ArticlePDF AvailableLiterature Review

Abstract and Figures

Transposable elements (TEs) have been historically depicted as detrimental genetic entities that selfishly aim at perpetuating themselves, invading genomes, and destroying genes. Scientists often co-opt “special” TEs to develop new and powerful genetic tools, that will hopefully aid in changing the future of the human being. However, many TEs are gentle, rarely unleash themselves to harm the genome, and bashfully contribute to generating diversity and novelty in the genomes they have colonized, yet they offer the opportunity to develop new molecular tools. In this review we summarize 30 years of research focused on the Bari transposons. Bari is a “normal” transposon family that has colonized the genomes of several Drosophila species and introduced genomic novelties in the melanogaster species. We discuss how these results have contributed to advance the field of TE research and what future studies can still add to the current knowledge.
Content may be subject to copyright.


Citation: Palazzo, A.; Caizzi, R.;
Moschetti, R.; Marsano, R.M. What
Have We Learned in 30 Years of
Investigations on Bari Transposons?.
Cells 2022,11, 583. https://
doi.org/10.3390/cells11030583
Academic Editors: Laura Fanti and
Patrizio Dimitr
Received: 12 January 2022
Accepted: 7 February 2022
Published: 8 February 2022
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
Copyright: © 2022 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
cells
Review
What Have We Learned in 30 Years of Investigations on
Bari Transposons?
Antonio Palazzo , Ruggiero Caizzi, Roberta Moschetti and RenéMassimiliano Marsano *
Dipartimento di Biologia, Universitàdi Bari, 70125 Bari, Italy; antonio.palazzo@uniba.it (A.P.);
ruggiero.caizzi@gmail.com (R.C.); roberta.moschetti@uniba.it (R.M.)
*Correspondence: renemassimiliano.marsano@uniba.it
Abstract:
Transposable elements (TEs) have been historically depicted as detrimental genetic entities
that selfishly aim at perpetuating themselves, invading genomes, and destroying genes. Scientists
often co-opt “special” TEs to develop new and powerful genetic tools, that will hopefully aid in
changing the future of the human being. However, many TEs are gentle, rarely unleash themselves to
harm the genome, and bashfully contribute to generating diversity and novelty in the genomes they
have colonized, yet they offer the opportunity to develop new molecular tools. In this review we
summarize 30 years of research focused on the Bari transposons. Bari is a “normal” transposon family
that has colonized the genomes of several Drosophila species and introduced genomic novelties in
the melanogaster species. We discuss how these results have contributed to advance the field of TE
research and what future studies can still add to the current knowledge.
Keywords:
Bari transposons; Drosophila; regulation; transposon tandem repeat; horizontal transfer;
blurry promoter; heterochromatin
1. Introduction
Transposable elements are fundamental genetic units in the genomes of virtually
all living organisms. TEs could be depicted as the characters of a happy ending fairytale.
Initially regarded as “junk” and “useless”, TEs turned out to be considered as evolutionarily
flagships after reconsidering the role they have had and still have in shaping genomes
and their functioning. Moreover, the characterization of many transposition systems has
led to the development of efficient DNA integration tools [
1
] as well as powerful genome
engineering systems [
2
,
3
], and to the implementation of TE control regions into efficient
expression systems [4].
It is a matter of fact that the hallmark of all TEs, i.e., the ability to integrate into
chromosomes, is the most interesting aspect of TEs for many biologists, due to their many
possible applications in a large group of fields in Life Sciences.
Efficient genome integration tools are indeed desirable to disrupt genes, either in a
random or targeted way, and to introduce exogenous DNA into the preferred cellular or
animal model. A special application of the latter practice is gene therapy, which consists
in the introduction of the non-pathological allele in the affected cell type of a patient that
suffers from a genetic-based disease, with the aim to rescue the illness phenotype.
In the past 40 years many transposition systems have been studied in detail with the
aim to set up new and efficient DNA integration tools.
Historically, the Drosophila P-element was the first transposon-based transposition
tool to be employed in functional genomics [
5
,
6
]. Unfortunately, its main limitation is the
narrow host range of transposition [
7
], which makes it useless for much noble applications,
such as gene therapy.
Elements of the Tc1/mariner are more tractable for this kind of application. Tc1/mariner
elements belong to the Class II of the eukaryotic transposons and are widely distributed,
Cells 2022,11, 583. https://doi.org/10.3390/cells11030583 https://www.mdpi.com/journal/cells
Cells 2022,11, 583 2 of 17
from bacteria [8] to higher eukaryotes [9], with few exceptions. Their wide distribution in
living organisms allowed the foundation of the IS630/Tc1/mariner superfamily.
More in general, the so-called “cut and paste” DNA transposons are the best can-
didates to develop molecular tools for transgenesis because of their simple mechanism
of transposition and their poor requirement of host factor [
10
]. Two of these elements
stepped into the limelight in the past decade, the Sleeping Beauty (SB) and the piggyBac (PB)
elements [
1
]. SB is undoubtedly the most sophisticated transposon-based system in the
context of therapeutic setup. The CARAMBA clinical trial (https://www.caramba-cart.eu;
accessed 15 December 2021) currently uses an advanced SB-based transposon technology
for therapeutic gene delivery [11].
However, not all the known transposition systems support this kind of application.
Most known TEs have limited transposition performances (i.e., low transposition rate,
narrow host specificity) or they have low flexibility (i.e., they are too large and complex
or display low cargo capability) to allow the development of efficient genome integration
systems. Nevertheless, many TEs are studied for their role in shaping genome structure [
12
]
and gene expression [13] or to develop new and alternative technologies [3,4,14,15].
Among the Tc1/mariner superfamily of TEs the Bari family was discovered 30 years
ago in the former Institute of Genetics at the University of Bari (Italy). Such discovery led
to the foundation of a new research line, which is still currently under investigation, in a
laboratory up to that time devoted to the study of glutamine synthetase [1618].
In this review, we comprehensively summarize the results of 30 years of research that
concern the Drosophila Bari elements, and frame these results in a comprehensive view
in the field of TE research. We also provide more extensive hypotheses on the role of Bari
transposons in the genome of Drosophilidae species.
The Discovery of the Bari1 Transposon: An Historical Overview
The discovery of the Bari transposons occurred during the characterization of the h39 re-
gion of the mitotic chromosomes. This is a complex repetitive locus in Drosophila melanogaster,
adjacent to the second chromosome’s centromere [
19
]. It was known from previous studies
that mutant flies carrying the deletion of the h39 region showed a semi-lethal phenotype
and low fitness [
20
]. The phenotype was associated with the deletion of the Responder
satellite [21], the main satellite mapped in the h39 until then.
The team headed by Prof. Caizzi and Prof. Pimpinelli hypothesized that additional
genetic and molecular entities could map in the h39 region, which could also account for the
phenotype associated with the region deletion. In the main effort of characterizing the h39
region at the molecular level, they identified a novel repetitive sequence, uniquely mapping
to this region. Originally, differential hybridization technique was used to identify, isolate,
and subsequently clone h39-specific sequences. The existence of extraordinary genetic
toolkits, such as precisely mapped chromosome rearrangements (the most effective was
the Rsp
ins16
(R16) deletion [
22
,
23
]) undoubtedly aided the genetic mapping in a heterochro-
matic region. Furthermore, the availability of molecular tools, such as the possibility to
construct strain-specific genomic libraries, but most of all acrylamide gel electrophoresis to
read Sanger sequencing reactions, strongly contributed to the characterization of a previ-
ously unknown sequence isolated from single copies dispersed in the euchromatin that
was soon classified as a new transposon of the Tc1/mariner superfamily. It was named Bari1
after its discovery in the Italian city of Bari, where the laboratory was based, and making
the wish (which would later come true!) that other Bari elements might be discovered to
complete the series.
Bari1 is a DNA transposon belonging to the IS639/Tc1/mariner superfamily with 26 bp
long inverted repeats (IRs) and three direct repeated sequences (DRs) [
24
], serving as the
transposase binding sites (Figure 1A). As noted earlier in comparative studies, the 3xDRs
structure is almost peculiar [
25
], since there are few known TEs with similar organization
of the terminal sequences, including Paris [26], S[27], minos [28], and SB [29].
Cells 2022,11, 583 3 of 17
If the identification of a new transposon in the early 1990s was per se a great advance-
ment in the field of genome structure and evolution, the characterization of the peculiar
arrangement of Bari1 in a heterochromatic locus was breathtaking. The precise head-to-tail
organization of roughly 80 Bari1 copies in the h39 region of the mitotic chromosomes of
D. melanogaster was featured by the systematic deletion of the very first two nucleotides
in each copy. To our knowledge, this enigmatic organization still has no comparable de-
scribed examples in the field of TEs. While other Drosophila species contain Bari-like
transposons (see the Section “The Bari Family Grows Up”), the heterochromatic Bari1 clus-
ter seems to be specific to the melanogaster species. This organization suggests a recent-and
species-specific evolutionary origin since it is specific to a single species. It also allows
the discrimination of two sibling species (i.e., the melanogaster and simulans species) at
the molecular level. Moreover, a second minor Bari1 cluster has been recently described,
which maps on the X chromosome of D. melanogaster [
30
,
31
]. This is a small cluster that
is composed of six copies of Bari1. Surprisingly, both the main and the small clusters
share the same di-nucleotide deletion at the 5
0
end of each element, and the head-to-tail
organization. In addition, both clusters share a heterochromatic localization, although on
different chromosomes. In a retrospective view, it is worth noting that the presence of
an additional Bari1 tandem repeat was also evident since the 1993 paper. Indeed, in one
of the Southern blot hybridization analyses presented in the paper, it was evident that
the Rsp
ins16
background still contains an additional Bari1 sequence block arranged in a
tandem repeat configuration (see Figure 4 in Caizzi et al., 1993 [
32
]. A similar pattern can
be observed in Caggese et al., 1995 [
33
] (see Figure 2 therein), an observation that allows
excluding technical artifacts. Taken together, these findings suggest a marked instability of
the Bari1 element in the melanogaster species, associated with an error-prone transposition
that has occurred at least twice during the evolution [
34
]. An aberrant transposase activity
that generated long concatemers form a circular transposon, in a way similar to the rolling
circle replication mechanism, has been proposed to explain the origin of both the Bari1
arrays [
34
]. However, the structural and functional role of these clusters (if any) remains
currently unresolved.
Among the possible role of the Bari clusters, two scenarios can be envisioned. The
simplest hypothesis is that it could have a regulatory function. The second hypothesis,
which we are currently testing using transgenic strains, is that the Bari cluster could be
involved in the structural organization of h39 domains, possibly aided by other repetitive
sequences mapping in the same region [3537].
Cells 2022,11, 583 4 of 17
Cells 2022, 11, x FOR PEER REVIEW 4 of 16
Figure 1. (A) Structure and TIRs organization of the three Bari sub-families. The length of the TIRs
is indicated by colored arrowheads. Bari1 elements may have two different TIR lengths (represented
by solid and dashed green arrowheads, respectively). The three DRs (outer (red), middle (violet),
and inner (yellow)) are shown as DNA logos [38] obtained by comparing at least 15 different Dro-
sophila species. The elements represented in the picture (TIRs, ORFs) are not drawn to scale. (B)
Distribution of Bari-like elements in the Drosophilidae (adapted from [30]). Symbols are explained
in the figure legend and have the same color-code as in panel A (i.e., Bari1-like green; Bari2-like blue;
Bari3-like orange).
2. The Bari Family Grows Up
2.1. Introducing Bari2 and Bari3
Studies aimed at the determination of the diffusion of the Bari transposons in Dro-
sophila genus and in other Diptera species demonstrated that Bari transposons are widely
represented in the Drosophila genus and that they can be subdivided into three distinct
sub-families.
Former studies, mainly performed using Southern blot hybridization techniques,
demonstrated the presence of homologous Bari1 sequences in species closely related to D.
melanogaster [39]. Weak or very faint hybridization signals suggested the presence of Bari
elements that were divergent in sequence in distant species, belonging to the Sophophora
and Drosophila sub-genera, and to the Zaprionus genus. Indeed, cloning and sequencing
hybridizing fragments (showing weak hybridization signals) from D. erecta and D.
diplacantha demonstrated the presence of another type of Bari element, which was named
Bari2, in the genome of many species in which the Bari1 element was also found. Bari2
differs from Bari1 in structure, since it is characterized by long TIRs (nearly identical 253
bp sequences) and no coding potential, due to numerous invalidating indels and
frameshift mutations that disrupt its ability to encode a transposase (Figure 1A). Not a
single active Bari2 element has been found to date, making Bari2 a non-autonomous sub-
A
B
Figure 1.
(
A
) Structure and TIRs organization of the three Bari sub-families. The length of the TIRs is
indicated by colored arrowheads. Bari1 elements may have two different TIR lengths (represented by
solid and dashed green arrowheads, respectively). The three DRs (outer (red), middle (violet), and
inner (yellow)) are shown as DNA logos [
38
] obtained by comparing at least 15 different Drosophila
species. The elements represented in the picture (TIRs, ORFs) are not drawn to scale. (
B
) Distribution
of Bari-like elements in the Drosophilidae (adapted from [
30
]). Symbols are explained in the figure
legend and have the same color-code as in panel A (i.e., Bari1-like green; Bari2-like blue; Bari3-
like orange).
2. The Bari Family Grows Up
2.1. Introducing Bari2 and Bari3
Studies aimed at the determination of the diffusion of the Bari transposons in Drosophila
genus and in other Diptera species demonstrated that Bari transposons are widely rep-
resented in the Drosophila genus and that they can be subdivided into three distinct
sub-families.
Former studies, mainly performed using Southern blot hybridization techniques,
demonstrated the presence of homologous Bari1 sequences in species closely related to
D. melanogaster [
39
]. Weak or very faint hybridization signals suggested the presence
of Bari elements that were divergent in sequence in distant species, belonging to the
Sophophora and Drosophila sub-genera, and to the Zaprionus genus. Indeed, cloning and
sequencing hybridizing fragments (showing weak hybridization signals) from D. erecta and
D. diplacantha demonstrated the presence of another type of Bari element, which was named
Bari2, in the genome of many species in which the Bari1 element was also found. Bari2
differs from Bari1 in structure, since it is characterized by long TIRs (nearly identical 253 bp
sequences) and no coding potential, due to numerous invalidating indels and frameshift
mutations that disrupt its ability to encode a transposase (Figure 1A). Not a single active
Cells 2022,11, 583 5 of 17
Bari2 element has been found to date, making Bari2 a non-autonomous sub-family. Notably,
the distribution of Bari2 in the genome of D. erecta is almost heterochromatic, suggesting
either an insertion preference of the ancestral (active) form of Bari2 or a recent elimination
of the euchromatic copies.
The evolutionary link between the potentially active Bari1 and the evolutionary
knocked out Bari2 elements was also difficult to understand. While the comparison of
the ORF (and its protein product) of Bari1 and the reconstructed consensus sequence of
Bari2 clearly suggested their evolutionary relationship, their TIRs are very dissimilar both
in sequence and structure. Bari2 is indeed featured by long TIRs, identical to each other.
Only at the DRs level the two families share evident homology, a sign that both derived
from an ancestral Bari transposon [
24
]. Why the TIRs of Bari2 have been preserved in
extant Drosophila species is not clear. An intriguing hypothesis, that parallelizes the one
proposed for the human Hsmar1 element, is that Bari2 TIRs have been co-opted to titrate
some endogenous nuclear protein [
40
,
41
] involved in the maintenance of the chromatin
status or in chromatin remodeling or to titrate the transposase of active Bari elements.
The missing evolutionary link between Bari1, possessing short TIRs and intact ORF,
and Bari2, possessing long TIRs and disrupted ORF, was subsequently identified with
the discovery of the third Bari family in D. mojavensis [
24
]. Bari3 was next identified in
species of the obscura and the willistoni groups [
30
]. Many intact Bari3 insertions and
the polymorphism observed in geographically distinct populations suggested that it is an
active transposon [
42
]. Bari3 transposases share 80% similarity with Bari1, and it is featured
by long TIRs with an IR/DR structure (Figure 1A) [24,42].
2.2. New Cognate Elements in New Species: The Crew Grows up in the Post-Genomic Era
The advent of the post-genomic era has offered the opportunity to perform compara-
tive studies that were very difficult to perform without the availability of genome sequence
assembly. Evidence of the presence of Bari elements in distant Drosophila species were
mounting in a former work which identified homologous sequences in the Sophophora and
Drosophila genera [
39
]. In a genomic survey study conducted in 23 species of Drosophila,
several other elements related to the three known Bari sub-families were identified in newly
sequenced Drosophila genomes (Figure 1B) [
30
]. In this study, Bari-like elements were
identified and annotated in all but the D. grimshawi species. The extended annotation of
Bari-like transposons suggests that, despite the diversity observed in the TIR structure, the
DRs are well-conserved across Bari sub-families (Figure 1A) [
24
,
30
]. It is worth noting that
an interesting Bari1-type element with long TIRs was identified in D. rhopaloa (Figure 1B),
which further entangles the evolutionary dynamics involving the terminal ends of the
Bari transposons.
The evolutionary scenario observed in the extant Drosophila species is complicated by
the presence of an additional group of non-autonomous sequences called MITEs (
Figure 1B
).
MITEs (Miniature
I
nverted repeats
T
ransposable
E
lements) are frequently found in eu-
karyotic genomes [
43
46
] and they are considered as evolutionary byproducts, originating
from a rearranged (i.e., internally deleted) ancestral form of TIR elements. Their sub-
sequent amplification in the genome occurred through trans-complementation with the
functional transposase expressed by active TEs. Bari-derived MITEs have been identified in
D. sechellia [
47
] and in other Drosophila species [
30
]. Bari-derived MITEs can be categorized
either as short- or long-MITEs, depending on their sequence length. While both forms
share the same terminal sequences, the internal sequence can be highly variable in length,
with the long form exhibiting sequences unrelated to Bari transposons [
30
]. It has been
proposed that the TIRs of both functional and defective copies (including MITEs) that
retain the transposase binding activity can act as buffer to titrate endogenous levels of the
transposase, [40]. Therefore, it is possible that also Bari-derived MITEs are maintained for
this regulatory purpose.
Cells 2022,11, 583 6 of 17
3. Horizontal Transfer Events Involving Bari Elements
Horizontal transfer (HT) is one of the most obscure yet fascinating aspects underly-
ing the evolutionary dynamics of the genomes [
48
,
49
]. TEs are among the most prone
DNA sequenced to take part in HT events [
50
,
51
]. While during the pre-genomic era
horizontal transposon transfer (HTT) events could be only detected using molecular as-
says, currently we have potent bioinformatic tools that allow HTT inference supported
by statistical methods [
52
]. It is now more evident from genome sequence comparison
that HTT commonly occurs during evolution but it is hard to detect only for two basic
limitations in our approaches. The first is intrinsic to the HTT process, in that we could
detect it if occurs in germline cells. In this case, the horizontally transferred DNA can be
transmitted in the population and we can detect it as an “alien” piece of DNA. Somatic
HTT events could conversely result in a small number of mosaic organisms and would not
be detected because of the low (or very low) representation of the transferred sequence
in whole genome extracts. The second limitation in detecting HTT is due to the restricted
number of sequenced genomes, compared to the number of extant species. Furthermore,
even if there are more than 20,000 genome projects in NCBI (different advancement status—
last access early December 2021) they refer to small individual samples, representative of
entire populations or species. This gives us a poor vision of the sequence variability caused
by HTT, with a consistent loss of event detection at the population level.
Several studies suggest that Bari1 moved horizontally several times during the evolu-
tion among Drosophilidae species. Several works provide evidence that Bari1 HT occurred
between D. melanogaster and D. simulans [
53
], between D. melanogaster and D. yakuba [
54
],
and between D. melanogaster and D. sechellia [
52
]. Moreover, an additional study in 23 se-
quenced species of Drosophila showed that horizontal transfer involving Bari1 elements
also occurred between D. biarmipes and D bipectinata [
30
]. Bari1 elements in the two species
are nearly identical in sequence, despite that the host species divergence dates back to
27 million years ago [55].
4. The Missing Jump to the Next Level
4.1. Why We Cannot Use Bari Transposons as Tools for Chromosomal Integration
An initial effort to develop a new chromosomal integration tool based on the Bari1
transposon was made in Drosophila [
56
]. A binary transposition system was constructed
along the same lines of the P-element system: a helper plasmid (the transposase source)
and a donor plasmid (the transposon source marked with a white reporter gene), were
injected into genotypically suitable fly embryos with the goal of genetically transforming
the recipient strain. After the initial excitement due to the identification of few transpo-
sition events (i.e., red-eyed individuals), their molecular characterization turned out to
be puzzling and frustrating, since the observed phenotype was due to transposition of
the NOF-FB transposon rather than the transposition of Bari1 from the donor plasmid. To
make a long story short, the expression of the Bari1 transposase from the helper plasmid
has possibly deregulated the NOF-FB transposon [
56
], whose transposition is not currently
known and may depend on the activity of unrelated active transposases. Taken together,
these fortuitous observations remind us that unpredictable and complex interactions occur
when we attempt to manipulate the genome. Following a stress condition, the genome
reacts, and the fastest response is often given by the de-repression of transposable elements
in several species [
57
60
]. We are currently investigating the possible cross-interaction
between the overexpression of the Bari1 transposase and the transposition of NOF-FB
in vivo.
Similar attempts to observe the transposition of Bari elements through a transposition
assay were made using cultured cells as experimental systems. Setting up a binary system,
in which the donor transposon was marked with a reporter cassette and the transposase
was expressed by a helper plasmid, did not result in a significant integration over the
background in Drosophila and human cultured cells [
42
,
61
]. Finally, even correcting the
diverging aminoacidic residues in critical transposase subdomains, with the guide of a
Cells 2022,11, 583 7 of 17
multiple transposase alignment containing other active Tc1-like transposons, does not
significantly improve the transposition efficiency of Bari1 in heterologous transposition
assays (RMM unpublished observations).
4.2. Active or Non-Active? That Is the Question
The reiterated and unsuccessful attempts to develop an efficient transposition system
from Bari elements led to question whether Bari transposons are transposition-competent. Ex-
cluding the Bari2 sub-family, which is entirely composed of non-autonomous elements [
39
],
members of the Bari1 and Bari3 sub-families have what it takes to be regarded as functional.
Standing to the general architecture of the IS630/Tc1/mariner transposase, the funda-
mental domains of this enzyme are the DNA binding domain, the GRPR-like domain
(which mediates protein–protein interactions), the nuclear localization signal, the homeo-
like domain, and the catalytic domain [
25
]. All these domains can be predicted in the
transposase of both Bari1 and Bari3. Furthermore, the functionality of the DNA binding
domain has been tested
in vitro
for both transposons [
42
,
61
]. In addition, there is indi-
rect evidence of the transposition ability of Bari transposons coming from population
genetics studies.
A series of population genetics analyses strongly suggest that Bari1 is an active trans-
poson in natural populations of D. melanogaster. Early studies were performed in 46 pop-
ulations of D. melanogaster, which suggested both Bari1 inter- and intra-stock polymor-
phisms [
33
]. Junakovic and collaborators performed additional studies on a Charolles
laboratory population using Southern blot hybridization of single-fly genomic digestions.
A strong difference in the insertion pattern can be highlighted in unstable (Charolles)
versus stable laboratory strains, suggesting that host factors control the transposition fre-
quency [
62
] and the insertion preference [
63
] of Bari1. The strongest evidence that Bari1 is
a functional transposon comes from the observation of an excision event in a population
established from field-collected flies. The excision event, involving one of the two adaptive
Bari1 insertions in the genome of D. melanogaster, was characterized at the molecular level,
demonstrating that it was due to genuine transposition (i.e., presence of the transposition
footprint) [64].
In conclusion, combining the indirect genetic evidence of the mobility of Bari1 transpo-
son with the outcome of the experimental transposition assays, we argue that Bari1 could
be tightly regulated, or alternatively we speculate that Bari1 could be subjected to some
unknown types of activation to become transposition-competent. Further and extensive
in vitro
-directed molecular evolution studies would clarify whether hyperactive variants
can be obtained to develop Bari-based transposition systems.
5. What Do We Know about the Regulation Bari Transposons?
The transposition activity of TEs is tightly regulated at various levels. The copy number
per haploid genome is a critical factor for the resulting fitness of the whole organism since an
excessive TE load can be deleterious for various reasons, ranging from the gene inactivation
to the disturbance of the physiological expression networks [13].
Standing to the current knowledge on Tc1/mariner elements, two possible types of
regulation can be predicted. One is the transposon self-regulation while the other one is
the epigenetic regulation.
One mode of self-regulation is exerted through the dissemination throughout the
genome of inactive TE copies that still retain the transposase binding ability. Defective
copies can act as buffer to titrate endogenous levels of the transposase [
40
]. Since de-
fective copies of Bari elements are abundant, it is conceivable to hypothesize this mode
of autoregulation.
There is some experimental evidence in favor of the self-regulation of Bari elements
through post-transcriptional processing of the transposase mRNA. Few reported data come
from overexpression of the transposase in S2R
+
cultured cells and in D. melanogaster em-
bryos [
42
,
61
] (Figure 2A). Under these experimental conditions, Bari1 and Bari3 transcripts
Cells 2022,11, 583 8 of 17
undergo alternative splicing that is potentially translated into a truncated transposase pro-
tein. It can be predicted that the transcriptional de-repression of Bari elements can inhibit the
transposition through the expression of a dominant-negative transposase form. The pres-
ence of alternatively spliced transcripts of Bari1 has also been reported in a D. melanogaster
HSP83 mutant that deregulates many transposons, including Bari1 [
65
,
66
]. Possibly, the
construction of synthetic Bari1 and Bari3 transposase genes in which all the conventional,
unconventional and cryptic splicing sites have been eliminated, could hopefully enhance
the transposition efficiency of both systems.
Bari Transposons Regulation Relies on the piRNA Pathways
The second mode of regulation of TEs is at the chromatin level. The transcriptional
control of TEs is intimately connected to chromatin control at the TE insertion site, and this
is possible through the recruitment of specific chromatin remodeling complexes that either
open or close the chromatin, thus influencing the transcription.
Genomic structural and transcriptional changes are at the basis of stress responses. In
this view, TEs are an amazing source of variability in the short temporal timeframe that
allows organisms to promptly react to virtually any kind of stress [67].
Figure 2.
The regulation of Bari transposons. (
A
) Spliced transposase mRNA of Bari1 (green)
identified in [
61
] and Bari3 (red) identified in [
42
]. Both spliced transcripts encode a transposase
with non-functional catalytic domain. (
B
) Distribution of piRNA mapping to the Bari1 transposon.
The amount of piRNA is purely representative of the relative fraction matching the ORF (green)
or the heterochromatic inter-monomer junctions (blue) of Bari1 (see text for further details). A
reference element.
Piwi-interacting RNAs (piRNAs) are the most abundant non-coding RNAs in the
germline, aiming at the genome safeguard against TE movement [
68
]. Their action is
mainly exerted through the transcriptional silencing. piRNAs usually originate from the
so-called piRNA clusters, genomic loci riddled of TE relics that form long non-coding
RNAs that are further processed into piRNAs that selectively degrade TE transcripts [
69
].
Subsequently, a heterochromatic repressive state can be induced at the TE insertion site,
reinforcing the transposition control [7072].
In several published reports, piRNA sequences matching Bari1 and Bari2 are de-
scribed [
73
,
74
], confirming that Bari transposons are among the plethora of Drosophila
TEs that are regulated by the piRNA pathway in the germline (Figure 2B). In addition, im-
pairment of the piRNA pathway leads to the transcriptional activation of Bari1, such as in the
HSP83 mutant [
65
], suggesting that transcriptional activation occurs upon piRNA depletion.
Despite the lack of experimental evidence, both Bari clusters of D. melanogaster might
support the transcriptional repression of the Bari elements. The clusters might indeed act as
Cells 2022,11, 583 9 of 17
piRNA clusters, through the expression of small RNA molecules (i.e., piRNA and siRNA)
that in turn regulate the transposition frequency.
Several databases offer the opportunity to search in silico annotated Drosophila piR-
NAs, using sequence similarity criteria. In the piRBase database [
75
], more than 5800 piR-
NAs can be retrieved using Bari1 as a query. Roughly 3800 of them recognize the Bari1
transposase gene. Notably, a small proportion of piRNAs matching the sequence across
the monomer-to-monomer junctions—typical of the Bari1 heterochromatic clusters—can
also be found (Table 1and Figure 2B). Why a piRNA should be directed against a piece
of untranscribed DNA is, however, unclear. Are they byproducts of the piRNA loci tran-
script maturation or could they have some regulatory or structural role? Time (and further
investigations) will tell.
However, direct genetics evidence is currently lacking in support of the piRNA cluster
role of the Bari1 arrays. The currently available chromosomal heterochromatic deletion
that removes the Bari1 cluster in the h39 region also deletes the adjacent Responder locus
([
32
] and references therein; [
76
]), while deletion only involving one of the main satellites
would be more useful. In addition, the lack of precise mapping of the small X-linked
cluster currently makes it impossible to perform detailed genetic studies in a Bari-cluster
null genetic background. Hopefully, such kind of chromosomal aberrations will be soon
available due to the application of the most modern genome editing techniques.
Cells 2022,11, 583 10 of 17
Table 1.
piRNAs targeting the Bari1 inter-monomer junction. Data extracted from the piRBase database [
75
] (last accessed March 2021). The sequence used to
query the database encompasses an inter-monomer junction of the heterochromatic Bari1 cluster (TTTGACCACCTCTGGTCATGGTCAAAATTAT). Sequence
matching either the left or the right monomers are marked with different colors (blue and red, respectively). O = ovaries; F = follicle cells; E = eggs; W = wild type;
T = transgenic; M = mutant.
Name Tissue Genetic
Background Methods Reads Sequence Length Reference
piR-dme-2858217 O; E W; T; M
oxidized small RNA
small RNA
1–3 TTTGACCACCTCTGGTCATGGTCAAAA 27 [7779]
piR-dme-3826713 O W; T; M
small RNA
oxidized small RNA
1–6 TCTGGTCATGGTCAAAATTATTTT 24 [77,7981]
piR-dme-8496440 O T small RNA 1–3 TTTGACCACCTCTGGTCATGGTCAA 25 [80]
piR-dme-13381112 O T small RNA 1 CCACCTCTGGTCATGGTCAAAATTAT 26 [80]
piR-dme-21388569 F; O W; T small RNA 1–9 TTTGACCACCTCTGGTCATGGTCAAAAT 28 [79,81,82]
piR-dme-21631816 O W small RNA 1 CACCTCTGGTCATGGTCAAAATTAT 25 [83]
piR-dme-26496558 O T small RNA 1 ACCACCTCTGGTCATGGTCAAAATTA 26 [79]
piR-dme-26779428 O T small RNA 1 CCACCTCTGGTCATGGTCAAAAT 23 [79]
piR-dme-27814712 O T small RNA 1 TCTGGTCATGGTCAAAATTATTT 23 [79]
piR-dme-29438648 O T small RNA 1 TGACCACCTCTGGTCATGGTCAAA 24 [79]
piR-dme-29670403 O T small RNA 1 TTGACCACCTCTGGTCATGGTCAAAA 26 [79]
piR-dme-30537191 O T small RNA 2 TTTGACCACCTCTGGTCATGGTCAAA 26 [79]
piR-dme-31705044 O T small RNA 1 CTCTGGTCATGGTCAAAATTATTT 24 [79]
piR-dme-32470189 O W small RNA 1 TTTGACCACCTCTGGTCATGGTCA 24 [81]
piR-dme-33774286 O W small RNA 1 TGACCACCTCTGGTCATGGTCAAAAT 26 [81]
piR-dme-38817646 O T small RNA 1 CTCTGGTCATGGTCAAAATTATTTT 25 [81]
Cells 2022,11, 583 11 of 17
6. Do Bari Transposons Have a Role in The Genome?
6.1. Contribution in Creating Somatic Mosaicism and Adaptive Insertions
It has been reported that TEs are unleashed in some circumstances, to create somatic
variability that could have a physiological relevance in certain tissue types [
84
]. The
somatic instability of several TEs has been described in two recent papers. The first paper
described the genetic mosaicism of the neurons in the mushroom bodies [
85
], although this
phenomenon has been resized after further studies [
86
,
87
]. The second study revealed the
somatic transposition in the intestinal stem cells [
88
,
89
]. In both cases, Bari1 was found
among the mobilized TEs responsible for the somatic mosaicism in the two tissue types.
The early distribution studies [
33
] suggested a patchy distribution of Bari1 euchromatic
insertions among 46 different populations of D. melanogaster collected worldwide. By
contrast, at least two insertions were invariably detected in all the populations analyzed.
These insertions occurred at the 55F and 91F bands of the polytene chromosomes. After
the completion of the Drosophila genome-sequencing project [
90
], it appeared clear that
both insertions were intimately connected to host genes. Indeed, the insertion in the
55F region falls near the Juvenile hormone epoxy hydrolase (Jheh) gene cluster (Bari-Jheh
insertion), while the 91F insertions are associated to the cyp12a4 gene (Bari1-Cyp12a4
insertion). Further studies in which ChIP-seq data were integrated with gene expression
analyses and phenotypic assays demonstrated that the Bari-Jheh insertion introduced extra
antioxidant response elements upstream of Jheh1 and Jheh2 genes [
91
]. Furthermore, Bari-
Jheh is differentially associated to H3K27me3 in stress vs. non-stress oxidative conditions,
suggesting the addition of histone marks to the intergenic region between Jheh2 and Jheh3
genes, and its association with histone marks enrichment in the promoter of Jheh1 gene [
92
].
The Bari1-Cyp12a4 insertion overlaps with the 3
0
end of the Cyp12a4 gene and it
contributes to the stability of the mature transcript. It has been demonstrated that Bari1-
Cyp12a4 supplies the polyadenylation sequence to the Cyp12a4 transcript [64].
In addition, the Bari1-Cyp12a4 showed an enrichment of H3K27me3 under oxidative
stress conditions [
92
], suggesting an active role of the insertion in altering the epigenetic
context in response to stress.
6.2. Possible Role in Chromatin Assembly
TEs can also act as potent epigenetic modifiers that could change both gene expression
and chromatin structure [
93
] with important evolutionary implications [
94
]. This is possible
thanks to the ability to recruit chromatin proteins [95].
Large-scale mapping of
in vivo
binding sites of chromatin proteins using tethered dam
methyltransferase [
96
,
97
] showed that the clustered Bari1 elements in the h39 region of the
2nd chromosome are targets of HP1, a chromatin protein mainly involved in heterochro-
matin formation [
98
]. It has been reported that Bari1 also contains Polycomb responsive
elements that could collaborate in recruiting additional heterochromatin components [
91
].
This could be of particular relevance when clustered copies of Bari1 are exploited in the
genome. It is therefore possible that both Bari1 clusters could have acquired a structural
role in the heterochromatin of D. melanogaster, such as to ensure proper chromosome
conformation and stability over the cell cycle.
7. The Blurry Promoter: Who Wants to Live Forever?
Along with the characterization of the Bari1 transposition system, the strength of the
Bari1 promoter was tested. Luciferase promoter assays [
99
] conducted in fly cell cultures
(S2R
+
) revealed that Bari1 has a weak promoter if compared to the strong constitutive copia
promoter [
100
]. Weak promoters are typical of the Tc1/mariner transposons, which suffer
from overproduction inhibition and therefore tend to limit the amount of transposase [
101
].
Unexpectedly, the Bari1 promoter drives the reporter transcription also in human, bacteria,
and yeast cells [
100
]. This is quite counterintuitive, since evolutionarily distant genomes
(e.g., animal and bacteria) have profoundly different modes of transcription and promoter
organization [
102
]. Surprisingly, the promoter of Bari3 also showed a similar promiscuous
Cells 2022,11, 583 12 of 17
activity (Figure 3). Due to this feature, the promoters were named “blurry”, to highlight
that they do not “sharply” activate the transcription in a single or few closely related
species. These findings led to the hypothesis that the members of the Bari family can take
advantage of this feature to engage successful HTT events. The ability of TEs promoter
to sustain the transcription of associated genes upon HTT is recognized as one of the
bottlenecks that restricts the success of HTT [
103
]. The presence of blurry promoters was
also assessed in other Tc1- and mariner-like TEs. This observation is in agreement with the
known predisposition of Tc1/mariner elements to be horizontally transferred [
50
,
104
]. It also
suggests a common origin of this promoter type, and a possible common survival strategy
for the elements belonging to the Tc1/mariner superfamily [
105
]. The discovery of the blurry
promoters in the Bari family has also opened the possibility to implement them, together
with many other TE-derived transcriptional control sequences, into expression modules
in order to expand the repertoire of the existing expression vectors with a considerable
improvement of their performances [4].
Figure 3.
Activity of the native promoter of Bari1 and Bari3 in heterologous cellular systems. The
transposon fragment tested in promoter-luciferase assays is depicted in the upper part of the figure.
The % activity compared to strong species-specific constitutive promoters (SV40, copia, URA3, and
CAT for human, fly, yeast, and bacteria cells, respectively), arbitrarily assumed as 100%, is reported
on Y axis of the chart.
8. Concluding Remarks
What We Have Learned and What We Still Have to Learn from Bari Transposons
In this review, we summarized the current scientific literature concerning the trans-
posable elements belonging to the Bari family. Although the scientific interest around this
transposon was mainly focused on its evolutionary history, several important experimental
outcomes are worth noting, which have been (and hopefully will be in the future) important
to deepen our understanding of TE biology.
Many aspects of the Bari transposons’ biology are still not completely known and
should be clarified, such as the low transposition rate
in vitro
. Studies on wild-collected
fly populations will likely be the key to obtaining insights into the regulation of the Bari
elements, as suggested by studies of Junakovic et al. [62].
It is possible that, as suggested by different studies, the Bari transposase could be
intrinsically error-prone, and only occasionally it gives rise to productive transposition
Cells 2022,11, 583 13 of 17
events. Fixing the transposase could possibly allow to obtain a robust transposition system.
We still have to understand how the blurry promoter has evolved, and how it can be used
to develop new tools for the genetic manipulation.
Finally, the determination of the structural and functional role of the heterochromatic
clusters is a task that deserves further investigations, and will be accomplished with the
aid of the genome editing technologies.
We think that more secrets associated to TEs remain to be discovered, and the continu-
ous effort in dissecting the most diverse TEs in nature will contribute to clarifying the role
of these genetic elements in evolution, hopefully attracting more interest in the field of TE
biology, especially from emerging scientists.
Author Contributions:
Writing—original draft preparation, A.P., R.C., R.M., and R.M.M.; writing—
review and editing, A.P., R.C., R.M., and R.M.M. All authors have read and agreed to the published
version of the manuscript.
Funding:
A.P. is supported by a grant from Regione Puglia “Research for Innovation (REFIN)”-POR
PUGLIA FESR-FSE 2014/2020. Codice Pratica: B39303C8.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: Not applicable.
Acknowledgments:
We are grateful to Z. Ivics for constructive discussion and for supporting
in vitro
site-directed mutagenesis experiments in his lab. We are also grateful to all past members of the lab
and all the graduating students for stimulating discussions.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
Sandoval-Villegas, N.; Nurieva, W.; Amberger, M.; Ivics, Z. Contemporary Transposon Tools: A Review and Guide through
Mechanisms and Applications of Sleeping Beauty, piggyBac and Tol2 for Genome Engineering. Int. J. Mol. Sci.
2021
,22, 5084.
[CrossRef] [PubMed]
2. Li, X.; Burnight, E.R.; Cooney, A.L.; Malani, N.; Brady, T.; Sander, J.D.; Staber, J.; Wheelan, S.J.; Joung, J.K.; McCray, P.B., Jr.; et al.
piggyBac transposase tools for genome engineering. Proc. Natl. Acad. Sci. USA 2013,110, E2279–E2287. [CrossRef] [PubMed]
3.
Kesselring, L.; Miskey, C.; Zuliani, C.; Querques, I.; Kapitonov, V.; Laukó, A.; Fehér, A.; Palazzo, A.; Diem, T.; Lustig, J.; et al. A
single amino acid switch converts the Sleeping Beauty transposase into an efficient unidirectional excisionase with utility in stem
cell reprogramming. Nucleic Acids Res. 2020,48, 316–331. [CrossRef] [PubMed]
4.
Palazzo, A.; Marsano, R.M. Transposable elements: A jump toward the future of expression vectors. Crit. Rev. Biotechnol.
2021
,41,
1–27. [CrossRef]
5.
Rubin, G.M.; Spradling, A.C. Genetic transformation of Drosophila with transposable element vectors. Science
1982
,218,
348–353. [CrossRef]
6.
Spradling, A.C.; Rubin, G.M. Transposition of cloned P elements into Drosophila germ line chromosomes. Science
1982
,218,
341–347. [CrossRef]
7.
O’Brochta, D.A.; Handler, A.M. Mobility of P elements in drosophilids and nondrosophilids. Proc. Natl. Acad. Sci. USA
1988
,85,
6052–6056. [CrossRef]
8.
Tenzen, T.; Matsutani, S.; Ohtsubo, E. Site-specific transposition of insertion sequence IS630. J. Bacteriol.
1990
,172,
3830–3836. [CrossRef]
9.
Plasterk, R.H.A. The Tc1/mariner Transposon Family. In Transposable Elements; Saedler, H., Gierl, A., Eds.; Springer: Berlin/Heidelberg,
Germany, 1996; pp. 125–143.
10.
Miskey, C.; Izsvak, Z.; Kawakami, K.; Ivics, Z. DNA transposons in vertebrate functional genomics. Cell Mol. Life Sci.
2005
,62,
629–641. [CrossRef]
11.
Prommersberger, S.; Reiser, M.; Beckmann, J.; Danhof, S.; Amberger, M.; Quade-Lyssy, P.; Einsele, H.; Hudecek, M.; Bonig, H.;
Ivics, Z. CARAMBA: A first-in-human clinical trial with SLAMF7 CAR-T cells prepared by virus-free Sleeping Beauty gene
transfer to treat multiple myeloma. Gene Ther. 2021,28, 560–571. [CrossRef]
12.
Wicker, T.; Gundlach, H.; Spannagl, M.; Uauy, C.; Borrill, P.; Ramírez-González, R.H.; De Oliveira, R.; Mayer, K.F.X.;
Paux, E.
;
Choulet, F.; et al. Impact of transposable elements on genome structure and evolution in bread wheat. Genome Biol.
2018
,
19, 103. [CrossRef]
13.
Bourque, G.; Burns, K.H.; Gehring, M.; Gorbunova, V.; Seluanov, A.; Hammell, M.; Imbeault, M.; Izsvák, Z.; Levin, H.L.;
Macfarlan, T.S.; et al. Ten things you should know about transposable elements. Genome Biol. 2018,19, 199. [CrossRef]
Cells 2022,11, 583 14 of 17
14.
Cain, A.K.; Barquist, L.; Goodman, A.L.; Paulsen, I.T.; Parkhill, J.; Van Opijnen, T. A decade of advances in transposon-insertion
sequencing. Nat. Rev. Genet. 2020,21, 526–540. [CrossRef]
15.
Kaya-Okur, H.S.; Wu, S.J.; Codomo, C.A.; Pledger, E.S.; Bryson, T.D.; Henikoff, J.G.; Ahmad, K.; Henikoff, S. CUT&Tag for
efficient epigenomic profiling of small samples and single cells. Nat. Commun. 2019,10, 1930. [CrossRef]
16.
Caggese, C.; Caizzi, R.; Bozzetti, M.P.; Barsanti, P.; Ritossa, F. Genetic determinants of glutamine synthetase in Drosophila melanogaster:
A gene for glutamine synthetase I resides in the 21B3-6 region. Biochem. Genet. 1988,26, 571–584. [CrossRef]
17.
Caggese, C.; Caizzi, R.; Barsanti, P.; Bozzetti, M.P. Mutations in the glutamine synthetase I (gsI) gene produce embryo-lethal
female sterility in Drosophila melanogaster.Dev. Genet. 1992,13, 359–366. [CrossRef]
18.
Caizzi, R.; Bozzetti, M.P.; Caggese, C.; Ritossa, F. Homologous nuclear genes encode cytoplasmic and mitochondrial glutamine
synthetase in Drosophila melanogaster.J. Mol. Biol. 1990,212, 17–26. [CrossRef]
19.
Pimpinelli, S.; Dimitri, P. Cytogenetic analysis of segregation distortion in Drosophila melanogaster: The cytological organization of
the Responder (Rsp) locus. Genetics 1989,121, 765–772. [CrossRef]
20.
Wu, C.I.; True, J.R.; Johnson, N. Fitness reduction associated with the deletion of a satellite DNA array. Nature
1989
,341,
248–251. [CrossRef]
21.
Wu, C.-I.; Lyttle, T.W.; Wu, M.-L.; Lin, G.-F. Association between a satellite DNA sequence and the responder of segregation
distorter in D. melanogaster.Cell 1988,54, 179–189. [CrossRef]
22.
Brittnacher, J.G.; Ganetzky, B. On the components of segregation distortion in Drosophila melanogaster. IV. Construction and
analysis of free duplications for the Responder locus. Genetics 1989,121, 739–750. [CrossRef] [PubMed]
23.
Ganetzky, B. On the components of segregation distortion in Drosophila melanogaster.Genetics
1977
,86, 321–355.
[CrossRef] [PubMed]
24.
Moschetti, R.; Chlamydas, S.; Marsano, R.M.; Caizzi, R. Conserved motifs and dynamic aspects of the terminal inverted repeat
organization within Bari-like transposons. Mol. Genet. Genom. 2008,279, 451–461. [CrossRef] [PubMed]
25.
Plasterk, R.H.; Izsvák, Z.; Ivics, Z. Resident aliens: The Tc1/mariner superfamily of transposable elements. Trends Genet.
1999
,15,
326–332. [CrossRef]
26.
Petrov, D.A.; Schutzman, J.L.; Hartl, D.L.; Lozovskaya, E.R. Diverse transposable elements are mobilized in hybrid dysgenesis in
Drosophila virilis. Proc. Natl. Acad. Sci. USA 1995,92, 8050–8054. [CrossRef]
27.
Merriman, P.J.; Grimes, C.D.; Ambroziak, J.; Hackett, D.A.; Skinner, P.; Simmons, M.J. S elements: A family of Tc1-like transposons
in the genome of Drosophila melanogaster.Genetics 1995,141, 1425–1438. [CrossRef]
28.
Arcà, B.; Savakis, C. Distribution of the Transposable Element Minos in the Genus Drosophila. Genetica
2000
,108,
263–267. [CrossRef]
29.
Izsvak, Z.; Khare, D.; Behlke, J.; Heinemann, U.; Plasterk, R.H.; Ivics, Z. Involvement of a bifunctional, paired-like DNA-binding
domain and a transpositional enhancer in Sleeping Beauty transposition. J. Biol. Chem. 2002,277, 34581–34588. [CrossRef]
30.
Palazzo, A.; Lovero, D.; D’Addabbo, P.; Caizzi, R.; Marsano, R.M. Identification of Bari Transposons in 23 Sequenced Drosophila
Genomes Reveals Novel Structural Variants, MITEs and Horizontal Transfer. PLoS ONE 2016,11, e0156014. [CrossRef]
31.
McGurk, M.P.; Barbash, D.A. Double insertion of transposable elements provides a substrate for the evolution of satellite DNA.
Genome Res. 2018,28, 714–725. [CrossRef]
32.
Caizzi, R.; Caggese, C.; Pimpinelli, S. Bari-1, a new transposon-like family in Drosophila melanogaster with a unique heterochromatic
organization. Genetics 1993,133, 335–345. [CrossRef]
33.
Caggese, C.; Pimpinelli, S.; Barsanti, P.; Caizzi, R. The distribution of the transposable element Bari-1 in the Drosophila melanogaster
and Drosophila simulans genomes. Genetica 1995,96, 269–283. [CrossRef]
34.
Marsano, R.M.; Milano, R.; Minervini, C.; Moschetti, R.; Caggese, C.; Barsanti, P.; Caizzi, R. Organization and possible origin of
the Bari-1 cluster in the heterochromatic h39 region of Drosophila melanogaster.Genetica 2003,117, 281–289. [CrossRef]
35.
Berloco, M.F.; Minervini, C.F.; Moschetti, R.; Palazzo, A.; Viggiano, L.; Marsano, R.M. Evidence of the Physical Interaction
between Rpl22 and the Transposable Element Doc5, a Heterochromatic Transposon of Drosophila melanogaster.Genes
2021
,
12, 1997. [CrossRef]
36.
Marsano, R.M.; Marconi, S.; Moschetti, R.; Barsanti, P.; Caggese, C.; Caizzi, R. MAX, a novel retrotransposon of the BEL-Pao
family, is nested within the Bari1 cluster at the heterochromatic h39 region of chromosome 2 in Drosophila melanogaster.Mol. Genet.
Genom. 2004,270, 477–484. [CrossRef]
37.
Marsano, R.M.; Moschetti, R.; Barsanti, P.; Caggese, C.; Caizzi, R. A survey of the DNA sequences surrounding the Bari1 repeats
in the pericentromeric h39 region of Drosophila melanogaster.Gene 2003,307, 167–174. [CrossRef]
38.
Crooks, G.E.; Hon, G.; Chandonia, J.M.; Brenner, S.E. WebLogo: A sequence logo generator. Genome Res.
2004
,14,
1188–1190. [CrossRef]
39.
Moschetti, R.; Caggese, C.; Barsanti, P.; Caizzi, R. Intra- and interspecies variation among Bari-1 elements of the melanogaster
species group. Genetics 1998,150, 239–250. [CrossRef]
40.
Hartl, D.L.; Lozovskaya, E.R.; Nurminsky, D.I.; Lohe, A.R. What restricts the activity of mariner-like transposable elements.
Trends Genet. 1997,13, 197–201. [CrossRef]
41.
Claeys Bouuaert, C.; Chalmers, R.M. Gene therapy vectors: The prospects and potentials of the cut-and-paste transposons.
Genetica 2010,138, 473–484. [CrossRef]
42.
Palazzo, A.; Moschetti, R.; Caizzi, R.; Marsano, R.M. The Drosophila mojavensis Bari3 transposon: Distribution and functional
characterization. Mob. DNA 2014,5, 21. [CrossRef] [PubMed]
Cells 2022,11, 583 15 of 17
43.
Bureau, T.E.; Wessler, S.R. Tourist: A large family of small inverted repeat elements frequently associated with maize genes. Plant
Cell 1992,4, 1283–1294. [CrossRef] [PubMed]
44.
Jiang, N.; Feschotte, C.; Zhang, X.; Wessler, S.R. Using rice to understand the origin and amplification of miniature inverted
repeat transposable elements (MITEs). Curr. Opin. Plant Biol. 2004,7, 115–119. [CrossRef] [PubMed]
45.
Quesneville, H.; Nouaud, D.; Anxolabéhère, D. P elements and MITE relatives in the whole genome sequence of Anopheles
gambiae. BMC Genom. 2006,7, 214. [CrossRef]
46.
De Freitas Ortiz, M.; Silva Loreto, E.L. The hobo-related elements in the melanogaster species group. Genet. Res.
2008
,90,
243–252. [CrossRef]
47.
Dias, E.S.; Carareto, C.M. msechBari, a new MITE-like element in Drosophila sechellia related to the Bari transposon. Genet. Res.
2011,93, 381–385. [CrossRef]
48.
Keeling, P.J. Functional and ecological impacts of horizontal gene transfer in eukaryotes. Curr. Opin. Genet. Dev.
2009
,19,
613–619. [CrossRef]
49. Boto, L. Horizontal gene transfer in the acquisition of novel traits by metazoans. Proc. Biol. Sci. 2014,281, 20132450. [CrossRef]
50.
Schaack, S.; Gilbert, C.; Feschotte, C. Promiscuous DNA: Horizontal transfer of transposable elements and why it matters for
eukaryotic evolution. Trends Evol. 2010,25, 537–546. [CrossRef]
51.
Wallau, G.L.; Vieira, C.; Loreto, É.L.S. Genetic exchange in eukaryotes through horizontal transfer: Connected by the mobilome.
Mob. DNA 2018,9, 6. [CrossRef]
52.
Wallau, G.L.; Capy, P.; Loreto, E.; Le Rouzic, A.; Hua-Van, A. VHICA, a New Method to Discriminate between Vertical and Hori-
zontal Transposon Transfer: Application to the Mariner Family within Drosophila. Mol. Biol. Evol.
2016
,33,
1094–1109. [CrossRef]
53.
Dias, E.S.; Carareto, C.M. Ancestral polymorphism and recent invasion of transposable elements in Drosophila species. BMC
Evol. Biol. 2012,12, 119. [CrossRef]
54.
Bartolome, C.; Bello, X.; Maside, X. Widespread evidence for horizontal transfer of transposable elements across Drosophila
genomes. Genome Biol. 2009,10, R22. [CrossRef]
55.
Ometto, L.; Cestaro, A.; Ramasamy, S.; Grassi, A.; Revadi, S.; Siozios, S.; Moretto, M.; Fontana, P.; Varotto, C.; Pisani, D.; et al.
Linking genomics and ecology to investigate the complex evolution of an invasive Drosophila pest. Genome Biol. Evol.
2013
,5,
745–757. [CrossRef]
56.
Moschetti, R.; Marsano, R.M.; Barsanti, P.; Caggese, C.; Caizzi, R. FB elements can promote exon shuffling: A promoter-
less white allele can be reactivated by FB mediated transposition in Drosophila melanogaster.Mol. Genet. Genom.
2004
,271,
394–401. [CrossRef]
57.
Capy, P.; Gasperi, G.; Biémont, C.; Bazin, C. Stress and transposable elements: Co-evolution or useful parasites? Heredity
2000
,85,
101–106. [CrossRef]
58.
Feng, G.; Leem, Y.-E.; Levin, H.L. Transposon integration enhances expression of stress response genes. Nucleic Acids Res.
2013
,
41, 775–789. [CrossRef]
59.
Rech, G.E.; Bogaerts-Márquez, M.; Barrón, M.G.; Merenciano, M.; Villanueva-Cañas, J.L.; Horváth, V.; Fiston-Lavier, A.-S.;
Luyten, I.
; Venkataram, S.; Quesneville, H.; et al. Stress response, behavior, and development are shaped by transposable
element-induced mutations in Drosophila. PLoS Genet. 2019,15, e1007900. [CrossRef]
60.
Horváth, V.; Merenciano, M.; González, J. Revisiting the Relationship between Transposable Elements and the Eukaryotic Stress
Response. Trends Genet. 2017,33, 832–841. [CrossRef]
61.
Palazzo, A.; Marconi, S.; Specchia, V.; Bozzetti, M.P.; Ivics, Z.; Caizzi, R.; Marsano, R.M. Functional Characterization of the Bari1
Transposition System. PLoS ONE 2013,8, e79385. [CrossRef]
62.
Junakovic, N.; Di Franco, C.; Terrinoni, A. Evidence for a host role in regulating the activity of transposable elements in
Drosophila melanogaster: The case of the persistent instability of Bari 1 elements in Charolles stock. Genetica
1997
,100, 149–154.
[CrossRef] [PubMed]
63.
Soriano, S.; Fortunati, D.; Junakovic, N. Evidence for the Host Contribution in the Definition of Preferential Insertion Sites of the
Elements of Bari 1 Transposon Family in Drosophila melanogaster.J. Mol. Evol. 2002,55, 606–615. [CrossRef] [PubMed]
64.
Marsano, R.M.; Caizzi, R.; Moschetti, R.; Junakovic, N. Evidence for a functional interaction between the Bari1 transposable
element and the cytochrome P450 cyp12a4 gene in Drosophila melanogaster.Gene 2005,357, 122–128. [CrossRef]
65.
Specchia, V.; Piacentini, L.; Tritto, P.; Fanti, L.; D’Alessandro, R.; Palumbo, G.; Pimpinelli, S.; Bozzetti, M.P. Hsp90 prevents
phenotypic variation by suppressing the mutagenic activity of transposons. Nature 2010,463, 662–665. [CrossRef] [PubMed]
66.
Specchia, V.; Bozzetti, M.P. The Role of HSP90 in Preserving the Integrity of Genomes Against Transposons Is Evolutionarily
Conserved. Cells 2021,10, 1096. [CrossRef]
67.
Pimpinelli, S.; Piacentini, L. Environmental change and the evolution of genomes: Transposable elements as translators of
phenotypic plasticity into genotypic variability. Funct. Ecol. 2020,34, 428–441. [CrossRef]
68. Malone, C.D.; Hannon, G.J. Small RNAs as guardians of the genome. Cell 2009,136, 656–668. [CrossRef]
69.
Brennecke, J.; Aravin, A.A.; Stark, A.; Dus, M.; Kellis, M.; Sachidanandam, R.; Hannon, G.J. Discrete small RNA-generating loci
as master regulators of transposon activity in Drosophila. Cell 2007,128, 1089–1103. [CrossRef]
70.
Grewal, S.I.S.; Elgin, S.C.R. Transcription and RNA interference in the formation of heterochromatin. Nature
2007
,447,
399–406. [CrossRef]
Cells 2022,11, 583 16 of 17
71.
Wang, S.H.; Elgin, S.C.R. Drosophila Piwi functions downstream of piRNA production mediating a chromatin-based transposon
silencing mechanism in female germ line. Proc. Natl. Acad. Sci. USA 2011,108, 21164–21169. [CrossRef]
72.
Le Thomas, A.; Rogers, A.K.; Webster, A.; Marinov, G.K.; Liao, S.E.; Perkins, E.M.; Hur, J.K.; Aravin, A.A.; Tóth, K.F. Piwi
induces piRNA-guided transcriptional silencing and establishment of a repressive chromatin state. Genes Dev.
2013
,27,
390–399. [CrossRef]
73.
Wang, H.; Ma, Z.; Niu, K.; Xiao, Y.; Wu, X.; Pan, C.; Zhao, Y.; Wang, K.; Zhang, Y.; Liu, N. Antagonistic roles of Nibbler and Hen1
in modulating piRNA 30ends in Drosophila. Development 2016,143, 530–539. [CrossRef]
74.
Pritykin, Y.; Brito, T.; Schupbach, T.; Singh, M.; Pane, A. Integrative analysis unveils new functions for the Drosophila Cutoff
protein in noncoding RNA biogenesis and gene regulation. RNA 2017,23, 1097–1109. [CrossRef]
75.
Wang, J.; Zhang, P.; Lu, Y.; Li, Y.; Zheng, Y.; Kan, Y.; Chen, R.; He, S. piRBase: A comprehensive database of piRNA sequences.
Nucleic Acids Res. 2019,47, D175–D180. [CrossRef]
76.
Chlamydas, S.; Heun, P.; Dimitri, P.; Moschetti, R.; Barsanti, P.; Caizzi, R. The paracentric inversion In(2Rh)PL alters the
centromeric organization of chromosome 2 in Drosophila melanogaster.Chromosome Res. 2009,17, 1–9. [CrossRef]
77.
Zhang, F.; Wang, J.; Xu, J.; Zhang, Z.; Koppetsch, B.S.; Schultz, N.; Vreven, T.; Meignin, C.; Davis, I.; Zamore, P.D.; et al. UAP56
couples piRNA clusters to the perinuclear transposon silencing machinery. Cell 2012,151, 871–884. [CrossRef]
78.
Grentzinger, T.; Armenise, C.; Brun, C.; Mugat, B.; Serrano, V.; Pelisson, A.; Chambeyron, S. piRNA-mediated transgenerational
inheritance of an acquired trait. Genome Res. 2012,22, 1877–1888. [CrossRef]
79.
Mugat, B.; Akkouche, A.; Serrano, V.; Armenise, C.; Li, B.; Brun, C.; Fulga, T.A.; Van Vactor, D.; Pélisson, A.;
Chambeyron, S.
MicroRNA-Dependent Transcriptional Silencing of Transposable Elements in Drosophila Follicle Cells. PLoS Genet.
2015
,
11, e1005194. [CrossRef]
80.
Olovnikov, I.; Ryazansky, S.; Shpiz, S.; Lavrov, S.; Abramov, Y.; Vaury, C.; Jensen, S.; Kalmykova, A. De novo piRNA cluster
formation in the Drosophila germ line triggered by transgenes containing a transcribed transposon fragment. Nucleic Acids Res.
2013,41, 5757–5768. [CrossRef]
81.
Feltzin, V.L.; Khaladkar, M.; Abe, M.; Parisi, M.; Hendriks, G.J.; Kim, J.; Bonini, N.M. The exonuclease Nibbler regulates
age-associated traits and modulates piRNA length in Drosophila. Aging Cell 2015,14, 443–452. [CrossRef]
82.
Chirn, G.W.; Rahman, R.; Sytnikova, Y.A.; Matts, J.A.; Zeng, M.; Gerlach, D.; Yu, M.; Berger, B.; Naramura, M.; Kile, B.T.; et al.
Conserved piRNA Expression from a Distinct Set of piRNA Cluster Loci in Eutherian Mammals. PLoS Genet.
2015
,11, e1005652.
[CrossRef] [PubMed]
83.
Shpiz, S.; Ryazansky, S.; Olovnikov, I.; Abramov, Y.; Kalmykova, A. Euchromatic transposon insertions trigger production of
novel Pi- and endo-siRNAs at the target sites in the drosophila germline. PLoS Genet. 2014,10, e1004138. [CrossRef] [PubMed]
84. Loreto, E.L.S.; Pereira, C.M. Somatizing the transposons action. Mob. Genet. Elem. 2017,7, 1–9. [CrossRef]
85.
Perrat, P.N.; DasGupta, S.; Wang, J.; Theurkauf, W.; Weng, Z.; Rosbash, M.; Waddell, S. Transposition-driven genomic heterogene-
ity in the Drosophila brain. Science 2013,340, 91–95. [CrossRef] [PubMed]
86.
Treiber, C.D.; Waddell, S. Resolving the prevalence of somatic transposition in Drosophila. Elife
2017
,6, e28297.
[CrossRef] [PubMed]
87.
Treiber, C.D.; Waddell, S. Transposon expression in the Drosophila brain is driven by neighboring genes and diversifies the neural
transcriptome. bioRxiv 2019, 838045. [CrossRef] [PubMed]
88.
Siudeja, K.; Nassari, S.; Gervais, L.; Skorski, P.; Lameiras, S.; Stolfa, D.; Zande, M.; Bernard, V.; Frio, T.R.; Bardin, A.J. Frequent
Somatic Mutation in Adult Intestinal Stem Cells Drives Neoplasia and Genetic Mosaicism during Aging. Cell Stem Cell
2015
,17,
663–674. [CrossRef] [PubMed]
89.
Siudeja, K.; Van den Beek, M.; Riddiford, N.; Boumard, B.; Wurmser, A.; Stefanutti, M.; Lameiras, S.; Bardin, A.J. Unraveling the
features of somatic transposition in the Drosophila intestine. Embo J. 2021,40, e106388. [CrossRef]
90.
Adams, M.D.; Celniker, S.E.; Holt, R.A.; Evans, C.A.; Gocayne, J.D.; Amanatides, P.G.; Scherer, S.E.; Li, P.W.; Hoskins, R.A.;
Galle, R.F.; et al. The genome sequence of Drosophila melanogaster.Science 2000,287, 2185–2195. [CrossRef]
91.
Guio, L.; Barron, M.G.; Gonzalez, J. The transposable element Bari-Jheh mediates oxidative stress response in Drosophila. Mol.
Ecol. 2014,23, 2020–2030. [CrossRef]
92.
Guio, L.; Vieira, C.; Gonzalez, J. Stress affects the epigenetic marks added by natural transposable element insertions in
Drosophila melanogaster.Sci. Rep. 2018,8, 12197. [CrossRef]
93.
Slotkin, R.K.; Martienssen, R. Transposable elements and the epigenetic regulation of the genome. Nat. Rev. Genet.
2007
,8,
272–285. [CrossRef]
94.
Caizzi, R.; Moschetti, R.; Piacentini, L.; Fanti, L.; Marsano, R.M.; Dimitri, P. Comparative Genomic Analyses Provide New Insights
into the Evolutionary Dynamics of Heterochromatin in Drosophila. PLoS Genet. 2016,12, e1006212. [CrossRef]
95.
Moschetti, R.; Palazzo, A.; Lorusso, P.; Viggiano, L.; Marsano, R.M. “What You Need, Baby, I Got It”: Transposable Elements as
Suppliers of Cis-Operating Sequences in Drosophila. Biology 2020,9, 25. [CrossRef]
96.
Van Steensel, B.; Henikoff, S. Identification of
in vivo
DNA targets of chromatin proteins using tethered Dam methyltransferase.
Nat. Biotechnol. 2000,18, 424–428. [CrossRef]
97.
Van Steensel, B.; Delrow, J.; Henikoff, S. Chromatin profiling using targeted DNA adenine methyltransferase. Nat. Genet.
2001
,27,
304–308. [CrossRef]
98.
Casale, A.M.; Cappucci, U.; Piacentini, L. Unravelling HP1 functions: Post-transcriptional regulation of stem cell fate. Chromosoma
2021,130, 103–111. [CrossRef]
Cells 2022,11, 583 17 of 17
99.
Brasier, A.R.; Ron, D. Luciferase reporter gene assay in mammalian cells. In Methods Enzymol; Academic Press: Cambridge, MA,
USA, 1992; Volume 216, pp. 386–397.
100.
Palazzo, A.; Caizzi, R.; Viggiano, L.; Marsano, R.M. Does the Promoter Constitute a Barrier in the Horizontal Transposon Transfer
Process? Insight from Bari Transposons. Genome Biol. Evol. 2017,9, 1637–1645. [CrossRef]
101.
Hartl, D.L.; Lohe, A.R.; Lozovskaya, E.R. Regulation of the transposable element mariner. Genetica
1997
,100, 177–184. [CrossRef]
102.
Kanhere, A.; Bansal, M. Structural properties of promoters: Similarities and differences between prokaryotes and eukaryotes.
Nucleic Acids 2005,33, 3165–3175. [CrossRef]
103.
Silva, J.C.; Loreto, E.L.; Clark, J.B. Factors that affect the horizontal transfer of transposable elements. Curr. Issues Mol. Biol.
2004
,
6, 57–71. [PubMed]
104.
Peccoud, J.; Loiseau, V.; Cordaux, R.; Gilbert, C. Massive horizontal transfer of transposable elements in insects. Proc. Natl. Acad.
Sci. USA 2017,114, 4721–4726. [CrossRef] [PubMed]
105.
Palazzo, A.; Lorusso, P.; Miskey, C.; Walisko, O.; Gerbino, A.; Marobbio, C.M.T.; Ivics, Z.; Marsano, R.M. Transcriptionally
promiscuous “blurry” promoters in Tc1/mariner transposons allow transcription in distantly related genomes. Mob. DNA
2019
,
10, 13. [CrossRef] [PubMed]
... When TEs translocate in genomes, they are well recognized for producing genetic changes and can impact gene expression directly or indirectly by affecting the expression of nearby genes [10]. Because the unrestricted activity of TEs is usually harmful, the host organism has multiple defense systems in place to limit TE mobility at various points of their transposition cycle [11,12]. Activating TEs in response to stress may result in random genetic alterations that result in variances and, on rare occasions, genotypes that are better adapted to the relevant environmental stress. ...
Article
Full-text available
menu Journals IJMS Volume 23 Issue 24 10.3390/ijms232415967 settingsOrder Article Reprints Open AccessArticle Mobilome of the Rhus Gall Aphid Schlechtendalia chinensis Provides Insight into TE Insertion-Related Inactivation of Functional Genes by Aftab Ahmad andZhumei Ren * School of Life Science, Shanxi University, Taiyuan 030006, China * Author to whom correspondence should be addressed. Int. J. Mol. Sci. 2022, 23(24), 15967; https://doi.org/10.3390/ijms232415967 Received: 29 October 2022 / Revised: 7 December 2022 / Accepted: 12 December 2022 / Published: 15 December 2022 (This article belongs to the Section Molecular Genetics and Genomics) Download Browse Figures Review Reports Versions Notes Abstract Transposable elements (TEs) comprise a considerable proportion of insect genomic DNA; how they contribute to genome structure and organization is still poorly understood. Here, we present an analysis of the TE repertoire in the chromosome-level genome assembly of Rhus gall aphid Schlechtendalia chinensis. The TE fractions are composed of at least 32 different superfamilies and many TEs from different families were transcriptionally active in the S. chinensis genome. Furthermore, different types of transposase-derived proteins were also found in the S. chinensis genome. We also provide insight into the TEs related insertional inactivation, and exogenization of TEs in functional genes. We considered that the presence of TE fragments in the introns of functional genes could impact the activity of functional genes, and a large number of TE fragments in introns could lead to the indirect inactivation of functional genes. The present study will be beneficial in understanding the role and impact of TEs in genomic evolution of their hosts.
... Interestingly, TEs are able to horizontally transfer between genomes of diverse eukaryotic species. This happens more often with DNA transposons and LTRs, but horizontal transposon transfer was also reported for some non-LTR retrotransposons [21][22][23]. ...
Article
Full-text available
Transposable elements (TEs) have been extensively studied for decades. In recent years, the introduction of whole-genome and whole-transcriptome approaches, as well as single-cell resolution techniques, provided a breakthrough that uncovered TE involvement in host gene expression regulation underlying multiple normal and pathological processes. Of particular interest is increased TE activity in neuronal tissue, and specifically in the hippocampus, that was repeatedly demonstrated in multiple experiments. On the other hand, numerous neuropathologies are associated with TE dysregulation. Here, we provide a comprehensive review of literature about the role of TEs in neurons published over the last three decades. The first chapter of the present review describes known mechanisms of TE interaction with host genomes in general, with the focus on mammalian and human TEs; the second chapter provides examples of TE exaptation in normal neuronal tissue, including TE involvement in neuronal differentiation and plasticity; and the last chapter lists TE-related neuropathologies. We sought to provide specific molecular mechanisms of TE involvement in neuron-specific processes whenever possible; however, in many cases, only phenomenological reports were available. This underscores the importance of further studies in this area.
Article
Full-text available
Chromatin is a highly dynamic biological entity that allows for both the control of gene expression and the stabilization of chromosomal domains. Given the high degree of plasticity observed in model and non-model organisms, it is not surprising that new chromatin components are frequently described. In this work, we tested the hypothesis that the remnants of the Doc5 transposable element, which retains a heterochromatin insertion pattern in the melanogaster species complex, can be bound by chromatin proteins, and thus be involved in the organization of heterochromatic domains. Using the Yeast One Hybrid approach, we found Rpl22 as a potential interacting protein of Doc5. We further tested in vitro the observed interaction through Electrophoretic Mobility Shift Assay, uncovering that the N-terminal portion of the protein is sufficient to interact with Doc5. However, in situ localization of the native protein failed to detect Rpl22 association with chromatin. The results obtained are discussed in the light of the current knowledge on the extra-ribosomal role of ribosomal protein in eukaryotes, which suggests a possible role of Rpl22 in the determination of the heterochromatin in Drosophila.
Article
Full-text available
Heterochromatin protein 1 (HP1) is a non-histone chromosomal protein first identified in Drosophila as a major component of constitutive heterochromatin, required for stable epigenetic gene silencing in many species including humans. Over the years, several studies have highlighted additional roles of HP1 in different cellular processes including telomere maintenance, DNA replication and repair, chromosome segregation and, surprisingly, positive regulation of gene expression. In this review, we briefly summarize past research and recent results supporting the unexpected and emerging role of HP1 in activating gene expression. In particular, we discuss the role of HP1 in post-transcriptional regulation of mRNA processing because it has proved decisive in the control of germline stem cells homeostasis in Drosophila and has certainly added a new dimension to our understanding on HP1 targeting and functions in epigenetic regulation of stem cell behaviour.
Article
Full-text available
The HSP90 protein is a molecular chaperone intensively studied for its role in numerous cellular processes both under physiological and stress conditions. This protein acts on a wide range of substrates with a well-established role in cancer and neurological disorders. In this review, we focused on the involvement of HSP90 in the silencing of transposable elements and in the genomic integrity maintenance. The common feature of transposable elements is the potential jumping in new genomic positions, causing chromosome structure rearrangements, gene mutations, and influencing gene expression levels. The role of HSP90 in the control of these elements is evolutionarily conserved and opens new perspectives in the HSP90-related mechanisms underlying human disorders. Here, we discuss the hypothesis that its role in the piRNA pathway regulating transposons may be implicated in the onset of neurological diseases.
Article
Full-text available
Transposons are mobile genetic elements evolved to execute highly efficient integration of their genes into the genomes of their host cells. These natural DNA transfer vehicles have been harnessed as experimental tools for stably introducing a wide variety of foreign DNA sequences, including selectable marker genes, reporters, shRNA expression cassettes, mutagenic gene trap cassettes, and therapeutic gene constructs into the genomes of target cells in a regulated and highly efficient manner. Given that transposon components are typically supplied as naked nucleic acids (DNA and RNA) or recombinant protein, their use is simple, safe, and economically competitive. Thus, transposons enable several avenues for genome manipulations in vertebrates, including transgenesis for the generation of transgenic cells in tissue culture comprising the generation of pluripotent stem cells, the production of germline-transgenic animals for basic and applied research, forward genetic screens for functional gene annotation in model species and therapy of genetic disorders in humans. This review describes the molecular mechanisms involved in transposition reactions of the three most widely used transposon systems currently available (Sleeping Beauty, piggyBac, and Tol2), and discusses the various parameters and considerations pertinent to their experimental use, highlighting the state-of-the-art in transposon technology in diverse genetic applications.
Article
Full-text available
Clinical development of chimeric antigen receptor (CAR)-T-cell therapy has been enabled by advances in synthetic biology, genetic engineering, clinical-grade manufacturing, and complex logistics to distribute the drug product to treatment sites. A key ambition of the CARAMBA project is to provide clinical proof-of-concept for virus-free CAR gene transfer using advanced Sleeping Beauty (SB) transposon technology. SB transposition in CAR-T engineering is attractive due to the high rate of stable CAR gene transfer enabled by optimized hyperactive SB100X transposase and transposon combinations, encoded by mRNA and minicircle DNA, respectively, as preferred vector embodiments. This approach bears the potential to facilitate and expedite vector procurement, CAR-T manufacturing and distribution, and the promise to provide a safe, effective, and economically sustainable treatment. As an exemplary and novel target for SB-based CAR-T cells, the CARAMBA consortium has selected the SLAMF7 antigen in multiple myeloma. SLAMF7 CAR-T cells confer potent and consistent anti-myeloma activity in preclinical assays in vitro and in vivo. The CARAMBA clinical trial (Phase-I/IIA; EudraCT: 2019-001264-30) investigates the feasibility, safety, and anti-myeloma efficacy of autologous SLAMF7 CAR-T cells. CARAMBA is the first clinical trial with virus-free CAR-T cells in Europe, and the first clinical trial that uses advanced SB technology worldwide.
Article
Full-text available
Transposable elements (TEs) play a significant role in evolution, contributing to genetic variation. However, TE mobilization in somatic cells is not well understood. Here, we address the prevalence of transposition in a somatic tissue, exploiting the Drosophila midgut as a model. Using whole-genome sequencing of in vivo clonally expanded gut tissue, we have mapped hundreds of high-confidence somatic TE integration sites genome-wide. We show that somatic retrotransposon insertions are associated with inactivation of the tumor suppressor Notch, likely contributing to neoplasia formation. Moreover, applying Oxford Nanopore long-read sequencing technology we provide evidence for tissue-specific differences in retrotransposition. Comparing somatic TE insertional activity with transcriptomic and small RNA sequencing data, we demonstrate that transposon mobility cannot be simply predicted by whole tissue TE expression levels or by small RNA pathway activity. Finally, we reveal that somatic TE insertions in the adult fly intestine are enriched in genic regions and in transcriptionally active chromatin. Together, our findings provide clear evidence of ongoing somatic transposition in Drosophila and delineate previously unknown features underlying somatic TE mobility in vivo.
Article
Full-text available
Transposable elements (TEs) are constitutive components of both eukaryotic and prokaryotic genomes. The role of TEs in the evolution of genes and genomes has been widely assessed over the past years in a variety of model and non-model organisms. Drosophila is undoubtedly among the most powerful model organisms used for the purpose of studying the role of transposons and their effects on the stability and evolution of genes and genomes. Besides their most intuitive role as insertional mutagens, TEs can modify the transcriptional pattern of host genes by juxtaposing new cis-regulatory sequences. A key element of TE biology is that they carry transcriptional control elements that fine-tune the transcription of their own genes, but that can also perturb the transcriptional activity of neighboring host genes. From this perspective, the transposition-mediated modulation of gene expression is an important issue for the short-term adaptation of physiological functions to the environmental changes, and for long-term evolutionary changes. Here, we review the current literature concerning the regulatory and structural elements operating in cis provided by TEs in Drosophila. Furthermore, we highlight that, besides their influence on both TEs and host genes expression, they can affect the chromatin structure and epigenetic status as well as both the chromosome’s structure and stability. It emerges that Drosophila is a good model organism to study the effect of TE-linked regulatory sequences, and it could help future studies on TE–host interactions in any complex eukaryotic genome.
Article
Expression vectors (EVs) are artificial nucleic acid molecules with a modular structure that allows for the transcription of DNA sequences of interest in either cellular or cell-free environments. These vectors have emerged as cross-disciplinary tools with multiple applications in an expanding Life Sciences market. The cis-regulatory sequences (CRSs) that control the transcription in EVs are typically sourced from either viruses or from characterized genes. However, the recent advancement in transposable elements (TEs) technology provides attractive alternatives that may enable a significant improvement in the design of EVs. Commonly known as "jumping genes," due to their ability to move between genetic loci, TEs are constitutive components of both eukaryotic and prokaryotic genomes. TEs harbor native CRSs that allow the regulated transcription of transposition-related genes. However, some TE-related CRSs display striking characteristics, which provides the opportunity to reconsider TEs as lead actors in the design of EVs. In this article, we provide a synopsis of the transcriptional control elements commonly found in EVs together with an extensive discussion of their advantages and limitations. We also highlight the latest findings that may allow for the implementation of TE-derived sequences in the EVs feasible, possibly improving existing vectors. By introducing this new concept of TEs as a source of regulatory sequences, we aim to stimulate a profitable discussion of the potential advantages and benefits of developing a new generation of EVs based on the use of TE-derived control sequences.
Article
Somatic transposon expression in neural tissue is commonly considered as a measure of mobilization and has therefore been linked to neuropathology and organismal individuality. We combined genome sequencing data with single-cell mRNA sequencing of the same, inbred fly strain to map transposon expression in the Drosophila midbrain and found that transposon expression patterns are highly stereotyped. Every detected transposon is resident in at least one cellular gene with a matching expression pattern. Bulk RNA sequencing from fly heads of the same strain revealed that coexpression is a physical link in the form of abundant chimeric transposon-gene mRNAs. We identified 264 genes where transposons introduce cryptic splice sites into the nascent transcript and thereby significantly expand the neural transcript repertoire. Some genes exclusively produce chimeric mRNAs with transposon sequence and on average 11.6% of the mRNAs produced from a given gene are chimeric. Conversely, most transposon-containing transcripts are chimeric, which suggests that somatic expression of these transposons is largely driven by cellular genes. We propose that chimeric mRNAs produced by alternative splicing into polymorphic transposons, rather than transposon mobilization, may contribute to functional differences between individual cells and animals.
Article
It has been 10 years since the introduction of modern transposon-insertion sequencing (TIS) methods, which combine genome-wide transposon mutagenesis with high-throughput sequencing to estimate the fitness contribution or essentiality of each genetic component in a bacterial genome. Four TIS variations were published in 2009: transposon sequencing (Tn-Seq), transposon-directed insertion site sequencing (TraDIS), insertion sequencing (INSeq) and high-throughput insertion tracking by deep sequencing (HITS). TIS has since become an important tool for molecular microbiologists, being one of the few genome-wide techniques that directly links phenotype to genotype and ultimately can assign gene function. In this Review, we discuss the recent applications of TIS to answer overarching biological questions. We explore emerging and multidisciplinary methods that build on TIS, with an eye towards future applications. In this Review, several experts discuss progress in the decade since the development of transposon-based approaches for bacterial genetic screens. They describe how advances in both experimental technologies and analytical strategies are resulting in insights into diverse biological processes.