Content uploaded by Fabian Fischer
Author content
All content in this area was uploaded by Fabian Fischer on Jul 22, 2022
Content may be subject to copyright.
Available via license: CC BY 4.0
Content may be subject to copyright.
Ingestion of single guide RNAs induces gene overexpression
and extends lifespan in Caenorhabditis elegans via CRISPR
activation
Received for publication, November 29, 2021, and in revised form, May 17, 2022 Published, Papers in Press, May 27, 2022,
https://doi.org/10.1016/j.jbc.2022.102085
Fabian Fischer
1,
*
,‡
, Christoph Benner
1,2, ‡
, Anita Goyala
3
, Giovanna Grigolon
1
, Davide Vitiello
1
, JiaYee Wu
1
,
Kim Zarse
1,4
, Collin Y. Ewald
3
, and Michael Ristow
1,4,
*
From the
1
Energy Metabolism Laboratory, Department of Health Sciences and Technology, Institute of Translational Medicine,
Swiss Federal Institute of Technology (ETH) Zurich, Schwerzenbach, Switzerland;
2
Science and Policy Program, Life Science Zurich
Graduate School, Zurich, Switzerland;
3
Extracellular Matrix Regeneration Laboratory, Department of Health Sciences and
Technology, Institute of Translational Medicine, Swiss Federal Institute of Technology (ETH) Zurich, Schwerzenbach, Switzerland;
4
Charité –Universitätsmedizin Berlin, Freie Universität Berlin and Humboldt-Universität zu Berlin, Institute of Experimental
Endocrinology and Diabetology, Berlin, Germany
Edited by Ursula Jakob
Inhibition of gene expression in Caenorhabditis elegans,a
versatile model organism for studying the genetics of devel-
opment and aging, is achievable by feeding nematodes with
bacteria expressing specific dsRNAs. Overexpression of
hypoxia-inducible factor 1 (hif-1) or heat-shock factor 1 (hsf-1)
by conventional transgenesis has previously been shown to
promote nematodal longevity. However, it is unclear whether
other methods of gene overexpression are feasible, particularly
with the advent of CRISPR-based techniques. Here, we show
that feeding C. elegans engineered to stably express a Cas9-
derived synthetic transcription factor with bacteria expressing
promoter-specific single guide RNAs (sgRNAs) also allows
activation of gene expression. We demonstrate that CRISPR
activation via ingested sgRNAs specific for the respective
promoter regions of hif-1 or hsf-1 increases gene expression
and extends lifespan of C. elegans. Furthermore, and as an in
silico resource for future studies aiming to use CRISPR acti-
vation in C. elegans, we provide predicted promoter-specific
sgRNA target sequences for >13,000 C. elegans genes with
experimentally defined transcription start sites. We anticipate
that the approach and components described herein will help
to facilitate genome-wide gene overexpression studies, for
example, to identify modulators of aging or other phenotypes
of interest, by enabling induction of transcription by feeding of
sgRNA-expressing bacteria to nematodes.
Targeted inhibition of gene expression by RNAi with
transcript-specific dsRNAs has greatly facilitated the system-
atic analyses of genetic pathways in eukaryotic organisms
(1–4). Because of its widespread research impact, the seminal
discovery of dsRNA-mediated RNAi by Fire et al., was awarded
with the Nobel Prize in Physiology or Medicine in 2006. In the
nematode Caenorhabditis elegans, RNAi-mediated knock-
down of specific transcripts can be conveniently achieved by
feeding nematodes with bacteria expressing appropriate
dsRNAs (3,5,6). This approach continues to be an essential
tool for C. elegans research (7) and has enabled several
genome-wide knockdown screens (1,3,8). Currently, no
complementary method for overexpression of C. elegans genes
with similar ease and flexibility exists.
The CRISPR-Cas system was initially described as a type of
bacterial adaptive immune defense, able to protect prokaryotic
organisms against viral or plasmid infections (9–12). Soon
after, it was utilized for the purpose of genome editing, mainly
by introducing the Cas9 protein from Streptococcus pyogenes
into other organisms (13–17). The versatility of Cas9 is largely
based on its ability to be directed by a single-guide RNA
(sgRNA) toward a desired DNA sequence (14). WT Cas9 in-
troduces DNA double-strand breaks at the targeted location
and is thus an RNA-guided DNA endonuclease. In this ca-
pacity, Cas9 has been used in several models, such as
C. elegans (18), Drosophila melanogaster (19), mice (20), and
human cells (21), for targeted gene deletions and to introduce
specific sequence modifications. The Cas9 protein has since
been adapted for various other molecular biology applications
(22–24). Through mutation of its two core catalytic residues to
alanine, Cas9 is rendered fully inactive as an endonuclease.
The resulting inert RNA-guided DNA-binding protein, called
nuclease–dead Cas9 (dCas9), can then be modularly fused
with different functional domains. Examples include its fusion
with transactivation (25,26) or DNA-methylase domains (27),
turning dCas9 into an RNA-guided transcription factor or
RNA-guided DNA-modifying enzyme, respectively.
Overexpression of genes by utilizing dCas9 fused with a
transactivation domain (dCas9
TA
) and promoter-specific
sgRNAs, here and by others termed CRISPR activation or
CRISPRa for short (28), has been demonstrated to be feasible
in, for example, D.melanogaster (29), zebrafish (30), and
‡
These authors contributed equally to this work.
*For correspondence: Michael Ristow, mristow@mristow.org; Fabian
Fischer, ffischer@ffischer.org.
Present address for Davide Vitiello: Rejuvenate Biomed NV, Vrunstraat 153,
Heusden Zolder 3550, Belgium.
RESEARCH ARTICLE EDITORS’PICK
J. Biol. Chem. (2022) 298(7) 102085 1
© 2022 THE AUTHORS. Published by Elsevier Inc on behalf of American Society for Biochemistry and Molecular Biology. This is an open access article under the CC
BY license (http://creativecommons.org/licenses/by/4.0/).
different human tissue culture models (25,26,31,32). The use
of CRISPRa has also been previously explored in at least two
independent C. elegans studies (30,33). In both cases,
CRISPRa was implemented using a technically rather
demanding delivery of necessary components to nematodes by
microinjection, preventing its use for large-scale or genome-
wide screening purposes. To our knowledge, only one study
so far examined the possibility of feeding sgRNA-expressing
bacteria to C. elegans, specifically in the context of classical
Cas9-mediated genome editing (34). This approach demon-
strated that bacterial delivery of sgRNAs to nematodes is
possible in general (34) but did not evaluate its feasibility for
targeted gene overexpression and was found to be of limited
utility (35).
Here, we combine the aforementioned approaches to
establish a novel method for inducing transcription of
endogenous genes in C. elegans by (a) generating and vali-
dating a C. elegans strain stably harboring an expression-
optimized variant of dCas9 fused with the well-characterized
VP64 transactivation domain (25,26,32,36) and (b) estab-
lishing a variant of the L4440 RNAi vector containing a scaf-
fold for expression of C. elegans promoter-specific sgRNAs in
Escherichia coli. By combining these components, focusing on
two genes previously linked to the control of aging phenotypes
(hif-1 (37) and hsf-1 (38)) for proof-of-principle purposes, we
show that they are sufficient to achieve gene overexpression in
C. elegans by feeding of sgRNA-expressing bacteria. Further-
more, we demonstrate that known C. elegans longevity phe-
notypes associated with increased expression of hif-1 and hsf-1,
respectively, by conventional methods can be achieved by our
method relying on ingested sgRNAs. We furthermore provide
an in silico library of C. elegans promoter-specific sgRNA
target sequences, covering the promoters of more than
13,000 C. elegans genes with experimentally defined repre-
sentative transcription start sites (TSSs) as previously identi-
fied (39). Thus, feeding-based CRISPRa in C. elegans is
demonstrated as an alternative and comparatively simple
method for gene overexpression, similar in concept to feeding-
based RNAi for gene inactivation purposes.
Results
To allow dCas9
TA
-mediated overexpression of genes in
C. elegans by bacterially delivered promoter-specific sgRNAs, a
vector encoding a C. elegans expression-optimized dCas9
fused with the VP64 transactivation domain (dCas9::VP64;
Fig. 1A), controlled by the ubiquitous sur-5/K03A1.5
(WormBase WBGene00006351) promoter, was constructed
and stably introduced into nematodes by biolistic bombard-
ment. It has been previously established that the sur-5 gene is
expressed across virtually all C. elegans tissues and stages of
the nematodal life cycle (40). Accordingly, the sur-5 promoter
is hence frequently used for ubiquitous and constitutive
C. elegans transgenic overexpression purposes (41–43).
Promoter-specific sgRNA target sequences were selected
from regions −50 to −400 bp upstream of the respective TSS
(Fig. 1B), following previously established sgRNA design rules
(44). Note that the designation of TSSs in C. elegans is
hampered by the frequently occurring phenomenon of trans-
splicing, that is, the replacement of the 50UTR of a pre-mRNA
transcript with a short common RNA sequence called the
spliced leader. Trans-splicing in C. elegans has been estimated
to affect up to 70% of mRNAs, which masks their original 50
UTR and thereby impedes mapping of TSSs and relevant
promoter regions (39,45). As detailed in the experimental
procedures, this phenomenon was explicitly taken into ac-
count when selecting C. elegans promoter-specific sgRNAs.
For the expression of C. elegans promoter-specific sgRNAs in
E. coli HT115 bacteria, the L4440 RNAi empty vector
(Addgene; plasmid #1654) was modified to contain two
consecutive sgRNA expression cassettes (14,46) under control
of individual T7 promoters and together flanked by BioBrick
cloning sites (47)(Fig. 1C), resulting in the vector
L4440_BioBrick-sgRNA.
First, expression of the 171 kDa dCas9::VP64 fusion protein
was tested for by immunoblotting, indicating that it was pre-
sent in initially bombarded dCas9::VP64 nematodes and still
retained after two and four rounds of outcrossing against WT
N2 nematodes (Fig. 1D). In addition, expression of the
dCas9::VP64 protein, which contains a FLAG-tag and hem-
agglutinin (HA)-tag, was confirmed by immunofluorescence
microscopy in outcrossed dCas9::VP64 nematodes using an
anti-HA antibody (Fig. S1A).
For unknown reasons, nonoutcrossed dCas9::VP64 nema-
todes showed a reduced lifespan versus the WT control on
OP50 bacteria (mean −13.0%, p-value <0.0001; Fig. S1B),
while the lifespans of strains outcrossed twice (Fig. S1C)or
four times (Fig. 1E) were not different from WT. The four-
times outcrossed dCas9::VP64 strain was used for all further
experiments, and additionally confirmed to not display a life-
span phenotype when raised on HT115 bacteria containing the
L4440 RNAi empty vector (HT115 L4440; Fig. 1F). Next,
HT115 bacteria expressing scramble control (SCR) sequences
from L4440_BioBrick-sgRNA, using two different sgRNA SCR
vectors A and B, were tested for their influence on C. elegans
aging when compared to HT115 L4440. Lifespans of both WT
and dCas9::VP64 nematodes remained unaltered on either of
the HT115 SCR bacteria compared to HT115 L4440 (Fig. S1,
D–G). Thus, HT115 SCR A and B bacteria, together hereafter
referred to as HT115 SCR, were used interchangeably as a
control for all subsequent experiments. The lifespan of
dCas9::VP64 nematodes versus WT raised on HT115 SCR was
assayed and, again, no appreciable difference of lifespans was
observed (Fig. 1G). Together, these results demonstrate that
neither presence of the dCas9::VP64 protein in the outcrossed
strain nor feeding with HT115 SCR bacteria has any discern-
ible impact on C. elegans lifespan (see Table S1 for detailed
statistics of lifespan assays and repeats thereof performed
throughout this study). Furthermore, overall transcriptomic
changes of dCas9::VP64 strain versus WT, raised on HT115
SCR bacteria, were assessed by RNA-Seq (full data available in
NCBI’s Gene Expression Omnibus, GEO Series accession
number GSE202213 [https://www.ncbi.nlm.nih.gov/geo/
query/acc.cgi?acc=GSE202213]). Thereby, only 94 of 12,824
EDITORS’PICK: Ingestion of sgRNAs induces C. elegans CRISPR activation
2J. Biol. Chem. (2022) 298(7) 102085
transcripts with feature counts above threshold were detected
as significantly differentially regulated between the two strains.
Notably, transcription of the genes used for proof of principle
in this study was not at all detectably affected (hif-1 fold-
change dCas9::VP64 versus WT = 0.954, p= 0.350, false dis-
covery rate (FDR) = 0.627; hsf-1 fold-change dCas9::VP64
versus WT = 1.049, p= 0.303, FDR = 0.584).
Next, promoter-specific sgRNA target sequences for the
promoters of the genes hif-1/F38A6.3 (WBGene00001851) and
hsf-1/Y53C10A.12 (WBGene00002004), four each in total,
were selected from the appropriate region (i.e.,−50 to −400 bp
upstream of the respective TSS) and inserted in pairs into
L4440_BioBrick-sgRNA. This resulted in two sgRNA expres-
sion vectors for each gene, referred to in short as sgRNA hif-1
A and B, as well as sgRNA hsf-1 A and B, respectively
(Table S2). Each vector was individually transformed into
HT115 bacteria.
Feeding dCas9::VP64 nematodes with HT115 bacteria
containing the sgRNA hif-1 A vector increased hif-1 expres-
sion mildly but significantly (1.63 ± 0.16 SEM, p= 0.0227), as
determined by quantitative PCR versus feeding with HT115
SCR (Fig. 2A). More strikingly, both mean and maximum
5’ 3’
dCas9FLAG NLS NLS VP64 HA
A
5’ sgRNA Region
-400 bp -50 bp
3’
TSS Target Gene
0 bp
B
dCas9::VP64WT (N2)
0 102030
0
20
40
60
80
100
Time (days)
Survival (%)
+3.4%
P = 0.1952
OP50 bacteria
E
- dC9V
- 171 kDa
kDa
150 -
100 -
50 -
25 -
x0 x2 x4
Anti-FLAG M2 (F3165)
Outcr.
D
- unsp.
F
0 102030
0
20
40
60
80
100
Time (days)
Survival (%)
-0.5%
P = 0.9562
dCas9::VP64
WT (N2)
HT115 bacteria - L4440 G
±0.0%
P = 0.3117
0102030
0
20
40
60
80
100
Time (days)
Survival (%)
dCas9::VP64WT (N2)
HT115 bacteria - SCR
dCas9::VP64
WT
gaattcgcggccgcttctagag
TAATACGACTCACTATAGGGCCGTCTTCGTTAGAAGACCT
GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCG
TTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT
aggttctgttaagtaactga
TAATACGACTCACTATAGGGAGAGACCAGTGTAGGTCTCT
GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCG
TTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT
aggttctgttaagtaactga
tactagtagcggccgctgcag
C
BioBrick Prefix (EcoRI, XbaI)
T7 Promoter | Target Sequence (BbsI)
Cas9 Handle
S. pyogenes Terminator
Spacer
T7 Promoter | Target Sequence (BsaI)
Cas9 Handle
S. pyogenes Terminator
Spacer
BioBrick Suffix (SpeI, PstI)
Figure 1. Components for CRISPR activation in C. elegans by bacterial delivery of sgRNAs. A, domain organization of the dCas9::VP64 fusion protein,
including two nuclear localization signals (NLSs), and a FLAG- and HA-tag. B, schematic representation of the region upstream of a given transcription start
site (TSS) from which promoter-specific sgRNAs are selected. C, full sequence of the two sgRNA expression cassettes in vector L4440_BioBrick-sgRNA,
including BioBrick cloning sites and with individual features as indicated by color. D, Western blot analysis of total protein extracts from WT N2 nema-
todes versus dCas9::VP64 nematodes outcrossed x0, x2, or x4 (MIR249). The 171 kDa dCas9::VP64 protein (dC9V) is detected with a FLAG antibody in all
dCas9::VP64 nematodes and an additional unspecific (unsp.) band is detected in all samples at 25 kDa. E–G, lifespan assay of WT versus dCas9::VP64
nematodes on OP50 bacteria (E), HT115 bacteria carrying the L4440 vector (F), or HT115 sgRNA scramble control (SCR) bacteria (G). p-values of C. elegans
lifespan assays were determined by log-rank test. See Table S1 for detailed lifespan assay statistics. HA, hemagglutinin; sgRNA, single-guide RNA.
EDITORS’PICK: Ingestion of sgRNAs induces C. elegans CRISPR activation
J. Biol. Chem. (2022) 298(7) 102085 3
+20.9%
P < 0.0001
dCas9::VP64
+sgRNA
hif-1 A
SCR
0 102030
0
20
40
60
80
100
Time (days)
Survival (%)
-3.2%
P = 0.4701
WT (N2)
+sgRNA
hif-1 A
SCR
0 102030
0
20
40
60
80
100
Time (days)
Survival(%)
±0.0%
P = 0.8911
dCas9::VP64 x ∆hif-1
+sgRN
A
hif-1 A
SCR
0102030
0
20
40
60
80
100
Time (days)
Survival (%)
+16.5%
P < 0.0001
dCas9::VP64
+sgRNA
hif-1 B
SCR
0102030
0
20
40
60
80
100
Time (days)
Survival (%)
+1.0%
P = 0.7279
WT (N2)
+sgRNA
hif-1 B
SCR
0102030
0
20
40
60
80
100
Time (days)
Survival (%)
-0.5%
P = 0.8529
dCas9::VP64 x ∆hif-1
+sgRN
A
hif-1 B
SCR
0102030
0
20
40
60
80
100
Time (days)
Survival (%)
+12.8%
P < 0.0001
dCas9::VP64
+sgRNA
hsf-1 A
SCR
0102030
0
20
40
60
80
100
Time (days)
Survival(%)
-0.5%
P = 0.744
WT (N2)
+sgRNA
hsf-1 A
SCR
0 102030
0
20
40
60
80
100
Time (days)
Survival(%)
0102030
0
20
40
60
80
100
Time (days)
Survival(%)
-1.8%
P = 0.4143
dCas9::VP64 x ∆hsf-1
+sgRN
A
hsf-1 A
SCR
+14.1%
P < 0.0001
dCas9::VP64
+sgRNA
hsf-1 B
SCR
0 102030
0
20
40
60
80
100
Time (days)
Survival(%)
-0.9%
P = 0.7035
WT (N2)
+sgRNA
hsf-1 B
SCR
0102030
0
20
40
60
80
100
Time (days)
Survival (%)
-4.1%
P = 0.0210
dCas9::VP64 x ∆hsf-1
+sgRN
A
hsf-1 B
SCR
0102030
0
20
40
60
80
100
Time (days)
Survival (%)
BCDA
FGHE
JKLI
NOPM
Relative expression
hsf-1 (x-fold)
SCR +sgRNA
hsf-1 B
0.0
0.5
1.0
1.5
2.0
0.0126
SCR +sgRNA
hsf-1 A
0.0
0.5
1.0
1.5
2.0
Relative expression
hsf-1 (x-fold)
0.0665
SCR
0.0
0.5
1.0
1.5
2.0
2.5
Relative expression
hif-1 (x-fold)
+sgRNA
hif-1 A
0.0227
SCR
0.0
0.5
1.0
1.5
2.0
Relative expression
hif-1 (x-fold)
+sgRNA
hif-1 B
0.0554
SCR
hsf-1 B
0
1×10
7
2×10
7
3×10
7
4×10
7
Flourescenceintensity (AU)
< 0.0001
< 0.0001
< 0.0001
hsf-1 A
dCas9::VP64 x
TJ375 (gpIs1 [hsp-16.2p::GFP])
100 μm 100 μm 100 μm
SCR +sgRNA
hsf-1 A
+sgRNA
hsf-1 B
QR
Figure 2. Increased gene expression and lifespan by CRISPRa with ingested sgRNAs. A, relative hif-1 expression in dCas9::VP64 nematodes fed with
HT115 sgRNA scramble control (SCR) or HT115 sgRNA hif-1 A bacteria, as determined by RT-qPCR. B, lifespan assay with nematodes and bacteria as in (A). C,
lifespan assay with bacteria as in (A) and using WT N2 nematodes. D, lifespan assay with bacteria as in (A) and using dCas9::VP64 nematodes with a
simultaneous hif-1 loss-of-function mutation (dCas9::VP64xΔhif-1, MIR250). E–H, similar experiments as in (A–D), using HT115 sgRNA hif-1 B bacteria instead.
I–L, similar experiments as in (A–D), using HT115 sgRNA hsf-1 A bacteria and dCas9::VP64xΔhsf-1 (MIR251). M–P, similar experiments as in (A–D), using HT115
sgRNA hsf-1 B bacteria and dCas9::VP64xΔhsf-1.Q, representative images showing expression of hsp-16.2 promoter-driven GFP in dCas9::VP64 x TJ375 (gpIs1
EDITORS’PICK: Ingestion of sgRNAs induces C. elegans CRISPR activation
4J. Biol. Chem. (2022) 298(7) 102085
lifespan of dCas::VP64 nematodes fed with HT115 sgRNA hif-
1A were extended versus the control (mean +20.9%, 75% max
28 versus 24 days, p<0.0001; Fig. 2B), and this overall effect
was confirmed in three independent lifespan assays (Table S1).
Notably, this increase in lifespan following sgRNA-mediated
hif-1 overexpression was comparable to what was previously
observed with transgenic strains with stable integrations of hif-
1p::hif-1::myc overexpression constructs, generated by classical
biolistic bombardment (37), and also to our own lifespan as-
says using this transgenic strain (ZG580), independent of the
bacterial food source (OP50, HT115 L4440, or HT115 SCR;
Fig. S1,H,Jand Land Table S1). To test the specificity of this
effect on lifespan, feeding of HT115 sgRNA hif-1 A to either
WT nematodes or dCas9::VP64 nematodes carrying a homo-
zygous hif-1 loss-of-function allele (dCas9::VP64xΔhif-1) was
assayed. In the absence of the dCas9::VP64 fusion protein
(Fig. 2C), or functional hif-1 (Fig. 2D), feeding with HT115
sgRNA hif-1 (A) did not affect lifespan. Performing the same
set of experiments as in 2A–2Dwith HT115 sgRNA hif-1 B
yielded very similar results (Fig. 2,E–H). While hif-1 expres-
sion following feeding with HT115 sgRNA hif-1 B was
increased only by trend (1.23 ± 0.07 SEM, p= 0.0554; Fig. 2E),
again a clear effect on the mean and maximum lifespan of
dCas9::VP64 nematodes was detected (mean +16.5%, 75% max
28 versus 23 days, p<0.0001; Fig. 2F) and found to be overall
reproducible in independent experiments (Table S1). This
increase in lifespan following feeding with HT115 sgRNA hif-
1B also required the presence of the dCas9::VP64 fusion
protein (Fig. 2G) and functional hif-1 (Fig. 2H).
Feeding dCas9::VP64 nematodes with HT115 bacteria
containing the sgRNA hsf-1 A or B vector in both cases, by
trend or significantly, increased hsf-1 expression (A: 1.33 ±
0.13 SEM, p= 0.0665; Fig. 2I| B: 1.67 ± 0.05 SEM, p= 0.0126;
Fig. 2M) and mean and maximum lifespan (A: mean +12.8%,
75% max 24 versus 21 days, p<0.0001; Fig. 2J|B:
mean +14.1%, 75% max 25 versus 21 days, p<0.0001; Fig. 2N)
in a reproducible manner (Table S1). These observations were
again congruent with published data on lifespan extension of a
transgenic hsf-1 overexpressor (38) and our own lifespan as-
says with this very strain (CF1824; Fig. S1,I,Kand M, and
Table S1). Similar as observed for hif-1, HT115 sgRNA hsf-1 A
and B were unable to extend lifespan when applied to either
WT nematodes lacking the dCas9::VP64 fusion protein (Fig. 2,
Kand O) or to dCas9::VP64 nematodes with a simultaneous
loss-of-function mutation of hsf-1 (dCas9::VP64xΔhsf-1; Fig. 2,
Land P). Feeding of sgRNA hif-1 or hsf-1 A and B bacteria to
the respective transgenic overexpression strain for hif-1
(ZG580) or hsf-1 (CF1824) also did not significantly affect
lifespan of these strains compared to feeding with HT115 SCR
(Fig. S1,N–Qand Table S1), again as to be expected in absence
of the dCas9::VP64 protein.
As an additional phenotypic readout for hsf-1 over-
expression, we quantified hsp-16.2 promoter-driven GFP
expression in a newly generated dCas9::VP64 x TJ375 (gpIs1
[hsp-16.2p::GFP]) reporter strain, with hsp-16.2 being a well-
described downstream target gene of the HSF-1 transcription
factor (48). Feeding this strain with HT115 sgRNA hsf-1 AorB
bacteria in both cases led to a significant increase of the
detectable GFP signal over feeding with HT115 SCR bacteria,
with feeding of sgRNA hsf-1 B bacteria having a stronger effect
(Fig. 2,Qand R).
Finally, also as a resource for future studies in the C. elegans
scientific community, we computationally predicted promoter-
specific sgRNA target sequences, applying the same design
rules that were followed to select the hif-1 and hsf-1 promoter-
specific sgRNA target sequences used in the proof-of-principle
experiments presented herein. Taking into account the phe-
nomenon of trans-splicing and the C. elegans TSS landscape as
mapped by Saito et al. (39), we generated a library of 20
nucleotide C. elegans promoter-specific sgRNA target se-
quences, located −50 to −400 bp upstream of the respective
embryonic and/or adult TSS, for more than 13,000 genes
(Table S3) (please refer to the Experimental procedures for
further details). Notably, the thus predicted sgRNA target se-
quences for hif-1 and hsf-1 were confirmed to contain those
that were selected manually and used in vectors sgRNA hif-1 A
and B and sgRNA hsf-1 A and B for proof-of-principle ex-
periments, as depicted previously.
Discussion
We here show that the implementation of CRISPRa by
ingested sgRNAs in C. elegans is a feasible approach to induce
gene expression. Specifically, our results demonstrate that the
here established components, meaning nematodes stably
expressing dCas9::VP64 and bacterial vectors expressing
C. elegans promoter-specific sgRNAs in E. coli HT115, are
sufficient to detectably increase expression of targeted genes
and to elicit additional phenotypic effects. Increases in lifespan
when overexpressing hif-1 and hsf-1 by feeding-based
CRISPRa are shown to be specific for the individual compo-
nents and targeted genes and are phenotypically congruent
with observations in transgenic hif-1 and hsf-1 overexpressing
animals (37,38). While previous studies in C. elegans have
already shown CRISPRa to be achievable by delivery of
necessary components to nematodes by microinjection (30,
33), feasibility of sgRNA delivery by bacteria for this purpose,
as here demonstrated, has apparently not been explored.
Notably, the degree of CRISPRa gene overexpression observed
in these studies was, similar to our results, somewhat limited.
This is not necessarily a problem, since low-level over-
expression of a given transgene by classical methods may yield
[hsp-16.2p::GFP]) (MIR276) animals fed with HT115 SCR or HT115 sgRNA hsf-1 A or B bacteria. R, scatter plots (mean and 95% CI) showing quantification data
for hsp-16.2p::GFP expression in animals as in (Q) from four independent replicate experiments (SCR n= 145, sgRNA hsf-1 An= 135, sgRNA hsf-1 Bn= 147
animals). Data in bar graphs are mean ± SEM, with individual data points representing biological replicates and p-values determined with two-tailed
unequal variances ttests. p-values of C. elegans lifespan assays were determined by log-rank test. See Table S1 for detailed lifespan assay statistics.
CRISPRa, CRISPR activation; RT-qPCR, reverse transcription-quantitative PCR; sgRNA, single-guide RNA.
EDITORS’PICK: Ingestion of sgRNAs induces C. elegans CRISPR activation
J. Biol. Chem. (2022) 298(7) 102085 5
the opposite phenotype of high-level overexpression; we
recently have shown that limited overexpression of Grainyhead
1(ghr-1) following transgene bombardment in C. elegans
promotes longevity, whereas high-level overexpression of the
same transgene shortens lifespan (49).
Further optimization of individual components used for
CRISPRa in C. elegans, for example, by testing additional
variants of transactivation domains fused to dCas9, different
promoters (with varying tissue specificity or inducibility, as
opposed to the ubiquitous and constitutive sur-5 promoter
here used) driving expression of such dCas9
TA
variants, other
dCas proteins instead of dCas9, and/or different bacterial
sgRNA expression cassettes, might considerably increase effi-
ciency and lead to more pronounced and better detectable
effects. Assaying efficiency of feeding-based CRISPRa on a
single nematode level and in different tissues by using distinct
and individually scorable readouts, especially when imple-
menting different combinations of aforementioned variable
components, might be particularly valuable for future
comparative methodological studies in this regard.
Nevertheless, feeding-based CRISPRa, as established here,
significantly simplifies gene overexpression compared to
methods commonly employed so far. These usually require (a)
several cloning steps to generate vectors in which a suitable
promoter controls expression of the desired gene or transcript,
(b) technically demanding delivery of such vectors to nema-
todes (injection or bombardment), and (c) extensive screening
procedures to identify stable overexpression mutants, followed
by (d) several rounds of backcrossing to avoid unspecific
effects.
Given the possibility of sgRNAs bacterially delivered to
C. elegans in directing Cas9 variants toward a desired DNA
sequence, as also demonstrated elsewhere (34), additional
methods following the same general concept appear quite
promising. For example, a fusion of dCas9 to histone
modifiers allows control of various epigenetic modifications
in a defined manner (50). Introducing appropriate dCas9
variants to C. elegans could thus be suitable for spatially
and temporally defined editing of epigenetic states by
supplying appropriate sgRNA-expressing bacteria. Overall,
the versatility and modularity of feeding-based dCas9 tar-
geting in C. elegans offers a host of opportunities for
scalable techniques of targeted genomic manipulation in
this organism.
Note added after acceptance
While this manuscript was under final review, another study
that implemented CRISPRa in combination with feeding of
sgRNAs in C. elegans was published elsewhere online ahead of
print (51). Instead of using an S.pyogenes Cas9-derived syn-
thetic transcription factor to activate hif-1 and hsf-1 expres-
sion, Luo et al. opted to use a Camphylobacter jejuni Cas9-
derived variant and focused on a different set of exemplary
target genes (including aak-2,lipl-4, and pha-4), otherwise
using a very similar approach to ours and also showing effects
both on mRNA expression and lifespan. We are very pleased
to see that a team of colleagues independently found feeding of
sgRNAs to be sufficient for CRISPRa in C. elegans and believe
this only adds to further strengthen overall validity of this
technique and incentivize its use in the C. elegans scientific
community.
Experimental procedures
C. elegans strains and maintenance
The following C. elegans strains used for this publication
were provided by the Caenorhabditis Genetics Center (CGC at
the University of Minnesota): N2 (C. elegans wild isolate variant
Bristol), HT1593 (unc-119(ed3) III.), ZG31 (hif-1(ia4) V.),
PS3551 (hsf-1(sy441) I.), ZG580 (unc-119(ed3) III; iaIs28 [hif-
1p::hif-1a::tag + unc-119(+)]), CF1824 (muEx265 [hsf-1p::hsf-
1(cDNA) + myo-3::GFP]), and TJ375 (gpIs1 [hsp-16.2p::GFP]).
We newly generated the strain dCas9::VP64 (K03A1.5p::3x-
FLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA + unc-119(+))
by biolistic bombardment of HT1593 with a dCas9::VP64
overexpression vector as detailed later. Unless explicitly stated
otherwise, we used this dCas9::VP64 strain outcrossed four
times against WT N2, the resulting outcrossed strain termed
MIR249 (risIs33), for all corresponding experiments reported in
this publication. For the generation of dCas9::VP64 nematodes
with additional loss-of-function mutations of hif-1 or hsf-1,
MIR249 was intercrossed with strain ZG31 or PS3551,
respectively. The resulting strains are termed MIR250 (MIR249
intercrossed with ZG31) and MIR251 (MIR249 intercrossed
with PS3551). MIR249 was additionally intercrossed with strain
TJ375 to generate MIR276, resulting in a strain that was used
for hsp-16.2p::GFP fluorescence microscopy experiments. All
newly generated MIR strains (249, 250, 251, and 276) have been
deposited at the CGC. For maintenance, nematodes were grown
on nematode growth medium (NGM) agar plates in 90 mm
petri dishes at 20 C using E. coli OP50 bacteria as a food source
(52). NGM agar plates, after pouring, were dried at room
temperature (RT) for 1 to 2 days and then stored at 4 C until
further use.
E. coli strains and culturing
E. coli OP50 bacteria (CGC) were streaked out on DYT
(16 g/l tryptone, 10 g/l yeast extract, 5 g/l NaCl, pH = 7.0 with
NaOH) agar plates, and single colonies picked from such
plates were cultured overnight at 37 C and constant shaking
in Erlenmeyer flasks containing liquid DYT medium. Bacterial
overnight cultures were concentrated by centrifugation for
30 min at 3200gand 4 C. The prepared bacteria were spotted
on NGM agar plates and allowed to grow for 16 to 24 h prior
to use.
E.coli HT115(DE3) bacteria (CGC), containing either the
standard L4440 RNAi empty vector or one of the vectors
derived from the L4440_BioBrick-sgRNA vector (see later),
were streaked out on LB agar plates with 100 μg/ml ampicillin
and 12.5 μg/ml tetracycline, and single colonies picked from
such plates were cultured overnight at 37 C and constant
shaking in Erlenmeyer flasks containing liquid LB medium
with 100 μg/ml ampicillin. Bacterial overnight cultures were
EDITORS’PICK: Ingestion of sgRNAs induces C. elegans CRISPR activation
6J. Biol. Chem. (2022) 298(7) 102085
concentrated by centrifugation for 30 min at 3200gand 4 C.
The prepared bacteria were spotted on NGM agar plates
additionally containing 100 μg/ml ampicillin and 1 mM IPTG
and allowed to grow for 16 to 24 h prior to use (all reagents
from AppliChem).
The E. coli strain NEB 5-alpha (New England Biolabs, cat-
alog no.: #C2987) was used according to the manufacturer’s
instructions for all cloning procedures as described later.
Design of C. elegans promoter-specific sgRNA target
sequences
To predict sgRNA target sequences specific for the pro-
moter of a particular C. elegans gene, stringent design rules
were defined. These rules were based on known properties of
the C. elegans TSS landscape (39) and established guidelines
for the selection of maximally efficient and specific promoter-
localized sgRNA target sequences (44,53,54).
(1) Identify the TSS of a C. elegans target gene, considering
the phenomenon of trans-splicing that might obscure relevant
TSSs (39). If applicable, give preference to the representative
adult TSS over the representative embryonic TSS. (2) Desig-
nate −50 to −400 bp upstream of the selected TSS as the re-
gion from which to select all sgRNA target sequences (44). (3)
From this region, select appropriate 20 nt sgRNA target se-
quences flanked by an NGG protospacer-adjacent motif based
on established computational design rules predicting their on-
and off-target scores (53,54). Preferably select sgRNA target
sequences with on- and off-target scores >50 and give pref-
erence to those with the highest possible scores. Note that
orientation of sgRNA target sequences relative to the TSS, that
is, whether they are located on the same or on opposite DNA
strands, appears negligible and should not be used as a crite-
rion for exclusion of otherwise suitable sgRNA target se-
quences (25).
All sgRNA target sequences used for proof-of-principle
experiments in this publication were designed strictly ac-
cording to these rules and are contained in Table S2.Spe-
cifically, we designed sgRNA target sequences for the
promoters of the genes hif-1/F38A6.3 (WBGene00001851)
and hsf-1/Y53C10A.12 (WBGene00002004). Additionally,
sgRNA SCR sequences were designed using random 20 nt
sequences with a GC content of 50% that were confirmed by
BLAST to not have any significant matches with the known
C. elegans genome.
For large-scale prediction of promoter-specificsgRNA
target sequences, we focused on all C. elegans genes with
experimentally confirmed representative embryonic and/or
adult TSSs (39), a total of more than 13,000 genes repre-
senting approximately 65% of all known C. elegans genes. The
rules described previously were used for batch computational
prediction using Ensembl BioMart release 97 (55), the guide
RNA selection tool CRISPOR (56), and custom JavaScript,
Perl, and Python scripts. Table S3 contains all relevant in-
formation together with the predicted sgRNA target se-
quences, ranked by their on-target efficiency scores according
to the method by Doench et al. (54). Each individual sgRNA
target sequence is given in the format
XX_NNNNNNNNNNNNNNNNNNNN, where XX is its on-
target efficiency score and N a nucleotide.
Cloning procedures
C. elegans dCas9::VP64 overexpression vector: We designed
a DNA fragment flanked by attB1 and attB2 recombination
sites and containing a Cas9 coding sequence optimized for
efficient expression in C. elegans (based on Addgene plasmid
#47549) (57). This sequence was altered by introducing two
amino acid mutations (D10A and H840A) known to inactivate
the endonuclease function of Cas9 (resulting in dCas9) (14). At
the 50end of the dCas9 sequence, a sequence encoding a
3xFLAG-tag and a SV40 nuclear localization signal (NLS) and
at the 30end, a sequence encoding another SV40 NLS, a VP64
transactivation domain, and an HA-tag (based on Addgene
plasmid #47107) (26) followed by a stop codon was added. The
full sequence (attb1_3xFLAG::SV40-NLS::dCas9::SV40-
NLS::VP64::HA_attB2) was obtained using a custom DNA
synthesis service and inserted into the Gateway pDONR221
vector (Thermo Fisher Scientific; catalog no.: #12536017) us-
ing recombination as mediated by the Gateway BP Clonase II
Enzyme Mix (Thermo Fisher Scientific; catalog no.:
#11789020), resulting in the vector pENTRY_dCas9-VP64. A
vector containing 2300 bp of the C. elegans sur-5/K03A1.5
(WBGene00006351) promoter was generated by amplifying
the promoter sequence from genomic DNA using primers,
introducing attB4 and attB1R recombination sites at the 50and
30end, respectively. The PCR product was inserted into the
Gateway pDONRP4-1R vector (Thermo Fisher Scientific;
catalog no.: #12536017) as aforementioned, resulting in the
vector pENTRY_sur5p. The newly generated vectors pEN-
TRY_psur5 and pENTRY_dCas9-VP64 were inserted into the
destination vector pdestMB14 (Addgene; plasmid #26415) (58)
using the Gateway LR Clonase II Enzyme Mix (Thermo Fisher
Scientific; catalog no.: #11791020), to obtain vector
pdestMB14_sur5p-dCas9-VP64 (deposited at and available
from Addgene with the ID 177788).
L4440-derived sgRNA expression vector: By usingthe standard
2790 bp L4440 RNAi empty vector (Addgene; plasmid #1654) as a
template for mutagenesis PCR with the Q5 Site-Directed Muta-
genesis Kit (New England Biolabs; catalog no.: #E0554S), the in-
termediate vector L4440-BioBrick was generated. In this 2585 bp
vector, nucleotides 1982 to 2204 of the original L4440 vector,
including the bidirectional T7 promoters, were deleted and
replaced with an 18 nt sequence (50GAATTCAAGCTTC
TGCAG) that contains EcoRI, HindIII, and PstI restriction sites.
The EcoRI and PstI restriction sites are positioned in such a way as
to conform to the BioBrick assembly standard (47). In addition, a
BsaI restriction site in the backbone of L4440 was destroyed. Into
L4440-BioBrick, a 329 bp sequence containing two sgRNA
expression cassettes (see Fig. S1A) wasinserted via EcoRI and PstI
restriction sites to obtain L4440_BioBrick-sgRNA (deposited at
and available from Addgene with the ID 177783). Individual
promoter-specific sgRNA target sequences or SCR were inserted
into L4440_BioBrick-sgRNA via the BbsI and BsaI restriction
EDITORS’PICK: Ingestion of sgRNAs induces C. elegans CRISPR activation
J. Biol. Chem. (2022) 298(7) 102085 7
sites and using oligos with appropriate overhangs. See Table S2
for vector designations and Addgene IDs, where all of these are
available from.
Bombardment and generation of stable C. elegans strains
The pdestMB14_sur5p-dCas9-VP64 vector (Addgene ID
177788) was transformed into the unc-119-deficient C. elegans
strain HT1593 by microparticle bombardment using the bio-
listic particle delivery system PDS-1000/He (Bio-Rad) ac-
cording to the manufacturer’s instructions and previously
described protocols (59). For identification and genotyping
of dCas9::VP64–positive nematodes, we conducted single-
nematode PCR using the primers Ce_dC9V_gt_fwd
(50-GAGGACAACGAGCAAAAGCA-30) and Ce_dC9V_g-
t_rev (50-GAGGTTGGTGAGGGTGAAGA-30). We obtained
a stable insertion of the construct into the genome, as
confirmed by PCR-based offspring analysis over several gen-
erations. We also verified the presence of the recombinant
protein by immunoblotting and immunofluorescence, as
detailed later. The resulting strain was called dCas9::VP64 and
outcrossed a total of four times against WT N2. Unless
explicitly stated otherwise, we used this four-time outcrossed
dCas9::VP64 strain for all experiments reported in this publi-
cation. This strain (MIR249) is available from the CGC.
C. elegans lifespan assays
All C. elegans lifespan assays were performed at 20 C ac-
cording to standard protocols as previously described, explic-
itly omitting FUdR (60). Briefly, adult nematodes were allowed
to lay eggs for 4 to 9 h, and the resulting eggs were incubated
for 64 h at 20 C on NGM agar plates inoculated with OP50 to
obtain a synchronized population of young adult nematodes.
For a typical lifespan assay, 100 young adult nematodes per
condition were manually transferred to NGM agar plates
(30–35 nematodes per 55 mm Petri dish, supplemented with
ampicillin and IPTG as described previously for all experi-
ments using HT115 bacteria) inoculated with the respective
bacteria as indicated. For the first 10 to 12 days, nematodes
were transferred daily and afterward every 2 to 3 days. Nem-
atodes showing no reaction to gentle stimulation were scored
as dead. Nematodes that crawled off the plates, displayed in-
ternal hatching or a protruding vulva were censored. All key
lifespan assays were repeated by different individual re-
searchers in two independent laboratories.
Protein extraction from C. elegans
Per sample, a mixed population of nonstarved nematodes
was collected from a 90 mm NGM agar plate by washing with
10 ml S buffer and transferred to a 15 ml reaction tube.
Samples were centrifuged for 1 min at 1300g, supernatants
were discarded to 0.5 ml, and the nematodes were transferred
to 1.5 ml reaction tubes. The remaining supernatant of each
sample was carefully discarded after centrifugation for 1 min at
20,000g. For extraction of total protein, approximately 100 μl
radioimmunoprecipitation assay buffer (equal to twice the
nematode pellet volume), containing 1× Halt Protease and
Phosphatase Inhibitor Cocktail (100×) (Thermo Fisher Scien-
tific; catalog no.: #78440), was added per sample. Nematodes
were cracked by three cycles of freeze-thawing (freeze samples
for 10–20 s in liquid nitrogen, incubate in RT water bath for
2–3 min until samples begin to thaw) and sonication on ice
(20 s at 80% amplitude). Samples were then centrifuged for
10 min at 12,000gand 4 C, and the supernatants containing
the extracted total proteins were transferred to new reaction
tubes. For protein quantification, the “Roti-Nanoquant”(Carl
Roth; catalog no.: #K880) reagent, along with bovine serum
albumin standard, was used according to the manufacturer’s
instructions. Samples were then either used directly for
immunoblotting or stored at −80 C until further use.
Immunoblotting
Per sample, 40 μgofC. elegans total protein extract was
boiled for 10 min at 95 C in 1× Laemmli sample buffer. The
samples were then used for a standard SDS-PAGE in a Mini-
PROTEAN Tetra Cell (Bio-Rad Laboratories) electrophoresis
chamber according to the manufacturer’s instructions.
Following electrophoresis, transfer of the proteins to a poly-
vinylidene fluoride membrane was achieved using the Mini
Trans-Blot Cell (Bio-Rad Laboratories) blotting module. After
blotting, the membrane was blocked for 30 min in Tris-
buffered saline with Tween-20 with 5% nonfat dry milk and
then incubated overnight at 4 C with the ANTI-FLAG M2
antibody (Sigma–Aldrich; catalog no.: #F3165) at a dilution of
5μg/ml. Incubation with the horseradish peroxidase–linked
secondary antimouse antibody (Cell Signaling Technology;
catalog no.: #7076) was performed for 1 h at RT and a dilution
of 1:1000. The Clarity Western ECL Substrate (Bio-Rad Lab-
oratories; catalog no.: #1705060) was used for chemilumines-
cent immunoblot detection and a ChemiDoc Imaging System
(Bio-Rad Laboratories) for documentation.
RNA extraction from C. elegans
Per sample, a 90 mm NGM agar plate containing 100 μg/ml
ampicillin and 1 mM IPTG was inoculated with 500 μlof2×
concentrated E. coli HT115 carrying the desired
L4440_BioBrick-sgRNA vector. Following 24 h preincubation
of the inoculated plates, ca. 200 synchronized young adult
nematodes were transferred onto each plate. Using S buffer,
nematodes were transferred daily onto new plates that were
inoculated and preincubated as before. After 48 to 72 h in-
cubation at 20 C, nematodes were collected by washing with
10 ml ice-cold S buffer and transferred to prechilled 15 ml
reaction tubes on ice. Samples were then centrifuged for 1 min
at 1300gand 4 C, supernatants were discarded to 0.5 ml, and
the nematodes were transferred to prechilled 1.5 ml reaction
tubes on ice. The remaining supernatant of each sample was
carefully discarded after centrifugation for 1 min at 20,000g
and 4 C, and the resulting nematode pellets were immediately
flash-frozen in liquid nitrogen and stored at −80 C until RNA
extraction was performed.
For extraction of total RNA, 500 μl of TRIzol Reagent
(Thermo Fisher Scientific; catalog no.: #15596018) was added
EDITORS’PICK: Ingestion of sgRNAs induces C. elegans CRISPR activation
8J. Biol. Chem. (2022) 298(7) 102085
to each frozen nematode pellet. Nematodes were cracked by
five cycles of freeze-thawing (freeze samples for 20 s in liquid
nitrogen and incubate at 37 C under constant shaking for
2–3 min until samples begin to thaw) and afterward incubated
for 5 min at RT. After the addition of 200 μl chloroform per
sample and vigorous shaking for 15 s, samples were incubated
for 3 min at RT and then centrifuged for 20 min at 12,000gand
4C. The upper aqueous phase (200–300 μl) of each sample
was transferred to a new 1.5 ml reaction tube, mixed with 1.1×
volume of isopropyl alcohol and 0.16× volume of 2 M NaAc
pH 4.0, and incubated for 10 min at RT. Nucleic acids were
pelleted by centrifugation for 20 min at 12,000gand 4 C, and
supernatants were discarded. Nucleic acid pellets were washed
twice with 1 ml of 80% ethanol and collected by centrifugation
for 10 min at 7500gand 4 C. After complete removal of
ethanol and air-drying for 5 to 10 min, each pellet was dis-
solved in 50 μl of nuclease-free H2O. The concentration of the
resulting RNA was measured using an LVis Plate on a
CLARIOstar microplate reader (BMG LABTECH), and RNA-
integrity was checked by agarose gel electrophoresis. RNA
samples were either used directly for reverse transcription or
stored at −80 C until further use.
Reverse transcription-quantitative PCR
Reverse transcription of RNA to cDNA was performed us-
ing the High-Capacity cDNA Reverse Transcription Kit
(Thermo Fisher Scientific; catalog no.: #4368813) with the
supplied RT Random Primers according to the manufacturer’s
instructions. Quantitative real-time PCR was carried out on a
ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) us-
ing the SYBR Select Master Mix (Thermo Fisher Scientific;
catalog no.: #4472919) in 384-well plates according to the
manufacturer’s instructions. In a typical reaction, final con-
centrations of 1 ng/μl cDNA template and 200 nM forward
and reverse primer were used in a total reaction volume of
10 μl per well. Two well-established C. elegans reference genes,
namely cdc-42/R07G3.1 (WBGene00000390) and pmp-3/
C54G10.3 (WBGene00004060) (61), were used for normali-
zation. Amplification of hif-1 was performed with primers
F38A6.3_hif1_fwd (50-GCCACAATTTGTCGACTGCG-30)
and F38A6.3_hif1_rev (50-CTCGACCTGTTAAATCTGT
CTGTG-30) and of hsf-1 with primers Y53C10A.12_hsf1_fwd
(50-GTAATGGCAGAGATGCGTGC-30) and Y53C10A.12_
hsf1_rev (50-TCCAGCACACCTCGTTTCG-30). Quantifica-
tion cycles (Cq) of target and reference genes were determined
using the QuantStudio Real-Time PCR Software v1.3 (Thermo
Fisher Scientific) according to the method described in the
associated user guide (Thermo Fisher Scientific, Publication
#4489822). Normalized fold expression of target genes was
calculated following a data workup procedure yielding results
equivalent to the ΔΔCq method (62).
Next-generation sequencing (RNA-Seq)
To identify genes regulated in MIR249 (dCas9::VP64) versus
WT N2 nematodes raised on E. coli HT115 SCR bacteria,
RNA-Seq and data analysis were performed using three
independent biological samples of total RNA extracted for
each condition, as previously described (49). Samples were
obtained from synchronized populations at 48 h
postdevelopment.
Library preparation
The quality of the isolated RNA was determined with a
Qubit (1.0) Fluorometer (Life Technologies) and a Bioanalyzer
2100 (Agilent). Only those samples with a 260 nm/280 nm
ratio between 1.8 to 2.1 and a 28S/18S ratio within 1.5 to 2
were further processed. The TruSeq RNA Sample Prep Kit v2
(Illumina; #RS-122-2001/2) was used in the succeeding steps.
Briefly, total RNA samples (100–1000 ng) were poly A
enriched and then reverse transcribed into double-stranded
cDNA. The cDNA samples were fragmented, end-repaired,
and polyadenylated before ligation of TruSeq adapters con-
taining the index for multiplexing. Fragments containing
TruSeq adapters on both ends were selectively enriched with
PCR. The quality and quantity of the enriched libraries were
validated using Qubit (1.0) Fluorometer and the Caliper GX
LabChip GX (Caliper Life Sciences). Products are a smear with
an average fragment size of approximately 260 bp. The li-
braries were normalized to 10 nM in Tris-Cl 10 mM, pH 8.5
with 0.1% Tween 20.
RNA-Seq
RNA-Seq was performed in one multiplex on the Illumina
Novaseq 6000 single-end at 100 bp, with a sequencing depth of
25 million reads per sample.
RNA-Seq data analysis
Bioinformatic analysis was performed within the data
analysis framework SUSHI (63). Quality controlled reads
(adapter trimmed with fastp: options “–trim_front1 1 —
trim_tail 1 –cut_tail 20 –trim_poly_x –poly_x_min_len 10
–length_required) were aligned to the C. elegans reference
genome (Ensembl WBcel235 [https://www.ncbi.nlm.nih.gov/
assembly/GCF_000002985.6]) using the STAR aligner (64).
Expression counts were computed using feature Counts in the
Bioconductor package Subread (65). Differential expression
analysis was performed using edgeR (66). To determine
differently regulated genes, a fold-change cutoff ≥2 and an
FDR cutoff of <0.01 were applied. The corresponding datasets
generated for this study can be found in the NCBI’s Gene
Expression Omnibus, GEO Series accession number
GSE202213 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?
acc=GSE202213).
Fluorescence microscopy
Strain MIR249 was intercrossed with strain TJ375 (gpIs1
[hsp-16.2p::GFP]), in which expression of GFP is controlled by
the hsp-16.2 promoter. The resulting strain was confirmed for
presence of the dCas9::VP64 construct by genotyping PCR and
for hsp-16.2p-driven expression of GFP under the fluorescence
microscope. Strains were maintained on OP50 bacteria at 20
C. Gravid adults were treated with sodium hypochlorite
EDITORS’PICK: Ingestion of sgRNAs induces C. elegans CRISPR activation
J. Biol. Chem. (2022) 298(7) 102085 9
solution to obtain eggs. The eggs were grown on HT115 SCR
or HT115 sgRNA hif-1 A or B bacteria until young adult. At
young adult stage, the plates were heat-shocked at 33 C for
2 h. After recovery from shock for 6 h at 20 C, approximately
30 animals were mounted onto 2% agarose pads and anes-
thetized with 20 mM levamisole for imaging. Animals were
captured at 10× magnification with one or two field of view
and then stitched together afterward using ImageJ (https://
imagej.nih.gov/ij/). Total fluorescence intensity was quanti-
fied by running a python script, GreenIntensityCalculator
(available at https://github.com/Ewaldlab-LSD/
GreenIntensityCalculator) in ImageJ. Statistical analysis of
the quantified data was performed using GraphPad Prism. The
experiment was performed in four independent replicate ex-
periments with fluorescence intensity of >120 animals quan-
tified in total for each condition.
Immunofluorescence
Worms were washed from one 10 cm plate using S-buffer
and snap-frozen in liquid nitrogen on top of a poly-D-lysine-
coated (Sigma; #P7405) glass slide. Afterward, they were
fixed for 20 min at −20 C in a methanol:acetone 1:1 ratio
solution. They were then rinsed twice in PBS + 0.1% Tween-20
and blocked for 1 h with a solution of 1% bovine serum al-
bumin, 10% goat serum in PBS + 0.1% Tween-20. Slides were
then incubated with 200-fold diluted rat anti-HA tag antibody
(Roche; #10744700) in blocking solution for 2 h at RT. They
were then washed three times, 10 min each, with PBS + 0.1%
Tween-20 and incubated for 45 min in 500-fold diluted sec-
ondary antirat antibody in blocking solution (Invitrogen;
#A21247). After three additional 10 min washes in PBS + 0.1%
Tween-20, coverslips were mounted using mounting media
ProLong Diamond Antifade Mountant (Invitrogen; #P36966)
and incubated overnight at RT prior to imaging
Confocal imaging
Confocal imaging was performed using an Olympus Fluo-
View 3000 (Olympus Corporation) microscope with inverted
stand. Fluoview FV31S-SW software (https://www.olympus-
lifescience.com/en/downloads/detail-iframe/?0[downloads]
[id]=847252002) was used for image acquisition. Single plane
images of individual nematodes were acquired using an
UPLFLN 20× objective (exc/em Alexa Fluor 647: 650/671).
Statistical analyses
Statistical analyses for all data except those from lifespan
assays were carried out using a ttest with appropriate pa-
rameters, that is, a two-tailed unequal variances ttest for
comparison of the unpaired control versus treatment groups.
For comparing distributions between different groups in the
lifespan assays, statistical calculations were performed using
JMP software version 9.0 (SAS Institute), applying the log-rank
test. All other calculations were performed using Microsoft
Excel or GraphPad Prism 8 (GraphPad Software). p-Values are
reported in detail without the use of arbitrary star ratings.
Data availability
All data supporting the findings of this study are available
within this paper and its supporting information.
Supporting information—This article contains supporting
information.
Acknowledgments—C. elegans strains used in this work were pro-
vided by the Caenorhabditis Genetics Centre (Univ. of Minnesota,
USA), which is funded by NIH Office of Research Infrastructure
Programs (P40 OD010440). This work was funded by the Swiss
National Science Foundation (Schweizerischer Nationalfonds, SNF
31003A_156031 and 310030_204511). The content is solely the
responsibility of the authors and does not necessarily represent the
official views of the National Institutes of Health.
Author contributions—F. F. and M. R. conceptualization; C. B.,
A. G., K. Z., and F. F. formal analysis; F. F., C. B., A. G., G. G.,
J. Y. W., and D. V. investigation; F. F., C. Y. E., and M. R. writing–
original draft; F. F., M. R., C. B., A. G., G. G., K. Z., J. Y. W., D. V.,
and C. Y. E. writing–review & editing; F. F. and M. R. supervision.
Conflict of interest—The authors declare that they have no conflicts
of interest with the contents of this article.
Abbreviations—The abbreviations used are: cDNA, complementary
DNA; CGC, Caenorhabditis Genetics Center; CRISPRa, CRISPR
activation; FDR, false discovery rate; HA, hemagglutinin; NGM,
nematode growth medium; sgRNA, single-guide RNA; TSS, tran-
scription start site.
References
1. Barstead, R. (2001) Genome-wide RNAi. Curr. Opin. Chem. Biol. 5,
63–66
2. Agrawal, N., Dasaradhi, P. V., Mohmmed, A., Malhotra, P., Bhatnagar, R.
K., and Mukherjee, S. K. (2003) RNA interference: biology, mechanism,
and applications. Microbiol. Mol. Biol. Rev. 67, 657–685
3. Whangbo, J. S., and Hunter, C. P. (2008) Environmental RNA interfer-
ence. Trends Genet. 24, 297–305
4. Mohr, S., Bakal, C., and Perrimon, N. (2010) Genomic screening with
RNAi: results and challenges. Annu. Rev. Biochem. 79,37–64
5. Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., and
Mello, C. C. (1998) Potent and specific genetic interference by double-
stranded RNA in Caenorhabditis elegans. Nature 391, 806–811
6. Timmons, L., and Fire, A. (1998) Specific interference by ingested dsRNA.
Nature 395, 854
7. Conte, D., Jr., MacNeil, L. T., Walhout, A. J., and Mello, C. C. (2015) RNA
interference in Caenorhabditis elegans. Curr. Protoc. Mol. Biol. 109, 26.3.
1–26.3.30
8. Boutros, M., and Ahringer, J. (2008) The art and design of genetic screens:
RNA interference. Nat. Rev. Genet. 9, 554–566
9. Barrangou, R., Fremaux, C., Deveau, H., Richards, M., Boyaval, P., Moi-
neau, S., et al. (2007) CRISPR provides acquired resistance against viruses
in prokaryotes. Science 315, 1709–1712
10. Brouns, S. J., Jore, M. M., Lundgren, M., Westra, E. R., Slijkhuis, R. J.,
Snijders, A. P., et al. (2008) Small CRISPR RNAs guide antiviral defense in
prokaryotes. Science 321, 960–964
11. Marraffini, L. A., and Sontheimer, E. J. (2008) CRISPR interference limits
horizontal gene transfer in staphylococci by targeting DNA. Science 322,
1843–1845
12. Horvath, P., and Barrangou, R. (2010) CRISPR/Cas, the immune system
of bacteria and archaea. Science 327, 167–170
EDITORS’PICK: Ingestion of sgRNAs induces C. elegans CRISPR activation
10 J. Biol. Chem. (2022) 298(7) 102085
13. Deltcheva, E., Chylinski, K., Sharma, C. M., Gonzales, K., Chao, Y., Pir-
zada, Z. A., et al. (2011) CRISPR RNA maturation by trans-encoded small
RNA and host factor RNase III. Nature 471, 602–607
14. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., and
Charpentier, E. (2012) A programmable dual-RNA-guided DNA endo-
nuclease in adaptive bacterial immunity. Science 337, 816–821
15. Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., et al. (2013)
Multiplex genome engineering using CRISPR/Cas systems. Science 339,
819–823
16. Hwang, W. Y., Fu, Y., Reyon, D., Maeder, M. L., Tsai, S. Q., Sander, J. D.,
et al. (2013) Efficient genome editing in zebrafish using a CRISPR-Cas
system. Nat. Biotechnol. 31, 227–229
17. Doudna, J. A., and Charpentier, E. (2014) Genome editing. The new
frontier of genome engineering with CRISPR-Cas9. Science 346,
1258096
18. Friedland, A. E., Tzur, Y. B., Esvelt, K. M., Colaiacovo, M. P., Church, G.
M., and Calarco, J. A. (2013) Heritable genome editing in C. elegans via a
CRISPR-Cas9 system. Nat. Methods 10, 741–743
19. Gratz,S.J.,Cummings,A.M.,Nguyen,J.N.,Hamm,D.C.,Dono-
hue, L. K., Harrison, M. M., et al. (2013) Genome engineering of
Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics
194, 1029–1035
20. Wang, H., Yang, H., Shivalila, C. S., Dawlaty, M. M., Cheng, A. W.,
Zhang, F., et al. (2013) One-step generation of mice carrying mutations in
multiple genes by CRISPR/Cas-mediated genome engineering. Cell 153,
910–918
21. Cho, S. W., Kim, S., Kim, J. M., and Kim, J. S. (2013) Targeted genome
engineering in human cells with the Cas9 RNA-guided endonuclease.
Nat. Biotechnol. 31, 230–232
22. Sander, J. D., and Joung, J. K. (2014) CRISPR-Cas systems for editing,
regulating and targeting genomes. Nat. Biotechnol. 32, 347–355
23. La Russa, M. F., and Qi, L. S. (2015) The new state of the art: Cas9 for
gene activation and repression. Mol. Cell. Biol. 35, 3800–3809
24. Jusiak, B., Cleto, S., Perez-Pinera, P., and Lu, T. K. (2016) Engineering
synthetic gene circuits in living cells with CRISPR technology. Trends
Biotechnol. 34, 535–547
25. Maeder, M. L., Linder, S. J., Cascio, V. M., Fu, Y., Ho, Q. H., and Joung, J.
K. (2013) CRISPR RNA-guided activation of endogenous human genes.
Nat. Methods 10, 977–979
26. Perez-Pinera, P., Kocak, D. D., Vockley, C. M., Adler, A. F., Kabadi, A. M.,
Polstein, L. R., et al. (2013) RNA-guided gene activation by CRISPR-Cas9-
based transcription factors. Nat. Methods 10, 973–976
27. Lei, Y., Zhang, X., Su, J., Jeong, M., Gundry, M. C., Huang, Y. H., et al.
(2017) Targeted DNA methylation in vivo using an engineered dCas9-
MQ1 fusion protein. Nat. Commun. 8, 16026
28. Komor, A. C., Badran, A. H., and Liu, D. R. (2017) CRISPR-based tech-
nologies for the manipulation of eukaryotic genomes. Cell 168,20–36
29. Lin, S., Ewen-Campen, B., Ni, X., Housden, B. E., and Perrimon, N. (2015)
In vivo transcriptional activation using CRISPR/Cas9 in Drosophila. Ge-
netics 201, 433–442
30. Long, L., Guo, H., Yao, D., Xiong, K., Li, Y., Liu, P., et al. (2015) Regu-
lation of transcriptionally active genes via the catalytically inactive Cas9 in
C. elegans and D. rerio. Cell Res. 25, 638–641
31. Konermann, S., Brigham, M. D., Trevino, A. E., Joung, J., Abudayyeh, O.
O., Barcena, C., et al. (2015) Genome-scale transcriptional activation by
an engineered CRISPR-Cas9 complex. Nature 517, 583–588
32. Mali, P., Aach, J., Stranges, P. B., Esvelt, K. M., Moosburner, M., Kosuri,
S., et al. (2013) CAS9 transcriptional activators for target specificity
screening and paired nickases for cooperative genome engineering. Nat.
Biotechnol. 31, 833–838
33. Zullo, J. M., Drake, D., Aron, L., O’Hern, P., Dhamne, S. C., Davidsohn,
N., et al. (2019) Regulation of lifespan by neural excitation and REST.
Nature 574, 359–364
34. Liu, P., Long, L., Xiong, K., Yu, B., Chang, N., Xiong, J. W., et al. (2014)
Heritable/conditional genome editing in C. elegans using a CRISPR-Cas9
feeding system. Cell Res. 24, 886–889
35. Shen, Z., Zhang, X., Chai, Y., Zhu, Z., Yi, P., Feng, G., et al. (2014)
Conditional knockouts generated by engineered CRISPR-Cas9
endonuclease reveal the roles of coronin in C. elegans neural develop-
ment. Dev. Cell 30, 625–636
36. Beerli, R. R., Dreier, B., and Barbas, C. F., 3rd (2000) Positive and negative
regulation of endogenous genes by designed transcription factors. Proc.
Natl. Acad. Sci. U. S. A. 97, 1495–1500
37. Zhang, Y., Shao, Z., Zhai, Z., Shen, C., and Powell-Coffman, J. A. (2009)
The HIF-1 hypoxia-inducible factor modulates lifespan in C. elegans.
PLoS One 4, e6348
38. Hsu, A. L., Murphy, C. T., and Kenyon, C. (2003) Regulation of aging and
age-related disease by DAF-16 and heat-shock factor. Science 300,
1142–1145
39. Saito, T. L., Hashimoto, S., Gu, S. G., Morton, J. J., Stadler, M., Blu-
menthal, T., et al. (2013) The transcription start site landscape of C.
elegans. Genome Res. 23, 1348–1361
40. Kaletsky, R., Yao, V., Williams, A., Runnels, A. M., Tadych, A., Zhou, S.,
et al. (2018) Transcriptome analysis of adult Caenorhabditis elegans cells
reveals tissue-specific gene and isoform expression. PLoS Genet. 14,
e1007559
41. Baird, N. A., Douglas, P. M., Simic, M. S., Grant, A. R., Moresco, J. J.,
Wolff, S. C., et al. (2014) HSF-1-mediated cytoskeletal integrity de-
termines thermotolerance and life span. Science 346, 360–363
42. Merkwirth, C., Jovaisaite, V., Durieux, J., Matilainen, O., Jordan, S. D.,
Quiros, P. M., et al. (2016) Two conserved histone demethylases regulate
mitochondrial stress-induced longevity. Cell 165, 1209–1223
43. McQuary, P. R., Liao, C. Y., Chang, J. T., Kumsta, C., She, X., Davis, A.,
et al. (2016) C. elegans S6K mutants require a creatine-kinase-like effector
for lifespan extension. Cell Rep. 14, 2059–2067
44. Gilbert, L. A., Horlbeck, M. A., Adamson, B., Villalta, J. E., Chen, Y.,
Whitehead, E. H., et al. (2014) Genome-scale CRISPR-mediated control
of gene repression and activation. Cell 159, 647–661
45. Hastings, K. E. (2005) SL trans-splicing: easy come or easy go? Trends
Genet. 21, 240–247
46. Larson, M. H., Gilbert, L. A., Wang, X., Lim, W. A., Weissman, J. S., and
Qi, L. S. (2013) CRISPR interference (CRISPRi) for sequence-specific
control of gene expression. Nat. Protoc. 8, 2180–2196
47. Shetty, R. P., Endy, D., and Knight, T. F., Jr. (2008) Engineering BioBrick
vectors from BioBrick parts. J. Biol. Eng. 2,5
48. Brunquell, J., Morris, S., Lu, Y., Cheng, F., and Westerheide, S. D. (2016)
The genome-wide role of HSF-1 in the regulation of gene expression in
Caenorhabditis elegans. BMC Genomics 17, 559
49. Grigolon, G., Araldi, E., Erni, R., Wu, J. Y., Thomas, C., La Fortezza, M.,
et al. (2022) Grainyhead 1 acts as a drug-inducible conserved transcrip-
tional regulator linked to insulin signaling and lifespan. Nat. Commun. 13,
107
50. Pulecio, J., Verma, N., Mejia-Ramirez, E., Huangfu, D., and Raya, A.
(2017) CRISPR/Cas9-based engineering of the epigenome. Cell Stem Cell
21, 431–447
51. Luo, Z., Dai, W., Wang, C., Ye, Q., Zhou, Q., and Wan, Q. L. (2022) Gene
activation in Caenorhabditis elegans using the Campylobacter jejuni
CRISPR-Cas9 feeding system. G3 J. 12, jkac068
52. Brenner, S. (1974) The genetics of Caenorhabditis elegans. Genetics 77,
71–94
53. Hsu, P. D., Scott, D. A., Weinstein, J. A., Ran, F. A., Konermann, S.,
Agarwala, V., et al. (2013) DNA targeting specificity of RNA-guided Cas9
nucleases. Nat. Biotechnol. 31, 827–832
54. Doench, J. G., Fusi, N., Sullender, M., Hegde, M., Vaimberg, E. W.,
Donovan, K. F., et al. (2016) Optimized sgRNA design to maximize ac-
tivity and minimize off-target effects of CRISPR-Cas9. Nat. Biotechnol.
34, 184–191
55. Zerbino, D. R., Achuthan, P., Akanni, W., Amode, M. R., Barrell, D., Bhai,
J., et al. (2018) ENSEMBL 2018. Nucleic Acids Res. 46, D754–D761
56. Haeussler, M., Schonig, K., Eckert, H., Eschstruth, A., Mianne, J., Renaud,
J. B., et al. (2016) Evaluation of off-target and on-target scoring algo-
rithms and integration into the guide RNA selection tool CRISPOR.
Genome Biol. 17, 148
57. Dickinson, D. J., Ward, J. D., Reiner, D. J., and Goldstein, B. (2013) En-
gineering the Caenorhabditis elegans genome using Cas9-triggered ho-
mologous recombination. Nat. Methods 10, 1028–1034
EDITORS’PICK: Ingestion of sgRNAs induces C. elegans CRISPR activation
J. Biol. Chem. (2022) 298(7) 102085 11
58. Dupuy, D., Li, Q. R., Deplancke, B., Boxem, M., Hao, T., Lamesch, P.,
et al. (2004) A first version of the Caenorhabditis elegans Promoterome.
Genome Res. 14, 2169–2175
59. Mansfeld, J., Urban, N., Priebe, S., Groth, M., Frahm, C., Hart-
mann, N., et al. (2015) Branched-chain amino acid catabolism is a
conserved regulator of physiological ageing. Nat. Commun. 6,
e10043
60. Schulz, T. J., Zarse, K., Voigt, A., Urban, N., Birringer, M., and Ristow, M.
(2007) Glucose restriction extends Caenorhabditis elegans life span by
inducing mitochondrial respiration and increasing oxidative stress. Cell
Metab. 6, 280–293
61. Hoogewijs, D., Houthoofd, K., Matthijssens, F., Vandesompele, J., and
Vanfleteren, J. R. (2008) Selection and validation of a set of reliable
reference genes for quantitative sod gene expression analysis in C. ele-
gans. BMC Mol. Biol. 9,9
62. Taylor, S. C., Nadeau, K., Abbasi, M., Lachance, C., Nguyen, M., and
Fenrich, J. (2019) The ultimate qPCR experiment: producing publication
quality, reproducible data the first time. Trends Biotechnol. 37, 761–774
63. Hatakeyama, M., Opitz, L., Russo, G., Qi, W., Schlapbach, R., and Rehra-
uer, H. (2016) SUSHI: an exquisite recipe for fully documented, repro-
ducible and reusable NGS data analysis. BMC Bioinformatics 17,228
64. Dobin, A., Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S.,
et al. (2013) STAR: ultrafast universal RNA-seq aligner. Bioinformatics
29,15–21
65. Liao, Y., Smyth, G. K., and Shi, W. (2013) The Subread aligner: fast,
accurate and scalable read mapping by seed-and-vote. Nucleic Acids Res.
41, e108
66. Robinson, M. D., McCarthy, D. J., and Smyth, G. K. (2010) edgeR: a
bioconductor package for differential expression analysis of digital gene
expression data. Bioinformatics 26, 139–140
Fabian Fischer is a translational scientist in aging research and drug discovery. After obtaining his PhD from the Goethe
University Frankfurt (Institute for Molecular Biosciences), he completed his postdoctoral training at ETH Zürich
(Institute of Translational Medicine). His current research revolves around identifying and exploiting evolutionarily
conserved transcriptional regulators of aging and disease as targets for geroprotective pharmacological interventions,
aiming to extend the healthy human life expectancy.
Christoph Benner is currently a PhD student at the Department of Health Sciences and Technology at ETH Zürich. His
general research interest revolves around the elucidation of the molecular processes behind biological aging using
C. elegans as a model organism. A special focus lies on how transcription factor activities and small-molecule in-
terventions promote the extension of lifespan and shortens the time spent in a diseased state via the induction of
autophagy.
EDITORS’PICK: Ingestion of sgRNAs induces C. elegans CRISPR activation
12 J. Biol. Chem. (2022) 298(7) 102085
