Cytonemes coordinate asymmetric signaling and organization in the Drosophila muscle progenitor niche

Abstract

Asymmetric signaling and organization in the stem-cell niche determine stem-cell fates. Here, we investigate the basis of asymmetric signaling and stem-cell organization using the Drosophila wing-disc that creates an adult muscle progenitor (AMP) niche. We show that AMPs extend polarized cytonemes to contact the disc epithelial junctions and adhere themselves to the disc/niche. Niche-adhering cytonemes localize FGF-receptor to selectively adhere to the FGF-producing disc and receive FGFs in a contact-dependent manner. Activation of FGF signaling in AMPs, in turn, reinforces disc-specific cytoneme polarity/adhesion, which maintains their disc-proximal positions. Loss of cytoneme-mediated adhesion promotes AMPs to lose niche occupancy and FGF signaling, occupy a disc-distal position, and acquire morphological hallmarks of differentiation. Niche-specific AMP organization and diversification patterns are determined by localized expression and presentation patterns of two different FGFs in the wing-disc and their polarized target-specific distribution through niche-adhering cytonemes. Thus, cytonemes are essential for asymmetric signaling and niche-specific AMP organization.

Full text

ARTICLE
Cytonemes coordinate asymmetric signaling and
organization in the Drosophila muscle progenitor
niche
Akshay Patel 1, Yicong Wu 2, Xiaofei Han2, Yijun Su2,3, Tim Maugel 4, Hari Shroff2,3 & Sougata Roy 1✉
Asymmetric signaling and organization in the stem-cell niche determine stem-cell fates.
Here, we investigate the basis of asymmetric signaling and stem-cell organization using the
Drosophila wing-disc that creates an adult muscle progenitor (AMP) niche. We show that
AMPs extend polarized cytonemes to contact the disc epithelial junctions and adhere
themselves to the disc/niche. Niche-adhering cytonemes localize FGF-receptor to selectively
adhere to the FGF-producing disc and receive FGFs in a contact-dependent manner. Acti-
vation of FGF signaling in AMPs, in turn, reinforces disc-specific cytoneme polarity/adhesion,
which maintains their disc-proximal positions. Loss of cytoneme-mediated adhesion pro-
motes AMPs to lose niche occupancy and FGF signaling, occupy a disc-distal position, and
acquire morphological hallmarks of differentiation. Niche-specific AMP organization and
diversification patterns are determined by localized expression and presentation patterns of
two different FGFs in the wing-disc and their polarized target-specific distribution through
niche-adhering cytonemes. Thus, cytonemes are essential for asymmetric signaling and
niche-specific AMP organization.
https://doi.org/10.1038/s41467-022-28587-z OPEN
1Department of Cell Biology and Molecular Genetics, University of Maryland, College Park, MD, USA. 2Laboratory of High-Resolution Optical Imaging,
National Institute of Biomedical Imaging and Bioengineering, National Institutes of Health, Bethesda, MD, USA. 3Advanced Imaging and Microscopy
Resource, National Institutes of Health, Bethesda, MD, USA. 4Department of Biology, Laboratory for Biological Ultrastructure, University of Maryland, College
Park, MD, USA. ✉email: sougata@umd.edu
NATURE COMMUNICATIONS | (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications 1
1234567890():,;
Content courtesy of Springer Nature, terms of use apply. Rights reserved

Tissue development and homeostasis rely on the ability of
stem cells to maintain a balance between self-renewal and
differentiation. Stem cell fate decisions are made in the
context of the niche that they adhere to and are controlled by
asymmetric signaling and the physical organization in the stem
cell microenvironment1–9. Asymmetric signaling maintains stem
cell identity in niche-resident stem cells but promotes differ-
entiation of their daughters outside the niche in an organized
pattern. Physical organization and interactions between stem and
supporting cells also control stem cell niche-occupancy and
asymmetric signaling1,10. Understanding how asymmetric sig-
naling and cellular organization arise and are coordinated within
the stem cell microenvironment is critical to understand how
stem cells maintain their identity and prime differentiation in an
organized pattern to generate tissues.
Niche cells are known to present self-renewal growth factors to
the stem cells in an asymmetric manner11,12. Although these
secreted signals can act over a long-range and are predicted to
disperse randomly in the extracellular environment, their activ-
ities are spatially confined to the niche. Moreover, signals are
selectively delivered only to the stem cells, but not to their
neighboring non-stem cell daughters, often located one cell dia-
meter away11,12. Elegant experiments using cultured embryonic
stem cells (ESC) have shown that asymmetric stem cell division
requires localized target-specific signal presentation13. For
instance, while the spatially restricted presentation of bead-
immobilized Wnt induces asymmetric signaling and ESC divi-
sion, the presentation of soluble Wnt and global activation of
signaling in ESC sustains only symmetrical division13. These
findings suggested that the localized and directed signal pre-
sentation and interpretation might form the basis of the asym-
metry within the stem cell niche.
An in vivo mechanism for localized and directed distribution
of signals during animal development came from the discovery of
specialized signaling filopodia, called cytonemes14–16. Studies in
developing Drosophila and vertebrate embryos demonstrated that
signal-exchanging cells extend cytonemes to contact each other
and exchange signaling proteins at their contact sites14,15,17–22.
Cytonemes have been implicated in all major signaling
pathways23–25. Cytonemes or cytoneme-like signaling projections
such as MT-nanotubes are known to be required in Drosophila
germline stem cells niches12,26,27 and stem-cell-derived synthetic
organoids28. These previous observations raise the possibility that
contact-dependent signaling through cytonemes could form the
basis of asymmetric signaling and cellular organization in stem
cell niches. However, much needs to be learned about the roles
and mechanisms of cytonemes in establishing functional asym-
metry in the stem cell niche.
To address this question, we selected the Drosophila wing disc-
associated adult muscle precursors (AMPs), which constitute a
well-characterized population of stem cells maintained within the
wing disc niche29,30. AMPs are embryonic in origin and are
associated with the larval wing disc to proliferate and produce a
pool of transient amplifying cells that undergo myogenic fusions
and differentiation during metamorphosis to form adult flight
muscles29,31–34. The wing imaginal disc produces several self-
renewal signals for AMPs30,34,35. Disc-derived Wingless (Wg)
and Serrate (Ser) control asymmetric AMP divisions, which retain
mitotically active AMPs at the disc-proximal space and place
their daughters at a disc-distal location to commit to post-mitotic
fates30. AMPs are also known to employ cytonemes to mediate
Notch and Wingless/Wg (Wnt) signaling with the disc-associated
trachea and wing discs, respectively36,37. These prior character-
izations and the availability of genetic tools and imaging methods
provide an ideal system to examine the roles of cytonemes in
generating functional asymmetry in the wing disc AMP niche.
In this study, we show that cytonemes are required to generate
asymmetric signaling and AMP organization within the wing disc
niche. Investigation into the underlying mechanisms revealed that
cytonemes integrate two essential cell organizing functions niche-
specific adherence and fibroblast growth factor (FGF) signaling.
AMPs extend FGFR-containing cytonemes to identify and adhere
to an FGF-producing wing disc niche. Niche-adhering AMP
cytonemes also directly receive FGFs from the niche, and the
activation of FGF signaling in AMPs, in turn, reinforces the
niche-specific polarity and adherence of cytonemes. We showed
that this interdependence between the cause and effect of
cytoneme-mediated interactions produces and maintains diverse
niche-specific asymmetric AMP organizations. Furthermore, we
showed that the cytoneme-dependent AMP organization is
modulated by the extrinsic compartmentalized expression and
presentation patterns of two different FGFs in the wing disc, and
by their polarized, target-specific distributions to the niche-
adhering AMPs through cytonemes. These findings provide
insights into how cytoneme-mediated polarized signaling can
play critical roles in generating and maintaining diverse niche-
specific asymmetric stem cell organizations.
Results
AMP polarity changes with increasing distance from the wing
disc niche. The Drosophila larval wing imaginal disc serves as the
niche for AMPs, the adult flight muscles progenitors, and the air-
sac primordium (ASP), the precursor for the adult air-sac that
supplies oxygen to flight muscles30,38 (Fig. 1A). AMPs are asso-
ciated with the basal surfaces of disc and ASP epithelia
(Fig. 1A’)39. In the 3rd instar larval discs, AMPs asymmetrically
divide by orienting their division axes in oblique-to-orthogonal
direction relative to the disc epithelium and produce a multi-
stratified layer orthogonal to the disc epithelial plane30. To gain
insights into the cellular organization of the AMP niche, we
examined 3rd instar larval wing discs using transmission electron
microscopy (TEM) and confocal microscopy. TEM analyses of 16
wing disc sections (from w1118 larvae) revealed that AMPs are
asymmetrically organized orthogonally over the disc within a
space between the basal surface of disc cells and the disc basal
lamina (Fig. 1A–D).
AMPs had polarized elliptical shapes; however, their orienta-
tions changed with a change in the AMP location along the
proximo (p)-distal (d) orthogonal axis relative to the disc plane
(Fig. 1A–D). While the disc-proximal AMPs (p) had their major
axis oriented in the oblique-to-orthogonal direction relative to the
disc plane, the disc-distal AMPs (d) had their major axes aligned
parallel to the disc plane (Fig. 1B, C). Moreover, the membrane of
proximal AMPs established direct contact with the disc and often
extended many cytoneme-like filopodia37 that protruded into the
disc cell membrane or the intercellular space (Fig. 1D and
Supplementary Fig. 1A, A’). In contrast, disc-distal AMPs (d)
lacked such direct physical contacts with the disc (Fig. 1B, C).
These results indicated that the positioning of individual AMPs
within the wing disc niche might be linked to their polarity and
contact-dependent interactions with the disc.
To quantitatively assess the correlation between AMP polarity
and positioning, we labeled AMP nuclei with nls:GFP (nuclear-
localized GFP expressed under the AMP-specifichtl-Gal4 driver),
and used confocal microscopy to record nuclear position and
orientation in three dimensions, relative to the actin-rich disc-
AMP interface (phalloidin-marked) (Fig. 1A, E–F”). To examine
how nuclear polarity changed with increasing distance from the
disc, we measured the angle between the wing disc plane and the
major axis of each elliptical nucleus positioned at various
distances away from the disc (Fig. 1G and Supplementary
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z
2NATURE COMMUNICATIONS | (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications
Content courtesy of Springer Nature, terms of use apply. Rights reserved

Table 1). With these analyses, we confirmed that disc-proximal
AMP nuclei were polarized toward the disc, and disc-distal nuclei
had their axes aligned parallel to the disc plane. Moreover, the
polarity of AMP nuclei gradually changed with increased
orthogonal distances from the disc (Fig. 1E–H and Supplemen-
tary Table 1).
In addition, as nls:GFP labeled both the nucleus and cytoplasm,
these experiments also revealed diverse morphological features of
distal AMPs (Fig. 1I–K and Supplementary Fig. 1B–D’). A
population of htl expressing distal cells had small non-polar
spherical (diameter ~2–5μm) shapes (Fig. 1K). Another group of
AMPs had highly elongated multi-nucleated (2–3 nuclei/cell)
Fig. 1 Correlation of the AMP position and polarity relative to the disc. A Drawing of an L3 wing disc showing the spatial organization of AMPs, wing disc
notum and hinge areas, and ASP (air-sac primordium) and TC (transverse connective); dashed box (left), ROI used for all subsequent YZ cross-sectional
images. B–DTEM sections of wing disc (w1118) showing YZ views of different wing disc notum areas; double-sided dashed arrows, long axes of elliptical
AMPs; p-d dashed arrow, proximo (p)-distal (d) axis relative to the disc plane (dashed line); white arrow, cytoneme-like disc-invading projections from
AMPs (Dsee Supplementary Fig. 1A,A’); BM basement membrane. E–E”Spatial organization of nls:GFP-marked AMP nuclei, orthogonal to the wing disc
notum (E,E”) and hinge (E,E’) as illustrated in A.F–HCross-sections of wing disc regions (indicated in ROI box in A) harboring nls:GFP-marked AMPs;
double-sided arrows, nuclear orientation; F’green channel of F; dashed and solid arrows, distal and proximal layer cells, respectively; Gdrawing illustrating
the strategy to measure nuclear orientation as angles (Theta, θ) between AMP nuclei and the disc plane; Hgraph showing quantitative analyses of AMP
nuclear orientation at different disc-relative locations; p: proximal (125 nuclei), d: distal (58 nuclei), p−1: one layer above p (119 nuclei), d−1: one layer below
d (84 nuclei); also see Supplementary Table 1 and see “Methods”section for statistics; source data are provided as a “Source Data”file. I–KSingle XY
optical sections of the discs, showing diverse morphologies of distal AMPs; dashed arrows, elongated syncytial cells; arrowhead, small nonpolar cells (also
see Supplementary Fig. 1B–D’). E,F”red, phalloidin, marking tissue outlines (also indicated by dashed line). Genotype: UAS-nls:GFP/+; htl-Gal4/+(E–K).
Scale bars: 20 μm; 10 μm(B,C,K); 5 μm(D).
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z ARTICLE
NATURE COMMUNICATIONS | (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications 3
Content courtesy of Springer Nature, terms of use apply. Rights reserved

syncytial morphology, which is a hallmark of myogenic fusion40
(Fig. 1I, J and Supplementary Fig. 1B–D’). Notably, AMPs with
diverse morphologies were predominantly enriched proximal to
the transverse connective (TC) and ASP and often adhered to the
TC/ASP surfaces (Supplementary Fig. 1C). It is possible that the
disc-associated tracheal epithelium acts as a second niche to
support disc-distal AMPs, but, here, we focus only on the disc-
AMP interactions.
Disc-specific AMP polarity and positioning are linked to disc-
adhering AMP cytonemes. The appearance of diverse morphol-
ogies in disc-distal AMPs is consistent with the post-mitotic fates
of the distal AMPs, as reported before30,38. Therefore, we hypo-
thesized that the disc-specific AMP polarity and adherence
maintain disc-proximal positional identity and stemness of
AMPs, and that the loss of disc-specific polarity and adhesion
enables AMPs to acquire disc-distal positions and morphologic
features required for fusion/differentiation. To test this model, we
generated a transgenic fly harboring a htl>FRT-stop-FRT>Gal4
construct that can induce random fluorescently marked FLIP-out
clones exclusively in the AMP layers (Fig. 2A, see “Methods”
section). Generation of sparsely located single-cell AMP clones,
marked with either membrane-localized CD8:GFP or actin-
binding Lifeact:GFP, allowed us to compare the morphologic
features of AMPs present at different locations within the same
tissue (Fig. 2B–B”and Supplementary Fig. 1E, F).
Confocal YZ sections of discs revealed that disc-proximal
AMPs (single cell clones) were oriented toward the disc, and they
also projected long orthogonally-polarized cytonemes toward the
disc that apparently invaded into the disc epithelium (~2–3/cell;
~12–15 μm long; Fig. 2B-B”and Supplementary Table 2). In
contrast, the disc-distal AMP clones had both polar and non-
polar shapes and they appeared to adhere to each other, often
forming syncytial morphologies (Fig. 2B”and Supplementary
Fig. 1G-G’). Importantly, the polarized disc-distal AMPs had
their axes aligned in parallel to the disc plane, as observed before,
and although they extended laterally oriented cytonemes (av. ~6/
cell) toward each other and the TC/ASP, they lacked orthogonal
cytonemes (Fig. 2B–B”and Supplementary Table 2). Notably,
despite having morphologic hallmarks of AMP–AMP adhesion/
fusion, distal AMPs (except for non-polar AMPs) still retained a
promyogenic transcriptional state based on the expression of the
transcription factor Twist (Twi) (Supplementary Fig. 1H-H”)41.
These observations were consistent with the model that the loss of
disc-specific polarity and adhesion primes AMPs to prepare for
myogenic fusion.
The presence of orthogonally polarized disc-invading cyto-
nemes exclusively in the disc-proximal AMPs suggested that these
cytonemes might be involved in physically adhering/holding
AMPs to the disc-proximal position and establishing their disc-
specific polarity. Orthogonal AMP cytonemes appeared to be
stable structures as they were detected in comparable numbers
under both fixed and live conditions and irrespective of the
genetic markers or drives used (Fig. 2C–E). Moreover, wing disc
cells were also observed to extend short actin-rich projections,
probably to promote AMP-disc physical interactions (Fig. 2F).
Further characterization of AMP cytonemes revealed that they
are primarily composed of actin. AMP cytonemes were enriched
with actin-binding phalloidin and Lifeact:GFP, but they lacked
microtubule marker, such as EB1:GFP (Fig. 2C’, D and
Supplementary Fig. 2A,A’). Live imaging of CD2:GFP-marked
AMPs in ex-vivo cultured wing discs, revealed that the orthogonal
cytonemes dynamically extend and retract at an average rate of ~
1μm/min and have an average life-time of ~25 min (Fig. 2G–J
and Supplementary Fig. 2C, D and Supplementary Movies 1–3).
Despite the regular turnover, the overall cytoneme density (niche
occupancy) within the disc area remained uniform over time
(Fig. 2I and Supplementary Movie 4). These results suggested that
the AMPs are dynamically adhered to the disc via cytonemes, and
that this dynamism might enable multiple proximal AMPs to
share the limited niche space.
AMP cytonemes anchor AMPs to the disc adherens junction.
To characterize the cytoneme–disc interactions, we simulta-
neously expressed CD2:GFP in AMPs under htl-LexA and
nls:mCherry in the disc notum under ths-Gal4 control. For deep
tissue imaging of cytonemes (50–80 μm deep from the objective),
we employed a triple-view line-confocal imaging method, which
enabled ~2-fold improvement in axial resolution (Fig. 3A–D”)42.
Orthogonal cytonemes were found to emanate in a polarized
manner from only the ventral surface of disc-proximal AMPs and
invade through the intercellular space of the disc epithelium
(Fig. 3C-D”’ and Supplementary Movie 5). Analyses of XY and
XZ optical sections revealed that multiple AMP cytonemes shared
a common disc intercellular space and they grew toward apical
junctions of the disc epithelium (Fig. 3D-D”).
To examine if AMP cytonemes are tethered to the intercellular
disc space, we expressed mCherryCAAX in disc cells and
CD2:GFP in AMPs and imaged these tissues with an Airyscan
confocal microscope. We also immunoprobed these tissues for
various sub-apical adherens junction markers, including Discs-
large protein, beta-catenin (Armadillo), and DE-Cadherin. As
shown in Fig. 3E–J (Supplementary Movies 6 and 7), long AMP
cytonemes extended through the basolateral intercellular space of
the wing disc cells and appeared to contact the sub-apical
adherens junction. Cytoneme tips were often helically twisted
around the junctional membrane components (Fig. 3J), poten-
tially to increase the surface area of the contacts.
To examine if AMP cytonemes selectively contact the apical
disc junctions, we used the synaptobrevin-GRASP, a trans-
synaptic GFP complementation technique20,43. When we
expressed CD4:GFP11 on the wing-disc cell membrane and
mCherryCAAX and syb:CD4:GFP1–10 in AMPs, high levels of
GFP reconstitution occurred selectively at the contact sites
between the tips of the cytonemes and the actin-rich (phalloi-
din-marked) disc apical junctions. Thus, AMP cytonemes
establish direct contact with the disc adherens junctions (Fig. 3K,
K’). It is important to note that although these experiments were
performed using a disc-specificths-Gal4 driver, contacts between
cytonemes and disc junction were recorded even in disc areas that
did not express ths-Gal4 (Fig. 3H, H’). Thus, AMPs employ
cytonemes to occupy the wing disc niche and this cytoneme-
mediated occupancy is likely to be a general mechanism for
AMP-niche adhesive interactions.
Cytoneme-disc contacts predict AMP position and polarity
relative to the disc. If cytoneme-mediated adhesion is required to
specify disc-specific AMP polarity, disc-proximal location, and
stemness, removal of cytonemes might induce the loss of these
features and gain of distal positioning and differentiation. The
Drosophila Formin Diaphanous (Dia) is a known cytoneme
modulator of actin-based cytonemes15,36. We found that AMP
cytonemes localized Dia:GFP and a constitutively active Dia-
act:GFP (Fig. 4A, B). Moreover, compared to control discs, dia
knockdown in Lifeact:GFP-marked AMPs significantly reduced
AMP cytoneme numbers (Fig. 4C, D). Therefore, to record the
effects of cytoneme loss in AMPs, we genetically removed AMP
cytonemes by knocking down dia from AMPs.
When dia-i was expressed in either Lifeact:GFP-marked
(detects morphology) or nls:GFP-marked (detects nuclear
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z
4NATURE COMMUNICATIONS | (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications
Content courtesy of Springer Nature, terms of use apply. Rights reserved

Fig. 2 Disc-specific AMP polarity and adhesion are linked to polarized AMP cytonemes. A Schematic depiction of htl>FRT>stop>FRT>Gal4 construct and
its application to generate FLIP-out clones exclusively in AMPs (also see Supplementary Fig. 1E, F). B-B”Wing disc harboring random CD8:GFP-marked
AMP clones (hs-Flp; UAS-CD8:GFP; htl>FRT>stop>FRT>Gal4) showing orthogonal and lateral polarity of AMPs and AMP cytonemes relative to disc plane;
arrow and dashed arrow, proximal and distal AMPs/AMP cytonemes, respectively; arrowhead, distal small non-polar cells; *, adherent distal AMPs;
phalloidin (red), actin-rich disc-AMP junction and cell-cortex (also see Supplementary Fig. 1G–H”); B’GFP channel of B;B”’ Violin plots showing angles
(Theta, θ; see Fig. 1G) between proximal and distal AMPs and their cytonemes relative to their underlying disc plane (see Supplementary Table 2 for
statistical analyses). C–EComparison of AMP cytonemes (arrows) marked by various fluorescent proteins driven by different transcription drivers, in fixed
and live tissues, as indicated; arrowhead, actin-rich (phalloidin-marked) apical-junction of disc epithelium; EGraphs comparing length and numbers
(count/100 μm length of AMP-disc interface) of orthogonal cytonemes (n=>125 cytonemes for each genotype/condition, imaged from >5 wing disc/
genotype under fixed condition and four discs under live condition; see “Source Data”for statistics). FActin-rich cytonemes (arrow) from wing disc cells
expressing mCherryCAAX and Lifeact:GFP (fixed tissue). G–JLive dynamics of AMP cytonemes; G3D-rendered image showing live cytonemes captured
from p-to-d direction of the tissue; Hdynamics of cytonemes (arrow) (2 min time-lapse, also see Supplementary Movies 1–4); IGraphs showing numbers
of niche-occupying cytonemes over time within selected ROIs; three graph colors, three discs; JGraph showing the distribution of cytonemes lifetimes
(n=77 cytonemes; also see Supplementary Fig. 2D). Source data for B”‘,I, and Jare provided as a “Source Data”file. C–JGenetic crosses: enhancer-Gal4/-
LexA xUAS-/LexO-fluorescent protein (FP), as indicated. Scale bars: 20 μm; 5 μm(H).
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z ARTICLE
NATURE COMMUNICATIONS | (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications 5
Content courtesy of Springer Nature, terms of use apply. Rights reserved

polarity and number) AMPs under htl-Gal4 control, the
polarized, multi-stratified AMP organization was lost with a
concomitant gain of fusogenic responses in AMPs (Fig. 4E–I’and
Supplementary Table 1). The mutant AMPs were apparently
induced to adhere and fuse to each other to form large syncytial
assemblies (Fig. 4F). Optical-sections through these giant
chambers revealed that each one of them was lined by a common
thick actin-rich membrane cortex (marked with phalloidin or
Lifeact:GFP) housing multiple large-sized nuclei (probed with
nls:GFP expression, DAPI, and Twist immunostaining)
(Fig. 4F–G’,I,I’). Since Lifeact:GFP was expressed only in AMPs,
a multi-nucleated syncytium lined by a common Lifeact:GFP-
marked membrane cortex indicated the fusion of multiple AMPs
to form the giant chambers.
Although mutant AMP nuclei localized the promyogenic
transcription factor Twist (twi), AMP fusion and syncytial
myotube-like formation is a morphological hallmark of AMP
differentiation40. Notably, AMP fusion is a multistep process,
which can be stalled at an intermediate step44. Based on the
Fig. 4G, G’, the dia-i induced AMP fusion apparently was stalled
X2
UAS
ths
CRE Gal4
htl-LexA
ths-Gal4
xy
z
Septate junction
Adherens
junction
Apical
Basal
XY section
(D”,F)
x
y
D”
CC’
D”’
A
B
DD’
htl-LexA>CD2:GFP ths-Gal4>mCherryCAAX
htl-LexA>CD2:GFP
htl-Gal4>Lifeact:GFP
αArm
αDCAD2
αDlg
LexA LexO
htl
CRE
X1
x
y
Phalloidin
J
htl-LexA>sybGFP1-10, mCherryCAAX
ths-Gal4>CD4:GFP11
K’
I’ K
I
EE’ E’’ F
htl-LexA>CD2:GFP ths-Gal4>nls-mCherry
wing disc
Glass bottom chamber
OBJ-2
OBJ-1
excitation
emission
OBJ-3
1xPBS
G
*
*
*
Wing disc
AMP
*
*
HH’
Fig. 3 AMP cytonemes anchor AMPs to the wing disc adherens junctions. A,BSchematic depictions of the genetic strategy (A) used to simultaneously
mark AMPs and the disc notum, and imaging strategy (B) using multi-view microscopy for deep-tissue imaging. C,D”’ Triple-view confocal imaging
showing CD2:GFP-marked orthogonally polarized cytonemes (arrow) emanating from disc-proximal AMPs (*, in C’) and invading through the intercellular
space between nls:mCherry-marked disc cells (C,D,D’); D”-D”’ single XY cross-sections of disc, as illustrated in D”’, showing multiple cytonemes sharing
the same intercellular space. E–H’CD2:GFP-marked AMP cytonemes at the intercellular space of mCherryCAAX-marked wing discs approaching apical
adherens junctions (Dlg stain, blue); E’,E”, dashed box area in E;FXY cross-section of disc showing niche sharing by multiple cytonemes; GAiryscan
image of cytoneme tip approaching adherens junction (arrowhead), H,H’AMP cytonemes (arrow) in both ths-Gal4 expressing (red) and non-expressing
areas (dashed line). I,JTip regions of AMP cytonemes contacting disc adherence junction that is marked with DCAD2 (I,I’) and Arm (J); *, helical twists
in cytonemes; arrowhead, contact sites; I’zoomed-in image from ROI in I.K,K’Synaptic cytoneme-disc contact sites mapped by syb-GRASP (see
“Methods”section) between sybGFP1–10- and mCherryCAAX-expressing AMP cytonemes and the actin-rich (phalloidin, blue) apical junction of
CD4:GFP11-expressing wing-disc cells. All images are YZ cross sections unless noted. All panels, Gal4/UAS or LexA/LexO or genetic combinations of both
used, as indicated (see Methods). Scale bars: 20 μm; 5 μm(E,E’,I’,F,G); 2 μm(J).
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z
6NATURE COMMUNICATIONS | (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications
Content courtesy of Springer Nature, terms of use apply. Rights reserved

htl>Lifeact:GFP Phalloidin
Control dia-i
D
C
mCherryCAAX
Diaact:GFP
Dia:GFP
AB
htl>FRT>Lifeact:GFP Phalloidin htl>nls:GFP Phalloidin
ASP
I
J
K’
L
L’
J’
I’
K
M
y
x
y
x
y
x
y
z
y
z
y
z
x
z
y
x
y
z
x
z
y
z
HH’
htl>Lifeact:GFP Phalloidin
y
x
y
x
Control
Control
dia-i
dia-i
DAPI DAPI
twi
EFGG’
O
NO’
*
**
*
**
*
**
*
d
d
d
p
p
p
d
*
**
Fig. 4 Disc-cytoneme adhesion determines AMP position and fates. A–DAMP cytoneme formation depends on Dia; A,BmCherryCAAX-marked AMP
cytonemes localizing Dia:GFP (AUAS-mCherryCAAX/UAS-Dia:GFP; htl-Gal4/+) and Diaact:GFP (Bhsflp/+; UAS-mCherryCAAX/+;htl>FRT>stop>FRT>Gal4/
UAS-Diaact:GFP). C,DLoss of cytonemes (arrow) in Lifeact:GFP-marked AMPs expressing dia-i; average numbers of orthogonal cytonemes/100 μmofAMP-
disc interface (± standard deviation (SD)): control (htl-Gal4>Lifeact:GFP) =36.9 ± 3.8, and dia-i condition (htl-Gal4>Lifeact:GFP; dia-i)=6 ± 4.1; Source data
are provided as a “Source Data”file. E–I’Comparison of control disc (E,H,H’) and disc expressing dia-i in AMPs under htl-Gal4, showing changes in the
number of AMPs and AMP nuclei, morphologies, and orientations relative to the disc; G,G’DAPI and Twi-stained; E–G’and H–I’AMPs expressing
Lifeact:GFP and nls:GFP, respectively; red, phalloidin; arrowhead, actin-rich cell outline; * examples of giant nuclei within a large chamber; arrow in G’shows
the cytoplasmic space and thin Lifeact:GFP-marked membrane cortex surrounding each giant nucleus indicating hemifusion; dashed line in Hand H’, tracheal
outline and AMP-disc junction, respectively. J–OComparison between control (J–K’) and dia-i-expressing (L–O’) AMP clones for their proximo-distal
localization, polarity, and morphology; dashed arrow, distal cell/cytonemes, solid arrow, proximal cell/cytonemes, dashed line, AMP-disc junction, dashed
double-sided arrow, space between basal disc surfaces and distal clones; M–O’arrowhead, multi-nucleated cells (M), actin-rich (phalloidin stained and
Lifeact:GFP-marked) fusogenic synapse (N–O’). XY or YZ views are indicated. Genotypes: UAS-X/+, htl-Gal4/UAS-dia-i (D,F–G’,I,I’). UAS-FP/+;htl-Gal4/
+(C,E,H,H’)HS-Flp/+; UAS-X/+; htl>FRT>stop>FRT>Gal4/+(J–K’). HS-Flp/+; UAS-X/+;htl>FRT>stop>FRT>Gal4/UAS-dia-i (L–O’). X =FP, as indicated.
Scale bars: 20 μm; 10 μm(A,B,M–O).
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z ARTICLE
NATURE COMMUNICATIONS | (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications 7
Content courtesy of Springer Nature, terms of use apply. Rights reserved

at a hemifusion stage44, where only the contacting monolayers of
cell membranes merged prior to the complete cytoplasmic
merger. This observation was consistent with a previous report
of Dia’s role at a step subsequent to the adhesion of fusion-
competent myoblasts (FCM)45. The reduction of AMP numbers
and concomitant formation of giant AMP nuclei also suggested
an induction of cytoplasmic growth, probably by suppressing cell
division. Thus, the loss of AMP cytonemes led to the loss of AMP
polarity, and instead facilitated fusogenic responses in AMPs
required for differentiation.
To further determine if cytonemes are required for both
maintaining AMP polarity/niche occupancy and inhibiting
fusion, we generated Lifeact:GFP-marked single-cell AMP
clones expressing dia-i. In comparison to control clones, dia
mutant clones had non-polar spherical shapes, and lacked
cytonemes (Fig. 4J–O and Supplementary Table 2). Importantly,
while WT AMP clones occurred at random positions along the
orthogonal p-d axis (Fig. 4J–K’and Supplementary Table 2),
cytoneme-deficient clones occurred only in the distal-most AMP
layers (Fig. 4L–O’and Supplementary Table 2). Cross-sections
through these non-polar clones revealed their syncytial nature
(2–4 nuclei/cell) (Fig. 4M). Many small mutant cells also
adhered to each other, forming actin-rich synapses, similar to
those observed during myoblast fusion45 (Fig. 4M–O’). These
results provided evidence that polarized disc-adhering AMP
cytonemes are required to predict disc-proximal AMP position,
and that the lack of these cytonemes induces AMPs to acquire
disc-distal positions and morphologic hallmarks of a fusogenic
response.
AMP cytonemes polarize toward the disc by activating FGF
signaling. Disc-adhering cytonemes might also be required for
contact-dependent reception of growth factors produced in the
disc, and the activation of signaling, in turn, might specify the
disc-specific polarity and fates in AMPs. Because the entire AMP
population expressed Htl (Supplementary Fig. 2B), which is an
FGF-receptor for two FGFs, Pyramus (Pyr) and Thisbe (Ths)46,
we presumed that AMP cytonemes might be critical for Htl sig-
naling. Previously, the crosstalk between the Wg and Htl sig-
naling was known to control AMP multiplication34,35, but
cytoneme-dependent Htl signaling was unknown.
Htl is the only FGFR that is expressed in the disc-associated
AMPs38. The second Drosophila FGFR, Breathless (Btl) is
specifically expressed in the disc-associated ASP and transverse
connective to receive disc-derived Branchless/Bnl38. To examine
if orthogonal AMP cytonemes localized Htl, we expressed
Htl:mCherry in CD2:GFP-marked AMPs. Hundred percent of
the CD2:GFP-marked AMP cytonemes that oriented toward the
disc localized Htl:mCherry (Fig. 5A). A htl:GFPfTRG fly line that
expresses physiological levels of Htl:GFP47, also localized Htl:GFP
on the entire population of orthogonal cytonemes (Fig. 5B and
Supplementary Movie 8).
To detect Htl-induced MAPK signaling in AMPs, we probed for
nuclear dpERK. AMPs with high levels of nuclear dpERK were
located in the disc-proximal niche and most disc-distal AMPs
lacked the nuclear dpERK (Fig. 5C–C”). This asymmetric
distribution of Htl signaling correlated with the asymmetric p-d
distribution of orthogonal AMP cytonemes (Fig. 2A, B). To
examine if orthogonal cytonemes in AMPs were required to
induce Htl signaling, we generated CD8:RFP-marked control (w−
)
and dia-i expressing clones of AMPs and compared dpERK
signaling between them. While ~49 of 52 WT control clones in the
disc-proximal location (96% ± 6.6; six discs) had dpERK
(Fig. 5D–E”), only 3/92 disc-distal WT clones had dpERK
(3% ± 3.6; six discs). In comparison, all of cytoneme-deficient
dia-i clones were localized in the distal locations and lacked
nuclear dpERK (n=320 clones, seven discs) (Fig. 5F, F’). Thus,
disc-adhering orthogonal cytonemes are required for Htl
signaling.
To examine if the activation of Htl signaling is also required for
the disc-specific orientation of AMP cytonemes, we expressed htl
RNAi (htl-i)eitherunderthehtl-Gal4 control (Fig. 5G–G”,J–J”–K)
or in clones under htl>FRT>Gal4 control (Fig. 5H, I, L, L’). In
control experiments, Lifeact:GFP-marked WT AMPs/AMP clones
extended orthogonal cytonemes when localized in the disc-proximal
location and lateral cytonemes when present in the disc-distal
location. In contrast, htl-knockdown AMPs exclusively lacked the
orthogonally polarized disc-specific cytonemes (Fig. 5G–Iand
Supplementary Table 2). Importantly, the lateral polarity of
AMPs/AMP cytonemes were unaffected by the htl-i condition
(Fig. 5G–I, J–L’). Thus, activation of Htl signaling in AMP is
required specifically for their disc-specificorthogonalpolarity.
Cytoneme-mediated Htl signaling determines the positional
identity of AMPs. Since Htl signaling is required for the disc-
specific polarity of AMP cytonemes, the effects of the loss of Htl
signaling on AMPs are expected to be similar to cytoneme-
deficient dia-i expressing AMPs. Indeed, htl knockdown in Life-
act:GFP and nls:GFP-marked AMPs showed fewer AMPs and
AMP layers with a concomitant increase in the AMP–AMP
adhesion, mimicking fusogenic responses (Fig. 5G–G”,J–J”and
Supplementary Tables 1 and 2). Importantly, unlike the complete
loss of polarity under the dia-i-expression, htl-i expressing AMPs
had lost polarity only toward the disc. The mutant nls:GFP-
marked AMPs had their axes aligned parallel to the disc plane
(Fig. 5J, K).
When we generated htl-i expressing Lifeact:GFP-marked AMP
clones. All of the mutant clones were positioned exclusively in the
disc-distal layer and only had laterally oriented cytonemes
(Fig. 5H, I). Similarly, a comparison of nlsGFP marked WT
and htl-i-expressing clones showed that the mutant clones
specifically occupied the disc-distal layer (Fig. 5L, L’). Phospho-
histone (PH3)-staining (anaphase marker) of these tissues
indicated that the presence of disc-distal htl-i mutant clones in
wing disc did not affect the normal orthogonal polarity of
division axes of mitotically active AMPs in the disc-proximal
layer, as reported before30. Thus, we concluded that cytoneme-
meditated Htl signaling is required for disc-specific AMP polarity,
positioning, and fates.
Altogether, these results suggested that AMP cytonemes are
required to integrate selective niche adherence and asymmetric
Htl signaling. Adherence of cytonemes to the niche is required to
activate Htl signaling in AMPs and activation of Htl signaling in
AMPs is, in turn, required for niche-specific polarity and affinity
of AMP cytonemes. Therefore, we presumed that to initiate and
maintain the asymmetrical patterns of these functions in an
interdependent manner, Htl ligands are presented and delivered
from wing disc cells exclusively to the disc-occupying AMP
cytonemes in a restricted target-specific manner.
Spatially restricted expression of two FGFs produces distinct
AMP niches. Htl ligand Ths is known to be expressed in the wing
disc notum (Fig. 6A and see ref. 35). However, Htl-expressing
AMPs and disc-adhering orthogonal AMP cytonemes also
populated the disc area such as the hinge, which lacked ths
expression (Fig. 3A, H, H’and 6A and Supplementary Movie 8).
When ectopically expressed in the disc, Pyr could modulate the
spatial distribution of AMPs48, but Pyr expression in the disc was
unknown. We presumed that Pyr might be expressed in the ths-
free hinge areas to support AMPs adherence. To identify pyr
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z
8NATURE COMMUNICATIONS | (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications
Content courtesy of Springer Nature, terms of use apply. Rights reserved

expression in the wing disc, we first generated a pyr-Gal4 fly using
CRISPR/Cas9-based genome editing and verified its accurate
spatial expression (Fig. 6B and Supplementary Fig. 3A–E).
Indeed, in the wing disc, pyr-Gal4 was highly expressed in the
disc hinge areas that lacked ths expression (Fig. 6C). When both
AMPs and the pyr source were marked, the spatial distribution of
AMPs over the hinge precisely coincided with the pyr expressing
zone. Thus, the wing disc niche is subdivided into two FGF-
producing niches: the Pyr-expressing hinge and the Ths-
expressing notum.
Two distinct FGF-expressing compartments might hold
different muscle-specific AMPs. The disc hinge area was known
to harbor direct flight muscle (DFM) progenitors, which express a
homeobox transcription factor, Cut, while the indirect flight
muscle (IFM) progenitors, which express high levels of Vestigial
(Vg) and low levels of Cut, occupy the notum33. Since Vg and Cut
expression is stabilized by a mutually repressive feedback loop,
Vg-expressing IFM progenitors and Cut-expressing DFM pro-
genitors appear to be mutually excluded from each other’s
niche33. Cut and Vg immunostaining of discs with CD8:GFP-
marked pyr and ths sources revealed that the pyr-expressing and
ths-expressing zones spatially correlated with the DFM and IFM
progenitor distribution, respectively (Fig. 6G–I). These results
suggested that the Pyr-expressing and Ths-expressing niches
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z ARTICLE
NATURE COMMUNICATIONS | (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications 9
Content courtesy of Springer Nature, terms of use apply. Rights reserved

promote the occupancy of different muscle-specific AMPs within
the respective FGF-expressing zones.
Since Htl is the only receptor for Pyr and Ths, and since all
AMPs express Htl, selective affinity/adherence of DFM-
progenitors to pyr-zone and IFM-progenitors to ths-zone, could
be due to the asymmetric niche-specific presentation and
signaling of Pyr and Ths. To test this possibility, we performed
RNAi-mediated knockdown of ths (ths-i) and pyr (pyr-i) from
their respective sources and visualized niche-specific effects while
marking the resident AMPs with CD2:GFP (Fig. 6J–P”). In
comparison to the control, ths-i expression under ths-Gal4 led to
fewer AMPs, AMP layers, and disc-specific polarized cytonemes
exclusively over the ths zone (Fig. 6J–L). Resident AMPs in the
ths-expression zone had reduced dpERK (Fig. 6K’,L’). However,
ths-Gal4>ths-i conditions did not produce any detectable defects
in dpERK signaling and AMP cytonemes over the pyr-expressing
hinge (Fig. 6M–M”). Similarly, pyr>pyr-i conditions had fewer
AMPs, AMP cytonemes, and, consequently, less dpERK signaling
over the pyr-Gal4-expressing hinge area (Fig. 6N–O”). However,
it did not affect signaling and polarized cytonemes in AMPs over
the ths zone (Fig. 6P, P’). These results suggested that disc-derived
Pyr and Ths can promote signaling and orthogonal cytoneme
formation exclusively in their respective expression zones.
Cytoneme-dependent Pyr and Ths exchange between the AMP
and wing disc. Pyr and Ths signal through a single Htl
receptor46. Therefore, we presumed that to hold two distinct
niche-specific AMP populations, Pyr and Ths would be restricted
from freely dispersing into each other’s zones. To examine this
possibility, we generated Ths:GFP and Pyr:GFP constructs and
expressed them under ths-Gal4 and pyr-Gal4, respectively
(Fig. 7A–J”, see “Methods”section). As predicted, despite the
overexpression, Pyr:GFP and Ths:GFP were distributed exclu-
sively in the AMPs that adhered to their respective expression
zones (Fig. 7A–D’). In addition, the levels of GFP-tagged signal
were higher in the disc-proximal AMPs than the disc-distal
AMPs (Fig. 7C–D’). This observation was consistent with high
levels of dpERK in disc-proximal AMPs (Fig. 5C–E”).
Ths:GFP-expressing disc epithelium had increased surface area
with many folds and projections (Fig. 7A’,A”), probably to hold
an expanding pool of hyper-proliferating AMPs. Ectopic over-
activation of FGF signaling in AMPs was known to increase the
AMP pool size35. Indeed, when AMP nuclei were marked with
nls:RFP (htl-LexA>LexO-nls:RFP) in Ths:GFP expressing discs
(ths-Gal4>UAS-Ths:GFP), we detected an increase in the number
of AMPs and AMP layers (12-15 layers in comparison to WT 4–5
layers; Supplementary Fig. 4A). Unlike the WT disc (Fig. 5C–E”),
the Ths:GFP-expressing discs harbored many disc-distal AMPs
with MAPK signaling and orthogonal polarity (Fig. 7E, E’and
Supplementary Fig. 4A–B”’). However, this increase in Ths
signaling range was limited only to the ths-expressing zone. In the
same discs, AMPs in the neighboring pyr-expressing zone were
unaffected. Similarly, pyr-Gal4-driven Pyr:GFP expanded AMP
pool size over the Pyr:GFP expressing niche, without affecting
AMPs in the ths zone (Fig. 7F, F’and Supplementary Fig. 4A,
C–C’”).
To examine if Pyr:GFP and Ths:GFP were target-specifically
received by AMP cytonemes, we examined mCherryCAAX-
marked AMPs in discs expressing either Pyr:GFP or Ths:GFP
from their respective sources. High-resolution imaging of fixed
tissues revealed that disc-invading AMP cytonemes localized
either Ths:GFP or Pyr:GFP puncta depending on the signal
source they contacted (Fig. 7G–J”). Notably, both Ths:GFP and
Pyr:GFP expressing wing disc cells localized high levels of signals
at the apico-lateral junctions, where AMP cytonemes had
established contacts (Fig. 7H, H’,J–J”). These results are
consistent with the polarized presentation and target-specific
cytoneme-mediated Pyr and Ths uptake.
To further examine if an ectopic Pyr and Ths expressing niche
can induce AMP homing and cytoneme-mediated asymmetric
FGF-specific organizations, we ectopically expressed Pyr:GFP and
Ths:GFP under dpp-Gal4 control. Ectopic Pyr expression in the
disc pouch under dpp-Gal4 is known to induce AMP migration
onto the dpp-expressing zone48. To detect the spatial relationship
between the AMP and ectopic FGF-source, we marked the dpp
source with mCherryCAAX and probed AMPs by Cut immu-
nostaining. As expected, Ths:GFP and Pyr:GFP expression from
the dpp source induced AMP homing and establishment of
ectopic niches by precisely overlapping with the dpp expressing
pouch area (Fig. 8A–F and Supplementary Fig. 5A–C). These
results also suggested that Ths:GFP and Pyr:GFP constructs are
functional.
In these ectopic niches, AMPs were orthogonally organized
into a multi-stratified layer over the signal expressing dpp source.
Despite overexpression, Ths:GFP and Pyr:GFP puncta were
asymmetrically distributed only to the disc-proximal AMPs
(Fig. 8C–F). Importantly, Cut and Vg staining revealed that the
proximal position of the Pyr:GFP-expressing niche was selectively
adhered by Cut-expressing AMPs, which lacked Vg expression,
while high Vg-expressing AMPs, which had suppressed Cut
levels, were sorted out into the disc-distal location (Fig. 8C, D).
Similarly, Vg-expressing AMPs selectively adhered to the
Ths:GFP-expressing niche and high Cut-expressing AMPs were
sorted to the distal layers (Fig. 8E, F). Thus, Pyr and Ths
Fig. 5 AMP cytonemes localize Htl and require FGF signaling for disc-adherence. A CD2:GFP-marked AMP cytonemes (arrows) localize Htl:mCherry
(LexO-Htl:mCherry/+;htl-LexA,LexO-CD2:GFP/+). BOrthogonal AMP cytonemes localize Htl:GFPfTRG.C,C”nls:GFP-marked AMPs stained with anti-dpERK.
D–F’CD8:RFP-marked clones (green, pseudo-colored) of control and dia-i-expressing AMPs showing the FGF signaling state (nuclear dpERK, red); D drawing
depicting optical sections in Eand E’, showing differences in numbers of dpERK positive clones between proximal (95.77% ±6.63 (±SD); 52 clones) and distal
(3.19% ±3.62; 92 clones) AMP layers (p< 0.0001)). G–LEffects of htl-i expression under either htl-Gal4 (G,G”,J,K)orhtl>FRT>Gal4 (single cell clones; H,I,L,
L’); G,G”,J,KDiscs harboring either Lifeact:GFP-marked (G,G”) or nls:GFP-marked (J,K)htl-i-expressing AMPs showing selective loss of-orthogonal
cytonemes (G,G”, cytoneme numbers/100 μm of AMP-disc interface: control =36.9 ± 3.8 and htl-i =0; p< 0.0001), cell polarity (H-K), AMP number and
layers (J,J”), and induction of fusogenic responses (G,G”,H,J’,J”). IGraphs comparing orthogonal and lateral cytoneme numbers per single-cell AMP clone;
Control proximal layer had only orthogonal cytonemes (average ± SD: 2.6±0.9/cell; total n=64 cytonemes/25 clones) and distal layer had only lateral
cytonemes (5.6 ± 1.8/cell; total n=105 cytonemes/19 clones); htl-i-expressing clones were distal and had only lateral cytonemes (6.1 ± 1.7/cell; total n=146
cytonemes/24 clones); error bars: SD; also see Supplementary Table 2. KGraphs comparing AMP nuclear angles (Theta, θ) in control (n=125 proximal/58
distal nuclei) and htl-i-expressing AMPs (n=33 nuclei; p< 0.0001). L,L’Discs with DAPI and PH3 staining showing relative location and orientation of nls:GFP-
marked control (L)andhtl-i-expressing (L’) AMP clones. C,C’,E–L’dashed arrow, distal cells/cytonemes; solid arrow, proximal cell/cytonemes; dashed line,
AMP-disc junction; dashed double-sided arrow, space between the basal disc surface and the distal layer. Source data are provided as a “Source Data”file; p-
values, unpaired two-tailed t-test. Genotypes: HS-Flp/+;UAS-X/+;htl>FRT>stop>FRT>Gal4/+(E,E”,L). HS-Flp/+;UAS-X/+;htl>FRT>stop>FRT>Gal4/UAS-
diaRNAi (F,F’); HS-Flp/+;UAS-X/UAS-htlRNAi;htl>FRT>stop>FRT>Gal4/+(H,I,L’). X =FP as indicated. Scale bars: 20 μm; 30 μm(C,C”); 10 μm(E,E’).
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z
10 NATURE COMMUNICATIONS | (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications
Content courtesy of Springer Nature, terms of use apply. Rights reserved

expressed from the dpp source produced ligand-specific cellular
organization in the ectopic niche.
To further visualize cytonemes from the niche-adhering
AMPs, we imaged mCherryCAAX-marked AMPs in the ectopic
Ths:GFP or Pyr:GFP-expressing dpp source (Fig. 8G–H’).
Proximal AMPs were polarized toward the ectopic niche and
extended niche-invading cytonemes toward the apical junctions
of the disc signal source (Fig. 8G). Single optical YZ sections
across these cytonemes showed signal enrichment along the
cytoneme shafts, suggesting cytoneme-mediated Ths:GFP and
Pyr:GFP uptake from the ectopic source (Fig. 8G’-G”’ H’and
Supplementary Fig. 5D, D’). These results showed that the
localized expression and presentation of Pyr and Ths, and their
cytoneme-mediated target-specific signaling can establish niche-
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z ARTICLE
NATURE COMMUNICATIONS | (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications 11
Content courtesy of Springer Nature, terms of use apply. Rights reserved

specific asymmetric signaling and AMP organization patterns
(Fig. 8I).
Discussion
These findings show a critical role and mechanism of cytoneme-
mediated signaling in generating asymmetric organizations in
the stem cell niche. Previously, well-characterized Drosophila
stem cell niches have revealed that the niches require two basic
strategies to function —adhesive niche-stem cell interactions
and asymmetric signaling49.Inthisstudy,high-resolution
imaging in combination with genetic analyses revealed that
AMPs employ cytonemes to integrate these two essential func-
tions, thereby constituting a central pathway that can generate
and maintain diverse niche-specific asymmetric signaling and
cellular organization.
We found that the mechanism of cytoneme-dependent AMP
organization is constituted of three basic steps (Fig. 8J). First,
AMPs extend cytonemes that orient toward the wing disc niche
and invade through the intercellular space of niche epithelial cells
to adhere AMPs to the disc cell junctions. This is a dynamic
process, which enables multiple AMPs to share the limited niche
area through cytonemes. Second, these cytonemes localize FGFR/
Heartless (Htl) to select and adhere to only the FGF-producing
disc areas and directly receive the disc-produced FGF. Third, the
activation of FGF signaling promotes AMPs to extend polarized
FGFR-containing cytonemes toward the disc and reinforce their
polarity/affinity toward the selected signal-producing niche.
A consequence of this mechanism appears to be an FGF sig-
naling feedback controlling the polarity and affinity of AMP
cytonemes toward an FGF-producing niche. Without FGF sig-
naling, AMPs are unable to polarize cytonemes toward the FGF-
producing disc and adhere to the disc adherens junctions and
without the disc-specific polarity and adhesion of cytonemes,
AMPs are unable to receive FGF and activate FGF signaling
(Fig. 8J). Such interdependent relationship of the cause and
consequence of cytoneme-mediated FGF signaling can integrate
multiple functions, including sensing and adhering to a specific
FGF-producing niche, receiving FGFs in a polarized manner, and
activating a signaling response to self-reinforce polarity, position,
and signaling fates.
Our results suggest that this self-regulatory property of cyto-
nemes can self-organize diverse niche-specific asymmetric pat-
terns (Fig. 8I). For instance, disc-proximal AMPs can determine
and reinforce their positional identity and orientation relative to
the disc by employing the FGF signaling feedback on cytoneme
polarity and adhesion. Cytoneme-dependent adhesion might also
be the basis of the orthogonally polarized division of disc-
proximal AMPs30. With increased orthogonal distances from the
disc, AMPs lose the niche-specific adhesion, FGF signaling, and
polarity, and, instead, gain morphologic hallmarks required for
AMP differentiation. Notably, AMP cytonemes integrate all these
functions simply by establishing or removing contacts with the
niche. Consequently, asymmetric cellular and signaling patterns
emerge in an interdependent manner along the p-d orthogonal
axis relative to the niche (disc plane) via cytoneme-mediated
niche-AMP interactions (Fig. 8I).
The same FGF signaling feedback on AMP cytonemes can also
produce a second asymmetric AMP organization (Fig. 8I). AMPs
that give rise to DFM (express Cut) and IFMs (express high Vg
and low Cut) are known to be maintained in two distinct regions
of the wing disc, and a mutual inhibitory feedback between Cut
and Vg is known to intrinsically reinforce the spatially separated
distribution of the two AMP subtypes33. We found that the wing
disc AMP niche is subdivided into Pyr and Ths expressing zones
that, in turn, support DFM-specific and IFM-specific AMPs,
respectively. Pyr and Ths signal to cells by binding to the com-
mon Htl receptor46, but when Htl-containing AMP cytonemes
physically adhered to the Ths-expressing niche and received Ths,
AMPs had IFM-specific fates and when AMP cytonemes adhered
to the Pyr-expressing niche and received Pyr, AMPs had DFM-
specific fates. We do not know whether Pyr/Ths signaling in
AMPs can directly control the Vg or Cut expression. However,
based on the experimental evidence from the ectopic Pyr/Ths-
producing AMP niches (Fig. 8A–F), we conclude that the DFM
precursors selectively adhere to the Pyr-expressing niche, and the
IFM precursors selectively adhere to the Ths-expressing niche.
Therefore, the self-promoting FGF signaling feedback on FGF-
receiving AMP cytonemes can organize and reinforce diverse
niche-specific AMP organization. However, the final architecture
of AMP organization is controlled extrinsically by the expression
and presentation patterns of niche-derived FGFs. We found that
Pyr and Ths-expressing wing disc cells restrict random secretion/
dispersion of FGFs and target their release only through
cytoneme-mediated AMP-niche contacts. How source cells
ensure target-specific Pyr and Ths release is unclear. A recent
discovery shows that Pyr is a transmembrane protein50 and
transmembrane tethering might ensure its cytoneme-dependent
exchange. Moreover, both Pyr and Ths are enriched at the apical
junctions of the disc (see ref. 50; Fig. 7G, H) where AMP cyto-
nemes establish contacts.
These findings also might implicate that the alteration of
cytoneme polarity, adhesion, and signaling specificity can deter-
mine differential fates/functions. For instance, although distal
AMPs do not extend cytonemes toward the disc, they extend
cytonemes toward each other and toward the TC/ASP. Our
results suggest that the TC/ASP might act as a niche for distal
AMPs. Moreover, cytoneme-dependent interactions between the
TC/ASP and AMPs are known to mediate Notch signaling36.
Similarly, filopodial tethering of embryonic AMPs to surrounding
muscles facilitate insulin and Notch signaling to control quies-
cence and reactivation51. Filopodia are also essential for
AMP::AMP/myotube fusion during myogenesis45,52. Thus, the
same AMP filopodia/cytoneme can dynamically balance between
different fates/functions, including quiescence, reactivation,
stemness, and differentiation, depending on where and when they
establish contacts.
Fig. 6 Wing discs express Pyr and Ths in distinct zones to support different AMP subtypes. A Spatial patterns of ths-Gal4-driven mCherryCAAX
expression in the wing disc notum and the distribution of CD2:GFP-marked AMPs; arrow, ths expression-free hinge area; right panel, red channel from the left
panel. BScheme depicting the genome editing strategy to generate a pyr-Gal4 enhancer trap construct (see Supplementary Fig. 3). C,DWing disc expression
patterns of pyr-Gal4-driven CD8:GFP (C)andmCherryCAAX(D) and its spatial correlation to the AMP distribution (Darrow). E–IImages showing CD8:GFP-
marked ths-Gal4 and pyr-Gal4 expression zones in wing discs and their correlation with the localization of IFM-specific(highVg,blue;lowCut,red;dashed
arrow) and DFM-specific (high Cut, red; dashed arrow) progenitors; Ischematic depicting the results of E–H.J–M”Images, showing effects of ths-i expression
from ths source (ths-Gal4; mCherryCAAX-marked, blue) on the resident AMPs (AMP number, cytonemes, polarity, multi-layered organization, and dpERK
signaling (red)) and non-resident AMPs (over the unmarked pyr-zone);dottedline(M”), ASP. N–P’Images showing effects of pyr-i expression from pyr
source (pyr-Gal4, blue area) on the resident AMPs and non-resident AMPs (unmarked ths-expression zone). J–P’solid arrows, pyr expression zone; dashed
arrow, ths-expression zone; dashed box, ROIs used to produce YZ views. Scale bars: 20 μm.
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z
12 NATURE COMMUNICATIONS | (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications
Content courtesy of Springer Nature, terms of use apply. Rights reserved

The molecular mechanisms that produce AMP-niche contacts
and control contact-dependent Pyr/Ths exchange are unknown.
Our n-syb-GRASP experiments showed that the AMP-niche
cytoneme contacts trans-synaptically reconstitute split n-syb GFP.
Since n-Syb containing vesicles are targeted specifically to the
neuronal synapses43, the niche-AMP cytoneme contact sites
might recruit neuron-like molecular and cellular events to
exchange signals. This is consistent with previous reports showing
that cytonemes share many biochemical and functional features
with neuronal communication16,53,54.
Fig. 7 Cytoneme-mediated FGF exchange generates niche-specific asymmetric signaling. A,B’XY and YZ views (as indicated) of wing discs expressing
mCherryCAAX and either Ths:GFP under ths-Gal4 (A,A”) or Pyr:GFP under pyr-Gal4 (B,B’). C,D’Images of wing discs harboring mCherryCAAX-marked
AMPs; wing discs expressing either Ths:GFP or Pyr:GFP as indicated. A–D’dashed arrow, signal in the source; arrow, non-autonomous punctate
distribution in the AMP; *, non-expressing areas of the lacking signal distribution. E,F’Wing discs expressing either Ths:GFP or Pyr:GFP as indicated,
showing niche-specific effects of signal overexpression on proliferation of niche-resident and non-resident AMPs (nls:GFP marked); thick and thin dashed
line, interface between AMPs and ths-expression and pyr-expression zones, respectively; dashed and solid arrows, effects on ths-expression and pyr-
expression zones, respectively. G–JYZ views of wing discs expressing either Ths:GFP or Pyr:GFP as indicated and harboring mCherryCAAX-marked AMPs,
showing disc-invading cytonemes receiving GFP-tagged signal (arrow) from the disc cells; arrowheads, localized signal enrichment in source cells. Scale
bars: 20μm; 5 μm(H,H’).
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z ARTICLE
NATURE COMMUNICATIONS | (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications 13
Content courtesy of Springer Nature, terms of use apply. Rights reserved

Cytoneme-deficiency in AMPs caused pupal lethality, which
might suggest that the contact-dependent signaling via cyto-
nemes plays an important role in muscle development/home-
ostasis. Moreover, a recent study showed that cytoneme-
dependent FGF–FGFR interactions between the ASP and wing
disc induces bidirectional responses21.Itislikelythatsimilar
cytoneme-dependent bidirectional receptor–ligand interactions
can simultaneously control both wing disc and AMP organiza-
tion. For instance, wing disc and AMP cells extend polarized
cytonemes toward each other (Fig. 2D, F). The loss of AMP
cytonemes alters the morphology of the wing disc epithelium
(Supplementary Fig. 7A–C). Similarly, overexpression of FGFs
from the disc induces folds and projections from the wing disc
epithelium to hold hyperproliferating AMPs within the niche
(Fig. 7A’,A”).
Collectively, these results establish an essential role of FGF
signaling in regulating AMP homing, niche occupancy, and
niche-specific organizations. FGF signaling achieves these goals
by controlling niche-specific polarity and affinity of AMP cyto-
nemes (Figs. 5G–L and 8A–H’and Supplementary Fig. 5A–C).
However, additional signaling inputs and their crosstalk with the
FGF signaling pathway might be required to specify different
muscle-specific transcriptional fates in AMPs. For instance, wing
disc-derived Wg/Wingless30,36, Hedgehog (Hh)48,55,56, and Ser-
rate (Ser)30 are required for different AMP fates or functions.
Moreover, crosstalk between Htl and Wg signaling or Wg and
dpp>Ths/Pyr
Ectopic
AMP niche
Pyr:GFP
Vg
Cut
Ths:GFP
Vg
Cut
dpp-Gal4>Ths:GFP
dpp-Gal4>Pyr:GFP
htl-LexA>mCherryCAAX
**
G
HH’
G’ G” G”’
Cut
Pyr:GFP
Ths:GFP
Cut
Vg
Vg
Cut
Control
dpp>Gal4, mCherryCAAX
**
*
*
*
A
A
A
A
A
A
P
P
P
P
P
P
B
CD
EF
B’
z
x
y
x
Myogenic differentiation
AMP subtypes (DFM or IFM)
IFMs
Ths zone Pyr zone
Ths Pyr
Stemness
Differen-
tiation
Basal lamina
Disc cells
Proximal
AMPs
Fates
Distal
Cytoneme
Cell
junctions
Apical
Basal
Z
X/Y
DFMs
Trachea
Niche-specific
AMP Identity
c
i
f
ic
ep
s-
e
h
c
i
N
n
o
is
e
h
d
a
&
y
ti
r
al
o
P
Signaling
Niche adhesion
and polarized
FGF uptake via
cytonemes
A
IJ
Fig. 8 Cytoneme-mediated FGF-specific organizations in ectopic niches. A–FAsymmetric FGF signaling and ligand-specific organization of DFM-specific
(αCut, blue) and IFM-specific(αVg, blue) AMPs when dpp-Gal4 ectopically expressed either Pyr:GFP or Ths:GFP (dpp-Gal4>UAS-Pyr:GFP or Ths:GFP,>UAS-
mCherryCAAX) in the wing disc pouch as illustrated in A;ADrawing depicting the experiments and results in B–F; dashed line, AMP-disc junctions; B’XZ
section from ROI in B; dashed and solid arrows, Cut and Vg expressing AMPs, respectively; double-sided arrow (D), proximal zone of Pyr:GFP expressing
niche lacking Vg-positive AMPs. G,G”’ Wing disc pouch expressing Ths:GFP under dpp-Gal4 and showing mCherryCAAX-marked AMP and AMP
cytonemes; *, proximal AMPs with orthogonal polarity and cytonemes; G”,G”’, single optical sections showing Ths:GFP on cytonemes (arrowheads);
dashed lines, disc epithelium. H,H’Wing disc pouch expressing Pyr:GFP under dpp-Gal4 and showing mCherryCAAX-marked AMP and AMP cytonemes;
arrowhead, Pyr:GFP on cytonemes. I,JModels for the niche-specific asymmetric signaling and organization via cytonemes-mediated Pyr and Ths signaling
(I) and signaling feedbacks reinforcing the cytoneme polarity and adhesion (J). Scale bars: 20 μm.
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z
14 NATURE COMMUNICATIONS | (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications
Content courtesy of Springer Nature, terms of use apply. Rights reserved

Notch signaling pathways are critical for AMP proliferation/
fates34,35. We speculate that the cytoneme-dependent adherence
to a specific FGF-expressing niche exposes AMPs to many other
signal sources that overlap with the FGF-producing zone. For
instance, we found that ~24% of the disc-occupying cytonemes in
the ths-zone overlap with the disc Wg source, and these cyto-
nemes localize Fz:Cherry (Supplementary Fig. 6A–D’36). In the
future, it will be interesting to explore if the cytoneme-dependent
niche occupancy can facilitate signaling crosstalk to specify dif-
ferent muscle-specific AMP fates.
FGF signaling pathway is critical to specify a wide range of
functions, including self-renewal and differentiation of many
vertebrate stem cells57,58. In this context, our results establish a
unique perspective of FGF signaling at the level of signaling input,
where the same FGF and signaling pathway can balance between
different functions, fates, or organizations of stem cells, simply by
controlling when and where the cells might establish cytoneme-
mediated FGF signaling contacts. An asymmetric signaling
microenvironment is required not only to hold stem cells, control
their proliferation, and repress differentiation inside the niche,
but also to guide organized patterns of differentiation of stem
cells outside the niche49. Therefore, our findings, showing how
polarized signaling and cellular interactions through cytonemes
generate and maintain diverse niche-specific signaling and cel-
lular asymmetry, have broad implications.
Methods
Drosophila melanogaster stocks.Allflies were raised at 25 °C with 12 h/12 h light/
dark cycle unless noted. This study: htl-LexA,pyr-Gal4/CyO,htl>FRT>stop>FRT>-
Gal4,UAS-Pyr:GFP,UAS-Ths:GFP and LexO-Htl:mCherry. All new transgenic
injections were performed by Rainbow Transgenic Flies, Inc. Bloomington Droso-
phila Stock Center: UAS-CD8:GFP,UAS-CD8:RFP,UAS-mCherryCAAX,LexO-
CD2:GFP,UAS-Eb1:GFP, UAS-Lifeact:GFP,UAS-nls:GFP,UAS-nls:mCherry,htl-
Gal4,ths-Gal4/CyO,UAS-Dia:GFP,UAS-ΔDAD-Dia:GFP,UAS-pyrRNAi,UAS-dia-
RNAi, hs-Flp,{nos-Cas9}ZH-2A,andw1118. Vienna Drosophila Resource Center:
htl:GFPfTRG,UAS-htlRNAi,andUAS-thsRNAi. Other sources: LexO-nsyb:GFP1–10,
UAS-CD4:GFP1120.LexO-mCherryCAAX15.dpp-Gal4/CyO,LexO-Fz:mCherry and
1151-Gal4 from Huang et al.36 (also see Supplementary Table 3).
Molecular cloning and generation of transgenic Drosophila lines. All over-
expression constructs described were cloned using the primers and cloning kits
listed in the Supplementary Table 3. In UAS-Pyr:GFP, an ectopic super-folder-GFP
sequence was inserted in frame between T
208
and T
209
of the original 766 amino-
acid-long Pyr. In UAS-Ths:GFP, the “VEGQGG linker- super-folder-GFP-
GSGGGS linker”sequence was inserted in frame between S
137
and V
138
of the
original 748 amino acids long Ths. LexO-Htl:mCherry consists of a htl CDS
amplified from genomic DNA fused in frame with a C-terminal VEGQGG-
mCherry-STOP sequence in pLOT vector.
To make pHtl-enh-FRT-stop-FRT3-FRT-FRT3-Gal4 (htl>FRT>stop>FRT>Gal4),
htl cis-regulatory element from P{GMR93H07-Gal4} construct (gift from G.
Rubin) was used to replace the pAct of the pAct-FRT-stop-FRT3-FRT-FRT3-Gal4
attB vector (Addgene #52889). To make pBP-htl-enh-nlsLexA::p65Uw (htl-LexA),
the htl cis-regulatory element was cloned into pBPnlsLexA::p65Uw vector (Addgene
#26230) using Gateway cloning (ThermoFisher). The resulting
htl>FRT>stop>FRT>Gal4 and htl-LexA constructs were injected using the phiC31
site-specific integration system into flies carrying the attP2 landing site. For other
constructs, transgenic flies were generated by P-element mediated germline
transformation in w1118 flies.
Generation of pyr-Gal4 transgenic Drosophila. To generate the pyr-Gal4 driver,
we followed a standard method described earlier in Du et al.59.Briefly:
a. gRNA design and cloning. Single gRNA target site was selected within the
second coding exon of pyr using the tools described earlier in Gratz et al.
and Du et al.59,60. The genomic gRNA binding site of the host fly chosen for
injection (nos-Cas9, BL# 54591) was sequence verified. The gRNA (PAM is
underlined): 5′ATAATATAAGTCCTGACATTGGG 3′.pCFD3-pyr-Gal4-
gRNA was cloned using methods outlined in Port et al.61.
b. Replacement cassette design. The replacement donor was designed to insert
“T2A-nls:Gal4:VP16-STOP”coding sequence into the second coding exon
of pyr (Supplementary Fig. 3A). Insertion site was at 25 nt after the 5′end of
the exon and 21 nt before the 3′of the exon. Insertion of this cassette into
the targeted genomic site disrupts the gRNA binding site to prevent post-
editing gRNA binding. The 5′homology arm (HA) contained 1.2 kb of pyr
genomic region upstream of the insertion site, and the 3′HA contained
1.3 kb of pyr genomic region downstream of the insertion site and were
amplified from the genomic DNA (gDNA) of the nos-Cas9 fly as described
in refs. 59,62. The T2A-nls:Gal4:VP16-STOP sequence was generated by PCR
(Supplementary Table 3) from the pAct-FRT-stop-FRT3-FRT-FRT3-Gal4
attB vector (Addgene). 5′HA-T2A-nls:Gal4:VP16-STOP-3′HA was
assembled in correct 5′-to-3′order between Not1 and EcoR1 sites of the
pJet1.2 vector.
The insertion of the “T2A-nls:Gal4:VP16-STOP”cassette did not affect cis-
regulatory elements and the original splicing sites of pyr second coding exon.
This enables the expression of a full-length pyr mRNA tagged with the Gal4-
expressing cassette. Expression of this chimeric pyr mRNA in cells is probed
with its translation into the nls:Gal4:VP16 protein, which can transactivate
reporters under UAS control (Supplementary Fig. 3B–E). Translation of this
chimeric mRNA begins from the WT 5′end of pyr mRNA, producing a
9-amino acid long N-terminal native Pyr protein, followed by the self-
cleaving T2A peptide and nls:Gal4:VP16. Translation terminates at the stop
codon inserted immediately after the nls:Gal4:VP16 CDS. The T2A-peptide
cleaves off the nine N-terminal Pyr amino acids from the nls:Gal4:VP16
protein. Although the chimeric mRNA contains pyr CDS, the presence of
stop codons in all three frames immediately 3′to the nls:Gal4:VP16 CDS
blocks any further downstream translation. Thus, the engineered locus allele
is functionally a null pyr allele.
c. Embryo Injection, fly genetics, and screening. pCFD3-pyr-Gal4-gRNA and the
replacement cassette plasmids were co-injected in {nos-Cas9}ZH-2A (BL
54591) embryos following59,62. For screening the genome edited flies, single
G
0
adults were crossed to Pin/CyO; UAS-CD8:GFP flies and GFP-positive
larvae from each cross were separated out, reared till adults, which were
individually crossed to Pin/CyO; UAS-CD8:GFP virgins. When the F2 larvae
emerged, the single F1 father from each cross was sacrificed for genomic
DNA preparation and PCR-based screening as described in Du et al.59,62.
Genomic DNA extracted from {nos-Cas9}ZH-2A fly served as the negative
control. PCR screening for the presence of T2A-Gal4 within the endogenous
pyr locus was performed using primer sets “gRNAseqF2”and “Seq2R”;
“Seq2F”and “gRNAseqR1”; and “pJet seqR”and “CseqF”(for ends-out)
(Supplementary Fig. 3A and Supplementary Table 3). The correct lines were
used for establishing balanced fly stocks prior to sequence verification. 30/32
F1-parent lines had successful HDR. 29/30 lines had correct “ends-out”
HDR. Two “ends-out”fly lines were used for full sequencing of the
engineered locus. These flies were outcrossed to establish final stocks for
subsequent use. The accurate pyr-Gal4 expression patterns in flies were
confirmed by comparing the observed patterns with the published pyr
mRNA in-situ hybridization patterns46,63 (Supplementary Fig. 3B–E).
Immunohistochemistry. All immunostainings were carried out following proto-
cols described in20. Antibodies used in this study: α-Discs large (1:100 DSHB 4F3),
α-PH3 (1:2000 Cell Signaling Technology 9701), α-dpERK (1:250 Sigma Aldrich
M-8159), α-Ct (1:50 DSHB 2B10), α-Shotgun (1:50 DSHB DCAD2), α-Arm (1:100
DSHB N2 7A1), α-Wg (1:50 DSHB 4D4), α-Vg (1:200 Gift from Kirsten Guss), α-
Twi (1:2000 gift from S. Roth), Phalloidin-iFlor 647 and Phalloidin-iFlor 555
(1:2000 Abcam ab176756 and ab176759, respectively). Alexa Fluor-conjugated
secondary antibodies (1:1000, Thermo Fisher Scientific) were used for immuno-
fluorescence detection (see Supplementary Table 3 for details).
Mosaic analyses. To generate FLP-out clones of AMPs of various genotypes,
females of hsflp; htl>FRT>stop>FRT>Gal4; UAS-X flies (X=UAS-CD8:GFP, UAS-
CD8:RFP, UAS-nls:GFP or UAS-Lifeact:GFP) were crossed to w1118 (control), UAS-
diaRNAi (for dia knockdown), or UAS-htlRNAi (for htl knockdown) male flies.
Crosses were reared at room temperature and clones were induced by heat shock
following standard methods prior to analyses as described in ref. 20.
Electron microscopy. After careful dissection from larvae, wing discs from w1118
larvae were immersed in a fixative mixture of 2.5% glutaraldehyde (GA) and 2.5%
paraformaldehyde (PFA) in 0.1 M sodium cacodylate buffer, pH 7.4 at room
temperature for at least 60 min. Buffer washes (0.1 M sodium cacodylate) to
remove excess initial fixative preceded a 60 min secondary fixation in 1% osmium
tetroxide reduced with 1% ferrocyanide64 in 0.1 M sodium cacodylate buffer. After
washing in distilled water, the discs were placed in 2% aqueous uranyl acetate for
60 min before dehydrating in an ascending series of ethanol (35–100%). The discs
were then infiltrated with propylene oxide, low viscosity epoxy resin series before
polymerization of the resin at 70 °C for 8–12 h. Thin sections (60–90 nm) were cut
from the polymerized blocks with a Reichert-Jung Ultracut E ultramicrotome,
placed on 200 mesh copper grids, and stained with 0.2% lead citrate65. Images were
recorded at 80 kV on a Hitachi HT7700 transmission electron microscope.
Live imaging of ex-vivo cultured wing discs. Long-term live imaging of ex-vivo
cultured wing discs was performed using a custom-built 3D-printed imaging
chamber following Barbosa and Kornberg66. Wing discs were carefully dissected in
WM1 media and cultured within a 3D-printed imaging chamber placed over a
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z ARTICLE
NATURE COMMUNICATIONS | (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications 15
Content courtesy of Springer Nature, terms of use apply. Rights reserved

glass-bottom dish. Wing discs were oriented to face the peripodial side toward the
glass-bottom imaging surface for better AMP cytoneme detection deep inside the
tissue. Time-lapse movies were captured at 1 min intervals using a 40× oil objective
(1.4NA) in a spinning disc confocal microscope.
Light microscopy and image processing
Spinning disc and line-scanning confocal. For most experiments, we used a Yoko-
gawa CSUX1 spinning disc confocal system equipped with an iXon 897 EMCCD
camera and Zeiss LSM 900 with Airyscan 2 and GaAsP detectors. Images were
resolved using either 20× (0.5 NA), 40× (1.3 NA oil), 60× (1.4 NA oil, Spinning
disc), or 63× (1.4 NA oil for LSM Airyscan) objectives.
Triple-view line confocal. For deep-tissue high-resolution imaging within a large 3D
volume (Fig. 3B–D”), we used triple-view line-confocal microscopy as described in
Wu et al.67. Wing discs of the genotype ths-Gal4/UAS-nls:mCherry; htl-LexA/
LexO-CD2:GFP were fixed in 4% PFA, washed 3× with 0.1% PBST, and mounted
on a poly-L-lysine-coated coverslip held inside a custom-designed imaging cham-
ber (Applied Scientific Instrumentation, I-2450) with the peripodial side of the
discs facing the cover-slip (Fig. 3B). The chamber was mounted onto the micro-
scope stage and filled with 1× PBS prior to imaging. Image volumes were captured
using one 60× objective (1.2 NA water immersion lens) beneath the coverslip and
two 40× objectives (0.8 NA water dipping lenses) assembled at 90 degrees to each
other, imaging the sample from above. All three confocal views were registered and
merged with additive deconvolution to improve axial resolution and recover signals
that would otherwise be lost due to scattering42.
Image processing. All images were processed using Fiji, MATLAB, or Imaris soft-
ware. The registration and deconvolution of triple-view line confocal images were
performed with a custom-written software in MATLAB (MathWorks, R2019b,
using the Image Processing and Parallel Computing Toolboxes).
Quantitation of cell number. Cell numbers were manually counted from
sequential 25 μm thick YZ maximum intensity sections visualized in Imaris to
cover clones within the entire disc area.
Quantitation of cytonemes numbers, length, and dynamics. Cytonemes were
manually counted from the maximum intensity YZ projections derived from 25 μm
thick YZ sections taken at the center of the disc. For comparative analyses, identical
central areas from discs of different genotypes were chosen, and cytoneme counts
were normalized per 100 μm using a line drawn along the disc-AMP junction in each
YZ section. Cytoneme length represents the length between the base and tip of a
cytoneme. Niche occupancy or cytoneme density (Fig. 2I) was measured by counting
the number of cytonemes at every 5min interval from a 1400 μm2ROI in YZ
sections obtained using Imaris. Cytoneme dynamics were measured following21.
Average extension and retraction rates represent the averaged extension and
retraction rates of the observed cytoneme during its respective lifetime. The exten-
sion and retraction rate of a given cytoneme represents the positive and negative
slope respectively of the experimentally measured cytoneme-length data graph
during its lifetime. The lifetime of a cytoneme constitutes the total time for the
extension and retraction cycle of a given cytoneme during the period of observation.
Quantitation of cell polarity. The polarity of a cell/nucleus was measured by the
angle θbetween the major axis of an elliptical cell/nucleus and the disc plane
immediately under the cell/nucleus, as shown in Fig. 1G.
Quantification of colocalization of Ths:GFP on cytonemes. We used FIJI to
derive intensity profiles across Ths:GFP puncta and cytonemes from single XZ and
ZY slices and analyzed the profiles for apparent colocalization. Ths:GFP puncta
and cytonemes were colocalized to within one pixel (i.e., 97.5 nm) (Supplementary
Fig. 5D, D’). For graphs in Supplementary Fig. 5D, D’,fluorescence intensities were
normalized to the maximum intensity.
Statistics and reproducibility. Statistical analyses were performed using Vassar-
Stat and GraphPad Prism 8. p-values were determined using the unpaired two-
tailed t-test for pair-wise comparisons or the ANOVA test followed by Tukey’s
honestly significant difference (HSD) test for comparison of multiple groups.
Differences were considered significant when p-values were <0.05. All measure-
ments were obtained from at least three independent experiments. All graphs and
kymographs were generated using GraphPad Prism 8.
Reporting summary. Further information on research design is available in the Nature
Research Reporting Summary linked to this article.
Data availability
The data generated in this study are provided in the Main Article and
associated Supplementary Information. Source data are provided with this paper.
Code availability
The code for triple-view image/movie is available at the following link: https://
github.com/hroi-aim/multiviewSR.
Received: 3 September 2021; Accepted: 2 February 2022;
References
1. Yamashita, Y. M., Yuan, H., Cheng, J. & Hunt, A. J. Polarity in stem cell
division: asymmetric stem cell division in tissue homeostasis. Cold Spring
Harb. Perspect. Biol. 2, a001313 (2010).
2. Losick, V. P., Morris, L. X., Fox, D. T. & Spradling, A. Drosophila stem cell
niches: a decade of discovery suggests a unified view of stem cell regulation.
Dev. Cell 21, 159–171 (2011).
3. Florian, M. C. & Geiger, H. Concise review: polarity in stem cells, disease, and
aging. Stem Cells 28, 1623–1629 (2010).
4. Morrison, S. J. & Spradling, A. C. Stem cells and niches: mechanisms that
promote stem cell maintenance throughout life. Cell 132, 598–611 (2008).
5. Venkei, Z. G. & Yamashita, Y. M. Emerging mechanisms of asymmetric stem
cell division. J. Cell Biol. 217, 3785–3795 (2018).
6. Nystul, T. G. & Spradling, A. C. Breaking out of the mold: diversity within
adult stem cells and their niches. Curr. Opin. Genet. Dev. 16, 463–468 (2006).
7. Li, L. & Xie, T. Stem cell niche: structure and function. Annu. Rev. Cell Dev.
Biol. 21, 605–631 (2005).
8. Zhang, J. & Li, L. Stem cell niche: microenvironment and beyond. J. Biol.
Chem. 283, 9499–9503 (2008).
9. Rompolas, P., Mesa, K. R. & Greco, V. Spatial organization within a niche as a
determinant of stem-cell fate. Nature 502, 513–518 (2013).
10. Yu, F., Kuo, C. T. & Jan, Y.-N. Drosophila neuroblast asymmetric cell division:
recent advances and implications for stem cell biology. Neuron 51,13–20 (2006).
11. Yamashita, Y. M., Fuller, M. T. & Jones, D. L. Signaling in stem cell niches:
lessons from the Drosophila germline. J. Cell Sci. 118, 665–672 (2005).
12. Buszczak, M., Inaba, M. & Yamashita, Y. M. Signaling by cellular protrusions:
keeping the conversation private. Trends Cell Biol. 26, 526–534 (2016).
13. Habib, S. J. et al. A localized Wnt signal orients asymmetric stem cell division
in vitro. Science 339, 1445–1448 (2013).
14. Ramírez-Weber, F. A. & Kornberg, T. B. Cytonemes: cellular processes that
project to the principal signaling center in Drosophila imaginal discs. Cell 97,
599–607 (1999).
15. Roy, S., Huang, H., Liu, S. & Kornberg, T. B. Cytoneme-mediated contact-
dependent transport of the Drosophila decapentaplegic signaling protein.
Science 343, 1244624–1244624 (2014).
16. Kornberg, T. B. & Roy, S. Communicating by touch-neurons are not alone.
Trends Cell Biol. 24, 370–376 (2014).
17. Roy, S., Hsiung, F. & Kornberg, T. B. Specificity of Drosophila cytonemes for
distinct signaling pathways. Science 332, 354–358 (2011).
18. Bischoff, M. et al. Cytonemes are required for the establishment of a normal
Hedgehog morphogen gradient in Drosophila epithelia. Nat. Cell Biol. 15,
1269–1281 (2013).
19. Stanganello, E. & Scholpp, S. Role of cytonemes in Wnt transport. J. Cell Sci.
129, 665–672 (2016).
20. Du, L., Sohr, A., Yan, G. & Roy, S. Feedback regulation of cytoneme-mediated
transport shapes a tissue-specific FGF morphogen gradient. Elife 7, e38137
(2018).
21. Du, L., Sohr, A. & Roy, S. GPI-anchored FGF directs cytoneme-mediated
bidirectional signaling to self-regulate tissue-specific dispersion. Preprint at
bioRxiv https://doi.org/10.1101/2021.02.23.432493 (2021).
22. Hall, E. T. et al. Cytoneme delivery of Sonic Hedgehog from ligand-producing
cells requires Myosin 10 and a Dispatched-BOC/CDON co-receptor complex.
Elife 10, e61432 (2021).
23. Kornberg, T. B. & Roy, S. Cytonemes as specialized signaling filopodia.
Development 141, 729–736 (2014).
24. Zhang, C. & Scholpp, S. Cytonemes in development. Curr. Opin. Genet. Dev.
57,25–30 (2019).
25. González-Mendez, L., Gradilla, A.-C. & Guerrero, I. The cytoneme
connection: direct long-distance signal transfer during development.
Development 146, dev174607 (2019).
26. Rojas-Rios, P., Guerrero, I. & Gonzalez-Reyes, A. Cytoneme-mediated delivery
of hedgehog regulates the expression of bone morphogenetic proteins to
maintain germline stem cells in Drosophila. PLoS Biol. 10, e1001298–13
(2012).
27. Inaba, M., Buszczak, M. & Yamashita, Y. M. Nanotubes mediate niche-stem-
cell signalling in the Drosophila testis. Nature 523, 329–332 (2015).
28. Junyent, S. et al. Specialized cytonemes induce self-organization of stem cells.
Proc. Natl Acad. Sci. USA 117, 7236–7244 (2020).
ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z
16 NATURE COMMUNICATIONS | (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications
Content courtesy of Springer Nature, terms of use apply. Rights reserved

29. Fernandes, J., Bate, M. & VijayRaghavan, K. Development of the indirect flight
muscles of Drosophila. Development 113,67–77 (1991).
30. Gunage, R. D., Reichert, H. & VijayRaghavan, K. Identification of a new stem
cell population that generates Drosophila flight muscles. Elife 3, e03126 (2014).
31. Bate, M., Rushton, E. & Currie, D. A. Cells with persistent twist expression are
the embryonic precursors of adult muscles in Drosophila. Development 113,
79–89 (1991).
32. Roy, S. & VijayRaghavan, K. Muscle pattern diversification in Drosophila: the
story of imaginal myogenesis. Bioessays 21, 486–498 (1999).
33. Sudarsan, V., Anant, S., Guptan, P., VijayRaghavan, K. & Skaer, H. Myoblast
diversification and ectodermal signaling in Drosophila. Dev. Cell 1, 829–839
(2001).
34. Gunage, R. D., Dhanyasi, N., Reichert, H. & VijayRaghavan, K. Drosophila
adult muscle development and regeneration. Semin. Cell Dev. Biol. 72,56–66
(2017).
35. Vishal, K., Lovato, T. L., Bragg, C., Chechenova, M. B. & Cripps, R. M. FGF
signaling promotes myoblast proliferation through activation of wingless
signaling. Dev. Biol. 464,1–10 (2020).
36. Huang, H. & Kornberg, T. B. Myoblast cytonemes mediate Wg signaling from
the wing imaginal disc and Delta-Notch signaling to the air sac primordium.
Elife 4, e06114 (2015).
37. Wood, B. M. et al. Cytonemes with complex geometries and composition
extend into invaginations of target cells. J. Cell Biol. 220, e202101116 (2021).
38. Sato, M. & Kornberg, T. B. FGF is an essential mitogen and chemoattractant
for the air sacs of the drosophila tracheal system. Dev. Cell 3, 195–207 (2002).
39. Guha, A., Lin, L. & Kornberg, T. B. Regulation of Drosophila matrix
metalloprotease Mmp2 is essential for wing imaginal disc:trachea association
and air sac tubulogenesis. Dev. Biol. 335, 317–326 (2009).
40. Abmayr, S. M. & Pavlath, G. K. Myoblast fusion: lessons from flies and mice.
Development 139, 641–656 (2012).
41. Anant, S., Roy, S. & VijayRaghavan, K. Twist and Notch negatively regulate
adult muscle differentiation in Drosophila. Development 125, 1361–1369
(1998).
42. Wu, Y. et al. Multiview super-resolution microscopy. Nature 600, 279–284
(2021).
43. Macpherson, L. J. et al. Dynamic labelling of neural connections in multiple
colours by trans-synaptic fluorescence complementation. Nat. Commun. 6,
10024 (2015).
44. Leikina, E. et al. Myomaker and Myomerger work independently to control
distinct steps of membrane remodeling during myoblast fusion. Dev. Cell 46,
767–780.e7 (2018).
45. Deng, S., Bothe, I. & Baylies, M. K. The formin diaphanous regulates myoblast
fusion through actin polymerization and Arp2/3 regulation. PLoS Genet. 11,
e1005381 (2015).
46. Stathopoulos, A., Tam, B., Ronshaugen, M., Frasch, M. & Levine, M. pyramus
and thisbe: FGF genes that pattern the mesoderm of Drosophila embryos.
Genes Dev. 18, 687–699 (2004).
47. Sarov, M. et al. A genome-wide resource for the analysis of protein localisation
in Drosophila. Elife 5, e12068 (2016).
48. Everetts, N. J., Worley, M. I., Yasutomi, R., Yosef, N. & Hariharan, I. K. Single-
cell transcriptomics of the Drosophila wing disc reveals instructive
epithelium-to-myoblast interactions. Elife 10, e61276 (2021).
49. Losick, V. P., Morris, L. X., Fox, D. T. & Spradling, A. Drosophila stem cell
niches: a decade of discovery suggests a unified view of stem cell regulation.
Dev. Cell 21, 159–171 (2011).
50. Stepanik, V., Sun, J. & Stathopoulos, A. FGF pyramus has a transmembrane
domain and cell-autonomous function in Polarity. Curr. Biol.https://doi.org/
10.1016/j.cub.2020.06.006 (2020).
51. Aradhya, R., Zmojdzian, M., Da Ponte, J. P. & Jagla, K. Muscle niche-driven
insulin-Notch-Myc cascade reactivates dormant adult muscle precursors in
Drosophila. Elife 4, e08497 (2015).
52. Segal, D., Dhanyasi, N., Schejter, E. D. & Shilo, B.-Z. Adhesion and fusion of
muscle cells are promoted by filopodia. Dev. Cell 38, 291–304 (2016).
53. González-Mendez, L. et al. Polarized sorting of patched enables cytoneme-
mediated Hedgehog reception in the Drosophila wing disc. EMBO J. 124,
e103629 (2020).
54. Huang, H., Liu, S. & Kornberg, T. B. Glutamate signaling at cytoneme
synapses. Science 363, 948–955 (2019).
55. Hatori, R. & Kornberg, T. B. Hedgehog produced by the Drosophila wing
imaginal disc induces distinct responses in three target tissues. Development
147, dev195974 (2020).
56. Hatori, R., Wood, B. M., Oliveira Barbosa, G. & Kornberg, T. B. Regulated
delivery controls Drosophila Hedgehog, wingless, and decapentaplegic
signaling. Elife 10, e71744 (2021).
57. Mossahebi-Mohammadi, M., Quan, M., Zhang, J.-S. & Li, X. FGF signaling
pathway: a key regulator of stem cell pluripotency. Front. Cell Dev. Biol. 8,79
(2020).
58. Huang, Y. et al. Type 2 fibroblast growth factor receptor signaling preserves
stemness and prevents differentiation of prostate stem cells from the basal
compartment. J. Biol. Chem. 290, 17753–17761 (2015).
59. Du, L. et al. Unique patterns of organization and migration of FGF-expressing
cells during Drosophila morphogenesis. Dev. Biol. 427,35–48 (2017).
60. Gratz, S. J. et al. Highly specific and efficient CRISPR/Cas9-catalyzed
homology-directed repair in Drosophila. Genetics 196, 961–971 (2014).
61. Port, F., Chen, H. M., Lee, T. & Bullock, S. L. An optimized CRISPR/Cas
toolbox for efficient germline and somatic genome engineering in Drosophila.
Proc. Natl. Acad. Sci. 111, E2967–E2976 (2014).
62. Du, L., Zhou, A., Sohr, A. & Roy, S. An efficient strategy for generating tissue-
specific binary transcription systems in Drosophila by genome editing. J. Vis.
Exp. https://doi.org/10.3791/58268 (2018).
63. Yang, S. et al. FGF signaling directs myotube guidance by regulating Rac
activity. Development 147, dev183624 (2020).
64. Rivlin, P. K. & Raymond, P. A. Use of osmium tetroxide-potassium
ferricyanide in reconstructing cells from serial ultrathin sections. J. Neurosci.
Methods 20,23–33 (1987).
65. Venable, J. H. & Coggeshall, R. A simplified lead citrate stain for use in
electron microscopy. J. Cell Biol. 25, 407–408 (1965).
66. Barbosa, G. O. & Kornberg, T. B. Protocol for ex vivo time lapse imaging of
Drosophila melanogaster cytonemes. STAR Protoc. https://doi.org/10.1016/
j.xpro.2022.101138 (2022).
67. Wu, Y. et al. Multiview confocal super-resolution microscopy. Nature.https://
doi.org/10.1038/s41586-021-04110-0 (2021).
Acknowledgements
We thank Drs. T.B. Kornberg, G.M. Rubin, K.A. Guss, and S. Roth for sharing reagents;
Drs. N. Andrews (U. Maryland), L. Du (U. Maryland), and T. Kornberg (UCSF) for
comments on the manuscript; Drs. T.B. Kornberg and G.O. Barbosa (UCSF) for sharing
the design of the culture chamber for live imaging. A.P. acknowledges a fellowship from
UMD CMNS Dean’s Matching Award for T32 GM080201; This work was funded by
NIH R35GM124878 and R35GM124878-03S1 grants to SR and intramural funding from
NIBIB-NIH to H.S.
Author contributions
S.R. supervised the work and designed the project; H.S. supervised Multiview micro-
scopy; T.M. supervised TEM; A.P. conducted all experiments, and Y.W., X.H., and Y.S.
conducted experiments with Multiview microscopy; S.R., A.P., H.S., Y.W., and T.M.
contributed to writing the paper.
Competing interests
The authors declare no competing interests.
Additional information
Supplementary information The online version contains supplementary material
available at https://doi.org/10.1038/s41467-022-28587-z.
Correspondence and requests for materials should be addressed to Sougata Roy.
Peer review information Nature Communications thanks Steffen Scholpp and the other,
anonymous, reviewer(s) for their contribution to the peer review of this work. Peer
reviewer reports are available.
Reprints and permission information is available at http://www.nature.com/reprints
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
Open Access This article is licensed under a Creative Commons
Attribution 4.0 International License, which permits use, sharing,
adaptation, distribution and reproduction in any medium or format, as long as you give
appropriate credit to the original author(s) and the source, provide a link to the Creative
Commons license, and indicate if changes were made. The images or other third party
material in this article are included in the article’s Creative Commons license, unless
indicated otherwise in a credit line to the material. If material is not included in the
article’s Creative Commons license and your intended use is not permitted by statutory
regulation or exceeds the permitted use, you will need to obtain permission directly from
the copyright holder. To view a copy of this license, visit http://creativecommons.org/
licenses/by/4.0/.
© The Author(s) 2022
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-022-28587-z ARTICLE
NATURE COMMUNICATIONS | (2022) 13:1185 | https://doi.org/10.1038/s41467-022-28587-z | www.nature.com/naturecommunications 17
Content courtesy of Springer Nature, terms of use apply. Rights reserved

1.
2.
3.
4.
5.
6.
Terms and Conditions
Springer Nature journal content, brought to you courtesy of Springer Nature Customer Service Center GmbH (“Springer Nature”).
Springer Nature supports a reasonable amount of sharing of research papers by authors, subscribers and authorised users (“Users”), for small-
scale personal, non-commercial use provided that all copyright, trade and service marks and other proprietary notices are maintained. By
accessing, sharing, receiving or otherwise using the Springer Nature journal content you agree to these terms of use (“Terms”). For these
purposes, Springer Nature considers academic use (by researchers and students) to be non-commercial.
These Terms are supplementary and will apply in addition to any applicable website terms and conditions, a relevant site licence or a personal
subscription. These Terms will prevail over any conflict or ambiguity with regards to the relevant terms, a site licence or a personal subscription
(to the extent of the conflict or ambiguity only). For Creative Commons-licensed articles, the terms of the Creative Commons license used will
apply.
We collect and use personal data to provide access to the Springer Nature journal content. We may also use these personal data internally within
ResearchGate and Springer Nature and as agreed share it, in an anonymised way, for purposes of tracking, analysis and reporting. We will not
otherwise disclose your personal data outside the ResearchGate or the Springer Nature group of companies unless we have your permission as
detailed in the Privacy Policy.
While Users may use the Springer Nature journal content for small scale, personal non-commercial use, it is important to note that Users may
not:
use such content for the purpose of providing other users with access on a regular or large scale basis or as a means to circumvent access
control;
use such content where to do so would be considered a criminal or statutory offence in any jurisdiction, or gives rise to civil liability, or is
otherwise unlawful;
falsely or misleadingly imply or suggest endorsement, approval , sponsorship, or association unless explicitly agreed to by Springer Nature in
writing;
use bots or other automated methods to access the content or redirect messages
override any security feature or exclusionary protocol; or
share the content in order to create substitute for Springer Nature products or services or a systematic database of Springer Nature journal
content.
In line with the restriction against commercial use, Springer Nature does not permit the creation of a product or service that creates revenue,
royalties, rent or income from our content or its inclusion as part of a paid for service or for other commercial gain. Springer Nature journal
content cannot be used for inter-library loans and librarians may not upload Springer Nature journal content on a large scale into their, or any
other, institutional repository.
These terms of use are reviewed regularly and may be amended at any time. Springer Nature is not obligated to publish any information or
content on this website and may remove it or features or functionality at our sole discretion, at any time with or without notice. Springer Nature
may revoke this licence to you at any time and remove access to any copies of the Springer Nature journal content which have been saved.
To the fullest extent permitted by law, Springer Nature makes no warranties, representations or guarantees to Users, either express or implied
with respect to the Springer nature journal content and all parties disclaim and waive any implied warranties or warranties imposed by law,
including merchantability or fitness for any particular purpose.
Please note that these rights do not automatically extend to content, data or other material published by Springer Nature that may be licensed
from third parties.
If you would like to use or distribute our Springer Nature journal content to a wider audience or on a regular basis or in any other manner not
expressly permitted by these Terms, please contact Springer Nature at
onlineservice@springernature.com