ArticlePDF Available

SUCNR1 Mediates the Priming Step of the Inflammasome in Intestinal Epithelial Cells: Relevance in Ulcerative Colitis

Authors:

Abstract and Figures

Intestinal epithelial cells (IECs) constitute a defensive physical barrier in mucosal tissues and their disruption is involved in the etiopathogenesis of several inflammatory pathologies, such as Ulcerative Colitis (UC). Recently, the succinate receptor SUCNR1 was associated with the activation of inflammatory pathways in several cell types, but little is known about its role in IECs. We aimed to analyze the role of SUCNR1 in the inflammasome priming and its relevance in UC. Inflammatory and inflammasome markers and SUCNR1 were analyzed in HT29 cells treated with succinate and/or an inflammatory cocktail and transfected with SUCNR1 siRNA in a murine DSS model, and in intestinal resections from 15 UC and non-IBD patients. Results showed that this receptor mediated the inflammasome, priming both in vitro in HT29 cells and in vivo in a murine chronic DSS-colitis model. Moreover, SUNCR1 was also found to be involved in the activation of the inflammatory pathways NFкB and ERK pathways, even in basal conditions, since the transient knock-down of this receptor significantly reduced the constitutive levels of pERK-1/2 and pNFкB and impaired LPS-induced inflammation. Finally, UC patients showed a significant increase in the expression of SUCNR1 and several inflammasome components which correlated positively and significantly. Therefore, our results demonstrated a role for SUCNR1 in basal and stimulated inflammatory pathways in intestinal epithelial cells and suggested a pivotal role for this receptor in inflammasome activation in UC.
Content may be subject to copyright.


Citation: Bauset, C.; Lis-Lopez, L.;
Coll, S.; Gisbert-Ferrándiz, L.;
Macias-Ceja, D.C.; Seco-Cervera, M.;
Navarro, F.; Esplugues, J.V.;
Calatayud, S.; Ortiz-Masia, D.; et al.
SUCNR1 Mediates the Priming Step
of the Inflammasome in Intestinal
Epithelial Cells: Relevance in
Ulcerative Colitis. Biomedicines 2022,
10, 532. https://doi.org/10.3390/
biomedicines10030532
Academic Editor: Ariella
Bar-Gil Shitrit
Received: 21 January 2022
Accepted: 22 February 2022
Published: 24 February 2022
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
Copyright: © 2022 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
biomedicines
Article
SUCNR1 Mediates the Priming Step of the Inflammasome in
Intestinal Epithelial Cells: Relevance in Ulcerative Colitis
Cristina Bauset 1, Lluis Lis-Lopez 1, Sandra Coll 1, Laura Gisbert-Ferrándiz 1, Dulce C. Macias-Ceja 1,
Marta Seco-Cervera 2, Francisco Navarro 3, Juan V. Esplugues 1,2,4, Sara Calatayud 1,4 ,
Dolores Ortiz-Masia 4, 5, * , Maria D. Barrachina 1,4 and Jesús Cosín-Roger 2, 4, *
1Departamento de Farmacología, Facultad de Medicina, Universidad de Valencia, 46010 Valencia, Spain;
cristina.bauset@uv.es (C.B.); lluislis@alumni.uv.es (L.L.-L.); sandra.coll@uv.es (S.C.);
laura.gisbert@uv.es (L.G.-F.); macias.dcc@gmail.com (D.C.M.-C.); juan.v.esplugues@uv.es (J.V.E.);
sara.calatayud@uv.es (S.C.); dolores.barrachina@uv.es (M.D.B.)
2Hospital Dr. Peset, FISABIO, 46017 Valencia, Spain; marta.seco@uv.es
3Hospital de Manises, 46940 Valencia, Spain; fran.navarro.vicente@gmail.com
4CIBERehd, 28029 Madrid, Spain
5Departamento de Medicina, Facultad de Medicina, Universidad de Valencia, 46010 Valencia, Spain
*Correspondence: m.dolores.ortiz@uv.es (D.O.-M.); jesus.cosin@uv.es (J.C.-R.)
Abstract:
Intestinal epithelial cells (IECs) constitute a defensive physical barrier in mucosal tissues
and their disruption is involved in the etiopathogenesis of several inflammatory pathologies, such as
Ulcerative Colitis (UC). Recently, the succinate receptor SUCNR1 was associated with the activation
of inflammatory pathways in several cell types, but little is known about its role in IECs. We aimed to
analyze the role of SUCNR1 in the inflammasome priming and its relevance in UC. Inflammatory
and inflammasome markers and SUCNR1 were analyzed in HT29 cells treated with succinate and/or
an inflammatory cocktail and transfected with SUCNR1 siRNA in a murine DSS model, and in
intestinal resections from 15 UC and non-IBD patients. Results showed that this receptor mediated the
inflammasome, priming both
in vitro
in HT29 cells and
in vivo
in a murine chronic DSS-colitis model.
Moreover, SUNCR1 was also found to be involved in the activation of the inflammatory pathways
NFкB and ERK pathways, even in basal conditions, since the transient knock-down of this receptor
significantly reduced the constitutive levels of pERK-1/2 and pNFкB and impaired LPS-induced
inflammation. Finally, UC patients showed a significant increase in the expression of SUCNR1 and
several inflammasome components which correlated positively and significantly. Therefore, our
results demonstrated a role for SUCNR1 in basal and stimulated inflammatory pathways in intestinal
epithelial cells and suggested a pivotal role for this receptor in inflammasome activation in UC.
Keywords: Ulcerative Colitis; SUCNR1; epithelial cells
1. Introduction
Intestinal epithelial cells (IECs) are pivotal cells in the maintenance of mucosal integrity.
They do so by forming a physical barrier, acting as sensors for damage- or pathogen-
associated molecular patterns and regulating immune cells [
1
]. The activation of the pattern
recognition receptors in these cells stimulates several intracellular signaling pathways,
such as NFкB and MAPKs pathways, which, in turn, induce the release of chemokines
and interleukins [
2
]. In the gastrointestinal tract, the disturbance of the epithelial barrier
allows for interaction between microbiota, dietary antigens and other compounds with
the immune system, which have been involved in the etiopathogenesis of Inflammatory
Bowel Disease (IBD) [
3
]. Ulcerative Colitis (UC) is a subtype of IBD characterized by
a diffuse, continuous and chronic inflammation limited to the mucosa and submucosa
layers of the colon. Given the increasing incidence and prevalence in both developed
and developing countries, UC has become a public health challenge worldwide [
4
] whose
Biomedicines 2022,10, 532. https://doi.org/10.3390/biomedicines10030532 https://www.mdpi.com/journal/biomedicines
Biomedicines 2022,10, 532 2 of 19
etiology is widely unknown [
5
,
6
]. Among all the molecular pathways involved in the
activation of inflammation described so far, the inflammasome complex has recently come
to be considered a critical regulator of intestinal homeostasis [7,8].
Inflammasomes constitute a group of cytosolic protein complexes whose main func-
tion is to recognize exogenous microbes and danger-associated endogenous components.
The activation of these complexes triggers the proteolytic cleavage of pro-Caspase-1 and
the production of IL-1
β
and IL-18, which in turn, starts the inflammatory and immune
responses [
9
,
10
]. Although several types of inflammasomes have been described so far,
including NLRP1, NLRP2, NLRP3, NLRC4 and AIM2, the most characterized and stud-
ied has been NLRP3, due to its clinical importance in a wide range of pathologies, such
as atherosclerosis, diabetes or IBD [
11
]. In order to induce a complete activation of the
inflammasome, a mechanism of two consecutive steps occurs. During the first step, called
priming, there is an induction of the transcriptional expression of the central components
of the inflammasome such as NLRP3, ASC, IL-1
β
and IL18. Next, in the second step, called
activation or triggering, the complete activity of the NLRP3 inflammasome is promoted
and, subsequently, the activation of the pro-Caspase-1 and the release of IL-1
β
occur [
12
].
Of interest, a key role of NLRP3 inflammasome has been described in several chronic
inflammatory pathologies, including UC. In fact, the importance of NLRP3 in UC patients
has been demonstrated by the presence of some SNPs in NLRP3 gene, such as rs10754558
and rs10925019, which are associated with a higher susceptibility of this pathology [
13
].
However, the specific role of NLRP3 in UC is still unclear, since controversial results have
been reported in murine models of colitis. Some studies in NLRP3 knock-out mice showed
protection in TNBS, DSS and oxazolone models of colitis [
14
16
], whereas others have
described a detrimental or worse colitis in the same knock-out mice [
17
19
]. These discrep-
ancies have been explained by two theories: the differences in the intestinal microbiota
of these mice [
20
] or the cell-specific role of NLRP3 inflammasomes. In fact, while, in
epithelial cells, it should help in the maintenance of homeostasis, its activation in immune
cells might have a harmful effect [
21
]. Therefore, further studies are required in order
to better elucidate the specific role of NLRP3 in the pathogenesis of UC and identify the
pathways that prime NLRP3 inflammasomes.
In recent years, succinate, an intermediate metabolite of the tricarboxylic acid (TCA)
cycle, acting through the G-protein-coupled receptor SUCNR1, has been involved in several
inflammatory and metabolic pathologies [
22
26
]. This receptor, initially named GPR91,
is expressed in several cell types, such as hepatic stellate cells, cardiomyocytes, platelets,
dendritic cells, macrophages, epithelial cells and fibroblasts, and is found in several tissues,
including liver, heart, kidney, retina, immune system and the gastrointestinal tract [
27
].
The binding of succinate to SUCNR1 triggers occurs as follows: the displacement of the
GDP by GTP, the release of the
α
subunit and the
βγ
dimer and the induction of different
downstream signaling pathways. The activation of one signaling pathway via both
α
and/or
βγ
subunits seems to be cell and tissue-specific; in cardiomyocytes, the
α
subunit
increases the cAMP levels and activates the PKA, whereas in adipose tissue, it reduces the
cAMP levels. Regarding the
βγ
dimer, it activates the PI3K-Akt-Src in platelets, while it
phosphorylates ERK-1/2 in dendritic cells [
28
]. The specific role of this receptor in immune
cells has been extensively analyzed and both proinflammatory and anti-inflammatory
effects have been reported [
29
]. On the one hand, SUCNR1 amplifies the release of IL-1
β
from macrophages [
30
], enhances the chemotaxis in white adipose tissue of monocyte-
derived macrophages [
31
] and can also decrease the expression of IL10, TLR4 and TLR5
and increase the expression of TNF-
α
in peripheral blood mononuclear cells [
32
]. On the
other hand, SUCNR1 promotes an anti-inflammatory effect through PKA–CREB–KLF4
pathways in adipose tissue macrophages [
33
]. Nevertheless, no information is available
about the role of SUCNR1 in epithelial cells.
In the present study, we aimed to analyze the role of SUCNR1 in the priming step of
the inflammasome activation in intestinal epithelial cells, and its relevance in colitis. Results
demonstrated, for the first time, that SUCNR1 mediated NLRP3 priming in both intestinal
Biomedicines 2022,10, 532 3 of 19
epithelial cells and a murine model of DSS-colitis, and that this receptor correlated with
inflammasome markers in human UC.
2. Materials and Methods
2.1. Patients
Intestinal resections from UC patients with severe refractory disease state who un-
derwent surgery were obtained. In the case of non-IBD patients, nondamaged mucosa of
colonic resections from patients with colorectal cancer were used as controls. The informa-
tion on all the patients analyzed in this study is summarized in Table 1. The study was
approved by the Institutional Review Board of the Hospital of Manises (Valencia, Spain).
Written informed consent was obtained from all participating patients.
Table 1. Information about UC and Non-IBD patients.
Ulcerative Colitis Patients Non-IBD Patients
Number of patients 25 30
Age
Median 47 54
Interval (17–69) (18–85)
Gender
Male 13 (52%) 18 (60%)
Female 12 (48%) 12 (40%)
Localization
Pancolitis 10 (40%)
Distal Colitis 5 (20%)
Proctosigmoiditis 10 (40%)
Treatment
Azathioprine 4
Corticoids 7
Anti-Inflammatory Drugs 6
Mesalazine 6
Budesonide 1
2.2. Mice
To perform
in vivo
experiments, wild type (WT) C57Bl/6 and SUCNR1
/
mice
(9–12 weeks old, 20–25 g weight, kindly provided by Dr. Kenneth McCreath and Dr.
Ana Cervera) bred into a C57Bl/6 background [
34
] were used. In all cases, mice were
co-housed to reduce possible differences in microbiota and maintained under a defined
pathogen-free environment. The institutional animal care and use committees of University
of Valencia approved all protocols. All experiments were performed in compliance with the
European Animal Research Law (European Communities Council Directives 2010/63/EU,
90/219/EEC, Regulation (EC) No. 1946/2003), and Generalitat Valenciana (Artículo 31,
Real Decreto 53/2013).
2.3. Introduction of Experimental DSS Colitis in Mice
Male 6–8-week-old C57Bl/6, and SUCNR1
/
mice received vehicle or Dextran
Sulfate Sodium (DSS, 40 kDa, Sigma-Aldrich, St. Louis, MO, USA) via their drinking water
solution with 4 cycles of increasing percentages of DSS (1%, 1%, 1.5% and 1.5%) over
7 days,
intercalated by 10 days with water. Hence, there were a total of four groups: WT vh, WT
DSS, SUCNR1
/
vh and SUCNR1
/
DSS (n= 10 mice per group). Body weight and
clinical signs of disease were recorded from day 1. At the end of the last cycle, on day 60,
mice were properly handled and euthanized, and colon tissue samples were collected for
further analysis.
Biomedicines 2022,10, 532 4 of 19
2.4. Cell Culture
HT29 cells (American Type Culture Collection, Manassas, VA, USA) were used to
perform
in vitro
experiments. McCoy’s Medium Modified (Sigma-Aldrich, Madrid, Spain),
supplemented with 100 U/mL penicillin, 100
µ
g/mL streptomycin, 2 mM L-glutamine
and 10% inactivated FBS, was used to culture these cells. Depending on the experiment,
HT29 cells
were treated for 24 h with LPS 0.1
µ
g/mL, succinate 1 mM, the MEK inhibitor
U0126 10
µ
M or an inflammatory cocktail containing TNF-
α
25 ng/mL, IFN-
γ
20 ng/mL,
LPS 1 µg/mL.
2.5. Small Interfering (siRNA) Transfection
HT29 cells were transfected using a control siRNA (siCtrl) and a specific SUCNR1
siRNA (Invitrogen Life Technologies, Barcelona, Spain) at a concentration of 20 pmol.
Lipofectamine-2000 (Invitrogen Life Technologies, Barcelona, Spain) was also used follow-
ing the manufacturer’s instructions. Gene and protein expression of SUCNR1 was analyzed
by qPCR and Western Blot in order to determine the efficiency of the transfection.
2.6. Protein Extraction and Western Blot Analysis
Protein was isolated from HT29 cells, colons of mice and human intestinal resections, as
previously described [
35
]. Western Blot was performed to analyze protein expression. SDS-
PAGE gels were used and equal amounts of protein were loaded. Then, proteins were trans-
ferred to nitrocellulose membranes, which were further incubated with specific primary
antibodies (detailed in Table 2) as well as the secondary antibodies peroxidase-conjugated
anti-rabbit IgG (Thermo Scientific, Waltham, MA, USA, 1:5000) or anti-mouse IgG (In-
vitrogen, Waltham, MA, USA, 1:2000). Protein bands were detected with Immobilon
®
Forte Western HRP Substrate (Millipore, Burlington, MA, USA) or Immobilon
®
Crescendo
Western HRP Substrate in AMERSHAM ImageQuant 800 (GE lifescience, Cornellàde Llo-
bregat, Spain). To normalize protein bands, Glyceraldehyde 3-phosphate dehydrogenase
(GAPDH) was used as housekeeping and Multi Gauge V3.0 software (Fujifilm Life Sciences,
Cambridge, MA, USA) was used to quantify the densitometry of the bands.
Table 2. Primary antibodies used for Western Blot analysis.
Antibody Supplier Dilution
NLRP3 13158, Cell Signaling 1:1000
Caspase-1 2225, Cell Signaling 1:1000
Cleaved Caspase-1 (Asp297)
4199, Cell Signaling 1:1000
Phospho-NFкB 3033S, Cell Signaling 1:1000
NFкB 8242S, Cell Signaling 1:1000
Phospho-ERK 9104, Cell Signaling 1:1000
ERK 4695, Cell Signaling 1:1000
IкB SC-371, Santa Cruz Biotechnology 1:1000
SUCNR1 IMG-6352a, IMGENEX 1:1000
GAPDH G9545, Sigma-Aldrich 1:5000
2.7. RNA Isolation and Real-Time Quantitative PCR (RT-qPCR)
Total RNA from cells and murine and human tissues was isolated using direct-zol RNA
MiniPrep Plus R2072 from ZymoResearch according to the manufacturer’s instructions.
Mice tissue and intestinal resections were homogenated with TRI Reagent
®
(ZymoResearch,
Irvine, CA, USA), using the GentleMACS Dissociator (Milteny Biotech, Gladbach, Ger-
many) as previously described [
36
]. cDNA was obtained from previously isolated RNA
by reverse transcription PCRusing the the PrimeScript RT reagent Kit (Takara Bitechnol-
ogy, Dalian, China). Gene expression was analyzed by real-time Quantitative PCR using
SYBR
®
Ex Taq (Takara Bio Inc., Saint-Germain-en-Laye, France) in LightCycler thermo-
cycler (Roche Diagnostics, Mannheim, Germany). Specific oligonucleotides detailed in
Tables 3and 4were designed to perform the analysis. The relative gene expression, as
Biomedicines 2022,10, 532 5 of 19
fold increase, was expressed as follows: change in expression (fold) = 2
(
CT) where
CT = CT (target) CT
(housekeeping) and
(
CT) =
CT (treated)
CT (control),
where β-actin was the housekeeping gene used.
Table 3. Sequences of human primers used in real-time PCR.
Gene Sense (50-30) Antisense (30-50)Fragment’s
Size (bp)
IL1B GCTCGCCAGTGAAATGATGG TCGTGCACATAAGCCTCGTT 330
iNOS ATAATGGACCCCAGGCAAG TCAGCAAGCAGCAGAATGAG 195
IL6 AGTGAGGAAGCCAGAGC ATTGTGGTTGGGTCAGGGG 143
TNF-a GCTGCACTTTGGAGTGATCG GGGTTTGCTACAACATGGGC 138
NLRP3 AGAACTGTCATCGGGTGGAG AACTGGAAGTGAGGTGGCTG 174
ASC CAAACGTTGAGTGGCTGCTG GAGCTTCCGCATCTTGCTTG 107
CASP1 AGAGAAAAGCCATGGCCGAC CCTTCACCCATGGAACGGAT 70
IL18 GCTGAAGATGATGAAAACCTGGA GAGGCCGATTTCCTTGGTCA 115
SUCNR1 GGAGACC CCAACTACAACCTC AGCAACCTGCCTATTCCTCTG 132
β-actin GGACTTCGAGCAAGAGATGG AGCACTGTGTTGGCGTACAG 57
Table 4. Sequences of mouse primers used in real-time PCR.
Gene Sense (50-30) Antisense (30-50)Fragment’s
Size (bp)
Cox-2 CCCGGACTGGATTCTATGGTG TTCGCAGGAAGGGGATGTTG 153
Tnf-a GATCGGTCCCCAAAGGGATG GGTGGTTTGTGAGTGTGAGGG 86
iNos CGCTTGGGTCTTGTTCACTC GGTCATCTTGTATTGTTGGGCTG 222
Il6 ATGAGGAGACTTGCCTGGTG CTGGCATTTGTGGTTGGGTC 202
Il10 GGACAACATACTGCTAACCGAC CCTGGGGCATCACTTCTACC 110
F4/80 TGTCTGAAGATTCTCAAAACATGGA TGGAACACCACAAGAAAGTGC 211
Cd86 GCACGGACTTGAACAACCAG CCTTTGTAAATGGGCACGGC 194
Ccr7 CTCTCCACCGCCTTTCCTG ACCTTTCCCCTACCTTTTTATTCCC 125
Arginase GTGGGGAAAGCCAATGAAGAG TCAGGAGAAAGGACACAGGTTG 232
Cd16 GAAGGGGAAACCATCACGCT GCAAACAGGAGGCACATCAC 293
Col1 CAGGCTGGTGTGATGGGATT AAACCTCTCTCGCCTCTTGC 317
Col3 CTACACCTGCTCCTGTGCTTC GATAGCCACCCATTCCTCCCA 237
Col4 ATTAGCAGGTGTGCGGTTTG ATTAGCAGGTGTGCGGTTTG 289
TGFβGCGGACTACTATGCTAAAGAGG TCAAAAGACAGCCACTCAGG 295
Vimentin GCTCCTACGATTCACAGCCA CGTGTGGACGTGGTCACATA 190
Timp1 GGCATCTGGCATCCTCTTGTTG GTGGTCTCGTTGATTTCTGGGG 147
Mmp2 GCCAACTACAACTTCTTCCCC CAAAAGCATCATCCACGGTTTC 112
Nlrp3 GTACCCAAGGCTGCTATCTGG TGCAACGGACACTCGTCATC 143
Asc TGACTGTGCTTAGAGACATGGG AACTGCCTGGTACTGTCCTTC 233
Casp1 CTCGTACACGTCTTGCCCTC GGTCCCACATATTCCCTCCTG 260
Il18 GCTTGCTTTCACTTCTCCCC TGCCTGGATGCTTGTAAACTTG 262
Sucnr1 GACAGAAGCCGACAGCAGAATG GCAGAAGAGGTAGCCAAACACC 160
β-actin GCCAACCGTGAAAAGATGACC GAGGCATACAGGGACAGCAC 95
2.8. Succinate Quantification
HT29 cells supernatant was used to quantify the succinate levels using the Succinate
Assay Kit (Abcam, Cambridge, UK) according to the manufacturer’s instructions. Briefly,
supernatants were filtered with 10 kDa spin columns (ab93349, Abcam). The Reaction Mix
from the kit was used to incubate samples in 96-well plates at 37
C during 30 min. Finally,
the absorbance at 450 nm was measured with the microplate reader SpectraMax Plus 384
(Molecular Devices, San Jose, CA, USA) and the succinate concentration was calculated
using the standard curve.
Biomedicines 2022,10, 532 6 of 19
2.9. IL-1βELISA
Secreted protein levels of IL-1
β
from supernatants of HT29 cells were quantified by
ELISA using the human IL-1
β
ELISA KIT (MyBioSource, San Diego, CA, USA) following
manufacturer’s instructions. Briefly, in order to remove the cell debris, cell supernatants
were centrifuged at 4
C for 20 min at 1000 rcf and diluted 1:10 with PBS. Samples were
incubated during 90 min at 37
C in the precoated 96-well strip plate. Then, Detection
Solution A was added during 45 min at 37
C and after that, Detection Solution B was
incubated for 45 min at 37
C. TMB Substrate Solution was then added at 37
C during
15 min.
Finally, Stop Solution was added and absorbance was measured at 450 nm with the
microplate reader SpectaMax Plus 384 (Molecular Devices, San Jose, CA, USA).
2.10. Hematoxylin-Eosin Staining
Mice colonic tissues, paraffin-embedded in 5
µ
m sections, were stained with Hematoxylin-
Eosin to analyze histology after the induction of chronic DSS-colitis. After deparaffinization
and rehydration, slides were incubated with Hematoxylin 1:25 (Sigma-Aldrich, Madrid,
Spain) during 3 min at room temperature. Then, ethanol-HCl 0.5% was added over 30 s
and ammonium hydroxide 1% was also added over 30 s. Finally, aqueous eosin Y solution
(Sigma-Aldrich, Madrid, Spain) diluted with glacial acetic acid 0.5% was added over 3 min
at room temperature and dehydrated. Sections were visualized with a light microscope
(Leica DMi8, L’Hospitalet de Llobregat, Spain) using LEICA LAS X software. To analyze
the histology of the tissue, the parameters of Obermeier et al. [
37
] were used. Briefly, as
detailed in Table 5, it consisted of a scale from 0 to 8 which represented the presence of
erosion, the depth and surface extension lesions in the epithelium, as well as the degree of
inflammatory infiltrate. The total histological score represented the sum of the epithelium
and infiltration score (total score = E + I) [37].
Table 5. Histological score parameters.
Epithelium (E) Infiltration (I)
0 Normal morphology 0 No infiltrate
1 Loss of epithelial cells 1 Infiltrate around crypt basis
2 Loss of epithelial cells in large areas 2 Infiltrate reaching to L. muscularis mucosae
3 Loss of crypts 3 Extensive infiltration reaching the L. muscularis mucosae and
thickening of the mucosa with abundant oedema
4 Loss of crypts in large areas 4 Infiltration of the L. submucosa
2.11. Sirius Red Staining
Mice colonic tissues, paraffin-embedded in 5
µ
m sections, were stained with Sirius
Red in order to analyze the collagen layer after induction of chronic DSS-colitis. Slides
were deparaffinized, rehydrated and incubated with Fast Green (Sigma-Aldrich, Madrid,
Spain) over 15 min at room temperature and with Sirius Red 0.1% (Sigma-Aldrich, Madrid,
Spain)/Fast Green 0.04% over 30 min at room temperature. Finally, slides were dehydrated
and observed with a light microscope (Leica DMDMi8, L’Hospitalet de Llobregat, Spain)
using LEICA LAS X software. Collagen deposition, represented by red coloration, was
quantified as mean red intensity per tissue area, using ImageJ (National Institutes of Health,
Bethesda, MD, USA). In the graph, it is represented as % of red area. In order to measure
the thickness of the collagen layer, ImageJ (National Institutes of Health, Bethesda, MD,
USA) was also used. The measurement was performed in a blinded manner by an observer
unaware of the corresponding group for each mouse.
2.12. Statistical Analysis
Data were expressed as mean
±
SEM and were compared by a t-test for comparisons
between two groups and by analysis of variance (one-way ANOVA) with Tukey post
Biomedicines 2022,10, 532 7 of 19
hoc correction or Kruskal–Wallis with Dunn’s post hoc correction where appropriate
for multiple comparisons. Statistical significance was considered with a p-value < 0.05.
Correlations from data obtained in human samples were analyzed using Spearman’s
correlation coefficient.
3. Results
3.1. SUCNR1 Mediates Inflammasome Priming in intestinal Epithelial Cells
The treatment with succinate—as well as the treatment with the inflammatory cocktail
and the combination of both—increased gene and protein expression of SUCNR1 in epithelial
cells, although the statistical significance was obtained in combination for gene expression
and in the cocktail for protein expression (Figure 1a). As expected, the treatment with the
inflammatory cocktail induced a significant increase in the expression of NLRP3, ASC and
CASP1, while the treatment with succinate alone failed to significantly modify their expression
(Figure 1c). The coadministration of succinate and the cocktail significantly potentiated the
expression of NLRP3,IL1B and IL18 induced by the cocktail (Figure 1c). The transient silencing
of SUCNR1 (Figure 1b) did not modify the expression of any inflammasome component
analyzed in basal conditions, but impaired the inflammasome priming, since there was a
significant reduction in the expression of NLRP3,IL1B, IL18 and ASC in siSUCNR1 cells treated
with the cocktail or the combination compared with siRNA control cells (Figure 1c).
Biomedicines 2022, 10, x FOR PEER REVIEW 8 of 20
Figure 1. SUCNR1 mediates inflammasome priming in intestinal epithelial cells. (a) HT29 cells
treated with succinate 1mM and/or an inflammatory cocktail. Graphs show mRNA (n = 7) and pro-
tein (n = 3) expression of SUCNR1. Image of a representative Western Blot of one independent ex-
periment. Bars in graphs represent mean ± SEM; * p < 0.05 and ** p < 0.01 vs. vehicle cells. (be) HT29
cells transiently transfected with a specific siRNA against SUCNR1 or ctrl; (b) Graphs show mRNA
and protein expression of SUCNR1 (n = 5). (c) Graphs show mRNA expression of NLRP3, CASP1,
IL1B, ASC and IL18 (n = 5). (d) Graph shows protein expression of pro-Caspase-1 (n = 4). Image of a
representative Western Blot of one independent experiment. (e) Graph shows secreted protein levels
of IL-1β detected in the supernatant of HT29 cells (n = 3). (f) Graph shows succinate levels in super-
natant of HT29 cells (n = 6). In all cases, bars in graphs represent mean ± SEM. * p < 0.05, ** p < 0.01
and *** p < 0.001 vs. siCtrl vehicle cells. # p < 0.05, ## p < 0.01 and ### p < 0.001 vs. the respective siCtrl
cells. $ p < 0.05, $$ p < 0.01, $$$ p < 0.001 vs. siCtrl cocktail treated cells.
3.2. SUCNR1 Mediates Basal and LPS-Stimulated Inflammatory Pathways in Intestinal
Epithelial Cells
The effect of LPS on SUCNR1 expression was analyzed in HT29 cells and results
showed a significant increase in both gene and protein expression of this receptor after
treatment with LPS during 24 h (Figure 2a). As shown in Figure 2b, LPS increased the
ratio pNFкB/NFкB, while it failed to significantly modify the ratio pERK-1/2/ERK-1/2
Figure 1.
SUCNR1 mediates inflammasome priming in intestinal epithelial cells. (
a
) HT29 cells
treated with succinate 1 mM and/or an inflammatory cocktail. Graphs show mRNA (n= 7) and protein
Biomedicines 2022,10, 532 8 of 19
(n= 3) expression of SUCNR1. Image of a representative Western Blot of one independent experiment.
Bars in graphs represent mean
±
SEM; * p< 0.05 and ** p< 0.01 vs. vehicle cells. (
b
e
) HT29
cells transiently transfected with a specific siRNA against SUCNR1 or ctrl; (
b
) Graphs show mRNA
and protein expression of SUCNR1 (n= 5). (
c
) Graphs show mRNA expression of NLRP3, CASP1,
IL1B,ASC and IL18 (n= 5). (
d
) Graph shows protein expression of pro-Caspase-1 (n= 4). Image
of a representative Western Blot of one independent experiment. (
e
) Graph shows secreted protein
levels of IL-1
β
detected in the supernatant of HT29 cells (n= 3). (
f
) Graph shows succinate levels
in supernatant of HT29 cells (n= 6). In all cases, bars in graphs represent mean
±
SEM. * p< 0.05,
** p< 0.01
and *** p< 0.001 vs. siCtrl vehicle cells. # p< 0.05, ## p< 0.01 and ### p< 0.001 vs. the
respective siCtrl cells. $ p< 0.05, $$ p< 0.01, $$$ p< 0.001 vs. siCtrl cocktail treated cells.
The analysis of the protein levels of pro-Caspase-1 revealed that the treatment with
the cocktail induced a significant increase, whereas levels of this protein were significantly
attenuated in siSUCNR1 cells treated with the cocktail and the combination (Figure 1d).
The quantification of secreted IL-1
β
protein levels by ELISA showed a significant increase
in HT29 cells treated with the inflammatory cocktail, which was potentiated with the
combination of both cocktail and succinate. A significant reduction in secreted levels of IL-
1
β
was obtained in both experimental conditions via the silencing of SUCNR1 (Figure 1e).
Finally, as shown in Figure 1f, succinate levels were quantified and 130.4
±
11.1
µ
M
of this metabolite were detected in the supernatant of vehicle HT29 cells. The treatment
with the cocktail failed to significantly modify levels of succinate which were also similar
in siSUCNR1-transfected cells.
3.2. SUCNR1 Mediates Basal and LPS-Stimulated Inflammatory Pathways in Intestinal
Epithelial Cells
The effect of LPS on SUCNR1 expression was analyzed in HT29 cells and results
showed a significant increase in both gene and protein expression of this receptor after
treatment with LPS during 24 h (Figure 2a). As shown in Figure 2b, LPS increased the ratio
pNFкB/NFкB, while it failed to significantly modify the ratio pERK-1/2/ERK-1/2 com-
pared with vehicle-treated cells. The silencing of SUCNR1 provoked, in basal conditions, a
reduction in the phosphorylation of both NFкB and ERK-1/2, only significant for ERK-1/2
in siSUCNR1 vehicle-treated cells. These levels were similar to that detected in siSUCNR1
LPS-treated cells (Figure 2b). Next, we wanted to elucidate whether this effect on inflam-
matory pathways triggered alterations in the expression of pro-inflammatory cytokines. As
expected, LPS treatment induced a significant increase in the mRNA expression of IL1B,
iNOS and IL6 while no changes in TNF-a were detected; these changes were significantly
reduced in LPS-treated siSUCNR1 transfected cells compared with LPS-treated siCtrl cells
(Figure 2b).
In order to analyze the effect of pERK-1/2 on NFкB activation, we treated HT29 cells
over 2 h with LPS and the MEK inhibitor U0126. LPS treatment for 2 h did not modify the
levels of pERK-1/2, while it reduced the protein levels of IкB in parallel, with a significant
increase in pNFкB (Figure 2c). Of interest, the treatment with the MEK inhibitor U0126,
impaired the LPS-reduction of IкB and significantly reduced the phosphorylated levels of
NFкB (Figure 2c).
Quantification of succinate levels in the supernatant revealed nonsignificant differ-
ences between any of the conditions analyzed (Figure 2d).
Biomedicines 2022,10, 532 9 of 19
Biomedicines 2022, 10, x FOR PEER REVIEW 9 of 20
compared with vehicle-treated cells. The silencing of SUCNR1 provoked, in basal condi-
tions, a reduction in the phosphorylation of both NFкB and ERK-1/2, only significant for
ERK-1/2 in siSUCNR1 vehicle-treated cells. These levels were similar to that detected in
siSUCNR1 LPS-treated cells (Figure 2b). Next, we wanted to elucidate whether this effect
on inflammatory pathways triggered alterations in the expression of pro-inflammatory
cytokines. As expected, LPS treatment induced a significant increase in the mRNA expres-
sion of IL1B, iNOS and IL6 while no changes in TNF-a were detected; these changes were
significantly reduced in LPS-treated siSUCNR1 transfected cells compared with LPS-
treated siCtrl cells (Figure 2b).
In order to analyze the effect of pERK-1/2 on NFкB activation, we treated HT29 cells
over 2 h with LPS and the MEK inhibitor U0126. LPS treatment for 2 h did not modify the
levels of pERK-1/2, while it reduced the protein levels of IкB in parallel, with a significant
increase in pNFкB (Figure 2c). Of interest, the treatment with the MEK inhibitor U0126,
impaired the LPS-reduction of IкB and significantly reduced the phosphorylated levels of
NFкB (Figure 2c).
Quantification of succinate levels in the supernatant revealed nonsignificant differ-
ences between any of the conditions analyzed (Figure 2d).
Figure 2.
SUCNR1 mediates basal and LPS-stimulated inflammatory pathways in intestinal epithelial
cells. (
a
) HT29 cells treated with LPS 0.1
µ
g/mL during 24 h and graphs show mRNA and protein
expression of SUCNR1 (n= 5). Image of a representative Western Blot of one independent experiment.
(
b
) HT29 cells transiently transfected with a specific siRNA against SUCNR1 or ctrl and treated with
LPS 0.1
µ
g/mL during 24 h. Graphs show protein expression of pERK-1/2, ERK-1/2, pNFкB and
NFкB (n= 6) and mRNA expression of IL1B,iNOS,IL6 and TNF-a (n= 5). Image of a representative
Western Blot of one independent experiment. (
c
) HT29 cells treated with vehicle or LPS (with or
without the MEK inhibitor U0126 10
µ
M) over 2 h and graphs show protein expression of pERK-1/2,
ERK-1/2, pNFкB, NFкB and IкB (n= 5). Image of a representative Western Blot of one independent
experiment. (
d
) Graph shows succinate levels in supernatant of HT29 cells (n= 4). In all cases, bars in
graphs represent mean
±
SEM. * p< 0.05, ** p< 0.01 and *** p< 0.001 vs. vehicle cells. # p< 0.05 and
## p< 0.01 vs. the respective siCtrl cells. $ p< 0.05 vs. U0126 nontreated cells.
3.3. Lack of SUCNR1 Ameliorates DSS-Chronic Colitis
In order to analyze the relevance of SUCNR1 receptors in chronic colitis, we treated
WT and SUCNR1
/
mice with four cycles of increasing percentage of DSS in drinking
water over 7 days intercalated with 10 days of water. At day 60, the survival proportion
was significantly higher in SUCNR1
/
mice with no deaths compared with WT mice
Biomedicines 2022,10, 532 10 of 19
which exhibited a 66.67% rate of survival (Figure 3a). In line with this, treatment with DSS
induced a loss of body weight after four cycles which was significantly more pronounced
in WT mice than in SUCNR1
/
mice (Figure 3b). Although chronic administration of
DSS induced a significant reduction in the colon length in both WT and SUCNR1
/
mice
(Figure 3c), the histology was more preserved and less altered in SUCNR1
/
DSS-treated
mice than in WT DSS-treated mice. Indeed, the histological analysis, performed following
Obermeier et al. scale [
37
], demonstrated less infiltration and less affected epithelia in
SUCNR1/DSS-treated mice compared to WT-DSS treated mice (Figure 3d).
Biomedicines 2022, 10, x FOR PEER REVIEW 10 of 20
Figure 2. SUCNR1 mediates basal and LPS-stimulated inflammatory pathways in intestinal epithe-
lial cells. (a) HT29 cells treated with LPS 0.1 µg/mL during 24h and graphs show mRNA and protein
expression of SUCNR1 (n = 5). Image of a representative Western Blot of one independent experi-
ment. (b) HT29 cells transiently transfected with a specific siRNA against SUCNR1 or ctrl and
treated with LPS 0.1 µg/mL during 24 h. Graphs show protein expression of pERK-1/2, ERK-1/2,
pNFкB and NFкB (n = 6) and mRNA expression of IL1B, iNOS, IL6 and TNF-a (n = 5). Image of a
representative Western Blot of one independent experiment. (c) HT29 cells treated with vehicle or
LPS (with or without the MEK inhibitor U0126 10 µM) over 2 h and graphs show protein expression
of pERK-1/2, ERK-1/2, pNFкB, NFкB and IкB (n = 5). Image of a representative Western Blot of one
independent experiment. (d) Graph shows succinate levels in supernatant of HT29 cells (n = 4). In
all cases, bars in graphs represent mean ± SEM. * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle cells.
# p < 0.05 and ## p < 0.01 vs. the respective siCtrl cells. $ p < 0.05 vs. U0126 nontreated cells.
3.3. Lack of SUCNR1 Ameliorates DSS-Chronic Colitis
In order to analyze the relevance of SUCNR1 receptors in chronic colitis, we treated
WT and SUCNR1/ mice with four cycles of increasing percentage of DSS in drinking
water over 7 days intercalated with 10 days of water. At day 60, the survival proportion
was significantly higher in SUCNR1/ mice with no deaths compared with WT mice
which exhibited a 66.67% rate of survival (Figure 3a). In line with this, treatment with DSS
induced a loss of body weight after four cycles which was significantly more pronounced
in WT mice than in SUCNR1/ mice (Figure 3b). Although chronic administration of DSS
induced a significant reduction in the colon length in both WT and SUCNR1/ mice (Fig-
ure 3c), the histology was more preserved and less altered in SUCNR1/ DSS-treated mice
than in WT DSS-treated mice. Indeed, the histological analysis, performed following
Obermeier et al. scale [37], demonstrated less infiltration and less affected epithelia in
SUCNR1/ DSS-treated mice compared to WT-DSS treated mice (Figure 3d).
Figure 3. Lack of SUCNR1 ameliorates chronic DSS-chronic colitis. Chronic intestinal colitis was
induced in vivo in WT and SUCNR1/ mice with four cycles of increasing percentage of DSS (1%,
1%, 1.5% and 1.5%) in drinking water over 7 days, intercalated with 10 days of water. At the end of
the last cycle, on day 60, mice were euthanized and colon tissue samples were collected. (a) Graph
shows the survival percentage in mice after the four cycles of DSS (n = 10). (b) Graph shows the
Figure 3.
Lack of SUCNR1 ameliorates chronic DSS-chronic colitis. Chronic intestinal colitis was
induced
in vivo
in WT and SUCNR1
/
mice with four cycles of increasing percentage of DSS (1%,
1%, 1.5% and 1.5%) in drinking water over 7 days, intercalated with 10 days of water. At the end of the
last cycle, on day 60, mice were euthanized and colon tissue samples were collected. (
a
) Graph shows
the survival percentage in mice after the four cycles of DSS (n= 10). (
b
) Graph shows the evolution
of body weight (n= 10). (
c
) Graph shows the colon length of mice (n= 10). (
d
) Hematoxylin-Eosin
staining performed on intestinal resections of WT and SUCNR1
/
mice and representative pictures
of each group are shown (n= 10). Histological score to assess the integrity of the epithelium and the
degree of infiltration also performed following Obermeier et al. parameters Bars in graphs represent
mean
±
SEM. * p< 0.05, ** p< 0.01 and *** p< 0.001 vs. WT H
2
O mice. ### p< 0.0001 vs. WT
DSS-treated mice.
3.4. SUCNR1 Impairs the Expression of Inflammasome Components in DSS-Chronic Colitis
The role of SUCNR1 in the expression of the inflammasome components
in vivo
was examined in WT and SUCNR1
/
mice after the induction of chronic colitis. The
four cycles
of DSS induced a significant increase in the mRNA expression of Nlrp3,Casp1
and Il1b and protein levels of pro-Caspase-1 in colonic tissue, while no changes were
observed in the Asc mRNA expression (Figure 4a,b). Interestingly, SUCNR1
/
DSS-
treated mice exhibited a significant reduction in the mRNA expression of Nlrp3,Casp-1 and
Il1b as well as in the protein expression of pro-Caspase-1 in the colon, compared with WT
DSS-treated mice (Figure 4a,b).
Biomedicines 2022,10, 532 11 of 19
Biomedicines 2022, 10, x FOR PEER REVIEW 11 of 20
evolution of body weight (n = 10). (c) Graph shows the colon length of mice (n = 10). (d) Hematoxy-
lin-Eosin staining performed on intestinal resections of WT and SUCNR1/ mice and representative
pictures of each group are shown (n = 10). Histological score to assess the integrity of the epithelium
and the degree of infiltration also performed following Obermeier et al. parameters Bars in graphs
represent mean ± SEM.* p < 0.05, ** p < 0.01 and *** p < 0.001 vs. WT H2O mice. ### p < 0.0001 vs. WT
DSS-treated mice.
3.4. SUCNR1 Impairs the Expression of Inflammasome Components in DSS-Chronic Colitis
The role of SUCNR1 in the expression of the inflammasome components in vivo was
examined in WT and SUCNR1/ mice after the induction of chronic colitis. The four cycles
of DSS induced a significant increase in the mRNA expression of Nlrp3, Casp1 and Il1b
and protein levels of pro-Caspase-1 in colonic tissue, while no changes were observed in
the Asc mRNA expression (Figure 4a,b). Interestingly, SUCNR1/ DSS-treated mice exhib-
ited a significant reduction in the mRNA expression of Nlrp3, Casp-1 and Il1b as well as in
the protein expression of pro-Caspase-1 in the colon, compared with WT DSS-treated mice
(Figure 4a,b).
Figure 4. SUCNR1 impairs the expression of inflammasome components in DSS-chronic colitis.
Chronic intestinal colitis was induced in vivo in WT and SUCNR1/ mice with four cycles of in-
creasing percentage of DSS in drinking water over 7 days, intercalated with 10 days of water. At the
end of the last cycle, on day 60, mice were euthanized and colon tissue samples were collected. (a)
Graphs show mRNA expression of Nlrp3, Casp-1, Il1b and Asc (n = 8). (b) Graph shows protein ex-
pression of pro-Caspase-1 (n = 3). Bars in graphs represent mean ± SEM. * p < 0.05, ** p < 0.01 and ***
p < 0.001 vs. WT H2O mice. # p < 0.05, ## p < 0.01 and ### p < 0.0001 vs. WT DSS-treated mice.
3.5. SUCNR1 Deficiency Reduces Intestinal inflammation and Fibrosis in DSS-Chronic Colitis
The analysis of the expression of proinflammatory and anti-inflammatory cytokines
in the colon revealed that chronic DSS treatment induced a significant increase in the ex-
pression of Cox2, Tnf-a, iNos, and Il6 in WT mice, which was significantly reduced in
SUCNR1/ DSS-treated mice. In knock-out mice treated with DSS, we detected a signifi-
cant increase in the expression of the anti-inflammatory cytokine Il10 compared with WT-
DSS-treated mice (Figure 5a).
Next, we studied the macrophage infiltration and macrophage phenotype in these
mice. Chronic DSS treatment significantly increased the expression of F4/80 only in WT
mice, whereas nonsignificant differences were observed in SUCNR1/ DSS-treated mice
Figure 4.
SUCNR1 impairs the expression of inflammasome components in DSS-chronic colitis.
Chronic intestinal colitis was induced
in vivo
in WT and SUCNR1
/
mice with four cycles of
increasing percentage of DSS in drinking water over 7 days, intercalated with 10 days of water. At
the end of the last cycle, on day 60, mice were euthanized and colon tissue samples were collected.
(
a
) Graphs show mRNA expression of Nlrp3,Casp-1, Il1b and Asc (n= 8). (
b
) Graph shows protein
expression of pro-Caspase-1 (n= 3). Bars in graphs represent mean
±
SEM. * p< 0.05, ** p< 0.01 and
*** p< 0.001 vs. WT H2O mice. # p< 0.05, ## p< 0.01 and ### p< 0.0001 vs. WT DSS-treated mice.
3.5. SUCNR1 Deficiency Reduces Intestinal inflammation and Fibrosis in DSS-Chronic Colitis
The analysis of the expression of proinflammatory and anti-inflammatory cytokines
in the colon revealed that chronic DSS treatment induced a significant increase in the
expression of Cox2,Tnf-a,iNos, and Il6 in WT mice, which was significantly reduced
in SUCNR1
/
DSS-treated mice. In knock-out mice treated with DSS, we detected a
significant increase in the expression of the anti-inflammatory cytokine Il10 compared with
WT-DSS-treated mice (Figure 5a).
Next, we studied the macrophage infiltration and macrophage phenotype in these
mice. Chronic DSS treatment significantly increased the expression of F4/80 only in WT
mice, whereas nonsignificant differences were observed in SUCNR1
/
DSS-treated mice
(Figure 5b). In WT-DSS-treated mice, the expression of Cd86,Ccr7,Arginase,Cd206 and Cd16
were significantly increased. In contrast, in SUCNR1
/
DSS-treated mice the increase in
mRNA expression of Cd86 was attenuated, while the increase in the mRNA expression
of both Arginase and Cd206 was potentiated in comparison with WT DSS-treated mice
(Figure 5b).
Aside from inflammation, chronic DSS treatment induced a significant increase in the
expression of profibrotic markers such as Col1,Col3,Col4,Tgf-b,Timp1 and Mmp2 in WT
mice (Figure 5c). On the other hand, SUCNR1
/
DSS-treated mice showed a significant
reduction in the expression of Col1,Col3,Col4,Vimentin,Tgf-b and Mmp2 compared with
WT DSS-treated mice (Figure 5c). Finally, the percentage of red area and the analysis of the
thickness of the collagen layer by Sirius Red staining revealed that WT DSS-treated mice
presented a thicker collagen layer and increased red percentage area than those detected in
SUCNR1/DSS-treated mice (Figure 5d).
Biomedicines 2022,10, 532 12 of 19
Biomedicines 2022, 10, x FOR PEER REVIEW 12 of 20
(Figure 5b). In WT-DSS-treated mice, the expression of Cd86, Ccr7, Arginase, Cd206 and
Cd16 were significantly increased. In contrast, in SUCNR1/ DSS-treated mice the increase
in mRNA expression of Cd86 was attenuated, while the increase in the mRNA expression
of both Arginase and Cd206 was potentiated in comparison with WT DSS-treated mice
(Figure 5b).
Aside from inflammation, chronic DSS treatment induced a significant increase in the
expression of profibrotic markers such as Col1, Col3, Col4, Tgf-b, Timp1 and Mmp2 in WT
mice (Figure 5c). On the other hand, SUCNR1/ DSS-treated mice showed a significant
reduction in the expression of Col1, Col3, Col4, Vimentin, Tgf-b and Mmp2 compared with
WT DSS-treated mice (Figure 5c). Finally, the percentage of red area and the analysis of
the thickness of the collagen layer by Sirius Red staining revealed that WT DSS-treated
mice presented a thicker collagen layer and increased red percentage area than those de-
tected in SUCNR1/ DSS-treated mice (Figure 5d).
Figure 5.
SUCNR1 deficiency reduces intestinal inflammation and fibrosis in DSS-chronic colitis.
Intestinal colitis was induced
in vivo
in WT and SUCNR1
/
mice with four cycles of increasing
percentage of DSS in drinking water over 7 days, intercalated with 10 days of water. At the end of the
last cycle, on day 60, mice were euthanized and colon tissue samples were collected. (
a
) Heat map
showing the mRNA expression of proinflammatory and anti-inflammatory cytokines including Cox2,
Tnf-a, iNos, IL6 and Il10. (
b
) Heat map showing the mRNA expression of macrophage infiltration
and phenotype markers such as F4/80, Cd86, Ccr7, Cd206, Arginase and Cd16. (c) Heat map showing
the mRNA expression of profibrotic markers including Col1, Col3, Col4, Tgf-b, Vimentin, Timp1 and
Mmp2. (
d
) Sirius-Red staining performed on intestinal resections of WT and SUCNR1
/
mice and
representative images of each group (n= 8). In addition, quantification of the collagen layer thickness
as well as % of red area is also represented. Bars in graphs represent mean
±
SEM. ** p< 0.01 and
*** p< 0.001 vs. WT H2O mice. # p< 0.05 and ### p< 0.001 vs. WT DSS-treated mice.
Biomedicines 2022,10, 532 13 of 19
3.6. SUCNR1 and Inflammasome Components Are Increased and Positively Correlate between
Them in Surgical Resections from UC Patients
Finally, we analyzed the expression of SUCNR1 and inflammasome components in
surgical resections obtained from UC patients. As shown in Figure 6a,b, gene and protein
expression of SUCNR1 was significantly increased in UC patients compared with non-IBD
patients. In parallel, the mRNA expression of NLRP3, CASP-1 and IL1B was significantly
higher in samples from UC patients than in control tissue, whereas no differences were
detected in the expression of ASC nor IL18 (Figure 6a). The ratio of Caspase-1/pro-Caspase-
1 was significantly increased in resections from UC patients, as well as NLRP3 protein levels
(Figure 6b). Next, we wanted to elucidate whether the succinate receptor was associated
with the inflammasome activation in human intestinal mucosa of UC patients. Results
revealed a positive and significant correlation between the expressions of SUCNR1 and
NLRP3,CASP1,IL1B,IL18 and ASC (Figure 6c.)
Biomedicines 2022, 10, x FOR PEER REVIEW 14 of 20
Figure 6. SUCNR1 and inflammasome components are increased and positively correlated in sur-
gical resections from UC patients. (a) Graphs show mRNA expression of SUCNR1, NLPR3, CASP-
1, IL1B, IL18 and ASC in intestinal resections from UC patients (n = 25) and non-IBD patients (n =
30). (b) Graphs show protein expression of SUCNR1, NLRP3 and Caspase-1/pro-Caspase-1 (n = 15).
Bars in graphs represent mean ± SEM. * p < 0.05 vs. non-IBD patients. (c) Graphs show the correla-
tions between data relative to mRNA expression of SUCNR1 vs. mRNA expression of the inflam-
masome components NLRP3, CASP1, IL1B and IL18 (expressed as ΔCt). In each correlation, the
value of the Spearman’s correlation coefficient (R) and p value are shown.
4. Discussion
The present study demonstrated, for the first time, that SUCNR1 mediated the in-
flammasome priming and the NFкB-pathway activation in both intestinal epithelial cells
and a chronic murine model of colitis, suggesting a role for this receptor in Ulcerative
Colitis.
Our data showed that SUCNR1 mediated the first step of the inflammasome activa-
tion in IECs, since the transient silencing of this receptor reduced the gene expression of
all inflammasome components and the protein levels of both pro-Caspase-1 and IL-1β.
Epithelial cells are the first line of defense against pathogens and several intestinal insults,
and the inflammasome activation may play a pivotal defensive role [38]. Most studies
have focused on the role of the inflammasome activation in epithelial cells. For instance,
it was reported that the inflammasome activation prevented Staphylococcus aureus infec-
tion in the eye [39] or influenza A viral infection in human airway epithelial cells [40]. In
addition, the activation of inflammasome regulated intestinal healing in DSS-treated mice,
Figure 6.
SUCNR1 and inflammasome components are increased and positively correlated in surgical
resections from UC patients. (
a
) Graphs show mRNA expression of SUCNR1,NLPR3,CASP-1,
IL1B,IL18 and ASC in intestinal resections from UC patients (n= 25) and non-IBD patients (n= 30).
(b) Graphs
show protein expression of SUCNR1, NLRP3 and Caspase-1/pro-Caspase-1 (n= 15). Bars
in graphs represent mean
±
SEM. * p< 0.05 vs. non-IBD patients. (
c
) Graphs show the correlations
between data relative to mRNA expression of SUCNR1 vs. mRNA expression of the inflammasome
components NLRP3,CASP1,IL1B and IL18 (expressed as
Ct). In each correlation, the value of the
Spearman’s correlation coefficient (R) and pvalue are shown.
Biomedicines 2022,10, 532 14 of 19
4. Discussion
The present study demonstrated, for the first time, that SUCNR1 mediated the inflam-
masome priming and the NFкB-pathway activation in both intestinal epithelial cells and a
chronic murine model of colitis, suggesting a role for this receptor in Ulcerative Colitis.
Our data showed that SUCNR1 mediated the first step of the inflammasome activa-
tion in IECs, since the transient silencing of this receptor reduced the gene expression of
all inflammasome components and the protein levels of both pro-Caspase-1 and IL-1
β
.
Epithelial cells are the first line of defense against pathogens and several intestinal insults,
and the inflammasome activation may play a pivotal defensive role [
38
]. Most studies
have focused on the role of the inflammasome activation in epithelial cells. For instance, it
was reported that the inflammasome activation prevented Staphylococcus aureus infection
in the eye [
39
] or influenza A viral infection in human airway epithelial cells [
40
]. In
addition, the activation of inflammasome regulated intestinal healing in DSS-treated mice,
as demonstrated by the use of Caspase-1 knock-out mice [
41
]. Nevertheless, there is a
lack of studies focused specifically on the molecular pathways involved in the priming
of the inflammasome. The present study revealed, for the first time, that SUCNR1 was
able to prime the NLRP3 inflammasome in intestinal epithelial cells, which suggested the
involvement of this receptor in the inflammasome activation and, subsequently, in the
maintenance of intestinal mucosal integrity.
Of interest, our results also showed that SUCNR1 mediated a constitutive regulation
of the ERK-1/2 pathway in intestinal epithelial cells, since siSUCNR1-cells exhibited a
significant reduction in levels of pERK-1/2, in line with previous studies in endothelial
cells [
42
] and in cells from the retinas of diabetic rats [
43
]. The only known ligand of
SUCNR1 is the TCA metabolite succinate; we propose that the constitutive activation
of this G-protein-coupled receptor might be mediated by the high levels of succinate
detected in the epithelial cellular supernatant. In fact, considering that the reported EC50 of
succinate was 91
±
14
µ
M [
44
], the levels that we detected in the supernatant of HT29 cells
were more than enough to reach the maximum activation of SUCNR1 in basal conditions.
Moreover, the present data extend these observations by showing that SUCNR1 regulated
the basal phosphorylation of the well-known proinflammatory transcription factor NFкB
in intestinal epithelial cells (Figure 7). These observations may help to explain the reduced
expression of proinflammatory cytokines detected in resting macrophages by several
studies [
26
,
30
]. Growing evidence has demonstrated that NFкB induces the transcription
of several inflammasome components such as Nlrp1, Nlrp3, and IL-1B [
45
]. Taking this
into account, we suggest that SUCNR1 regulates the inflammasome priming through NFкB
since the transient silencing of SUCNR1 reduces the phosphorylation of this transcription
factor and, subsequently, the transcription of the inflammasome components, as shown in
Figure 7.
Previous studies have specifically located SUCNR1 in the apical membrane of renal
and retinal epithelial cells [
44
,
46
]. Considering that epithelial cells are in close contact
with the intestinal microbiota, a source of succinate [
47
] and bacterial toxins, it seems
likely that the activation of proinflammatory pathways by SUCNR1 plays a homeostatic
role in the maintenance of mucosal integrity. In this line, we found that the increased
phosphorylation of NFкB and the consequent transcription of IL1B, iNOS and IL6, induced
by 24 h LPS-treatment, were significantly prevented in cells in which SUCNR1 had been
knocked down. Unexpectedly, LPS failed to modify levels of pERK-1/2, even when these
cells were analyzed 2 h after LPS treatment, conditions in which we did detect a reduction of
IкB levels and an increase of pNFкB. It seemed that LPS activated inflammatory pathways
by ERK-1/2-independent mechanisms; however, the use of the ERK-1/2 inhibitor U0126,
which abolished the ability of these cells to phosphorylate this kinase, increased IкB levels
and reduced the phosphorylated levels of NFкB, in LPS-treated cells. Taken together,
our results strongly suggested that activation of NFкB in both basal and LPS-stimulated
conditions depended on the constitutive cellular levels of pERK-1/2 (Figure 7).
Biomedicines 2022,10, 532 15 of 19
Both LPS and the inflammatory cocktail upregulated the gene and protein expression
of SUCNR1 in intestinal epithelial cells, in line with that reported in bone marrow-derived
macrophages (BMDMs) [
48
]. Unexpectedly, they both failed to significantly increase the
extracellular levels of succinate, in contrast to that reported in BMDMs [
30
]. It is important
to note that differences in succinate levels between cell lines and primary cells have been
reported [
42
]; we found that, in HT29 cells, levels of this metabolite were on the order
of ten times higher than those detected in blood from carcinoma [
49
] or Crohn’s Disease
patients [
26
]. Therefore, we suggest that, in intestinal epithelial HT29 cells, SUCNR1 (rather
than succinate levels) might be the limiting factor for the activation of the proinflammatory
signalling pathway. Reinforcing this observation, treatment with 1 mM of succinate per
se failed to activate inflammasome, while it potentiated the activation of this process by a
specific cocktail—probably due to the increased SUCNR1 protein expression associated to
that condition.
Figure 7.
The activation of SUCNR1 by constitutive levels of succinate regulates ERK and NFкB
phosphorylation in non-stimulated epithelial cells. In LPS-treated cells, there is an upregulation of
SUCNR1 which increases the phosphorylation of ERK and NFкB, with the subsequent expression of
proinflammatory genes.
The functional role of SUCNR1
in vivo
was analyzed in a chronic murine model of
colitis induced by DSS. In line with previous studies showing a role for NLRP3 inflam-
masome in DSS colitis etiopathogenesis [
14
,
15
], we found an increased expression of both
IL1B mRNA and inflammasome components, as well as protein levels of pro-Caspase-1, in
colonic tissue of DSS-treated mice. The lack of SUCNR1 by the use of SUCNR1
/
mice
significantly prevented the expression of inflammasome components induced by chronic
DSS. Indeed, SUCNR1
/
mice exhibited ameliorated chronic colitis and a higher survival,
compared with WT mice. Previous studies have reported a role for SUCNR1 in acute
colitis [
26
], arthritis [
30
,
50
,
51
], isoproterenol-induced myocardial ischemia [
52
], obesity and
diabetes [
31
], but as far as we know, the present study was the first to show a role for this
receptor in the
in vivo
regulation of inflammasome priming. The absence of SUCNR1 was
also associated with a reduction in the expression of proinflammatory cytokines and M1
Biomedicines 2022,10, 532 16 of 19
markers and a higher expression of M2 markers such as Cd206 and Arginase, in colonic
tissue of DSS-treated mice. The attenuation of the inflammatory process ran in parallel
with a significant reduction in the expression of the most common profibrotic markers
such as Col1,Col3,Col4,Tgf-b,Vimentin and a reduced thickness of collagen layer. Data
in the present study reinforced previous observations reported in intestinal fibrosis using
the heterotopic transplant model [
53
], and extended them by showing that the absence of
SUCNR1 impaired the inflammasome priming and intestinal fibrosis induced by chronic
DSS treatment. SUCNR1 was detected in several cell types involved in fibrosis develop-
ment, such as fibroblasts, epithelial cells and immune cells [
27
], and present and previous
studies have demonstrated a proinflammatory role of SUCNR1 in all of them. It seems
likely that, in chronic conditions of intestinal inflammation, the proinflammatory role of
SUCNR1 in immune cells [
30
] prevailed over the homeostatic mechanism mediated by
this receptor in epithelial cells, some of which may have been lost in the affected tissue.
Reinforcing this observation, our study showed a higher expression of SUCNR1 and in-
flammasome activation in colonic resections from UC patients, in line with that previously
reported in the ileum of Crohn
´
s Disease patients [
26
]. Of interest, a positive and significant
correlation was detected between SUCNR1 and several inflammasome components, such as
NLRP3,CASP-1,IL1B,IL18 and ASC expression. Taken together, our results suggested that
blockading SUCNR1 could benefit patients with an UC outbreak, but the dosage schedule
must consider the protective role played by this receptor in the maintenance of epithelial
barrier function.
In summary, our study demonstrated a role for SUCNR1 in epithelial activation of
inflammatory pathways, suggesting a homeostatic role for this receptor in the maintenance
of intestinal integrity. However, this receptor is also involved in the first step of the
inflammasome associated with chronic murine and human colitis. Additional studies are
needed before proposing this receptor as a new pharmacological target in the treatment of
chronic inflammatory conditions.
Author Contributions:
J.C.-R. and M.D.B. designed the research. C.B., L.L.-L., S.C. (Sandra Coll),
L.G.-F., D.C.M.-C., M.S.-C. and D.O.-M. performed the research. F.N. provided the surgical resections.
C.B., M.D.B. and J.C.-R. analyzed the data. J.C.-R. and M.D.B. wrote the paper. C.B., S.C. (Sara
Calatayud), J.V.E. and D.O.-M. critically reviewed the manuscript. All authors have read and agreed
to the published version of the manuscript.
Funding:
This work was funded by CIBERehd Investigadores Noveles [EHD19PI05], Fundación para
el Fomento de la Investigación Sanitaria y Biomédica de la Comunitat Valenciana [UGP-19-032] and
Ministerio de Ciencia e Innovación (PID2019-108996RB-I00). C.B. is a recipient of a ACIF/2020/014.
S.C. (Sandra Coll) is a recipient of a ACIF/2019/178. Both grants are funded by Generalitat Valenciana
and the European Social Fund+. J.C.-R. is a recipient of a Miguel Servet contract (CP20/00017) from
Carlos III Health Institute.
Institutional Review Board Statement:
The study was conducted in accordance with the Declaration
of Helsinki, and approved by the Institutional Review Board (or Ethics Committee) of Hospital Univer-
sitario y Politécnico La Fe (Valencia, Spain) (protocol code 2020-009-1) for studies involving humans.
The animal study protocol was approved by the Institutional Review Board (or Ethics Committee) of
University of Valencia performed in compliance with the European Animal Research Law (European
Communities Council Directives 2010/63/EU, 90/219/EEC, Regulation (EC) No. 1946/2003), and
Generalitat Valenciana (Artículo 31, Real Decreto 53/2013) (protocol code 2019/VSC/PEA/0290) for
studies involving animals.
Informed Consent Statement: Informed consent was obtained from all subjects involved in the study.
Conflicts of Interest: The authors declare no conflict of interest.
Biomedicines 2022,10, 532 17 of 19
References
1.
Ostvik, A.E.; Svendsen, T.D.; Granlund, A.V.B.; Doseth, B.; Skovdahl, H.K.; Bakke, I.; Thorsvik, S.; Afroz, W.; Walaas, G.A.;
Mollnes, T.E.; et al. Intestinal Epithelial Cells Express Immunomodulatory ISG15 During Active Ulcerative Colitis and Crohn’s
Disease. J. Crohn’s Colitis 2020,14, 920–934. [CrossRef] [PubMed]
2.
Fukata, M.; Arditi, M. The role of pattern recognition receptors in intestinal inflammation. Mucosal. Immunol.
2013
,6, 451–463.
[CrossRef] [PubMed]
3.
Lee, J.Y.; Wasinger, V.C.; Yau, Y.Y.; Chuang, E.; Yajnik, V.; Leong, R.W. Molecular Pathophysiology of Epithelial Barrier Dysfunction
in Inflammatory Bowel Diseases. Proteomes 2018,6, 17. [CrossRef]
4.
Ng, S.C.; Shi, H.Y.; Hamidi, N.; Underwood, F.E.; Tang, W.; Benchimol, E.I.; Panaccione, R.; Ghosh, S.; Wu, J.C.Y.; Chan, F.K.L.; et al.
Worldwide incidence and prevalence of inflammatory bowel disease in the 21st century: A systematic review of population-based
studies. Lancet 2017,390, 2769–2778. [CrossRef]
5.
Ghouri, Y.A.; Tahan, V.; Shen, B. Secondary causes of inflammatory bowel diseases. World J. Gastroenterol.
2020
,26, 3998–4017.
[CrossRef] [PubMed]
6.
de Souza, H.S.; Fiocchi, C. Immunopathogenesis of IBD: Current state of the art. Nat. Rev. Gastroenterol. Hepatol.
2016
,13, 13–27.
[CrossRef] [PubMed]
7.
Khatri, V.; Kalyanasundaram, R. Therapeutic implications of inflammasome in inflammatory bowel disease. FASEB J.
2021
,35, e21439.
[CrossRef]
8. Zhen, Y.; Zhang, H. NLRP3 Inflammasome and Inflammatory Bowel Disease. Front. Immunol. 2019,10, 276. [CrossRef]
9. Groslambert, M.; Py, B.F. Spotlight on the NLRP3 inflammasome pathway. J. Inflamm. Res. 2018,11, 359–374. [CrossRef]
10. Man, S.M.; Kanneganti, T.D. Regulation of inflammasome activation. Immunol. Rev. 2015,265, 6–21. [CrossRef]
11.
Samoila, I.; Dinescu, S.; Costache, M. Interplay between Cellular and Molecular Mechanisms Underlying Inflammatory Bowel
Diseases Development-A Focus on Ulcerative Colitis. Cells 2020,9, 1647. [CrossRef] [PubMed]
12.
Patel, M.N.; Carroll, R.G.; Galvan-Pena, S.; Mills, E.L.; Olden, R.; Triantafilou, M.; Wolf, A.I.; Bryant, C.E.; Triantafilou, K.; Masters,
S.L. Inflammasome Priming in Sterile Inflammatory Disease. Trends Mol. Med. 2017,23, 165–180. [CrossRef] [PubMed]
13.
Shao, B.Z.; Wang, S.L.; Pan, P.; Yao, J.; Wu, K.; Li, Z.S.; Bai, Y.; Linghu, E.Q. Targeting NLRP3 Inflammasome in Inflammatory
Bowel Disease: Putting out the Fire of Inflammation. Inflammation 2019,42, 1147–1159. [CrossRef] [PubMed]
14.
Zhang, J.; Fu, S.; Sun, S.; Li, Z.; Guo, B. Inflammasome activation has an important role in the development of spontaneous colitis.
Mucosal. Immunol. 2014,7, 1139–1150. [CrossRef]
15.
Bauer, C.; Duewell, P.; Mayer, C.; Lehr, H.A.; Fitzgerald, K.A.; Dauer, M.; Tschopp, J.; Endres, S.; Latz, E.; Schnurr, M. Colitis
induced in mice with dextran sulfate sodium (DSS) is mediated by the NLRP3 inflammasome. Gut
2010
,59, 1192–1199. [CrossRef]
16.
Itani, S.; Watanabe, T.; Nadatani, Y.; Sugimura, N.; Shimada, S.; Takeda, S.; Otani, K.; Hosomi, S.; Nagami, Y.; Tanaka, F.; et al.
NLRP3 inflammasome has a protective effect against oxazolone-induced colitis: A possible role in ulcerative colitis. Sci. Rep.
2016,6, 39075. [CrossRef]
17.
Hirota, S.A.; Ng, J.; Lueng, A.; Khajah, M.; Parhar, K.; Li, Y.; Lam, V.; Potentier, M.S.; Ng, K.; Bawa, M.; et al. NLRP3 inflammasome
plays a key role in the regulation of intestinal homeostasis. Inflamm. Bowel. Dis. 2011,17, 1359–1372. [CrossRef]
18.
Zaki, M.H.; Boyd, K.L.; Vogel, P.; Kastan, M.B.; Lamkanfi, M.; Kanneganti, T.D. The NLRP3 inflammasome protects against loss of
epithelial integrity and mortality during experimental colitis. Immunity 2010,32, 379–391. [CrossRef]
19.
Allen, I.C.; TeKippe, E.M.; Woodford, R.M.; Uronis, J.M.; Holl, E.K.; Rogers, A.B.; Herfarth, H.H.; Jobin, C.; Ting, J.P. The
NLRP3 inflammasome functions as a negative regulator of tumorigenesis during colitis-associated cancer. J. Exp. Med.
2010
,207,
1045–1056. [CrossRef]
20.
Donovan, C.; Liu, G.; Shen, S.; Marshall, J.E.; Kim, R.Y.; Alemao, C.A.; Budden, K.F.; Choi, J.P.; Kohonen-Corish, M.; El-Omar,
E.M.; et al. The role of the microbiome and the NLRP3 inflammasome in the gut and lung. J. Leukoc. Biol.
2020
,108, 925–935.
[CrossRef]
21.
Zambetti, L.P.; Mortellaro, A. NLRPs, microbiota, and gut homeostasis: Unravelling the connection. J. Pathol.
2014
,233, 321–330.
[CrossRef] [PubMed]
22.
MacFarlane, J.; Seong, K.C.; Bisambar, C.; Madhu, B.; Allinson, K.; Marker, A.; Warren, A.; Park, S.M.; Giger, O.; Challis, B.G.; et al.
A review of the tumour spectrum of germline succinate dehydrogenase gene mutations: Beyond phaeochromocytoma and
paraganglioma. Clin. Endocrinol. 2020,93, 528–538. [CrossRef] [PubMed]
23.
Guo, Y.; Cho, S.W.; Saxena, D.; Li, X. Multifaceted Actions of Succinate as a Signaling Transmitter Vary with Its Cellular Locations.
Endocrinol. Metab. 2020,35, 36–43. [CrossRef] [PubMed]
24. Mills, E.; O’Neill, L.A. Succinate: A metabolic signal in inflammation. Trends Cell Biol. 2014,24, 313–320. [CrossRef] [PubMed]
25.
Hollander, A.P.; Corke, K.P.; Freemont, A.J.; Lewis, C.E. Expression of hypoxia-inducible factor 1alpha by macrophages in the
rheumatoid synovium: Implications for targeting of therapeutic genes to the inflamed joint. Arthritis Rheum.
2001
,44, 1540–1544.
[CrossRef]
26.
Macias-Ceja, D.C.; Ortiz-Masia, D.; Salvador, P.; Gisbert-Ferrandiz, L.; Hernandez, C.; Hausmann, M.; Rogler, G.; Esplugues, J.V.;
Hinojosa, J.; Alos, R.; et al. Succinate receptor mediates intestinal inflammation and fibrosis. Mucosal. Immunol.
2019
,12, 178–187.
[CrossRef]
Biomedicines 2022,10, 532 18 of 19
27.
Velcicky, J.; Wilcken, R.; Cotesta, S.; Janser, P.; Schlapbach, A.; Wagner, T.; Piechon, P.; Villard, F.; Bouhelal, R.; Piller, F.;
et al. Discovery and Optimization of Novel SUCNR1 Inhibitors: Design of Zwitterionic Derivatives with a Salt Bridge for the
Improvement of Oral Exposure. J. Med. Chem. 2020,63, 9856–9875. [CrossRef]
28.
Li, X.; Xie, L.; Qu, X.; Zhao, B.; Fu, W.; Wu, B.; Wu, J. GPR91, a critical signaling mechanism in modulating pathophysiologic
processes in chronic illnesses. FASEB J. 2020,34, 13091–13105. [CrossRef]
29.
Krzak, G.; Willis, C.M.; Smith, J.A.; Pluchino, S.; Peruzzotti-Jametti, L. Succinate Receptor 1: An Emerging Regulator of Myeloid
Cell Function in Inflammation. Trends Immunol. 2021,42, 45–58. [CrossRef]
30.
Littlewood-Evans, A.; Sarret, S.; Apfel, V.; Loesle, P.; Dawson, J.; Zhang, J.; Muller, A.; Tigani, B.; Kneuer, R.; Patel, S.; et al. GPR91
senses extracellular succinate released from inflammatory macrophages and exacerbates rheumatoid arthritis. J. Exp. Med.
2016
,
213, 1655–1662. [CrossRef]
31.
van Diepen, J.A.; Robben, J.H.; Hooiveld, G.J.; Carmone, C.; Alsady, M.; Boutens, L.; Bekkenkamp-Grovenstein, M.; Hijmans, A.;
Engelke, U.F.H.; Wevers, R.A.; et al. SUCNR1-mediated chemotaxis of macrophages aggravates obesity-induced inflammation
and diabetes. Diabetologia 2017,60, 1304–1313. [CrossRef] [PubMed]
32.
Trauelsen, M.; Rexen Ulven, E.; Hjorth, S.A.; Brvar, M.; Monaco, C.; Frimurer, T.M.; Schwartz, T.W. Receptor structure-based
discovery of non-metabolite agonists for the succinate receptor GPR91. Mol. Metab. 2017,6, 1585–1596. [CrossRef] [PubMed]
33.
Keiran, N.; Ceperuelo-Mallafre, V.; Calvo, E.; Hernandez-Alvarez, M.I.; Ejarque, M.; Nunez-Roa, C.; Horrillo, D.; Maymo-Masip,
E.; Rodriguez, M.M.; Fradera, R.; et al. SUCNR1 controls an anti-inflammatory program in macrophages to regulate the metabolic
response to obesity. Nat. Immunol. 2019,20, 581–592. [CrossRef] [PubMed]
34.
McCreath, K.J.; Espada, S.; Galvez, B.G.; Benito, M.; de Molina, A.; Sepulveda, P.; Cervera, A.M. Targeted disruption of the
SUCNR1 metabolic receptor leads to dichotomous effects on obesity. Diabetes 2015,64, 1154–1167. [CrossRef] [PubMed]
35.
Cosin-Roger, J.; Ortiz-Masia, D.; Calatayud, S.; Hernandez, C.; Esplugues, J.V.; Barrachina, M.D. The activation of Wnt signaling
by a STAT6-dependent macrophage phenotype promotes mucosal repair in murine IBD. Mucosal. Immunol.
2016
,9, 986–998.
[CrossRef] [PubMed]
36.
Cosin-Roger, J.; Canet, F.; Macias-Ceja, D.C.; Gisbert-Ferrandiz, L.; Ortiz-Masia, D.; Esplugues, J.V.; Alos, R.; Navarro, F.;
Barrachina, M.D.; Calatayud, S. Autophagy Stimulation as a Potential Strategy Against Intestinal Fibrosis. Cells
2019
,8, 1078.
[CrossRef]
37.
Obermeier, F.; Kojouharoff, G.; Hans, W.; Scholmerich, J.; Gross, V.; Falk, W. Interferon-gamma (IFN-gamma)- and tumour
necrosis factor (TNF)-induced nitric oxide as toxic effector molecule in chronic dextran sulphate sodium (DSS)-induced colitis in
mice. Clin. Exp. Immunol. 1999,116, 238–245. [CrossRef]
38.
Santana, P.T.; Martel, J.; Lai, H.C.; Perfettini, J.L.; Kanellopoulos, J.M.; Young, J.D.; Coutinho-Silva, R.; Ojcius, D.M. Is the
inflammasome relevant for epithelial cell function? Microbes Infect. 2016,18, 93–101. [CrossRef]
39.
McGilligan, V.E.; Gregory-Ksander, M.S.; Li, D.; Moore, J.E.; Hodges, R.R.; Gilmore, M.S.; Moore, T.C.; Dartt, D.A. Staphylococcus
aureus activates the NLRP3 inflammasome in human and rat conjunctival goblet cells. PLoS ONE 2013,8, e74010. [CrossRef]
40.
Allen, I.C.; Scull, M.A.; Moore, C.B.; Holl, E.K.; McElvania-TeKippe, E.; Taxman, D.J.; Guthrie, E.H.; Pickles, R.J.; Ting, J.P. The
NLRP3 inflammasome mediates
in vivo
innate immunity to influenza A virus through recognition of viral RNA. Immunity
2009
,
30, 556–565. [CrossRef]
41.
Dupaul-Chicoine, J.; Yeretssian, G.; Doiron, K.; Bergstrom, K.S.; McIntire, C.R.; LeBlanc, P.M.; Meunier, C.; Turbide, C.; Gros,
P.; Beauchemin, N.; et al. Control of intestinal homeostasis, colitis, and colitis-associated colorectal cancer by the inflammatory
caspases. Immunity 2010,32, 367–378. [CrossRef]
42.
Mu, X.; Zhao, T.; Xu, C.; Shi, W.; Geng, B.; Shen, J.; Zhang, C.; Pan, J.; Yang, J.; Hu, S.; et al. Oncometabolite succinate
promotes angiogenesis by upregulating VEGF expression through GPR91-mediated STAT3 and ERK activation. Oncotarget
2017
,
8, 13174–13185. [CrossRef] [PubMed]
43.
Li, T.; Hu, J.; Du, S.; Chen, Y.; Wang, S.; Wu, Q. ERK1/2/COX-2/PGE2 signaling pathway mediates GPR91-dependent VEGF
release in streptozotocin-induced diabetes. Mol. Vis. 2014,20, 1109–1121. [PubMed]
44.
Gnana-Prakasam, J.P.; Ananth, S.; Prasad, P.D.; Zhang, M.; Atherton, S.S.; Martin, P.M.; Smith, S.B.; Ganapathy, V. Expression and
iron-dependent regulation of succinate receptor GPR91 in retinal pigment epithelium. Investig. Ophthalmol. Vis. Sci.
2011
,52,
3751–3758. [CrossRef]
45.
Kinoshita, T.; Imamura, R.; Kushiyama, H.; Suda, T. NLRP3 mediates NF-kappaB activation and cytokine induction in microbially
induced and sterile inflammation. PLoS ONE 2015,10, e0119179. [CrossRef] [PubMed]
46.
Robben, J.H.; Fenton, R.A.; Vargas, S.L.; Schweer, H.; Peti-Peterdi, J.; Deen, P.M.; Milligan, G. Localization of the succinate receptor
in the distal nephron and its signaling in polarized MDCK cells. Kidney Int. 2009,76, 1258–1267. [CrossRef] [PubMed]
47.
Banerjee, A.; Herring, C.A.; Chen, B.; Kim, H.; Simmons, A.J.; Southard-Smith, A.N.; Allaman, M.M.; White, J.R.; Macedonia,
M.C.; McKinley, E.T.; et al. Succinate Produced by Intestinal Microbes Promotes Specification of Tuft Cells to Suppress Ileal
Inflammation. Gastroenterology 2020,159, 2101–2115.e2105. [CrossRef]
48.
Bush, S.J.; McCulloch, M.E.B.; Lisowski, Z.M.; Muriuki, C.; Clark, E.L.; Young, R.; Pridans, C.; Prendergast, J.G.D.; Summers,
K.M.; Hume, D.A. Species-Specificity of Transcriptional Regulation and the Response to Lipopolysaccharide in Mammalian
Macrophages. Front. Cell Dev. Biol. 2020,8, 661. [CrossRef]
Biomedicines 2022,10, 532 19 of 19
49.
Terra, X.; Ceperuelo-Mallafre, V.; Merma, C.; Benaiges, E.; Bosch, R.; Castillo, P.; Flores, J.C.; Leon, X.; Valduvieco, I.; Baste, N.; et al.
Succinate Pathway in Head and Neck Squamous Cell Carcinoma: Potential as a Diagnostic and Prognostic Marker. Cancers
2021
,
13, 1653. [CrossRef]
50.
Saraiva, A.L.; Veras, F.P.; Peres, R.S.; Talbot, J.; de Lima, K.A.; Luiz, J.P.; Carballido, J.M.; Cunha, T.M.; Cunha, F.Q.; Ryffel, B.; et al.
Succinate receptor deficiency attenuates arthritis by reducing dendritic cell traffic and expansion of Th17 cells in the lymph nodes.
FASEB J. 2018,32, 6550–6558. [CrossRef]
51.
Rubic-Schneider, T.; Carballido-Perrig, N.; Regairaz, C.; Raad, L.; Jost, S.; Rauld, C.; Christen, B.; Wieczorek, G.; Kreutzer, R.;
Dawson, J.; et al. GPR91 deficiency exacerbates allergic contact dermatitis while reducing arthritic disease in mice. Allergy
2017
,
72, 444–452. [CrossRef] [PubMed]
52.
Lu, Y.T.; Li, L.Z.; Yang, Y.L.; Yin, X.; Liu, Q.; Zhang, L.; Liu, K.; Liu, B.; Li, J.; Qi, L.W. Succinate induces aberrant mitochondrial
fission in cardiomyocytes through GPR91 signaling. Cell Death Dis. 2018,9, 672. [CrossRef] [PubMed]
53.
Ortiz-Masia, D.; Gisbert-Ferrandiz, L.; Bauset, C.; Coll, S.; Mamie, C.; Scharl, M.; Esplugues, J.V.; Alos, R.; Navarro, F.; Cosin-Roger,
J.; et al. Succinate Activates EMT in Intestinal Epithelial Cells through SUCNR1: A Novel Protagonist in Fistula Development.
Cells 2020,9, 1104. [CrossRef] [PubMed]
ResearchGate has not been able to resolve any citations for this publication.
Article
Full-text available
Head and neck squamous cell carcinoma (HNSCC) is characterized by high rates of mortality and treatment-related morbidity, underscoring the urgent need for innovative and safe treatment strategies and diagnosis practices. Mitochondrial dysfunction is a hallmark of cancer and can lead to the accumulation of tricarboxylic acid cycle intermediates, such as succinate, which function as oncometabolites. In addition to its role in cancer development through epigenetic events, succinate is an extracellular signal transducer that modulates immune response, angiogenesis and cell invasion by activating its cognate receptor SUCNR1. Here, we explored the potential value of the circulating succinate and related genes in HNSCC diagnosis and prognosis. We determined the succinate levels in the serum of 66 pathologically confirmed, untreated patients with HNSCC and 20 healthy controls. We also surveyed the expression of the genes related to succinate metabolism and signaling in tumoral and nontumoral adjacent tissue and in normal mucosa from 50 patients. Finally, we performed immunohistochemical analysis of SUCNR1 in mucosal samples. The results showed that the circulating levels of succinate were higher in patients with HNSCC than in the healthy controls. Additionally, the expression of SUCNR1, HIF-1α, succinate dehydrogenase (SDH) A, and SDHB was higher in the tumor tissue than in the matched normal mucosa. Consistent with this, immunohistochemical analysis revealed an increase in SUCNR1 protein expression in tumoral and nontumoral adjacent tissue. High SUCNR1 and SDHA expression levels were associated with poor locoregional control, and the locoregional recurrence-free survival rate was significantly lower in patients with high SUCNR1 and SDHA expression than in their peers with lower levels (77.1% [95% CI: 48.9–100.0] vs. 16.7% [95% CI: 0.0–44.4], p = 0.018). Thus, the circulating succinate levels are elevated in HNSCC and high SUCNR1/SDHA expression predicts poor locoregional disease-free survival, identifying this oncometabolite as a potentially valuable noninvasive biomarker for HNSCC diagnosis and prognosis.
Article
Full-text available
Background & Aims Countries endemic for parasitic infestations have a lower incidence of Crohn’s disease (CD) than non-endemic countries, and there have been anecdotal reports of the beneficial effects of helminths in CD patients. Tuft cells in the small intestine sense and direct the immune response against eukaryotic parasites. We investigated the activities of tuft cells in patients with CD and mouse models of intestinal inflammation. Methods We used microscopy to quantify tuft cells in intestinal specimens from patients with ileal CD (n = 19), healthy individuals (n = 14), and TNFΔARE/+ mice, which develop Crohn’s-like ileitis. We performed single-cell RNA-sequencing, mass spectrometry, and microbiome profiling of intestinal tissues from wildtype and ATOH1-knockout mice, which have expansion of tuft cells, to study interactions between microbes and tuft cell populations. We assessed microbe dependence on these populations using microbiome depletion, organoids, and microbe transplant experiments. We used multiplex imaging and cytokine assays to assess alterations in inflammatory response following expansion of tuft cells with succinate administration in TNFΔARE/+ and anti-CD3E CD mouse models. Results Inflamed ileal tissues from patients and mice had reduced numbers of tuft cells, compared with healthy individuals or wild-type mice. Expansion of tuft cells was associated with increased expression of genes that regulate the tricarboxylic acid cycle, which resulted from microbe production of the succinate. Experiments in which we manipulated the intestinal microbiota of mice revealed the existence of an ATOH1-independent population of tuft cells that was sensitive to metabolites produced by microbes. Administration of succinate to mice expanded tuft cells and reduced intestinal inflammation in TNFΔARE/+ mice and anti-CD3E-treated mice, increased GATA3+ cells and type 2 cytokines (IL22, IL25, IL13), and decreased RORGT+ cells and type 17 cytokines (IL23) in a tuft cell-dependent manner. Conclusions We found that tuft cell expansion reduced chronic intestinal inflammation in mice. Strategies to support tuft cells might be developed for treatment of CD.
Article
Full-text available
Mammalian macrophages differ in their basal gene expression profiles and response to the toll-like receptor 4 (TLR4) agonist, lipopolysaccharide (LPS). In human macrophages, LPS elicits a temporal cascade of transient gene expression including feed forward activators and feedback regulators that limit the response. Here we present a transcriptional network analysis of the response of sheep bone marrow-derived macrophages (BMDM) to LPS based upon RNA-seq at 0, 2, 4, 7, and 24 h post-stimulation. The analysis reveals a conserved transcription factor network with humans, and rapid induction of feedback regulators that constrain the response at every level. The gene expression profiles of sheep BMDM at 0 and 7 h post LPS addition were compared to similar data obtained from goat, cow, water buffalo, horse, pig, mouse and rat BMDM. This comparison was based upon identification of 8,200 genes annotated in all species and detected at >10TPM in at least one sample. Analysis of expression of transcription factors revealed a conserved transcriptional millieu associated with macrophage differentiation and LPS response. The largest co-expression clusters, including genes encoding cell surface receptors, endosome–lysosome components and secretory activity, were also expressed in all species and the combined dataset defines a macrophage functional transcriptome. All of the large animals differed from rodents in lacking inducible expression of genes involved in arginine metabolism and nitric oxide production. Instead, they expressed inducible transporters and enzymes of tryptophan and kynurenine metabolism. BMDM from all species expressed high levels of transcripts encoding transporters and enzymes involved in glutamine metabolism suggesting that glutamine is a major metabolic fuel. We identify and discuss transcripts that were uniquely expressed or regulated in rodents compared to large animals including ACOD1, CXC and CC chemokines, CD163, CLEC4E, CPM, CSF1, CSF2, CTSK, MARCO, MMP9, SLC2A3, SLC7A7, and SUCNR1. Conversely, the data confirm the conserved regulation of multiple transcripts for which there is limited functional data from mouse models and knockouts. The data provide a resource for functional annotation and interpretation of loci involved in susceptibility to infectious and inflammatory disease in humans and large animal species.
Article
Full-text available
The citric acid cycle, also known as the Krebs cycle, plays an integral role in cellular metabolism and aerobic respiration. Mutations in genes encoding the citric acid cycle enzymes succinate dehydrogenase, fumarate hydratase and malate dehydrogenase all predispose to hereditary tumour syndromes. The succinate dehydrogenase enzyme complex (SDH) couples the oxidation of succinate to fumarate in the citric acid cycle and the reduction of ubiquinone to ubiquinol in the electron transport chain. A loss of function in the succinate dehydrogenase (SDH) enzyme complex is most commonly caused by an inherited mutation in one of the four SDHx genes (SDHA, SDHB, SDHC and SDHD). This mechanism was first implicated in familial phaeochromocytoma and paraganglioma. However, over the past two decades the spectrum of tumours associated with SDH deficiency has been extended to include; gastrointestinal stromal tumours (GIST), renal cell carcinoma (RCC) and pituitary adenomas. The aim of this review is to describe the extended tumour spectrum associated with SDHx gene mutations and to consider how functional tests may help to establish the role of SDHx mutations in new or unexpected tumour phenotypes.
Article
Inflammatory bowel disease (IBD) remains a persistent health problem with a global burden surging over 6.8 million cases currently. Clinical pathology of IBD is complicated; however, hyperactive inflammatory and immune responses in the gut is shown to be one of the persistent causes of the disease. Human gut inflammasome, the activator of innate immune system is believed to be a primary underlying cause for the pathology and is largely associated with the progression of IBD. To manage IBD, there is a need to fully understand the role of inflammasome activation in IBD. Since inflammasome potentially play a significant role in IBD, systemic modulation of inflammasome may provide an effective therapeutic and clinical approach to control IBD symptoms. In this review, we have focused on this association between IBD and gut inflammasome, and recent advances in the research and therapeutic strategies for IBD. We have discussed inflammasomes and their components, outcomes from the experimental animals and human studies, inflammasome inhibitors, and developments in the inflammasome‐targeted therapies for IBD.
Article
The rapidly evolving area of immunometabolism has shed new light on the fundamental properties of products and intermediates of cellular metabolism (metabolites), highlighting their key signaling roles in cell-to-cell communication. Recent evidence identifies the succinate–succinate receptor 1 (SUCNR1) axis as an essential regulator of tissue homeostasis. Succinate signaling via SUCNR1 guides divergent responses in immune cells, which are tissue and context dependent. Herein, we explore the main cellular pathways regulated by the succinate–SUCNR1 axis and focus on the biology of SUCNR1 and its roles influencing the function of myeloid cells. Hence, we identify new therapeutic targets and putative therapeutic approaches aimed at resolving detrimental myeloid cell responses in tissues, including those occurring in the persistently inflamed central nervous system (CNS).
Article
G-protein-coupled receptor SUCNR1 (succinate receptor 1 or GPR91) senses the citric cycle intermediate succinate and is implicated in various pathological conditions such as rheumatoid arthritis, liver fibrosis, or obesity. Here, we describe a novel SUCNR1 antagonist scaffold discovered by high-throughput screening. The poor permeation and absorption properties of the most potent compounds, which were zwitterionic in nature, could be improved by the formation of an internal salt bridge, which helped in shielding the two opposite charges and thus also the high polarity of zwitterions with separated charges. The designed compounds containing such a salt bridge reached high oral bioavailability and oral exposure. We believe that this principle could find a broad interest in the medicinal chemistry field as it can be useful not only for the modulation of properties in zwitterionic compounds but also in acidic or basic compounds with poor permeation.
Article
Succinate receptor GPR91 is one of G protein-coupled receptors (GPCRs), and is expressed in a variety of cell types and tissues. Succinate is its natural ligand, and its activation represents that an intrinsic metabolic intermediate exerts a regulatory role on many critical life processes involving pathophysiologic mechanisms, such as innate immunity, inflammation, tissue repair, and oncogenesis. With the illustration of 3-dimensional crystal structure of the receptor and discovery of its antagonists, it is possible to dissect the succinate-GPR91-G protein signaling pathways in different cell types under pathophysiological conditions. Deep understanding of the GPR91-ligand binding mode with various agonists and antagonists would aid in elucidating the molecular basis of a spectrum of chronic illnesses, such as hypertension, diabetes, and their renal and retina complications, metabolic-associated fatty liver diseases, such as nonalcoholic steatohepatitis and its fibrotic progression, inflammatory bowel
Article
The nucleotide‐binding oligomerization domain (NOD)‐like receptor (NLR) family, pyrin domain‐containing protein 3 (NLRP3) inflammasome, is one of the most well‐characterized inflammasomes, activated by pathogen‐associated molecular patterns and damage‐associated molecular patterns, including from commensal or pathogenic bacterial and viral infections. The NLRP3 inflammasome promotes inflammatory cell recruitment and regulates immune responses in tissues such as the gastrointestinal tract and the lung, and is involved in many diseases that affect the gut and lung. Recently, the microbiome in the gut and the lung, and the crosstalk between these organs (gut–lung axis), has been identified as a potential mechanism that may influence disease in a bidirectional manner. In this review, we focus on themes presented in this area at the 2019 World Congress on Inflammation. We discuss recent evidence on how the microbiome can affect NLRP3 inflammasome responses in the gut and lung, the role of this inflammasome in regulating gut and lung inflammation in disease, and its potential role in the gut–lung axis. We highlight the exponential increase in our understanding of the NLRP3 inflammasome due to the synthesis of the NLRP3 inflammasome inhibitor, MCC950, and propose future studies that may further elucidate the roles of the NLRP3 inflammasome in gut and lung diseases. Review on NLRP3 inflammasome as a key bi‐directional mediator of the state of the gut‐lung microbiome axis.
Article
Inflammatory bowel diseases (IBD), conventionally consist of Crohn's disease (CD) and ulcerative colitis. They occur in individuals with high risk genotype for the disease in the setting of appropriate environmental factors. The pathogenesis of IBD involves a dysregulated autoimmune response to gut dysbiosis, which in turn is triggered due to exposure to various inciting environmental factors. But there is no clearly defined etiology of IBD and this type of disease is termed as "idiopathic IBD", "classic IBD", or "primary IBD". We reviewed the current medical literature and found that certain etiological factors may be responsible for the development of IBD or IBD-like conditions, and we consider this form of de novo IBD as "secondary IBD". Currently known factors that are potentially responsible for giving rise to secondary IBD are medications; bowel altering surgeries and transplantation of organs, stem cells or fecal microbiome. Medications associated with the development of secondary IBD include; immunomodulators, anti-tumor necrosis factor alpha agents, anti-interleukin agents, interferons, immune stimulating agents and checkpoint inhibitors. Colectomy can in some cases give rise to de novo CD, pouchitis of the ileal pouch, or postcolectomy enteritis syndrome. After solid organ transplantation or hematopoietic stem cell transplantation, the recipient may develop de novo IBD or IBD flare. Fecal microbiota transplantation has been widely used to treat patients suffering from recurrent Clostridium difficile infection but can also causes IBD flares.