cell metabolism [
7
,
8
]. Chlorogenic acid is an important biologically active polyphenol
that has important antioxidant, anti-inflammatory, and anti-microbial properties [
9
–
11
].
Furthermore, chlorogenic acid significantly reduces the wound area size during the in-
flammatory phase [
12
]. Desai and Mallya reported that green coffee bean extract showed
anti-elastase activity in L929 cell lines without toxicity [
13
]. Zofia et al. demonstrated that
green coffee bean and kombucha extracts exhibit anti-aging properties through inhibition
of enzyme collagenase and elastase activities in keratinocyte and fibroblast cell lines [
14
].
Coffee silverskin extracts have the potential to reduce the production of intracellular ROS
in keratinocytes, improve hydration and firmness, and protect against skin photoaging
induced by UV radiation [
15
]. In our previous study, extract of coffee byproducts showed
high phenolic content with good antioxidant activities in Ferric reducing power, DPPH
radical scavenging, nitric oxide inhibition, and increased superoxide dismutase activity [
16
].
The literature has demonstrated that all parts of coffee fruit contain bioactive compounds.
Using the whole fruit has high potential for application in new anti-aging formulations.
In a study by McDaniel, twice-daily application of 1% coffee berry extract in cream and
0.1% extract in cleanser showed improvement of skin appearance, fine lines and wrinkles,
roughness and dryness, and skin pigmentation. Skin biopsies showed that application of
the products reduced MMP-1 and IL-1
β
. The extract also showed up-regulation of gene
expression for four collagen structural proteins and down-regulated gene expression for
three MMPs [17].
Although various biological activities of coffee extracts have been reported and cos-
metics containing coffee extract are available in the market [
16
,
18
–
20
], information about
the mechanism of action of coffee berry in human cell-based assays, in comparison with its
major compounds, caffeine and chlorogenic acid, is limited. To obtain useful information
for cosmetic applications, this study aimed to investigate skin anti-aging and anti-hair loss
along with hair growth promoting potential of CBE and its major components in human
skin (HDF) and hair (HFDP) cells. HDF cells were used to determine skin antioxidant,
cell proliferation and anti-collagenase activities. Additionally, HFDP cells were applied to
evaluate the effect of the extract on hair cell proliferation, 5
α
-reductase inhibition, and gene
expression of IGF-1, KGF, hepatocyte growth factor (HGF), and VEGF. In all experiments,
caffeine and chlorogenic acid, the predominant compounds in coffee extract, were used as
positive compounds.
2. Materials and Methods
Ethanol, sulfuric acid, and trichloroacetic acid were purchased from Merck, Darmstadt,
Germany. 1,1-Diphenyl-2-picrylhydrazyl (DPPH), caffeine, chlorogenic acid, folin-ciocalteu
reagent, gallic acid, lipopolysaccharide (LPS), phenylmethanesulfonyl fluoride, sodium
carbonate, Tris/HCl, triton x-100, vanillin and SOD assay Kit-WST were purchased from
Sigma-Aldrich Co., St. Louis, MO, USA. Ferric chloride and potassium ferricyanide were
purchased from Fisher scientific, Waltham, MA, USA.
Cosmetics 2022,9, 66 3 of 19
Dimethyl sulfoxide (DMSO) and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide (MTT) were purchased from Bio Basic Inc., Markham, ON, Canada. Penicillin
streptomycin solution, phosphate buffered saline (PBS), and trypsin/EDTA solution were
purchased from Gibco, Grand Island, NY, USA. Fetal bovine serum, human hair follicle
dermal papilla cells (C-12071), follicle dermal papilla cell growth medium (C26501), human
dermal fibroblast (C-12302) and fibroblast growth medium (C-23020) were purchased from
PromoCell GmbH, Heidelberg, Germany.
2.1. Extraction
The fresh coffee berries were collected from Chiang Rai, Thailand in September 2019.
The berries were washed and air dried at ambient temperature. Then, they were crushed
into small pieces using a blender. The coffee berries (100 g) were soaked in 50% ethanol
(500 mL) in a sonication bath at 20 MHz at room temperature for 30 min. The extract
was filtered with Whatman No. 1 filter paper. Then, the extracts were evaporated by
a rotary evaporator (Buchi R-114 Rotary Vap System) at 40
◦
C and stored at 4
◦
C until
being analyzed.
2.2. Determination of Caffeine and Chlorogenic Acid
The quantities of caffeine and chlorogenic acid were analyzed using high-performance
liquid chromatography (HPLC, 1290 Infinity II LC System, Agilent Technologies, Wald-
bronn, Germany) with photodiode array (PDA) detection at 280 nm. CBE was filtered
through Whatman
®
membrane filters with nylon pore size of 0.2
µ
m, and then, 10
µ
L of the
extract was injected into a Poroshell 120 EC-C18 (250 mm o
×
4.6 mm, 4
µ
m). The mobile
phase systems were (A) acetonitrile and 1.5% acetic acid with a ratio of 10:90, and (B) ace-
tonitrile and 1.5% of acetic acid with a ratio of 15:85; elution with a flow rate of 1 mL/min
of A from 0 to 6 min and B from 6 to 12 min. The retention times of chlorogenic acid and
caffeine standards were 7.21 and 7.86 min. The peak areas were automatically integrated,
and the chromatograms were plotted and processed by computer using Agilent software.
The standard calibration curves were created by plotting peak areas obtained from HPLC
analysis against concentrations of standard solution. The stock solutions of caffeic acid and
chlorogenic acid were dissolved in DMSO and diluted to give concentrations of 5, 10, 25, 50
and 100
µ
g/ mL for preparation of the calibration range. The calibration curves of both
standards were fitted by linear regression. The concentrations of caffeine and chlorogenic
acid were calculated using the calibration curve of the standards.
2.3. Cell Culture
HDF and HFDP cells were cultured in medium supplemented with 10% fetal bovine
serum and 1% penicillin streptomycin solution. Cells were cultured until reaching 90%
confluence, and then, cells (20,000 cells/mL) were counted into new microwell plates
and incubated at 37
◦
C in a 5% CO
2
humidified incubator for 24 h before being used for
further determination.
2.4. Cytotoxicity
HDF and HFDP cells were used to investigate the cytotoxicity of the test samples by
MTT assay [
21
]. Both cells were treated with the diluted extract, caffeine and chlorogenic
acid at a concentration of 0–5 mg/mL for 24 h. Afterward, the culture medium was
removed, and 50
µ
L of MTT solution (0.1 mg/mL) was added to each well and incubated
for a further 4 h. DMSO (100
µ
L) was added to all wells and incubated at room temperature
for 30 min. The absorbance of each well was measured at 570 nm using a microplate
reader (Biochrom, Cambridge, UK). The percentage of cell viability was calculated using
the formula:
Viable cell (%) = (Atreated group)
(Auntreated group)×100
Cosmetics 2022,9, 66 4 of 19
The cytotoxicity of test samples was expressed in terms of IC
50
, which is the concen-
tration of test sample needed to induce 50% inhibition of cell growth, as compared with
untreated control cells. Then, the non-cytotoxic concentration of the sample was chosen to
use as the test concentration in further experiments.
2.5. Cell Proliferation
HDF and HFDP cell proliferation-promoting activity was determined by a modified
MTT proliferation method [
22
]. The samples with the maximum nontoxic dose were added
to cells (20,000 cells/mL) and incubated at 37
◦
C in a 5% CO
2
humidified incubator for
72 h. Then, the culture medium was removed. A 50
µ
L amount of filtered sterilized MTT
solution (0.1 mg/mL) was added and incubated for 4 h. At the end of the incubation,
100
µ
L of dimethylsulfoxide was added, followed by incubatation for a further 30 min. The
absorbance was measured at 570 nm using a microplate reader (Biochrom, Holliston, MA,
USA). The proliferation of both cells was calculated according to the following equation:
Cell proliferation (%) = (Asample −Acontrol)
(Acontrol)×100
where A
control
is the absorbance of the control (without test sample), and A
sample
is the
absorbance in the presence of the test sample.
2.6. Antioxidant Activity by Superoxide Dismutase
Superoxide dismutase activity on cells was determined by using the modified SOD
determination kit [
22
]. HDF cells were supplemented with 100
µ
L of the sample and
incubated for 24 h. Then, cells were harvested with 0.05% trypsin solution. Cells were lysed
with lysis buffer (20 mM Tris/HCl, 0.5 mM phenylmethanesulfonyl and 0.2% triton x-100)
and centrifuged at 3000 rpm for 15 min. The SOD activity in supernatants was measured
by using SOD assay Kit (Sigma-Aldrich, St. Louis, MO, USA). Briefly, 20
µ
L of supernatant
was added with 200
µ
L of WST working solution and 20
µ
L of enzyme working solution.
Then, the mixture was incubated at 37
◦
C for 20 min, and the absorbance measured at
450 nm using a microplate reader (Biochrom, Holliston, MA, USA). The SOD activity was
calculated using the following equation:
SOD activity (%) = (Acontrol −Asample)
(Acontrol)×100
where
Acontrol
is the absorbance of the control (without extract), and
Asample
is the ab-
sorbance in the presence of the test sample.
2.7. Antioxidant Activity by Nitric Oxide Inhibition
HDF cells were supplemented with 100
µ
L of sample before being stimulated with
1
µ
g/mL lipopolysaccharide (LPS) and incubated for 24 h. The nitric oxide production
was assessed using the Griess reagent system (Promega, Madison, WI, USA). In brief, the
culture medium (50
µ
L) was combined with 50
µ
L of sulfanilamide solution and 50
µ
L
of 0.1% N-1-napthylethylenediamine dihydrochloride solution. Then, the mixture was
incubated at room temperature for 5 min, and the absorbance was measured at 540 nm
using a microplate reader (Biochrom, Holliston, MA, USA). The amount of nitrite in the
samples was determined using a sodium nitrite standard curve, and the percentage of
nitric oxide inhibition was calculated as follows:
Inhibition of nitric oxide (%) = (Acontrol −Asample)
(Acontrol)×100
where
Acontrol
is the absorbance of the control (without extract), and
Asample
is the ab-
sorbance in the presence of the test sample.
Cosmetics 2022,9, 66 5 of 19
2.8. Anti-Collagenase Activity
Matrix metalloproteinase-1 (MMP-1) colorimetric drug discovery kit, which was
designed to screen MMP-1 inhibitors using a thiopeptide as a chromogenic substrate, was
used to determine collagenase inhibition activity. HDF cells were supplemented with a
100
µ
L sample and incubated for 24 h. Then, cells were harvested with 0.05% trypsin
solution. Cells were lysed with lysis buffer and centrifuged at 3000 rpm for 15 min. The
supernatants, 20
µ
L of 153 mU/
µ
L MMP-1 and 20
µ
L of 1.3
µ
M prototypic control inhibitor,
were mixed and incubated at 37
◦
C for 60 min to allow interaction between inhibitor and
enzyme. Next, 10
µ
L of 100
µ
M thiopeptide was added, and then, the absorbance was
measured at 412 nm. The percentage of collagenase inhibition was calculated as:
Collagenase inhibition (%) = (Acontrol −Asample)
(Acontrol)×100
where
Acontrol
is the absorbance of the control (without test sample), and
Asample
is the
absorbance in the presence of the test sample.
2.9. 5α-Reductase Inhibition
HFDP cells were cultured with medium without fetal bovine serum for 24 h. Then,
the cells were incubated with the samples for 24 h. Total RNAs were extracted by acid
guanidinium thiocyanate-phenol-chloroform method. Then, 2 mg of total RNAs were
reverse transcribed with M-MLV reverse transcriptase in the presence of random hexamer.
The cDNA obtained from this reaction was used as a DNA template for PCR reactions. The
PCR-thermal profile started with an initial denaturation at 94
◦
C for 3 min, followed by
35 cycles of denaturation at 94
◦
C for 30 s, annealing at 52
◦
C for 30 s, and extension at
72
◦
C for 2 min, followed by a final extension at 72
◦
C for 10 min. The PCR products were
analyzed using 1% agarose gel electrophoresis and quantified using a densitometer [23].
2.10. Growth Factor Gene Expression
HFDP cells were cultured with medium without fetal bovine serum for 24 h. Then,
the cells were incubated with the samples for 24 h. Total RNAs were extracted by acid
guanidinium thiocyanate-phenol-chloroform method. Two milligrams of total RNAs were
reverse transcribed with M-MLV reverse transcriptase in the presence of random hexamer.
The resultant RT mixtures were then subjected to PCR cycles as follows: 94
◦
C for 30 s,
58
◦
C for 30 s, 72
◦
C for 1 min for 40 cycles (IGF-1, HGF and VEGF) and 35 cycles (KGF) [
24
].
The nucleotide sequences of the primers and expected sizes of PCR products are shown in
Table 1.
Table 1. Nucleotide sequences of primers and expected sizes of PCR products.
Growth Factor Primer Sequence Expected Size (bp)
IGF-1 Forward (50–30) TCAACAAGCCCACAGGGTAT 307
Reverse (50–30)
ACTCGTGCAGAGCAAAGGAT
HGF Forward (50–30) CGAGGCCATGGTGCTATACT 297
Reverse (50–30)
ACACCAGGGTGATTCAGACC
KGF Forward (50–30) GACATGGATCCTGCCAACTT 304
Reverse (50–30) AATTCCAACTGCCACTGTCC
VEGF Forward (50–30) TCTTCAAGCCATCCTGTGTG 297
Reverse (50–30) GCGAGTCTGTGTTTTTGCAG
2.11. Statistical Analysis
All measurements were performed in triplicate. The obtained data were statistically
analyzed using SPSS 11.5 for Windows (SPSS Inc., Chicago, IL, USA), and the differences
were considered significant when p< 0.05. Data comparison was analyzed by using one
way analysis of variance (ANOVA) with Duncan’s multiple range test.
Cosmetics 2022,9, 66 6 of 19
3. Results and Discussion
3.1. Determination of Caffeine and Chlorogenic Acid
Coffee contains a large number of chemical compounds such as alkaloids (caffeine,
trigonelline), phenolics (chlorogenic acid (as main phenolic), epicatechin, catechin, rutin,
protocatechuic acid and ferulic acid) and polymers (melanoidins) [
25
]. The well-known
major bioactive constituents of coffee are caffeine and chlorogenic acid [
26
]. Caffeine
increases blood circulation, promotes healthier hair follicles, and reduces hair loss by
inhibiting 5
α
-reductase. Therefore, it has been a popular component of commercial anti-
hair loss products. Chlorogenic acid exhibits antioxidant, anti-inflammatory, anti-microbial,
and wound healing properties that are related to skin anti-aging. In this study, coffee
berries were extracted with 50% ethanol, and the presence of caffeine and chlorogenic
acid was determined by HPLC analysis. The chromatogram of CBE at a UV detection
wavelength of 280 nm showed two major peak signals that were identified as chlorogenic
acid and caffeine at the retention time of 7.21 and 7.86 min, respectively (Figure 1). The
concentrations of chlorogenic acid and caffeine were calculated from the peak area against
the standard calibration curve and showed values of 34.82
±
0.79 and 22.29
±
2.73
µ
g/mL
extract, respectively.
Cosmetics 2022, 9, x FOR PEER REVIEW 6 of 19
were considered significant when p < 0.05. Data comparison was analyzed by using one
way analysis of variance (ANOVA) with Duncan’s multiple range test.
3. Results and Discussion
3.1. Determination of Caffeine and Chlorogenic Acid
Coffee contains a large number of chemical compounds such as alkaloids (caffeine,
trigonelline), phenolics (chlorogenic acid (as main phenolic), epicatechin, catechin, rutin,
protocatechuic acid and ferulic acid) and polymers (melanoidins) [25]. The well-known
major bioactive constituents of coffee are caffeine and chlorogenic acid [26]. Caffeine in-
creases blood circulation, promotes healthier hair follicles, and reduces hair loss by inhib-
iting 5α-reductase. Therefore, it has been a popular component of commercial anti-hair
loss products. Chlorogenic acid exhibits antioxidant, anti-inflammatory, anti-microbial,
and wound healing properties that are related to skin anti-aging. In this study, coffee ber-
ries were extracted with 50% ethanol, and the presence of caffeine and chlorogenic acid
was determined by HPLC analysis. The chromatogram of CBE at a UV detection wave-
length of 280 nm showed two major peak signals that were identified as chlorogenic acid
and caffeine at the retention time of 7.21 and 7.86 min, respectively (Figure 1). The con-
centrations of chlorogenic acid and caffeine were calculated from the peak area against
the standard calibration curve and showed values of 34.82 ± 0.79 and 22.29 ± 2.73 μg/mL
extract, respectively.
Figure 1. HPLC chromatogram of CBE.
3.2. Cytotoxicity
First, the cytotoxicity of CBE, caffeine and chlorogenic acid was evaluated by treating
HDF and HFDP cells with various concentrations (0–5 mg/mL) of the samples. All test
samples showed cytotoxicity in a dose-dependent manner and had a similar pattern. At
the low concentration, CBE (≤1.2 mg/mL), caffeine (≤0.2 mg/mL) and chlorogenic acid
(≤0.2 mg/mL) displayed non-cytotoxicity to both cells and also stimulated a small percent-
age of cell proliferation, and, as expected, the increase in the concentration decreased the
cells’ viability (Figure 2A,B). The test sample concentration with cell viability of 50%, IC
50
,
was calculated from dose–response data as compared with control (untreated cells) data.
The IC
50
values for all components on both cell types are summarized in
Table 2. In com-
parison to HDF cells, chlorogenic acid and caffeine showed slightly higher toxicity on
HFDP cells with lower IC
50 ,
while CBE showed no difference in effect. The significantly
higher IC
50
of the extract (3.08 and 3.07 mg/mL for HDF and HFDP, respectively) indicated
a lower level of toxicity than that of chlorogenic acid (2.71 and 2.62 mg/mL for HDF and
HFDP, respectively) and caffeine (2.63 and 2.38 mg/mL for HDF and HFDP, respectively).
Figure 1. HPLC chromatogram of CBE.
3.2. Cytotoxicity
First, the cytotoxicity of CBE, caffeine and chlorogenic acid was evaluated by treating
HDF and HFDP cells with various concentrations (0–5 mg/mL) of the samples. All test
samples showed cytotoxicity in a dose-dependent manner and had a similar pattern.
At the low concentration, CBE (
≤
1.2 mg/mL), caffeine (
≤
0.2 mg/mL) and chlorogenic
acid (
≤
0.2 mg/mL) displayed non-cytotoxicity to both cells and also stimulated a small
percentage of cell proliferation, and, as expected, the increase in the concentration decreased
the cells’ viability (Figure 2A,B). The test sample concentration with cell viability of 50%,
IC
50
, was calculated from dose–response data as compared with control (untreated cells)
data. The IC
50
values for all components on both cell types are summarized in Table 2. In
comparison to HDF cells, chlorogenic acid and caffeine showed slightly higher toxicity on
HFDP cells with lower IC
50
, while CBE showed no difference in effect. The significantly
higher IC
50
of the extract (3.08 and 3.07 mg/mL for HDF and HFDP, respectively) indicated
a lower level of toxicity than that of chlorogenic acid (2.71 and 2.62 mg/mL for HDF and
HFDP, respectively) and caffeine (2.63 and 2.38 mg/mL for HDF and HFDP, respectively).
It can be presumed that the lower toxicity of CBE is due to the contribution of other
Cosmetics 2022,9, 66 7 of 19
compounds present in this particular extract. Other studies have also observed that coffee
silver skin extract had potential antidiabetic property without toxicity in INS-1E cells [
27
].
Ethanol extract of coffee cherry at a concentration of 10 mg/mL did not show any irritation
in an HET-CAM assay [
28
]. Abd et al. reported that 3.6% caffeine did not induced any
toxicity in a normal human keratinocyte cell line. The results suggested that the coffee
extract is considered safe and non-toxic for human skin [
29
]. Hence, the maximum non-
toxic doses of CBE (1.2 mg/mL), caffeine (0.2 mg/mL), and chlorogenic acid (1.2 mg/mL)
were chosen to use as the test concentrations in further experiments.
Cosmetics 2022, 9, x FOR PEER REVIEW 7 of 19
It can be presumed that the lower toxicity of CBE is due to the contribution of other com-
pounds present in this particular extract. Other studies have also observed that coffee sil-
ver skin extract had potential antidiabetic property without toxicity in INS-1E cells [27].
Ethanol extract of coffee cherry at a concentration of 10 mg/mL did not show any irritation
in an HET-CAM assay [28]. Abd et al. reported that 3.6% caffeine did not induced any
toxicity in a normal human keratinocyte cell line. The results suggested that the coffee
extract is considered safe and non-toxic for human skin [29]. Hence, the maximum non-
toxic doses of CBE (1.2 mg/mL), caffeine (0.2 mg/mL), and chlorogenic acid (1.2 mg/mL)
were chosen to use as the test concentrations in further experiments.
A
B
Figure 2. Cytotoxicity of various concentrations of CBE, caffeine, and chlorogenic acid on (A) HDF
and (B) HFDP cells.
Table 2. The maximum non-toxic dose and 50% inhibition concentration (IC
50
) of CBE, caffeine, and
chlorogenic acid on HDF and HFDP cells.
Samples
HDF HFDP
Maximum Non-
Toxic Dose
(mg/mL)
IC
50
(mg/mL)
Maximum Non-
Toxic Dose
(mg/mL)
IC
50
(mg/mL)
CBE ≤1.2 3.08 ± 0.04
a
≤1.2 3.07 ± 0.09
a
Caffeine ≤0.2 2.63 ± 0.14
b
≤0.2 2.38 ± 0.12
b
Chlorogenic acid ≤0.2 2.71 ± 0.03
b
≤0.2 2.62 ± 0.04
b
Data with different lower-case letters (a and b) indicate significant differences (p < 0.05) between
samples.
3.3. Skin Anti-Aging Effect
Skin is the largest organ of the human body and is susceptible to the aging process
due to exposure to the harsh external environment [30]. Skin aging is the result of a loss
of cellular function, gradual loss of the homeostatic mechanism, and disruption in the
structure of skin tissues [31]. These mechanisms are directly linked to skin aging
Figure 2.
Cytotoxicity of various concentrations of CBE, caffeine, and chlorogenic acid on (
A
) HDF
and (B) HFDP cells.
Table 2.
The maximum non-toxic dose and 50% inhibition concentration (IC
50
) of CBE, caffeine, and
chlorogenic acid on HDF and HFDP cells.
Samples
HDF HFDP
Maximum
Non-Toxic Dose
(mg/mL)
IC50
(mg/mL)
Maximum
Non-Toxic Dose
(mg/mL)
IC50
(mg/mL)
CBE ≤1.2 3.08 ±0.04 a≤1.2 3.07 ±0.09 a
Caffeine ≤0.2 2.63 ±0.14 b≤0.2 2.38 ±0.12 b
Chlorogenic acid
≤0.2 2.71 ±0.03 b≤0.2 2.62 ±0.04 b
Data with different lower-case letters (a and b) indicate significant differences (p< 0.05) between samples.
3.3. Skin Anti-Aging Effect
Skin is the largest organ of the human body and is susceptible to the aging process
due to exposure to the harsh external environment [
30
]. Skin aging is the result of a
loss of cellular function, gradual loss of the homeostatic mechanism, and disruption in
Cosmetics 2022,9, 66 8 of 19
the structure of skin tissues [
31
]. These mechanisms are directly linked to skin aging
phenotypes: wrinkle formation, uneven pigmentation and decreased wound healing [
32
].
Recently, many alternative cell-based assays have been used to investigate the cosmetic
potential of compounds instead of painful
in vivo
animal tests as a way to reduce or
eliminate harm to animals. Human skin cells, especially fibroblast cells, are used to
investigate antioxidant, anti-inflammatory, wound healing, collagen synthesis and cell
proliferation properties of natural extracts according to how these cells synthesize the
extracellular matrix [
33
]. The biological mechanisms involved in the aging of dermal cells
are key areas to understand skin aging. Large numbers of biological mechanisms, such
as decreasing protein synthesis in the extracellular matrix or increasing degradation, are
known to be altered during the skin aging process. In this context, as part of the ongoing
search for ways to prevent and attenuate the skin aging mechanism, candidate compounds
can be investigated in fibroblast culture models. Therefore, in this study, fibroblast cells
were used to investigate skin anti-aging mechanisms including cell proliferation and
antioxidant (enhancing SOD activity and nitric oxide inhibition) and collagenase inhibition
through in vitro assays.
3.3.1. HDF Cell Proliferation
The ability of compounds to enhance the proliferation of HDF cells can be used to
establish their wound healing and anti-aging effect to rejuvenate skin cells [
34
]. Older
skin fibroblasts tend to migrate more slowly compared to younger cells, and promoting
fibroblast proliferation is related to anti-aging properties. All samples promoted HDF
cell proliferation in a dose-dependent manner (Figure 3A,B). At maximum nontoxic con-
centration, chlorogenic acid showed significantly higher proliferation-promoting activity
at
18.46 ±1.01%
than caffeine and CBE at 16.22
±
0.86% and 14.97
±
0.81%, respectively
(
Figure 4A
). CBE showed enhancement of fibroblast cell proliferation in relation to the
report by Affonso et al. that a hydrogel containing aqueous extract of green coffee showed
good results in wound reduction (78.20%) [
12
]. Chen et al. reported that using 1% chloro-
genic acid for a topical applied to Wistar rats for 15 days showed wound healing capacity
with increased collagen synthesis via its antioxidant properties [35].
Cosmetics 2022, 9, x FOR PEER REVIEW 8 of 19
phenotypes: wrinkle formation, uneven pigmentation and decreased wound healing [32].
Recently, many alternative cell-based assays have been used to investigate the cosmetic
potential of compounds instead of painful in vivo animal tests as a way to reduce or elim-
inate harm to animals. Human skin cells, especially fibroblast cells, are used to investigate
antioxidant, anti-inflammatory, wound healing, collagen synthesis and cell proliferation
properties of natural extracts according to how these cells synthesize the extracellular ma-
trix [33]. The biological mechanisms involved in the aging of dermal cells are key areas to
understand skin aging. Large numbers of biological mechanisms, such as decreasing pro-
tein synthesis in the extracellular matrix or increasing degradation, are known to be al-
tered during the skin aging process. In this context, as part of the ongoing search for ways
to prevent and attenuate the skin aging mechanism, candidate compounds can be inves-
tigated in fibroblast culture models. Therefore, in this study, fibroblast cells were used to
investigate skin anti-aging mechanisms including cell proliferation and antioxidant (SOD
and nitric oxide inhibition) and collagenase inhibition through in vitro assays.
3.3.1. HDF Cell Proliferation
The ability of compounds to enhance the proliferation of HDF cells can be used to
establish their wound healing and anti-aging effect to rejuvenate skin cells [34]. Older skin
fibroblasts tend to migrate more slowly compared to younger cells, and promoting fibro-
blast proliferation is related to anti-aging properties. All samples promoted HDF cell pro-
liferation in a dose-dependent manner (Figure 3A,B). At maximum nontoxic concentra-
tion, chlorogenic acid showed significantly higher proliferation-promoting activity at
18.46 ± 1.01% than caffeine and CBE at 16.22 ± 0.86% and 14.97 ± 0.81%, respectively (Fig-
ure 4A). CBE showed enhancement of fibroblast cell proliferation in relation to the report
by Affonso et al. that a hydrogel containing aqueous extract of green coffee showed good
results in wound reduction (78.20%) [12]. Chen et al. reported that using 1% chlorogenic
acid for a topical applied to Wistar rats for 15 days showed wound healing capacity with
increased collagen synthesis via its antioxidant properties [35].
A
Figure 3. Cont.
Cosmetics 2022,9, 66 9 of 19
Cosmetics 2022, 9, x FOR PEER REVIEW 9 of 19
B
Figure 3. HDF and HFDP cell proliferation effect of various concentrations of CBE (A), caffeine, and
chlorogenic acid (B).
A
B
Figure 4. Effects of CBE, caffeine, and chlorogenic acid at maximum nontoxic concentrations on
proliferation of HDF (A) and HFDP (B) cells. Data with different lower-case letters (a and b) indicate
significant differences (p < 0.05) between samples.
Figure 3.
HDF and HFDP cell proliferation effect of various concentrations of CBE (
A
), caffeine, and
chlorogenic acid (B).
Cosmetics 2022, 9, x FOR PEER REVIEW 9 of 19
B
Figure 3. HDF and HFDP cell proliferation effect of various concentrations of CBE (A), caffeine, and
chlorogenic acid (B).
A
B
Figure 4. Effects of CBE, caffeine, and chlorogenic acid at maximum nontoxic concentrations on
proliferation of HDF (A) and HFDP (B) cells. Data with different lower-case letters (a and b) indicate
significant differences (p < 0.05) between samples.
Figure 4.
Effects of CBE, caffeine, and chlorogenic acid at maximum nontoxic concentrations on
proliferation of HDF (
A
) and HFDP (
B
) cells. Data with different lower-case letters (a and b) indicate
significant differences (p< 0.05) between samples.
Cosmetics 2022,9, 66 10 of 19
3.3.2. Antioxidant Activities
SOD is a primary antioxidant enzyme that works against the toxic effect of superoxide
radicals (O
2−
) on cells by catalyzing hydrogen peroxide (H
2
O
2
) and oxygen (O
2
) [
36
]. An
imbalance between free radical production and antioxidant levels leads to oxidative stress,
which was observed in the reduced activity of SOD antioxidant enzymes [
37
]. SOD is also
a major antioxidant in human fibroblasts and is a causative factor in oxidative stress on
telomere shortening [
38
]. Moreover, promotion of SOD activity can enhance the prevention
of oxidative stress and photo-induced aging of the skin.
In order to investigate the SOD antioxidant-enhancing activity of CBE, a SOD determi-
nation kit that allows for a convenient assay by producing a water-soluble formazan dye
upon reduction with a superoxide anion was used. The rate of reduction with O
2
is linearly
related to the xanthine oxidase activity, which is inhibited by SOD. Therefore, SOD activity
can be quantified by measuring the decrease in the color development of WST-1 formazan.
The treatment with CBE induced significantly higher SOD activity (
74.53 ±0.92%
) than that
of caffeine (12.56
±
2.43%), but lower activity than that of chlorogenic acid (
91.00 ±1.11%
)
(Figure 5A). These outcomes are in agreement with those reported by Zofia, who noticed
that green coffee extract (100
µ
g/mL) showed high activity of the superoxide dismutase
enzyme, and its fermentation duration also had an effect on this ability, with 14-day fer-
mented extract showing better results than extracts fermented for 7 and 28 days [
14
]. In
addition, improvement of SOD and glutathione reductase (GR) activities by chlorogenic
acid, caffeine and trigonelline were found in chronic coffee and caffeine ingestion mice [
3
].
Cosmetics 2022, 9, x FOR PEER REVIEW 11 of 19
3.3.3. Anti-Collagenase Activity
The clavation of interstitial collagens and alteration of the extracellular matrix are
primarily responsible for the clinical manifestations of skin aging such as wrinkles, sag-
ging, and laxity [43,44]. Hence, inhibition of collagenase was suggested as a key factor to
slow down not only the loss of skin elasticity but also the progress of sagging [45]. There-
fore, the evaluation of collagenase inhibition properties is the most often used assay to
investigate the anti-aging effects of many natural products to be applied as cosmeceutical
ingredients. To investigate the collagenase inhibition activity of CBE and reference com-
pounds (caffeine and chlorogenic acid), bioassays were performed with a member of ma-
trix metalloproteinases, MMP-1. Caffeine showed collagenase inhibition of 43.47%. The
results corresponded to the report by Lee et al. [46], who established the inhibition of col-
lagenase in a concentration-dependent manner of caffeine in an in silico experiment and
an in vitro approach. Interestingly, CBE showed the highest significant inhibition of
MMP-1, of 65.88%, followed by chlorogenic acid (53.19%) and caffeine (43.47%) (Figure
5C). This may be the result of the synergistic action of the chemically complex matrices of
CBE. The results correspond with the study by McDaniel in which coffee berry extract
showed down-regulated MMP-1 gene expression in biopsy skin samples that were taken
and sectioned from participants who twice-daily applied CBE 1% cream and CBE 0.1%
cleanser for 6 weeks
[
17].
A
B
Figure 5. Cont.
Cosmetics 2022,9, 66 11 of 19
Cosmetics 2022, 9, x FOR PEER REVIEW 12 of 19
C
Figure 5. The superoxide dismutase (A), nitric oxide inhibition (B), and anti-collagenase (C) activi-
ties of CBE, caffeine, and chlorogenic acid on HDF. Data with different lower-case letters (a, b and
c) indicate significant differences (p < 0.05) between samples.
3.4. Anti-Hair Loss Effect
Nowadays, the number of persons who suffer from hair loss is increasing. Thus, it is
quite relevant to develop cosmetic products to stop hair loss and enhance hair growth.
HFDP cells were used to investigate the potential of new substances as novel therapeutic
and cosmetic hair growth stimulating agents in hair care products. Dermal papilla cells
are specialized mesenchymal cells located at the base of hair follicles that play essential
roles in hair follicular morphogenesis and postnatal hair growth cycles. Therefore, these
cells have been used to examine anti-hair loss and hair growth modulating effects of a
variety of agents, natural extracts, growth factors, cytokines, peptides, and hormones. In
addition, effects on a wide range of biomolecules and mechanistic pathways that play a
key role in the biology of hair growth were also investigated using HFDP cells [47]. Sev-
eral studies have shown that dermal papilla proliferation is closely associated with the
hair growth cycle and an increase in dermal papilla cells in the anagen phase, causing a
slowdown in hair loss. For the study reported herein, the test samples were investigated
for their effects on cell proliferation, 5α-reductase and the growth factor of HFDP cells.
3.4.1. HFDP Cell Proliferation
HFDP cell proliferation has been widely tested to determine the hair growth-promot-
ing or hair-loss inhibiting effects from natural extracts [48]. HFDP cell proliferation pro-
longed the hair cycle’s anagen phase, which increased hair density and reduced hair loss
[36]. In this study, the mitogenic effect of CBE was investigated on the dermal papilla cell
culture system. All samples promoted the proliferation of HFDP cells in a dose-dependent
manner, with 1.2 mg/mL of CBE stimulating hair cell proliferation at 15.64 ± 1.59% (Figure
3A,B), whereas 0.2 mg/mL of caffeine (20.60 ± 0.63%) and chlorogenic acid (20.40 ± 1.54%)
showed significantly higher promotion of HFDP cell proliferation than CBE (Figure 4B).
Enhancing HFDP cell proliferation with the test sample showed its possibility to extend
the anagen phase, which is related to healthy hair and reduction of hair loss. In a previous
study, Kim et al. reported that after being treated with 10, 20 and 50 ppm of caffeine, hu-
man dermal papilla cells showed increased proliferation of 10, 18, and 19%, respectively,
in a CCK-8 assay, which was related to hair growth promoting results [49].
3.4.2. 5α-Reductase Inhibition
Not only cell proliferation but also androgens are involved in hair growth. Testos-
terone and dihydrotestosterone are two major androgens that indirectly control hair
growth. Hair loss is induced by dihydrotestosterone, which is converted from testosterone
by 5α-reductase. Increasing the androgenic signal decreases the duration of the anagen
phase [50,51], and the response to the transformation of large follicles to smaller ones
Figure 5.
The superoxide dismutase (
A
), nitric oxide inhibition (
B
), and anti-collagenase (
C
) activities
of CBE, caffeine, and chlorogenic acid on HDF. Data with different lower-case letters (a, b and c)
indicate significant differences (p< 0.05) between samples.
Nitric oxide is involved in various types of inflammatory disorders by acting as an
anti-inflammatory agent under normal physiological conditions. The overproduction of
nitric oxide is considered to be a pro-inflammatory mediator and induces inflammation
under abnormal conditions [
39
]. Moreover, nitric oxide is a short-lived radical and an
important immune mediator with a profound cytotoxic and wound healing effect [
40
].
Thus, the determination of nitric oxide levels is a good indicator of cell inflammation. In
this study, the amount of nitric oxide production in the culture medium was quantitated
using Griess reagent after treating HDF with the test samples. Chlorogenic acid showed
significantly higher inhibition of nitric oxide, by 91.29
±
1.41% (Figure 5B). Although CBE
(
63.93 ±2.05%
) provided significantly lower inhibition activity than chlorogenic acid, it
provided significant higher activity than caffeine (21.81
±
1.78%) (p< 0.05). Lemos also
reported that coffee bean exhibited inhibition of nitric oxide production in macrophage
cells (RAW 264.7) [
41
]. However, 50 ug/mL of chlorogenic acid and caffeine revealed
no significant nitric oxide inhibition [
41
], which was different from our result. This may
be because their study used four-fold lower concentrations of pure compounds than
our experiment.
Chlorogenic acid, which is a major phenolic compound in coffee, showed significantly
higher antioxidant activities than alkaloids (caffeine) in both antioxidant assays (p< 0.05).
Generally, many antioxidant experiments have proved that phenolic compounds are good
free radical scavengers [
42
]. Many previous studies demonstrated that the extracts of
coffees obtained from different fruit parts or locations and polarities of extraction solvent
exhibited differences in antioxidant activities, and the literature makes it clear that the
antioxidant activity depends mainly upon the presence of phenolic compounds. The
interaction mechanism of the phenolic compounds has been correlated to the numbers and
locations of functional groups, especially hydroxy groups, in the phenolic molecules, which
directly affects their biological effects, with higher hydroxy groups resulting in an increase
in activity and hydroxy groups in ortho position showing higher activity than those in
meta- and para- positions. These results also strongly indicated that phenolic compounds
in CBE are major contributors to their antioxidant capacity, which correlates with skin
anti-aging capacity. Moreover, since the chlorogenic acid concentration in the CBE sample
was about 30 ug/mL it can be assumed that the high antioxidant activities of CBE are due
to the synergism effect of other antioxidants (epicatechin, catechin, rutin, protocatechuic
acid, and ferulic acid, etc.) present in this extract.
3.3.3. Anti-Collagenase Activity
The clavation of interstitial collagens and alteration of the extracellular matrix are
primarily responsible for the clinical manifestations of skin aging such as wrinkles, sag-
ging, and laxity [
43
,
44
]. Hence, inhibition of collagenase was suggested as a key factor
to slow down not only the loss of skin elasticity but also the progress of sagging [
45
].
Cosmetics 2022,9, 66 12 of 19
Therefore, the evaluation of collagenase inhibition properties is the most often used assay
to investigate the anti-aging effects of many natural products to be applied as cosmeceu-
tical ingredients. To investigate the collagenase inhibition activity of CBE and reference
compounds (caffeine and chlorogenic acid), bioassays were performed with a member
of matrix metalloproteinases, MMP-1. Caffeine showed collagenase inhibition of 43.47%.
The results corresponded to the report by Lee et al. [
46
], who established the inhibition
of collagenase in a concentration-dependent manner of caffeine in an in silico experiment
and an
in vitro
approach. Interestingly, CBE showed the highest significant inhibition of
MMP-1, of 65.88%, followed by chlorogenic acid (53.19%) and caffeine (43.47%) (Figure 5C).
This may be the result of the synergistic action of the chemically complex matrices of
CBE. The results correspond with the study by McDaniel in which coffee berry extract
showed down-regulated MMP-1 gene expression in biopsy skin samples that were taken
and sectioned from participants who twice-daily applied CBE 1% cream and CBE 0.1%
cleanser for 6 weeks [17].
3.4. Anti-Hair Loss Effect
Nowadays, the number of persons who suffer from hair loss is increasing. Thus, it
is quite relevant to develop cosmetic products to stop hair loss and enhance hair growth.
HFDP cells were used to investigate the potential of new substances as novel therapeutic
and cosmetic hair growth stimulating agents in hair care products. Dermal papilla cells are
specialized mesenchymal cells located at the base of hair follicles that play essential roles
in hair follicular morphogenesis and postnatal hair growth cycles. Therefore, these cells
have been used to examine anti-hair loss and hair growth modulating effects of a variety of
agents, natural extracts, growth factors, cytokines, peptides, and hormones. In addition,
effects on a wide range of biomolecules and mechanistic pathways that play a key role in
the biology of hair growth were also investigated using HFDP cells [
47
]. Several studies
have shown that dermal papilla proliferation is closely associated with the hair growth
cycle and an increase in dermal papilla cells in the anagen phase, causing a slowdown in
hair loss. For the study reported herein, the test samples were investigated for their effects
on cell proliferation, 5α-reductase and the growth factor of HFDP cells.
3.4.1. HFDP Cell Proliferation
HFDP cell proliferation has been widely tested to determine the hair growth-promoting
or hair-loss inhibiting effects from natural extracts [
48
]. HFDP cell proliferation prolonged
the hair cycle’s anagen phase, which increased hair density and reduced hair loss [
36
]. In
this study, the mitogenic effect of CBE was investigated on the dermal papilla cell culture
system. All samples promoted the proliferation of HFDP cells in a dose-dependent manner,
with 1.2 mg/mL of CBE stimulating hair cell proliferation at 15.64
±
1.59% (Figure 3A,B),
whereas 0.2 mg/mL of caffeine (20.60
±
0.63%) and chlorogenic acid (20.40
±
1.54%)
showed significantly higher promotion of HFDP cell proliferation than CBE (Figure 4B).
Enhancing HFDP cell proliferation with the test sample showed its possibility to extend
the anagen phase, which is related to healthy hair and reduction of hair loss. In a previous
study, Kim et al. reported that after being treated with 10, 20 and 50 ppm of caffeine, human
dermal papilla cells showed increased proliferation of 10, 18, and 19%, respectively, in a
CCK-8 assay, which was related to hair growth promoting results [49].
3.4.2. 5α-Reductase Inhibition
Not only cell proliferation but also androgens are involved in hair growth. Testosterone
and dihydrotestosterone are two major androgens that indirectly control hair growth.
Hair loss is induced by dihydrotestosterone, which is converted from testosterone by
5
α
-reductase. Increasing the androgenic signal decreases the duration of the anagen
phase [
50
,
51
], and the response to the transformation of large follicles to smaller ones
induces progressive thinning of the scalp hair and hair loss [
50
,
52
]. The inhibition of 5
α
-
Cosmetics 2022,9, 66 13 of 19
reductase activity in dermal papilla cells should have a direct effect on androgenic alopecia
treatment [22].
Previous studies have determined that caffeine inhibits the activity of the 5
α
-reductase
enzyme and contributes to a renewed growth phase for human hair. Thus, caffeine was
identified as a stimulator of human hair growth
in vitro
, which may have an important clin-
ical impact on managing androgenetic alopecia [
53
]. Lademann et al. [
54
] and Teichmann
et al. [
55
] demonstrated that shampoo containing caffeine efficiently penetrated into the
hair follicles of the human scalp and affected hair growth. Thus, caffeine is used in hair care
products that are claimed to reduce and slow down balding and also stimulate hair growth.
In our previous study, in order to obtain caffeine as a major component in coffee berry ex-
tract, we extracted the coffee fruit with ethanol and investigated its 5
α
-reductase inhibition
activity in human prostate cancer cell lines (DU
−
145). The extract showed a 16.5% reduc-
tion in 5
α
-reductase activity. In a clinical trial with 13 men and 34 women, daily application
of hair tonic spray containing 10% extract for 3 months showed significant reduction in hair
loss numbers after the combing test [
56
]. In this study, we extracted the sample with higher
polarity solvent (50% ethanol) to obtain higher phenolic compounds [
16
] and evaluated
the inhibition of 5
α
-reductase activity in HFDP cells. When the cells were incubated with
the samples at various concentrations, there was a dose-dependent 5
α
-reductase inhibition
(Figure 6). Surprisingly, at the maximum nontoxic concentration, CBE (67.59
±
2.43%) and
chlorogenic acid (66.35
±
1.30%) showed higher inhibition of 5
α
-reductase activity than the
known inhibitor, caffeine (55.87
±
1.04%) (Figure 7). Based on our best knowledge, this is
the first report on the comparison of 5
α
-reductase inhibition activity of caffeine, chlorogenic
acid and coffee berry extract. These results suggested that the hair growth-promoting effect
of CBE mediated through the 5α-reductase inhibition pathway was due to its chlorogenic
acid and caffeine content, which provided a synergistic effect.
Cosmetics 2022, 9, x FOR PEER REVIEW 13 of 19
induces progressive thinning of the scalp hair and hair loss [50,52]. The inhibition of 5α-
reductase activity in dermal papilla cells should have a direct effect on androgenic alope-
cia treatment [22].
Previous studies have determined that caffeine inhibits the activity of the 5α-reduc-
tase enzyme and contributes to a renewed growth phase for human hair. Thus, caffeine
was identified as a stimulator of human hair growth in vitro, which may have an im-
portant clinical impact on managing androgenetic alopecia [53]. Lademann et al. [54] and
Teichmann et al. [55] demonstrated that shampoo containing caffeine efficiently pene-
trated into the hair follicles of the human scalp and affected hair growth. Thus, caffeine is
used in hair care products that are claimed to reduce and slow down balding and also
stimulate hair growth. In our previous study, in order to obtain caffeine as a major com-
ponent in coffee berry extract, we extracted the coffee fruit with ethanol and investigated
its 5α-reductase inhibition activity in human prostate cancer cell lines (DU−145). The ex-
tract showed a 16.5% reduction in 5α-reductase activity. In a clinical trial with 13 men and
34 women, daily application of hair tonic spray containing 10% extract for 3 months
showed significant reduction in hair loss numbers after the combing test [56]. In this
study, we extracted the sample with higher polarity solvent (50% ethanol) and evaluated
the inhibition of 5α-reductase activity in HFDP cells. When the cells were incubated with
the samples at various concentrations, there was a dose-dependent 5α-reductase inhibi-
tion (Figure 6). Surprisingly, at the maximum nontoxic concentration, CBE (67.59 ± 2.43%)
and chlorogenic acid (66.35 ± 1.30%) showed higher inhibition of 5α-reductase activity
than the known inhibitor, caffeine (55.87 ± 1.04%) (Figure 7). Based on our best knowledge,
this is the first report on the comparison of 5α-reductase inhibition activity of caffeine,
chlorogenic acid and coffee berry extract. These results suggested that the hair growth-
promoting effect of CBE mediated through the 5α-reductase inhibition pathway was due
to its chlorogenic acid and caffeine content, which provided a synergistic effect.
A
B
Figure 6. Cont.
Cosmetics 2022,9, 66 14 of 19
Cosmetics 2022, 9, x FOR PEER REVIEW 14 of 19
C
Figure 6. 5α-reductase inhibition of (A) CBE, (B) caffeine, and (C) chlorogenic acid on HFDP cells.
Figure 7. 5α-reductase inhibition of CBE, caffeine, and chlorogenic acid at maximum nontoxic con-
centration. Data with different lower-case letters (a and b) indicate significant differences (p < 0.05)
between samples.
3.4.3. Growth Factor Gene Expression
The gene expression level of growth factor is one method to elucidate the mechanism
of compounds in hair growth-promoting activity. There are several growth factors that
are implicated in the regulation of hair growth, such as IGF-1, KGF, HGF and VEGF. The
expression of several growth factors is involved in the regulation of hair morphogenesis
and hair growth [57]. IGF-1 stimulates the growth of epithelial cells and regulates cellular
proliferation and migration during hair follicle development [58,59]. IGF-1 promotes hair
growth and plays an important role in follicular proliferation, tissue remodeling, and the
hair growth cycle, and the decreased secretion of IGF-1 was correlated with androgenetic
alopecia [60,61]. KGF is an endogenous mediator of hair follicle growth and stimulates
sebaceous glands and hair follicle keratinocytes’ development [62]. Furthermore, KGF is
one of the growth factors that stimulates hair fiber elongation, protects hair follicles from
cell death, and directly affects the development of hair follicles [63]. HGF is a paracrine
factor that promotes follicular growth via action on neighboring follicular epithelial cells
[64]. HGF has been shown to be secreted by dermal papilla cells that are utilized to ma-
nipulate the sheath fibroblasts surrounding hair follicles and stimulate hair regeneration
[65]. VEGF is an important mediator of angiogenesis in hair follicles by improving peri-
follicular vascularization and increasing hair follicle size [66–68]. The importance of VEGF
in hair growth stimulation has been further supported by a study on the activity of minox-
idil (a well-known drug for androgenic alopecia) [69]. To clarify the molecular mechanism
of compounds in hair growth-promoting activity, these growth factors were determined.
In this study, the expression levels of these growth factors were measured in HFDP cells
when treated with and without CBE, caffeine, and chlorogenic acid. As compared to the
untreated group (1.00-fold), the results showed that HFDP cells treated with caffeine (2.04-
fold) showed significantly higher levels of IGF-1 expression than cells treated with CBE
Figure 6. 5α-reductase inhibition of (A) CBE, (B) caffeine, and (C) chlorogenic acid on HFDP cells.
Cosmetics 2022, 9, x FOR PEER REVIEW 14 of 19
C
Figure 6. 5α-reductase inhibition of (A) CBE, (B) caffeine, and (C) chlorogenic acid on HFDP cells.
Figure 7. 5α-reductase inhibition of CBE, caffeine, and chlorogenic acid at maximum nontoxic con-
centration. Data with different lower-case letters (a and b) indicate significant differences (p < 0.05)
between samples.
3.4.3. Growth Factor Gene Expression
The gene expression level of growth factor is one method to elucidate the mechanism
of compounds in hair growth-promoting activity. There are several growth factors that
are implicated in the regulation of hair growth, such as IGF-1, KGF, HGF and VEGF. The
expression of several growth factors is involved in the regulation of hair morphogenesis
and hair growth [57]. IGF-1 stimulates the growth of epithelial cells and regulates cellular
proliferation and migration during hair follicle development [58,59]. IGF-1 promotes hair
growth and plays an important role in follicular proliferation, tissue remodeling, and the
hair growth cycle, and the decreased secretion of IGF-1 was correlated with androgenetic
alopecia [60,61]. KGF is an endogenous mediator of hair follicle growth and stimulates
sebaceous glands and hair follicle keratinocytes’ development [62]. Furthermore, KGF is
one of the growth factors that stimulates hair fiber elongation, protects hair follicles from
cell death, and directly affects the development of hair follicles [63]. HGF is a paracrine
factor that promotes follicular growth via action on neighboring follicular epithelial cells
[64]. HGF has been shown to be secreted by dermal papilla cells that are utilized to ma-
nipulate the sheath fibroblasts surrounding hair follicles and stimulate hair regeneration
[65]. VEGF is an important mediator of angiogenesis in hair follicles by improving peri-
follicular vascularization and increasing hair follicle size [66–68]. The importance of VEGF
in hair growth stimulation has been further supported by a study on the activity of minox-
idil (a well-known drug for androgenic alopecia) [69]. To clarify the molecular mechanism
of compounds in hair growth-promoting activity, these growth factors were determined.
In this study, the expression levels of these growth factors were measured in HFDP cells
when treated with and without CBE, caffeine, and chlorogenic acid. As compared to the
untreated group (1.00-fold), the results showed that HFDP cells treated with caffeine (2.04-
fold) showed significantly higher levels of IGF-1 expression than cells treated with CBE
Figure 7.
5
α
-reductase inhibition of CBE, caffeine, and chlorogenic acid at maximum nontoxic
concentration. Data with different lower-case letters (a and b) indicate significant differences (
p< 0.05
)
between samples.
3.4.3. Growth Factor Gene Expression
The gene expression level of growth factor is one method to elucidate the mechanism
of compounds in hair growth-promoting activity. There are several growth factors that
are implicated in the regulation of hair growth, such as IGF-1, KGF, HGF and VEGF. The
expression of several growth factors is involved in the regulation of hair morphogenesis
and hair growth [
57
]. IGF-1 stimulates the growth of epithelial cells and regulates cellular
proliferation and migration during hair follicle development [
58
,
59
]. IGF-1 promotes hair
growth and plays an important role in follicular proliferation, tissue remodeling, and the
hair growth cycle, and the decreased secretion of IGF-1 was correlated with androgenetic
alopecia [
60
,
61
]. KGF is an endogenous mediator of hair follicle growth and stimulates
sebaceous glands and hair follicle keratinocytes’ development [
62
]. Furthermore, KGF is
one of the growth factors that stimulates hair fiber elongation, protects hair follicles from cell
death, and directly affects the development of hair follicles [
63
]. HGF is a paracrine factor
that promotes follicular growth via action on neighboring follicular epithelial cells [
64
].
HGF has been shown to be secreted by dermal papilla cells that are utilized to manipulate
the sheath fibroblasts surrounding hair follicles and stimulate hair regeneration [
65
]. VEGF
is an important mediator of angiogenesis in hair follicles by improving perifollicular
vascularization and increasing hair follicle size [
66
–
68
]. The importance of VEGF in hair
growth stimulation has been further supported by a study on the activity of minoxidil
(a well-known drug for androgenic alopecia) [
69
]. To clarify the molecular mechanism
of compounds in hair growth-promoting activity, these growth factors were determined.
In this study, the expression levels of these growth factors were measured in HFDP cells
when treated with and without CBE, caffeine, and chlorogenic acid. As compared to
the untreated group (1.00-fold), the results showed that HFDP cells treated with caffeine
(2.04-fold) showed significantly higher levels of IGF-1 expression than cells treated with
CBE (1.69-fold) and chlorogenic acid (0.84-fold) (Figure 8A). Caffeine (1.85-fold) and CBE
Cosmetics 2022,9, 66 15 of 19
(1.58-fold) showed significantly higher levels of KGF expression than chlorogenic acid
(1.30-fold) (Figure 8B). However, there was not a significant difference in the expression of
the HGF gene between caffeine (0.44-fold) and CBE (0.28-fold) or caffeine and chlorogenic
acid (0.54-fold)), and there was also lower expression of HGF than of other growth factors
in this study (Figure 8C). Caffeine showed significantly higher induced VEGF expression
(2.33-fold) than CBE (1.74-fold) and chlorogenic acid (0.63-fold) (Figure 8D).
Cosmetics 2022, 9, x FOR PEER REVIEW 15 of 19
(1.69-fold) and chlorogenic acid (0.84-fold) (Figure 8A). Caffeine (1.85-fold) and CBE (1.58-
fold) showed significantly higher levels of KGF expression than chlorogenic acid (1.30-
fold) (Figure 8B). However, there was not a significant difference in the expression of the
HGF gene between the samples (CBE (0.28-fold), caffeine (0.44-fold) and chlorogenic acid
(0.54-fold)), and there was also lower expression of HGF than of other growth factors in
this study (Figure 8C). Chlorogenic acid showed significantly higher induced VEGF ex-
pression (2.33-fold) than CBE (1.74-fold) and caffeine (0.63-fold) (Figure 8D).
The results showed that caffeine and chlorogenic acid influence hair growth via dif-
ferent pathways. In this study, caffeine showed a high effect on IGF-1 and KFG genes,
which indicated its effect on epithelial cells and hair follicle keratinocytes’ development.
These results are consistent with the report by Fischer et al. that caffeine enhanced hair
shaft elongation, prolonged anagen duration, stimulated hair matrix keratinocyte prolif-
eration and upregulated IGF-1 gene expression [52,70]. Kim et al. also reported that after
treatment with (caffeine 20 ppm) and minoxidil (10 ppm) (as positive control), the mRNA
level in human dermal papilla cells increased in KGF by 1.6 and 1.7-fold, respectively,
higher than in the untreated group) [49], whereas chlorogenic acid highly induced VEGF
gene expression and had a strong effect on the induction of vasodilation of scalp blood
vessels.
In this regard, it is noteworthy that CBE has broader potential to increase hair growth
mR NA exp ressio n, espe ciall y of IGF -1, KG F, a nd VEGF, in compa rison w ith the pur e com-
pounds due to CBE containing both caffeine and chlorogenic acid components. The results
indicated that CBE could stimulate hair growth by inducing the proliferation of epithelial
cells near the base of the hair follicles together with the vasodilation of scalp blood vessels.
A B
C
D
Figure 8. Relative fold expression levels of IGF-1 (A), KGF (B), HGF (C) and VEGF (D) genes in
HFDP cells.
Values are presented as means ± SD (n = 3). Data with different lower-case letters (a, b
and c) indicate significant differences (p < 0.05) between samples.
Figure 8.
Relative fold expression levels of IGF-1 (
A
), KGF (
B
), HGF (
C
) and VEGF (
D
) genes in
HFDP cells. Values are presented as means
±
SD (n= 3). Data with different lower-case letters (a, b
and c) indicate significant differences (p< 0.05) between samples.
The results showed that caffeine and chlorogenic acid influence hair growth via differ-
ent pathways. In this study, caffeine showed a high effect on IGF-1, KGF and VEGF genes,
which indicated its effect on epithelial cells and hair follicle keratinocytes’ development
together with a strong effect on the induction of vasodilation of scalp blood vessels. These
results are consistent with the report by Fischer et al. that caffeine enhanced hair shaft elon-
gation, prolonged anagen duration, stimulated hair matrix keratinocyte proliferation and
upregulated IGF-1 gene expression [
70
]. Kim et al. also reported that after treatment with
caffeine (20 ppm) and minoxidil (10 ppm, as positive control), the mRNA level in human
dermal papilla cells increased in KGF by 1.6 and 1.7-fold, respectively, higher than in the
untreated group and caffeine increased VEGF gene expression more than minoxidil [
49
].
Chlorogenic acid increased KGF expression compared to untreated cells, implying that it
has an impact on hair follicle development. However, any of the samples have no effect on
HGF, which is related to follicular growth and encourages hair regeneration.
In this regard, it is noteworthy that CBE has broader potential to increase hair growth
mRNA expression, especially of IGF-1, KGF, and VEGF, in comparison with the pure
compound, chlorogenic acid, due to CBE containing both caffeine and chlorogenic acid
components. The results indicated that CBE could stimulate hair growth by promoting
Cosmetics 2022,9, 66 16 of 19
epithelial cell proliferation around the base of hair follicles, hair follicle keratinocyte devel-
opment, and vasodilation of scalp blood vessels.
4. Conclusions
The major compounds of CBE were identified as caffeine and chlorogenic acid by
HPLC. CBE showed skin anti-aging properties including enhanced keratinocyte cell prolif-
eration and SOD activity and inhibited nitric oxide and collagenase activities. Moreover,
CBE showed an increase in dermal papilla cell numbers as well as the mRNA expression of
hair growth-related factors including IGF-1, KGF and VEGF, the essential growth factors
for prolonging the anagen (growth) phase in the hair cycle. CBE also exhibited good
inhibitory activity against 5
α
-reductase. Therefore, our findings confirmed that CBE has
high potential to be used as an active ingredient for skin anti-aging, anti-hair loss and hair
growth stimulation in not only skin care but also hair care product applications.
To our knowledge, the present work is the first report comparing anti-hair loss and
hair growth promoting effects of caffeine, chlorogenic acid and coffee berry extract in cell
based assays.
Funding:
This work was financially supported by the Office of National Higher Education Science
Research and Innovation Policy Council through Program Management Unit for Competitiveness,
grant number C10F640029.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: All of the data are available in the manuscript.
Acknowledgments:
The author expresses thanks to the Office of National Higher Education Science
Research and Innovation Policy Council through Program Management Unit for Competitiveness for
research funding and Cosmetic and Beauty Innovations for Sustainable Development (CBIS) Research
Group and Scientific and Technological Instruments Center, Mae Fah Luang University for providing
scientific equipment and facilities for this work.
Conflicts of Interest: The author declares no conflict of interest.
References
1.
Chiu, P.C.; Chan, C.C.; Lin, H.M.; Chiu, H.C. The clinical anti-aging effects of topical kinetin and niacinamide in Asians: A
randomized, double-blind, placebo-controlled, split-face comparative trial. J. Cosmet. Dermatol. 2007,6, 243–249. [CrossRef]
2.
Williams, R.; Pawlus, A.D.; Thornton, J.M. Getting under the skin of hair aging: The impact of the hair follicle environment. Exp.
Dermatol. 2020,29, 588–597. [CrossRef]
3.
Liang, N.; Kitts, D.D. Antioxidant property of coffee components: Assessment of methods that define mechanisms of action.
Molecules 2014,19, 19180–19208. [CrossRef]
4.
Geromel, C.; Ferreira, L.P.; Guerreiro, S.M.; Cavalari, A.A.; Pot, D.; Pereira, L.F.P.; Leroy, T.; Vieira, L.G.E.; Mazzafera, P.;
Marraccini, P. Biochemical and genomic analysis of sucrose metabolism during coffee (Coffea arabica) fruit development. J. Exp.
Bot. 2006,57, 3243–3258. [CrossRef]
5.
Hall, R.D.; Trevisan, F.; de Vos, R.C. Coffee berry and green bean chemistry–Opportunities for improving cup quality and crop
circularity. Food Res. Int. 2022,151, 110825. [CrossRef]
6.
Azam, S.; Hadi, N.; Khan, N.U.; Hadi, S.M. Antioxidant and prooxidant properties of caffeine, theobromine and xanthine. Med.
Sci. Monit. 2003,9, 325–330.
7.
Duangjai, A.; Suphrom, N.; Wungrath, J.; Ontawong, A.; Nuengchamnong, N.; Yosboonruang, A. Comparison of antioxidant,
antimicrobial activities and chemical profiles of three coffee (Coffea arabica L.) pulp aqueous extracts. Integr. Med. Res.
2016
,5,
324–331. [CrossRef]
8.
Devasagayam, T.P.; Kamat, J.P.; Mohan, H.; Kesavan, P.C. Caffeine as an antioxidant: Inhibition of lipid peroxidation induced by
reactive oxygen species. Biochim. Biophys. Acta 1996,1282, 63–70. [CrossRef]
9.
Santana-Galvez, J.; Cisneros-Zevallos, L.; Jacobo-Velazquez, D.A. Chlorogenic acid: Recent advances on its dual role as a food
additive and a nutraceutical against metabolic syndrome. Molecules 2017,22, 358. [CrossRef]
10.
Naveed, M.; Hejazi, V.; Abbas, M.; Kamboh, A.A.; Khan, G.J.; Shumzaid, M.; Ahmad, F.; Babazadeh, D.; FangFang, X.; Modarresi-
Ghazani, F.; et al. Chlorogenic acid (CGA): A pharmacological review and call for further research. Biomed. Pharmacother.
2018
,97,
67–74. [CrossRef]
Cosmetics 2022,9, 66 17 of 19
11.
Meng, S.; Cao, J.; Feng, Q.; Peng, J.; Hu, Y. Roles of chlorogenic Acid on regulating glucose and lipids metabolism: A review. Evid.
Based Complement. Alternat. Med. 2013,2013, 801457. [CrossRef]
12.
Affonso, R.C.L.; Voytena, A.P.L.; Fanan, S.; Pitz, H.; Coelho, D.S.; Horstmann, A.L.; Pereira, A.; Uarrota, V.G.; Hillmann, M.C.;
Varela, L.A.C.; et al. Phytochemical composition, antioxidant activity, and the effect of the aqueous extract of coffee (Coffea arabica
L.) bean residual press cake on the skin wound healing. Oxid. Med. Cell. Longev. 2016,2016, 1923754. [CrossRef]
13.
Desai, J.; Mallya, R. Development of green coffee beans extract loaded anti-aging liposomal gel. Indian J. Pharm. Educ. Res.
2021
,
55, 979–988. [CrossRef]
14.
Zofia, N.Ł.; Aleksandra, Z.; Tomasz, B.; Martyna, Z.D.; Magdalena, Z.; Zofia, H.B.; Tomasz, W. Effect of fermentation time on
antioxidant and anti-ageing properties of green coffee Kombucha ferments. Molecules 2020,25, 5394. [CrossRef]
15.
Bessada, S.M.; Alves, R.C.; Oliveira, M.B.P.P. Coffee silverskin: A review on potential cosmetic applications. Cosmetics
2018
,5, 5.
[CrossRef]
16.
Saewan, N.; Vichit, W.; Jimtaisong, A. Optimization of microwave-assisted extraction of anti-oxidant compound from coffee berry
pulp using response surface methodology. In Proceedings of the 6th International Conference on Natural Products for Health and
Beauty (NATPRO6), Khon Kaen, Thailand, 21–23 January 2016.
17.
McDaniel, D.H. Clinical safety and efficacy in photoaged skin with coffeeberry extract, a natural antioxidant. Cosmet. Dermatol.
Cedark Knollis 2009,22, 610.
18.
Murthy, P.S.; Naidu, M.M. Recovery of phenolic antioxidants and functional compounds from coffee industry by-products. Food
Bioproc. Tech. 2012,5, 897–903. [CrossRef]
19. Lachin, T. Effect of antioxidant extract from cherries on diabetes. Recent Pat. Endocr. Metab. Immune Drug. Discov. 2014,8, 67–74.
[CrossRef]
20.
Vichit, W.; Saewan, N.; Jimtaisong, A. Antioxidant and sun protection activities of coffee berry pulp extracts. In Proceedings of
the 42nd Congress on Science and Technology of Thailand (STT42), Bangkok, Thailand, 30 November–2 December 2016.
21. Vichit, W.; Saewan, N. Antioxidant activities and cytotoxicity of Thai pigmented rice. Int. J. Pharm. Pharm. Sci. 2015,7, 329–334.
22.
Vichit, W.; Saewan, N. Effect of germination on antioxidant, anti-inflammatory and keratinocyte proliferation of rice. Int. Food
Res. J. 2016,23, 2006–2015.
23.
Jain, R.; Monthakantirat, O.; Tengamnuay, P.; De-Eknamkul, W. Identification of a new plant extract for androgenic alopecia
treatment using a non-radioactive human hair dermal papilla cell-based assay. BMC Complement. Altern. Med.
2016
,16, 18–26.
[CrossRef] [PubMed]
24.
Roh, S.S.; Kim, C.D.; Lee, M.H.; Hwang, S.L.; Rang, M.J.; Yoon, Y.K. The hair growth promoting effect of Sophora flavescens extract
and its molecular regulation. J. Dermatol. Sci. 2002,30, 43–49. [CrossRef]
25.
Pandey, A.; Soccol, C.R.; Nigam, P.; Brand, D.; Mohan, R.; Roussos, S. Biotechnological potential of coffee pulp and coffee husk for
bioprocesses. Biochem. Eng. J. 2000,6, 153–162. [CrossRef]
26.
Brezová, V.; Šlebodová, A.; Staško, A. Coffee as a source of antioxidants: An EPR study. Food Chem.
2009
,114, 859–868. [CrossRef]
27.
Fernandez-Gomez, B.; Ramos, S.; Goya, L.; Mesa, M.D.; del Castillo, M.D.; Martín, M.Á. Coffee silverskin extract improves
glucose-stimulated insulin secretion and protects against streptozotocin-induced damage in pancreatic INS-1E beta cells. Food
Res. Int. 2016,89, 1015–1022. [CrossRef]
28.
Kiattisin, K.; Intasai, N.; Nitthikan, N.; Nantarat, T.; Lee, K.; Lin, W.C.; Lue, S.C.; Leelapornpisid, L. Antioxidant, anti-tyrosinase,
anti-aging potentials and safety of arabica coffee cherry extract. Chiang Mai J. Sci. 2019,46, 930–945.
29.
Abd, E.; Gomes, J.; Sales, C.C.; Yousef, S.; Forouz, F.; Telaprolu, K.C.; Andréo-Filho, N. Deformable liposomes as enhancer of
caffeine penetration through human skin in a Franz diffusion cell test. Int. J. Cosmet. Sci. 2021,43, 1–10. [CrossRef]
30.
Seifert, A.W.; Monaghan, J.R.; Voss, S.R.; Maden, M. Skin regeneration in adult axolotls: A blueprint for scar-free healing in
vertebrates. PLoS ONE 2012,7, e32875. [CrossRef]
31.
Ganceviciene, R.; Liakou, A.I.; Theodoridis, A.; Makrantonaki, E.; Zouboulis, C.C. Skin anti-aging strategies. Dermatoendocrinology
2012,4, 308–319. [CrossRef]
32. Bonora, M.; Pinton, P. Mitochondrial DNA keeps you young. Cell Death Dis. 2018,9, 992. [CrossRef]
33.
Mariggio, M.A.; Cassano, A.; Vinella, A.; Vincenti, A.; Fumarulo, R.; Lo Muzio, L.; Maiorano, E.; Ribatti, D.; Favia, G. Enhancement
of fibroblast proliferation, collagen biosynthesis and production of growth factors as a result of combining sodium hyaluronate
and aminoacids. Int. J. Immunopathol. Pharmacol. 2009,22, 485–492. [CrossRef] [PubMed]
34.
Sriram, G.; Bigliardi, P.L.; Bigliardi-Qi, M. Fibroblast heterogeneity and its implications for engineering organotypic skin models
in vitro. Eur. J. Cell Biol. 2015,94, 483–512. [CrossRef] [PubMed]
35.
Chen, W.C.; Liou, S.S.; Tzeng, T.F.; Lee, S.L.; Liu, I.M. Effect of topical application of chlorogenic acid on excision wound healing
in rats. Planta Medica 2013,79, 616–621. [CrossRef]
36.
Pieme, C.A.; Penlap, V.N.; Ngogang, J.; Costache, M.
In vitro
cytotoxicity and antioxidant activities of five medicinal plants of
Malvaceae family from Cameroon. Environ. Toxicol. Pharmacol. 2010,29, 223–228. [CrossRef] [PubMed]
37.
Mohd Esa, N.; Abdul Kadir, K.K.; Amom, Z.; Azlan, A. Antioxidant activity of white rice, brown rice and germinated brown rice
(
in vivo
and
in vitro
) and the effects on lipid peroxidation and liver enzymes in hyperlipidaemic rabbits. Food Chem.
2013
,141,
1306–1312. [CrossRef]
38.
Serra, V.; von Zglinicki, T.; Lorenz, M.; Saretzki, G. Extracellular superoxide dismutase is a major antioxidant in human fibroblasts
and slows telomere shortening. J. Biol. Chem. 2003,278, 6824–6830. [CrossRef]
Cosmetics 2022,9, 66 18 of 19
39.
Debnath, T.; Park, S.; Kim, D.; Jo, J.; Lim, B. Anti-oxidant and anti-inflammatory activities of Inonotus obliquus and germinated
brown rice extracts. Molecules 2013,18, 9293–9304. [CrossRef]
40.
Aramwit, P.; Kanokpanont, S.; De-Eknamkul, W.; Kamei, K.; Srichana, T. The effect of sericin with variable amino-acid content
from different silk strains on the production of collagen and nitric oxide. J. Biomater. Sci. Polym. Ed.
2009
,20, 1295–1306. [CrossRef]
41.
Lemos, M.F.; de Andrade Salustriano, N.; de Souza Costa, M.M.; Lirio, K.; da Fonseca, A.F.A.; Pacheco, H.P.; Scherer, R.
Chlorogenic acid and caffeine contents and anti-inflammatory and antioxidant activities of green beans of conilon and arabica
coffees harvested with different degrees of maturation. J. Saudi Chem. Soc. 2022,26, 101467. [CrossRef]
42. Kiattisin, K.; Nantarat, T.; Leelapornpisid, P. Evaluation of antioxidant and anti-tyrosinase activities as well as stability of green
and roasted coffee bean extracts from Coffea arabica and Coffea canephora grown in Thailand. J. Pharmacogn. Phytother.
2016
,
8, 182–192.
43.
Philips, N.; Auler, S.; Hugo, R.; Gonzalez, S. Beneficial regulation of matrix metalloproteinases for skin health. Enzyme Res.
2011
,
2011, 427285. [CrossRef] [PubMed]
44.
Demaria, M.; Desprez, P.Y.; Campisi, J.; Velarde, M.C. Cell autonomous and non-autonomous effects of senescent cells in the skin.
J. Investig. Dermatol. 2015,135, 1722–1726. [CrossRef] [PubMed]
45.
Wittenauer, J.; Mackle, S.; Sussmann, D.; Schweiggert-Weisz, U.; Carle, R. Inhibitory effects of polyphenols from grape pomace
extract on collagenase and elastase activity. Fitoterapia 2015,101, 179–187. [CrossRef] [PubMed]
46.
Lee, E.K.; Bharadwaj, S.; Yadava, U.; Kang, G.S. Evaluation of caffeine as inhibitor against collagenase, elastase and tyrosinase
using in silico and in vitro approach. J. Enzyme Inhib. Med. Chem. 2019,34, 927–936.
47.
Madaan, A.; Verma, R.; Singh, A.T.; Jaggi, M. Review of hair follicle dermal papilla cells as
in vitro
screening model for hair
growth. Int. J. Cosmet. Sci. 2018,40, 429–450. [CrossRef]
48.
Luanpitpon, S.; Nimmannit, U.; Pongrakhan, V.; Chanvorach, P. Emblica (Phyllanthus emblica Linn.) Fruit extract promotes
proliferation in dermal papilla cells of human hair follicle. Res. J. Med. Plant 2011,5, 95–100. [CrossRef]
49.
Kim, S.; Kim, S.N.; Jeong, G.; Hong, M.J.; Lee, Y.; Shin, S.H.; Park, H.; Jung, Y.C.; Kim, E.J.; Park, B.C.; et al. Efficacy of caffeine in
promoting hair growth by enhancing intracellular activity of hair follicles. Korean J. Cosmet. Sci. 2019,1, 11–18. [CrossRef]
50. Anderson, K.M.; Liao, S. Selective retention of dihydrotestosterone by prostatic nuclei. Nature 1968,219, 277–279. [CrossRef]
51.
Randall, V.A.; Hibberts, N.A.; Thornton, M.J.; Hamada, K.; Merrick, A.E.; Kato, S.; Jenner, T.J.; De Oliveira, I.; Messenger, A.G.
The hair follicle: A paradoxical androgen target organ. Horm. Res. 2000,54, 243–250. [CrossRef]
52.
Junlatat, J.; Sripanidkulchai, B. Hair growth-promoting effect of Carthamus tinctorius floret extract. Phytother. Res.
2014
,28,
1030–1036. [CrossRef]
53.
Fischer, T.W.; Hipler, U.C.; Elsner, P. Effect of caffeine and testosterone on the proliferation of human hair follicles
in vitro
.Int. J.
Dermatol. 2007,46, 27–35. [CrossRef] [PubMed]
54.
Lademann, J.; Richter, H.; Schanzer, S.; Klenk, A.; Sterry, W.; Patzelt, A. Analysis of the penetration of a caffeine containing
shampoo into the hair follicles by in vivo laser scanning microscopy. Laser Phys. 2009,20, 551–556. [CrossRef]
55.
Teichmann, A.; Richter, H.; Knorr, F.; Antoniou, C.; Sterry, W.; Lademann, J. Investigation of the penetration and storage of a
shampoo formulation containing caffeine into the hair follicles by
in vivo
laser scanning microscopy. Laser Phys. Lett.
2007
,4,
464–468. [CrossRef]
56. Prinyarux, T.; Saewan, N. Anti-hairloss efficacy of coffee berry extract. Food Appl. Biosci. J. 2020,8, 27–39.
57. Paus, R.; Cotsarelis, G. The biology of hair follicles. N. Engl. J. Med. 1999,341, 491–497. [CrossRef]
58.
Itami, S.; Kurata, S.; Takayasu, S. Androgen induction of follicular epithelial cell growth is mediated via insulin-like growth
factor-I from dermal papilla cells. Biochem. Biophys. Res. Commun. 1995,212, 988–994. [CrossRef]
59.
Su, H.Y.; Hickford, J.G.; Bickerstaffe, R.; Palmer, B.R. Insulin-like growth factor 1 and hair growth. Dermatol. Online J.
1999
,5, 1.
[CrossRef]
60.
Tang, L.; Bernardo, O.; Bolduc, C.; Lui, H.; Madani, S.; Shapiro, J. The expression of insulin-like growth factor 1 in follicular
dermal papillae correlates with therapeutic efficacy of finasteride in androgenetic alopecia. J. Am. Acad. Dermatol.
2003
,49,
229–233. [CrossRef]
61.
Li, J.; Yang, Z.; Li, Z.; Gu, L.; Wang, Y.; Sung, C. Exogenous IGF-1 promotes hair growth by stimulating cell proliferation and
down regulating TGF-β1 in C57BL/6 mice in vivo. Growth Horm. IGF Res. 2014,24, 89–94. [CrossRef]
62.
Danilenko, D.M.; Ring, B.D.; Yanagihara, D.; Benson, W.; Wiemann, B.; Starnes, C.O.; Pierce, G.F. Keratinocyte growth factor is an
important endogenous mediator of hair follicle growth, development, and differentiation. Normalization of the nu/nu follicular
differentiation defect and amelioration of chemotherapy-induced alopecia. Am. J. Pathol. 1995,147, 145–154.
63.
Braun, S.; Krampert, M.; Bodó, E.; Kümin, A.; Born-Berclaz, C.; Paus, R.; Werner, S. Keratinocyte growth factor protects epidermis
and hair follicles from cell death induced by UV irradiation, chemotherapeutic or cytotoxic agents. J. Cell Sci.
2006
,119, 4841–4849.
[CrossRef] [PubMed]
64.
Lee, Y.R.; Yamazaki, M.; Mitsui, S.; Tsuboi, R.; Ogawa, H. Hepatocyte growth factor (HGF) activator expressed in hair follicles is
involved in in vitro HGF-dependent hair follicle elongation. J. Dermatol. Sci. 2001,25, 156–163. [CrossRef]
65.
Qi, Y.; Li, M.; Xu, L.; Chang, Z.; Shu, X.; Zhou, L. Therapeutic role of human hepatocyte growth factor (HGF) in treating hair loss.
Peer J. 2016,4, e2624. [CrossRef] [PubMed]
66.
Lachgar, S.; Charveron, M.; Sarraute, J.; Gall, Y.; Bonafe, J.L. Anti-androgens and estrogens: Modulators of VEGF expression in
cultured hair dermal papilla cells. Exp. Dermatol. 1999,8, 336–338. [PubMed]
Cosmetics 2022,9, 66 19 of 19
67.
Yano, K.; Brown, L.F.; Detmar, M. Control of hair growth and follicle size by VEGF-mediated angiogenesis. J. Clin. Investig.
2001
,
107, 409–417. [CrossRef]
68.
Dvorak, H.F.; Brown, L.F.; Detmar, M.; Dvorak, A.M. Vascular permeability factor/vascular endothelial growth factor, microvas-
cular hyperpermeability, and angiogenesis. Am. J. Clin. Pathol. 1995,146, 1029–1039.
69.
Rho, S.S.; Park, S.J.; Hwang, S.L.; Lee, M.H.; Kim, C.D.; Lee, I.H.; Chang, S.Y.; Rang, M.J. The hair growth promoting effect of
Asiasari radix extract and its molecular regulation. J. Dermatol. Sci. 2005,38, 89–97. [CrossRef]
70.
Fischer, T.W.; Herczeg-Lisztes, E.; Funk, W.; Zillikens, D.; Biro, T.; Paus, R. Differential effects of caffeine on hair shaft elongation,
matrix and outer root sheath keratinocyte proliferation, and transforming growth factor-beta2/insulin-like growth factor-1-
mediated regulation of the hair cycle in male and female human hair follicles in vitro. Br. J. Dermatol. 2014,171, 1031–1043.
