Content uploaded by Ivan N. Marin
Author content
All content in this area was uploaded by Ivan N. Marin on Mar 29, 2022
Content may be subject to copyright.
© INVERTEBRATE ZOOLOGY, 2022Invertebrate Zoology, 2022, 19(1): 24–34
A new species of stygobiotic atyid shrimps of the genus
Xiphocaridinella (Crustacea: Decapoda: Atyidae) from the
Racha-Lechkhumi and Kvemo Svaneti, with a new record
of X. kumistavi from the Imereti, Western Georgia,
Caucasus
I.N. Marin1, Sh. Barjadze2
1 A.N. Severtsov Institute of Ecology and Evolution of RAS, Moscow, Russia; https://orcid.org/0000-
0003-0552-8456
2 Institute of Zoology, Ilia State University, Tbilisi, Georgia; https://orcid.org/0000-0001-8992-
4987
E-mails: coralliodecapoda@mail.ru1, vanomarin@yahoo.com1, shalva.barjadze@yahoo.com2
ABSTRACT: An integrative approach resulted in a description of a new species of
stygobiotic shrimps of the genus Xiphocaridinella Sadowsky, 1930 (Crustacea: Decapoda:
Atyidae) from the southern part of the Racha-Lechkhumi and Kvemo Svaneti Region of the
Western Georgia (SW Caucasus). The area and caves, from which this species is recorded
will be flooded during the construction of the Tvishi hydroelectric power plant and it is
unknown whether it will be possible to find the species again. Xiphocaridinella lechkhu-
mensis sp.n. is easily separated from the other species of the genus both morphologically and
genetically, as evidenced by barcoding segments of the mitochondrial COI gene marker
(barcoding). In addition, we discovered a new population of X. kumistavi Marin, 2017 in the
Satevzia Cave from Imereti Region. This population genetically diverged from the type
series from the Prometheus Cave by the barcoding gap of 2.4%. The genus Xiphocaridinella
in the Colchis Valley of the SW Caucasus now encompasses 15 species.
How to cite this article: Marin I.N., Barjadze Sh. 2022. A new species of stygobiotic atyid
shrimps of the genus Xiphocaridinella (Crustacea: Decapoda: Atyidae) from the Racha-
Lechkhumi and Kvemo Svaneti, with a new record of X. kumistavi from the Imereti, Western
Georgia, Caucasus // Invert. Zool. Vol.19. No.1. P.24–34. doi: 10.15298/invertzool.19.1.04
KEY WORDS: Barcoding, COI mtDNA, Stygobiotic shrimps, Hydrogeology, Caucasus.
Новый вид стигобионтных креветок рода
Xiphocaridinella (Crustacea: Decapoda: Atyidae)
из Рача-Лечхуми и Квемо Сванети, и новая находка
X. kumistavi в Имеретии, Западная Грузия, Кавказ
И.H. Марин1, Ш. Баржадзе2
1 Институт экологии и эволюции им. А.Н. Северцова РАН, Москва, Россия; https://orcid.org/
0000-0003-0552-8456
2 Институт зоологии, Государственный университет Ильи, Тбилиси, Грузия. https://orcid.org/
0000-0001-8992-4987
25A new Xiphocaridinella from Georgia, with a new record of X. kumistavi
E-mails: coralliodecapoda@mail.ru1, vanomarin@yahoo.com1, shalva.barjadze@yahoo.com2
РЕЗЮМЕ: Интегративный подход позволил описать новый вид стигобионтных
креветок рода Xiphocaridinella Sadowsky, 1930 (Ракообразные: Decapoda: Atyidae) из
южной части региона Рача-Лечхуми и Квемо Сванети Западной Грузии (Южный
Кавказ). Территория и пещеры, где обитал этот вид, будут в ближайшее время
затоплены во время строительства гидроэлектростанции Твиши, и неизвестно, уда-
стся ли найти его снова в будущем. Xiphocaridinella lechkhumensis sp.n. хорошо
отделен от других видов рода морфологически и генетически с помощью штрихко-
дирования сегментов митохондриального гена COI. Также, нами обнаружена новая
популяция X. kumistavi в пещере Сатевция из Имеретии, которая отличается от
типовой из пещеры Прометея на 2.4% по генному маркеру цитохромоксидазы (COI).
Разнообразие рода Xiphocaridinella из Колхидской низменности на Южном Кавказе
увеличилось до 15 видов.
Как цитировать эту статью: Marin I.N., Barjadze Sh. 2022. A new species of stygobiotic
atyid shrimps of the genus Xiphocaridinella (Crustacea: Decapoda: Atyidae) from the
Racha-Lechkhumi and Kvemo Svaneti, with a new record of X. kumistavi from the Imereti,
Western Georgia, Caucasus // Invert. Zool. Vol.19. No.1. P.24–34. doi: 10.15298/
invertzool.19.1.04
КЛЮЧЕВЫЕ СЛОВА: штрихкодирование, COI мтДНК, стигобиотические кревет-
ки, гидрогеология, Кавказ.
(Caucasus), two unknown populations of stygo-
biotic shrimps were discovered in the Imereti
and Racha-Lechkhumi and Kvemo Svaneti Re-
gions. In the Verdzistava II Cave near village
Tvishi, Tsageri municipality of the Racha-Lech-
khumi and Kvemo Svaneti region, we collected
two small individuals representing a species
described below as new. At present, the fate of
the species and a possibility of new sampling are
questionable, since a hydroelectric power plant
is being built in the area and many caves are
expected to be flooded. For this reason, the new
species is described on the basis of only two
individuals, but molecular genetic data confirm
its validity. Shrimps collected from the Imereti
region represent a new discovered population of
X. kumistavi Marin, 2017 and also reported
herewith with the help of an integrative ap-
proach.
Material and methods
SAMPLING AND REPOSITORIES.
Shrimps were collected by hand net in a subter-
ranean stream of the Verdzistava II Cave
Introduction
The stygobiotic atyid shrimp genus Xipho-
caridinella Sadowsky, 1930 (Crustacea: Deca-
poda: Atyidae) currently includes 13 valid spe-
cies described from the subterranean water hab-
itats of the northern and northwestern part of
Kolkhida coastal lowland plain of the eastern
Black Sea (Colchis), SW Caucasus (e.g. Sad-
owsky, 1930; Birštein, 1939, 1948; Juzbaš’jan,
1940, 1941; Marin, Sokolova, 2014; Marin,
2017a, b, 2018a, b, 2019, 2020). Sadowsky
(1930) proposed a new genus Xiphocaridinella
for the Caucasian representatives of the subter-
ranean Troglocaris-like shrimps, which was once
placed in the subgenus Troglocaris Dormitzer,
1853 (e.g., De Grave, Fransen, 2011), but re-
cently again restored to the full generic status
(Marin, 2017b; WoRMS, 2021). Our knowl-
edge about these stygobiotic shrimps living in
underground habitats is still incomplete, and
new species have been discovered and described
in recent years.
In 2018, during a biospeleological study of
the cave biodiversity of the Western Georgia
26 I.N. Marin, Sh. Barjadze
USA) and dye-labeled terminators (BigDye
terminator v. 1.1; Applied Biosystems, Foster
City, CA, USA). Dataset of aligned sequences
of COI mtDNA gene markers of other conge-
neric species (617 base pairs in length) were
taken from GenBank (NCBI).
PHYLOGENETIC ANALYSIS. Consensus
of complementary sequences was obtained with
MEGA 7.0. PartitionFinder v. 2. for finding
best-fitting partitions for the COI mtDNA gene
marker (Lanfear et al., 2016), which is usually
characterized by a strong heterogeneity in nu-
cleotide substitution rates among all three cod-
ing positions. The best evolutionary substitu-
tion model was also determined using MEGA
7.0 and jModeltest2.1.141 as GTR+G+I. Fur-
ther PhyML 3.0 (http://www.atgc-montpellier.fr/
phyml/) (Guindon et al., 2010) with several
models based on BIC (Bayesian Information
Criterion) and AIC (Akaike Information Crite-
rion) with 1000 bootstrap replicates was used to
create Maximum Likelihood (ML) phylogenies
used for visualization the phylogenetic relation-
ships. Pairwise genetic divergences (p-distanc-
es) was calculated using MEGA 7.0 with the
Kimura 2-parameter (K2P) model of evolution
(Kimura, 1980) to show interspecific genetic
divergence.
Results
DNA ANALYSIS. The interspecific p-dis-
tance between two specimens of Xiphocaridinel-
la lechkhumensis sp. n. (n=2) collected in the
Verdzistava II Cave (Racha-Lechkhumi and
Kvemo Svaneti, Georgia) is very low,
0.005±0.0003 substitutions per 100 nucleotide
positions (about 0.5%), indicating that the two
specimens belong to the same species, and be-
ing similar to other known species of the genus
Xiphocaridinella (see Marin, 2017a, 2018a, b,
2019, 2020; Marin, Turbanov, 2021). The inter-
specific K2P-distances between Xiphocaridinel-
la lechkhumensis sp.n. (n=2) and other 13 Cau-
casian congeneric species are about 0.08 substi-
tutions per 100 nucleotide positions (about 8%)
(Table 1).
(42°31′44.23″N, 42°47′38.79″E) located near
village Tvishi, Tsageri Municipality, Racha-
Lechkhumi and Kvemo Svaneti Region of West-
ern Georgia (SW Caucasus) in May 2018. All
specimens were preserved and stored in 96%
ethanol for further DNA analysis. The postor-
bital carapace length (pcl., in mm), the length
from the posterior margin of the orbit to the
posterodorsal margin of carapace, and the total
body length (tbl., in mm), measured from the tip
of rostrum to the posterior margin of the telson,
are used for measurements. The holotype is
deposited in the collection of the Zoological
Museum of Moscow University (ZMMU),
Moscow, Russia; the paratype specimen is de-
posited in the collection of the Institute of Zool-
ogy, Ilia State University, Tbilisi, Georgia (IZ-
ISU).
DNA EXTRACTION. Partial fragment of
the cytochrome c oxidase subunit I gene (COI)
of the mitochondrial DNA is used as one of the
most informative markers for assessing species
status within Xiphocaridinella (Avise, 1993;
Sket, Zakšek, 2009; Marin, 2017a, b, 2018a, b,
2019, 2020). Total genomic DNA was extracted
from muscle tissue of the pleon using the innu-
PREP DNA Micro Kit (AnalitikJena, Germa-
ny). The COI mtDNA gene marker was ampli-
fied with the help of the universal primers
LCO1490 (5'–GGTCAACAAATCATAAA-
GATATTGG–3') and HC02198 (5'–TAAACT-
TCAGGGTGACCAAAAAATCA–3') (Folmer
et al., 1994). PCR was performed on amplifica-
tor T100 (Bio-Rad, USA) under the following
conditions: initial denaturation at 96 °C for 1.5
min followed by 42 cycles of 95 °C for 2 min,
49 °C for 35 seconds, and 72 °C for 1.5 min,
followed by chain extension at 72 °C for 7 min.
The volume of 10µL of reaction mixture con-
tained 1uL of total DNA, 2µL of 5xPCR mix
(Dialat, Russia) and 1µL of each primer (60µM).
The amplification products were separated by
using gel electrophoresis of nucleic acids on a
1.5% agarose gel in 1xTBE, and then stained
and visualized with 0.003% EtBr using imaging
UV software. Direct sequencing of the purified
PCR products was performed with the ABI
3500l Genetic Analyzer (Applied Biosystems,
27A new Xiphocaridinella from Georgia, with a new record of X. kumistavi
Table 1. Uncorrected pairwise genetic distances (the number of substitutions per 100 nucleotides) of the
barcoding segments of the COI gene marker between Xiphocaridinella lechkhumensis sp.n. (n=2) and
the other 14 known Caucasian species of the genus Xiphocaridinella arranged by the degree of genetic
divergence (from low to high).
Таблица 1. Нескорректированные попарные генетические дистанции (число замен на 100
нуклеотидов) результатов штрихкодирования генного маркера COI между Xiphocaridinella lech-
khumensis sp.n. (n=2) и другими 14 известными кавказскими видами рода Xiphocaridinella,
упорядоченные по степени генетической дивергенции (от низкой к высокой).
Xiphocaridinella kumistavi Marin, 2017 (n=18) 0.077±0.011
Xiphocaridinella kelasuri Marin et Turbanov, 2021 (n=15) 0.079±0.011
Xiphocaridinella smirnovi Marin, 2020 (n=1) 0.079±0.011
Xiphocaridinella kutaissiana Sadowsky, 1930 (n=16) 0.081±0.014
Xiphocaridinella demidomi Marin, 2021 (n=1) 0.095±0.014
Xiphocaridinella motena Marin, 2019 (n=10) 0.096±0.014
Xiphocaridinella fagei (Birštein, 1939) (n=17) 0.101±0.012
Xiphocaridinella dbari Marin, 2019 (n=7) 0.102±0.013
Xiphocaridinella otapi Marin, 2018 (n=18) 0.103±0.013
Xiphocaridinella jusbaschjani (Birštein, 1948) (n=14) 0.102±0.013
Xiphocaridinella osterloffi (Juzbaš'jan, 1941) (n=15) 0.105±0.014
Xiphocaridinella shurubumu Marin, 2018 (n=15) 0.107±0.015
Xiphocaridinella falcirostris Marin, 2020 (n=11) 0.110±0.015
Xiphocaridinella ablaskiri (Birštein, 1939) (n=5) 0.115±0.015
TYPE MATERIAL. HOLOTYPE, non-oviger-
ous $ (pcl. 4.2 mm, tbl. 14.0 mm) (damaged, without
pereopods), ZMMU Ma-6215, SW Caucasus, Geor-
gia, Racha-Lechkhumi and Kvemo Svaneti, Tsageri
Municipality, inside Verdzistava II Cave located
near the village of Tvishi, 42°31′44.23″N
42°47′38.79″E, about 400 m a.s.l., coll. G. Ne-
bieridze, 16.05.2018.
PARATYPE, 1 juv. (pcl. 3.8 mm, tbl. 12.0 mm)
(damaged), IZISU AC-T-00001, same locality and
data as holotype.
ETYMOLOGY. The new species is named after
Lechkhumi region of the Western Georgia, where it
was discovered.
DESCRIPTION. Small-sized shrimp with swol-
len, subcylindrical body.
CARAPACE (Fig. 2A–C, E) smooth, dorsally
unarmed. ROSTRUM (Fig. 2A–C, E) dorsoventral-
ly flattened, broadly triangular in dorsal view, distal-
ly slightly upturned in holotype (Fig. 2 A, B), straight
in paratype (Fig. 2C, E); dorsal surface unarmed, but
The specimens from the Satevzia Cave (n=2)
(Imereti, Georgia) are genetically close to Xi-
phocaridinella kumistavi (Marin, 2017) (n=18)
from the Kumistavi Cave (type locality) (see
Fig. 1), with the K2P-distances between the
populations about 0.024±0.004 substitutions per
100 nucleotides (about 2.4%). Such values of
genetic divergence are significantly lower than
interspecific divergence within Xiphocaridinel-
la, which is approximately 5% (e.g., Marin,
2020).
Taxonomic part
Order Decapoda Latreille, 1802
Family Atyidae De Haan, 1849
Genus Xiphocaridinella Sadowsky, 1930
Xiphocaridinella lechkhumensis sp.n.
Fig. 2.
28 I.N. Marin, Sh. Barjadze
Fig. 1. The map indicating the locality, where shrimps where collected (A), and phylogenetic reconstruction
(tree) of the Caucasian species of Xiphocaridinella (GTR+G+I model) (below) using mitochondrial COI
mtDNA gen marker with the support (BS) based on ML method (B).
Рис. 1. Карта с указанием района, где были собраны креветки (А), и филогенетическая реконструкция
(дерево) Кавказских Xiphocaridinella (модель GTR+G+I) (ниже) c использованием генного маркера
COI мтДНК) с поддержкой на основе метода ML (Б).
29A new Xiphocaridinella from Georgia, with a new record of X. kumistavi
Fig. 2. Xiphocaridinella lechkhumensis sp.n., holotype, $, pcl. 5.0 mm, tl. 16.0 mm, ZMMU Ma-6215 (A,
B, F–P); paratype $, pcl. 3.2 mm, tl. 12.0 mm, IZISU AC-T-00001 (C–E): A, C, E — front of carapace, dorsal
view; B, D — front of carapace, lateral view; F — antennula, dorsal view; G — antennula, lateral view; H —
antenna; I — telson and uropods, dorsal view; J — pereopod III; K — pereopod IV; L — pereopod V; M —
pereopod I; N, O — pereopod II, different views; P — chela of pereopod II, ventral view.
Рис. 2. Xiphocaridinella lechkhumensis sp.n., голотип, $, pcl. 5,0 мм, tl. 16,0 мм, ZMMU Ma-6215 (A,
B, F–P); паратип, $, pcl. 3,2 мм, tl. 12,0 мм, IZISU AC-T-00001 (C–E): A, C, E — передняя часть
карапаскса, вид сверху; B, D — передняя часть карапакса, вид сбоку; F — антеннула, вид сверху; G —
антеннула, вид сбоку; H — антенна; I — тельсон и уроподы, вид сверху; J — переопод III; K —
переопод IV; L — переопод V; M — переопод I; N, O — переопод II, разные виды; P — клешня
переоподы II, вид снизу.
30 I.N. Marin, Sh. Barjadze
feebly developed terminal hook interacting seto-
branch on pereopod I, and with arthrobranch; exo-
pod slender, almost reaching distal margin of ante-
penultimate segment; antepenultimate segment slen-
der, about 8 times as long as wide; penultimate
segment about 7–8 times as long as wide, with
straight lateral margin; ultimate (distal) segment
slender, about 7 times as long as wide, tapering
distally, with tufts of short simple stick-like setae
along ventral and lateral margins.
PEREOPOD I (present in paratype only) (Fig.
2M) stout; coxa with well-developed slender epipod
bearing feebly developed terminal hook and seto-
branch; basis about as long as wide, with feebly
developed exopod (not illustrated); ischium about
1.5 times longer than wide; merus stout, about 1.5–
2 times as long as wide, slightly longer than ischium
and equal in length to carpus; carpus relatively stout,
significantly widening distally, about as long as
maximal width; palm stout, about 1.3 times as long
as wide, subcylindrical in cross-section; fingers stout,
about 1.5 times as long as the length of palm and
about 1.3–1.5 times as long as their proximal width,
blunt distally, armed with a row of stout strong
plumose setae fringing terminal margins.
PEREOPOD II (present in paratype only) (Fig.
2N–P) stout, subequal in length to pereopod I; coxa
with epipod and setobranchs; basis about as long as
wide, with short exopod, probably because of feebly
development in the juvenile specimen; ischium about
1.5 times as long as wide; merus slender, about 2
times as long as wide, slightly longer than ischium;
carpus relatively slender, about 1.3 times as long as
wide, widening distally; palm (Fig. 2P) stout, similar
to that of pereopod I, about as long as wide, subcy-
lindrical in cross-section; fingers stout, about 1.5
times as long as palm, blunt distally, about as long as
proximal width, with simple and straight cutting
edge, with row of strong plumose setae on terminal
margins.
PEREOPOD III (Fig. 2J) relatively slender; coxa
with setobranch and small epipod without terminal
hook; basis about as long as wide, with well-devel-
oped exopod overreaching mero-carpal articulation
ischium about 2.0–2.5 times as long as wide, with 1
subdistal small movable spine on lateral surface
ventrally; merus about 6 times as long as wide, with
3 spines on lateral surface along ventral margin;
carpus relatively slender, about 7 times as long as
wide, slightly widening distally, about half-length of
merus or propodus, with small subdistal spine on
lateral surface; propodus straight, about 10 times as
long as wide, armed with 9 spinules on proximal half
with short carina in distal half; lateral margins slight-
ly convex or straight, each with small tooth located
at about midlength; ventral surface unarmed.
EYES (Fig. 2A–C, E) reduced, without pigment;
eyestalk stout, swollen, subcylindrical, about as long
as wide.
PLEON (not illustrated) smooth, unarmed; terg-
ites non-carinate; pleura of pleomeres I–IV margin-
ally rounded, posteroventral margins of pleomere V
slightly produced posterodorsally. Telson (Fig. 2I)
about 3.7 times as long as proximal width, tapering
distally, with 2 pairs of small dorsal submarginal
spines, set at about 0.45 and 0.75 telson length
respectively; distal margin almost straight, with 4
pairs of spines.
ANTENNULE (Fig. 2F, G) with robust basal
peduncular segment, about twice longer than proxi-
mal width, without ventromedial tooth, distolateral
angle with broadly produced; stylocerite tapering
distally to acute tip, reaching beyond mid-length of
basal peduncular segment; second and third pedun-
cular segments stout, unarmed; second segment about
1.8 times as long as wide and about 1.5–2 times as
long as distal segment; distal segment about as long
as wide; flagellum well developed, about as long as
body length.
ANTENNA (Fig. 2H) with basicerite stout, with
ventrolateral distal spine; carpocerite robust, about 2
times as long as wide, reaching midlength of scapho-
cerite; scaphocerite well developed, broad, with
small but well-marked distolateral tooth not reach-
ing to rounded distal margin of lamella.
MOUTHPARTS typical for the genus, without
specific features, not figured. Mandible well devel-
oped, without palp; molar process well developed,
relatively slender, with several small and large
distodorsal teeth; incisor process slender, tapering
distoventrally, with slender serrated sharp lamina
distally. Maxillule with dorsal lobe bearing com-
pletely fused lacinia, ventral lobe small, covered
with curved setae distally, palp well-developed, with
2 distal setae. Maxilla with small, tapering palp;
endites moderately broad, well developed; basal
endite feebly bilobed, furnished with elongated stiff
setae; coxal endite obsolete; scaphognathite broad,
furnished with short plumose setae. Maxilliped I
with reduced epipod; exopod small and slender,
basally with expanded caridean lobe bearing plu-
mose marginal setae; basal and coxal endites com-
pletely fused, excavate, furnished with long simple
setae distally. Maxilliped II without epipod; exopod
long and slender, reaching distal segments. Maxil-
liped III slender, with small epipod on coxa bearing
31A new Xiphocaridinella from Georgia, with a new record of X. kumistavi
Sokolova, 2014), X. kumistavi (Marin, 2017) from
the Prometheus Cave, Imereti region (see Marin,
2017) and X. motena Marin, 2019 from the Motena
Cave, Samegrelo-Zemo Svaneti region (see Marin,
2018b, 2019). However, X. lechkhumensis sp.n. is
unique in the “kutaissiana” group by the relatively
short rostrum, not reaching the midlength of the
basal segment of the antennular peduncle (see Fig.
2A, B), while other species of the group have ros-
trum distinctly overreaching the distal margin of the
basal segment of the antennular peduncle. The un-
armed rostrum is shared only with X. motena, where-
as in X. kutaissiana and X. kumistavi the rostrum is
dorsally and ventrally armed. We have only two
individuals, probably both immature, but the ros-
trum is still much smaller than that of immature
individuals in other species of the group.
The new species can be easily separated geneti-
cally from the species of the “kutaissiana” species
group, as well as other congeners (see Fig. 1; Table
1). The minimum genetic divergence of COI be-
tween other Caucasian congeners is 8%, which sup-
ports the validity of the new species.
Currently, Khvampli karst massif is located in
Lechkhumi historic region of Western Georgia
(Tatashidze et al., 2009), where cave dwelling inver-
tebrates are poorly investigated. Only two species
are recorded in this karst massif: collembolans Arg-
onychiurus multiocellatus Djanashvili, Barjadze,
Jordana et Burkhardt, 2014 (Colembola: Onychiu-
ridae) (troglobiont) and Plutomurus birsteini Djan-
ashvili et Barjadze, 2011 (Colembola: Tomocer-
idae) (troglophile) (Djanashvili, Barjadze, 2011; Dja-
nashvili et al., 2014). Both of them are living in the
Tvishi Cave.
Xiphocaridinella kumistavi (Marin, 2017)
Fig. 3.
MATERIAL EXAMINED. 1 non-ovigerous $
(pcl. 6.8 mm, tl. 18.0 mm), 1 # (pcl. 7.0 mm, tl. 20.0
mm), ZMMU Ma-6216, SW Caucasus, Georgia,
Imereti region, Tskaltubo district, Dzedzileti vil-
lage, Sataplia–Tskaltubo karst massif, Satevzia Cave,
42°25′52.01″N 42°33′58.12″E, coll. E. Maghradze,
2.12.2020; 1 #, 3 $$, 2 juvs, IZISU AC-NT-00001-
6, same locality and data as above.
BRIEF DESCRIPTION. Medium-sized shrimp
with swollen body. CARAPACE (Fig. 3A–D)
smooth, with short dorsal postrostral carina in fron-
tal part. ROSTRUM relatively long, slender, reach-
ing midlength to distal margin of second antennular
segment, sharply pointed distally, unarmed. EYES
of flexor margin and a row of short simple setae on
its distal half; dactylus about 2.5–3 times longer than
maximal width, biunguiculate, flexor margin armed
2 accessory spinules on the flexor margin in addition
to the penultimate unguis and several small simple
setae, ultimate unguis smooth, curved; penultimate
unguis triangular, sharp, larger than other accessory
spines on flexor margin, about half-length of ulti-
mate unguis.
PEREOPOD IV (Fig. 2K) generally similar and
slightly shorter than pereopod III; coxa with tuft of
setobranchs and small epipod; basis about as long as
wide, with well-developed exopod overreaching
carpo-meral articulation; ischium about 1.7 times as
long as wide, with small distoventral movable spine;
merus about 6 times as long as wide, armed with 3
spines on lateral surface along ventral margin; car-
pus about 5 times as long as wide with small subdis-
tal spine on lateral surface; propodus about 8 times
as long as wide, with straight margins, armed with 7
spinules along ventral margin; dactylus about 2.5–3
times longer than wide, biunguiculate; flexor margin
armed with 2 small accessory spinules in addition to
the penultimate unguis, ultimate unguis smooth,
curved and sharp, penultimate unguis sharp, about
twice larger than ventral teeth, about twice shorter
than ultimate unguis.
PEREOPOD V (Fig. 2L) similar to pereopods III
and IV; basis without exopod; propodus about 10
times as long as wide, with straight margins, ventral-
ly unarmed; dactylus with ventral margin armed with
a dense “brush” consisting of small simple sharp
setae; without penultimate and accessory unguis,
ultimate unguis curved, triangular, sharp distally.
PLEOPODS without specific differentiating fea-
tures.
UROPODS (Fig. 4I) relatively slender, slightly
exceeding telson; lateral margin of exopod straight,
with 1 large spine mesial to posterolateral tooth;
dieresis simple, unarmed.
COLORATION IN LIFE. Body and appendages
translucent white; cornea of eye albescent.
GENBANK ACCESSION NUMBERS.
OL704738 (holotype), OL704739 (paratype).
DISTRIBUTION. The species is currently known
only from the type locality — Verdzistava II Cave.
TAXONOMIC REMARKS. The new species
belongs to the genetically and geographically sepa-
rated “kutaissiana” group (clade) in Xiphocaridinel-
la distributed in Western Georgia (see Fig. 1), in-
cluding X. kutaissiana Sadowsky, 1930 (the type
species of the genus) from the Tskal-Tsiteli (=Iazo-
ni) Cave, Kutaisi (see Sadowsky, 1930; Marin,
32 I.N. Marin, Sh. Barjadze
Fig. 3. Xiphocaridinella kumistavi (Marin, 2017) from the Satevzia Cave, # (pcl. 7.0 mm, tl. 20.0 mm) (A,
B, E–G, H) and $ (pcl. 6.8 mm, tl. 18.0 mm) (C, D, I, J), ZMMU Ma-6216: A, C — front of carapace, dorsal
view; B, D — front of carapace, lateral view; E — pereopod I; F — pereopod II; G, I — pereopod III; H,
J — dactyli of pereopod III.
Рис. 3. Xiphocaridinella kumistavi (Марин, 2017) из пещеры Сатевция, # (pcl. 7,0 мм, tl. 20,0 мм) (A,
B, E–G, H) и $ (pcl. 6,8 мм, tl. 18,0 мм) (C, D, I, J), ZMMU Ma-6216: A, C — передняя часть карапакса,
вид сзади; B, D — передняя часть карапакса, вид сбоку; E — переопод I; F — переопод II; G, I —
переопод III; H, J — дактилусы переоподы III.
33A new Xiphocaridinella from Georgia, with a new record of X. kumistavi
specimens from the Kumistavi Cave. Minor mor-
phological differences are as follows: 1) the tooth-
less rostrum in all examined specimens (n=8) from
the Satevzia Cave, while the and armature of the
rostrum is greatly in the Kumistavi Cave from a short
toothless to a long curved rostrum with a large
number of dorsal and ventral spines (see Marin,
2017); and 2) the meri of ambulatory pereiopods,
especially pereiopod III, armed with 2 spines (vs.
usually 3 spines in the specimens from the Kumistavi
Cave (see Marin, 2017)). However, significant dif-
ferences in these traits have also been observed in a
series of samples from the type locality (see Marin,
2017a) and can be explained by the intraspecific
variability with an evidence of a low genetic diver-
gence between the two populations (see above). The
development of a long, armed rostrum in Troglo-
caris-like shrimps is usually associated with the
presence of active predators in the subterranean
habitats, for example, cave salamander Proteus an-
guinus Laurenti, 1768 (Amphibia: Caudata: Pro-
teidae) (Jugovic et al., 2011) or fishes (common
river goby Neogobius cf. melanostomus (Pallas,
1811) (Teleostei: Gobiidae) in the Kumistavi cave
(see Marin, 2017a)). It is obvious that in the small
Satevzia Cave such predators are absent.
GENBANK ACCESSION NUMBERS.
OL704740, OL704741.
DISTRIBUTION. The species was originally
described from the Kumistavi Cave, 42°22′35.8″N
42°36′03.2″E. The newly discovered population from
the Satevzia Cave, 42°25′52.01″N 42°33′58.12″E,
expands the distributional range of the species in the
Sataplia-Tskaltubo karst massif.
Compliance with ethical standards
CONFLICTS OF INTEREST: The authors de-
clare that they have no conflicts of interest.
Acknowledgements. Sampling of the cave dwell-
ing invertebrates was carried out within the frame-
works of the Institutional Grant of Ilia State Univer-
sity, Tbilisi, Georgia “Taxonomy, fauna and ecology
of the invertebrates in the potentially endangered
Khvamli karst massif” and the grant: “Conservation
actions and invertebrates investigations in Sataplia-
Tskaltubo karst caves, Georgia” supported by the
Conservation Leadership Programme (CLP). Au-
thors are very grateful to Mr. G. Nebieridze (Millen-
nium School, Tbilisi, Georgia) and Ms. Eter Magh-
radze (Ilia State University, Tbilisi, Georgia) for
sampling the specimens. The study is also partly
supported by the Russian Foundation for Basic Re-
search (RFBR) (grant No. 20-04-00803_A). Au-
thors are very thankful to anonymous reviewer and
Dr. Tomoyuki Komai for very useful comments for
improvements of the manuscript.
(Fig. 3A, C) partly covered by carapace; cornea
rounded, reduced and feebly marked, without pig-
ment; eyestalk stout, swollen, cylindrical, about as
long as wide. PEREOPODS I (Fig. 3E) similar in
males and females; basis with well-developed exo-
pod overreaching carpo-meral articulation; ischium
about 4 times as long as wide; merus slender, about
4 times as long as wide, equal to ischium in length;
carpus relatively stout in males and slightly more
slender in females, significantly widening distally,
slightly longer than merus, about 4 times as long as
maximal width; palm relatively stout, about as long
as wide, subcylindrical in cross-section, smooth;
fingers relatively slender, smooth, with blunt distal
margins, about 4 times as long as proximal width,
furnished with a row of stiff plumose setae. PERE-
OPODS II (Fig. 3F) similar to pereopod I in males
and females; coxa with well-developed slender epi-
pod and setobranch; basis with well-developed exo-
pod overreaching carpo-meral articulation; ischium
about 3 times as long as wide, with straight margins,
unarmed; merus slender, about 5 times as long as
wide, longer than ischium; carpus slender, about 8
times as long as wide, slightly widening distally,
longer than merus; palm relatively stout, similar to
palm of pereopod I, about as long as wide, subcy-
lindrical in cross-section, smooth; fingers relatively
slender, smooth, tapering distally, about 4 times as
long as proximal width, with simple and straight
cutting edges, with broad blunt distal margin, armed
with a row of stout strong plumose setae. PEREO-
POD III (Fig. 3G, I) with coxa bearing setobranchs
and small distally blunt epipod; basis nearly as long
as wide, with well-developed exopod almost reach-
ing midlength of merus; ischium with well-marked
distoventral spine; merus about 6 times as long as
wide, with 2 well marked spines along ventral mar-
gin; carpus with small subdistal spine; propodus in
males (Fig. 3G) widening distally, armed with nu-
merous short spinules along distal 1/3 of its flexor
margin and pair of long slender spines at distal flexor
angle; dactylus in males (Fig. 3H) with flexor margin
armed with dense brush of small, simple spine-like
setae; with curved acuminate unguis; propodus in
females not particularly widened distally, armed
with 4–5 spines along proximal half of flexor mar-
gin; dactylus in females (Fig. 3J) about 3 times longer
than wide, ventral margin armed with 6–7 small
spines, unguis curved and acuminate; second (acces-
sory) unguis triangular, sharp, slightly larger than
flexor spines, about half length of terminal unguis.
REMARKS. The studied specimens from the
Satevzia Cave are morphologically similar to the
34 I.N. Marin, Sh. Barjadze
Marin I.N. 2017b. COXI based phylogenetic analysis of
Caucasian clade of European Troglocaris s.l. (Crusta-
cea: Decapoda: Atyidae) with the suggestion of a new
taxonomic group structure // Biosystems Diversity.
Vol.25. No.4. P.323–327. https://doi.org/10.15421/
011749
Marin I. 2018a. Cryptic diversity of stygobiotic shrimp
genus Xiphocaridinella Sadowsky, 1930 (Crustacea:
Decapoda: Atyidae): the first case of species co-
occurrence in the same cave system in the Western
Caucasus // Zootaxa. Vol.4441. No.2. P.201–224.
https://doi.org/10.11646/zootaxa.4441.2.1
Marin I. 2018b. Xiphocaridinella shurubumu Marin sp.n.
(Crustacea: Decapoda: Atyidae) – a new stygobiotic
atyid shrimp species from Shurubumu and Mukhuri
caves, Chkhorotsku, Western Georgia, Caucasus //
Zoologichesky Zhurnal. Vol.97. No.10. P.1238–1256.
https://doi.org/10.1134/S0044513418100082
Marin I.N. 2019. Crustacean “cave fishes” from the Ara-
bika karst massif (Abkhazia, Western Caucasus): new
species of stygobiotic crustacean genera Xiphocar-
idinella and Niphargus from the Gegskaya Cave and
adjacent area // Arthropoda Selecta. Vol.28. No.2.
P.225–245. https://doi.org/10.15298/arthsel. 28.2.05
Marin I.N. 2020. Stygobiotic atyid shrimps (Crustacea,
Decapoda, Atyidae) from the Amtkel karst system,
western Abkhazia, Caucasus, with a redescription of
Xiphocaridinella osterloffi and the description of two
new co-occurring species // Zoologicheskyi Zhurnal.
Vol.99. No.11. P.1203–1222.
Marin I.N. 2021. The shrimps from the bottom: a new
species of stygobiotic atyid shrimps of the genus
Xiphocaridinella from the world-deepest Verevkina
Cave // Arthropoda Selecta. Vol.30. No.4. P.521–530.
https://doi.org/10.15298/arthsel.30.4.07
Marin I., Sokolova A. 2014. Redescription of the stygobi-
otic shrimp Troglocaris (Xiphocaridinella) jusb-
aschjani Birštein, 1948 (Decapoda: Caridea: Aty-
idae) from Agura River, Sochi, Russia, with remarks
on other representatives of the genus from Caucasus
// Zootaxa. Vol.3754. No.3. P.277–298. https://doi.org/
10.11646/zootaxa.3754.3.3
Marin I., Turbanov I. 2021. Molecular genetic analysis of
stygobiotic shrimps of the genus Xiphocaridinella
(Crustacea: Decapoda: Atyidae) reveals a connection
between distant caves in Central Abkhazia, south-
western Caucasus // International Journal of Speleol-
ogy. Vol.50. No.3. P.301–311. https://doi.org/10.5038/
1827-806X.50.3.2378
Sadowsky A.A. 1930. [Xiphocaridinella kutaissiana nov.
gen. et sp. (Fam. Atyidae) aus einer unterirdischen
Höhle bei Kutais] // Zakavkazskiy kraevedstenniy
sbornik nauchnoissledovatel’nogo kraevedstvenogo
kabineta Universiteta Tiflis. Vol.1. P.93–104 [in Rus-
sian with German abstract].
Tatashidze Z.K., Tsikarishvili K.D., Jishkariani J.M. 2009.
[The Cadastre of the Karst Caves of Georgia]. Tbilisi:
Petiti Publishing House. 670 pp. [In Georgian]
WoRMS 2021. Xiphocaridinella Sadowsky, 1930. Ac-
cessed at: http://www.marinespecies.org/aphia.php?p
=taxdetails&id=586744 on 2021-12-01
Responsible editors: A.L. Vereshchaka,
E.N. Temereva
References
Birštein Ya.A. 1939. [About cave shrimps of Abkhazia] //
Zoologichesky Zhurnal. Vol.18. No.6. P.960–974 [in
Russian].
Birštein Ya.A. 1948. [The occurrence of the cave shrimp
Troglocaris in underground water of Mazesta and
related problems] // Byulleten’ Moskovskogo Obsh-
chestva Ispytatelei Prirody, Otdel Biologicheskii.
Vol.53. No.3. P.3–10 [in Russian].
De Grave S., Fransen C.H.J.M. 2011. Carideorum catalo-
gus: the recent species of the dendrobranchiate, ste-
nopodidean, procarididean and caridean shrimps
(Crustacea: Decapoda) // Zoologische Mededelingen.
Vol.85. No.9. P.195–589.
Djanashvili R., Barjadze Sh. 2011. A new species of the
genus Plutomurus Yosii, 1956 (Collembola, Tomocer-
idae) from Georgian caves // Journal of cave and karst
studie. Vol.73. No.1. P.28–30.
Djanashvili R., Barjadze Sh., Jordana R., Burkhardt U.
2014. Redefinition of the genus Argonychiurus Bag-
nall, 1949 (Collembola, Onychiuridae) with descrip-
tion of a new species from Georgia // Zootaxa.
Vol.3835. No.3. P.381–391.
Folmer O., Black M., Hoeh W., Lutz R., Vrijenhoek R.
1994. DNA primers for amplification of mitochondri-
al cytochrome c oxidase subunit 1 from diverse meta-
zoan invertebrates // Molecular Marine Biology and
Biotechnology. Vol.3. No.5. P.294–299.
Guindon S., Dufayard J.F., Lefort V., Anisimova M.,
Hordijk W., Gascuel O. 2010. New Algorithms and
Methods to Estimate Maximum–Likelihood Phyloge-
nies: Assessing the Performance of PhyML 3.0 //
Systematic Biology. Vol.59. No.3. P.307–321. https:/
/doi.org/10.1093/sysbio/syq010
Jugovic J., Prevorènik S., Aljanèiè G., Sket B. 2010. The
atyid shrimp (Crustacea: Decapoda: Atyidae) ros-
trum: phylogeny versus adaptation, taxonomy versus
trophic ecology // Journal of Natural History. Vol.44.
No.41–42. P.2509–2533. https://doi.org/10.1080/
00222933.2010.502258
Juzbaš’jan S.M. 1941. [On the subspecies and intraspecif-
ic differentiation in Troglocaris kutaissiana Sad-
owsky. Communication I] // Soobshcheniya Aka-
demii Nauk Gruzinskoy SSR. Vol.2. No.10. P.929–
935 [in Russian].
Kimura M. 1980. A simple method for estimating evolu-
tionary rates of base substitutions through compara-
tive studies of nucleotide sequences // Journal of
Molecular Evolution. Vol.16. No.2. P.111–120. ht-
tps://doi.org/10.1007/BF01731581
Lanfear R., Frandsen P.B., Wright A.M., Senfeld T.,
Calcott B. 2016. PartitionFinder 2: new methods for
selecting partitioned models of evolution formolecu-
lar and morphological phylogenetic analyses // Mo-
lecular Biology and Evolution. https://doi.org/10.1093/
molbev/msw260.
Marin I. 2017a. Troglocaris (Xiphocaridinella) kumistavi
sp. nov., a new species of stygobiotic atyid shrimp
(Crustacea: Decapoda: Atyidae) from Kumistavi Cave,
Imereti, Western Georgia, Caucasus // Zootaxa.
Vol.4311. No.4. P.576–588. https://doi.org/10.11646/
zootaxa.4311.4.9
