RESTful RNA Folding

Full text

RESTful RNA Folding
Michael T. Wolfinger
16 February 2013
Bled, Slovenia

1Introduction to RESTful Web Services
2RESTful Design Principles
3The Perl Dancer Micro Framework
4RESTfold: A RESTful approach for RNA folding
5Summary
Michael T. Wolfinger RESTful RNA Folding 2 / 24

Introduction to RESTful Web Services
Representational State Transfer (REST)
Representational State Transfer (REST) is a software architecture style
for distributed systems such as the World Wide Web that has emerged as
a predominant Web Service design model.
Initially introduced in Roy Fielding’s PhD dissertation (2000).
RESTful Web Services use HTTP als the underlying application
protocol,URIs to locate resources and (among others) XHTML,XML or
JSON get get a representation.
Michael T. Wolfinger RESTful RNA Folding 3 / 24

Introduction to RESTful Web Services
REST Basics
RESTful architectures are based on a simple client-server model:
A client initiates a request to a server
A server processes the response and returns a response
A key feature of RESTful architectures is the fact that requests and
responses are built around the transfer of representations of different
resources.
Resource: A coherent entity that can be addressed
Representation: A document that captures the state of a resource
Michael T. Wolfinger RESTful RNA Folding 4 / 24

Introduction to RESTful Web Services
What is a Web Service?
A web page that is meant for a computer to request and process
Consumed by an autonomous program rather than by a Web Browser
Requires architectural style (because client is not a smart human)
An architectural style is a coordinated set of architectural constraints that
restricts the roles and features of architectural elements, and the allowed
relationships among those elements, within any architecture that conforms
to that style
A style can be applied to many architectures
An architecture can consist of many styles
Michael T. Wolfinger RESTful RNA Folding 5 / 24

RESTful Design Principles
The REST model
Traditional distributed systems rely on a shared model (a.k.a. API). A
RESTful system relies on three properties:
Nouns: Used to name the resources of interest
Verbs: Operations that are applied to named resources ⇒HTTP
methods
Content Types: Used to define resource representations
Michael T. Wolfinger RESTful RNA Folding 6 / 24

RESTful Design Principles
Nouns in a RESTful System
Nouns are used to name resources, in most designs these will be the URIs
⇒URI Design
Anything of interest should be named
Applications can talk about named things
Separating nouns from verbs and representations improves extensibility
applications might still work with resources without being able to
process them
introducing new operations on the Web does not break the Web
Michael T. Wolfinger RESTful RNA Folding 7 / 24

RESTful Design Principles
HTTP Methods in a RESTful System
REST aims at using universal verbs (those that can be applied to all
nouns) only. HTTP/1.1 covers eight verbs (a.k.a. methods,operations)
that are valid for all resources. For most applications, the following HTTP
methods are sufficient:
GET: Fetch a resource’s representation
PUT: Create or update a resource
POST: Add to a resource (instead of an overwriting update)
DELETE: Delete a resource
These correspond to the basic CRUD (create, read, update, delete)
database operations.
Michael T. Wolfinger RESTful RNA Folding 8 / 24

RESTful Design Principles
RESTful Web Services
Representational State Transfer (REST) is a set of design principles to
qualify architectures. As such, REST is an architectural style.
Resources are identified by Uniform Resource Identifiers (URIs)
Resources are manipulated through their representations
Messages are self-descriptive and stateless
Multiple representations are accepted or sent
Hypertext is the engine of application state
Resource Oriented Architecture (ROA)
Method information goes into the HTTP method
Scoping information goes into the URI
Content type information goes into the HTTP header
Michael T. Wolfinger RESTful RNA Folding 9 / 24

RESTful Design Principles
RESTful State Management
In a RESTful design
State is transferred between server and client
State is represented as part of the transferred content
Data transfer is not state-specific (no stateful connection handling)
Advantages:
Scalability
Resources can be made available on different servers
Clients are not affected by server interruption/failure
Michael T. Wolfinger RESTful RNA Folding 10 / 24

RESTful Design Principles
REST Principles
It is easy to break down REST to five core principles
Resources with unique Identification
Use URIs to identify persistent (individual or set) entities
Linking / Hypermedia
Use hyperlinks to connect resources and direct the application flow
Standard methods
Use standard HTTP methods like GET, PUT, POST, DELETE
Different representations
Use different representations of resources to satisfy requirements
Stateless Communication
Make the client hold any state information
Michael T. Wolfinger RESTful RNA Folding 11 / 24

The Perl Dancer Micro Framework
Perl Dancer: A powerful Web application framework
Dancer is a micro-framework for writing RESTful Web applications,
inspired by Ruby’s Sinatra framework. Dancer comes with:
intuitive, minimalist and dead simple syntax
a standalone lightweight server
support for FastCGI and CGI backends
a simple templating engine plus support for TemplateToolit
clear separation between dynamic vs. static (JS,CSS,images)
dedicated pages for various HTTP status codes (500 / 404 etc.)
Michael T. Wolfinger RESTful RNA Folding 12 / 24

The Perl Dancer Micro Framework
Perl Dancer in action
package MyApp;
use Dancer;
our $VERSION = ’0.1’;
get ’/’ => sub {
template ’index’ ;
};
true;
Michael T. Wolfinger RESTful RNA Folding 13 / 24

The Perl Dancer Micro Framework
Perl Dancer Route Handlers
A perl Dancer application is a collection of route handlers
A route handler is, basically, a subroutine
It is bound to a HTTP method
And a path or path pattern
Dancing recipe:
Choose a HTTP method
Add a path segment
Mix it with a subroutine
Sprinkle plugins and keywords on top
Michael T. Wolfinger RESTful RNA Folding 14 / 24

The Perl Dancer Micro Framework
Perl Dancer Route Structure
get ’/path’ => sub {... };
post ’/path’ => sub {... };
put ’/path’ => sub {... };
del ’/path’ => sub {... };
options ’/path’ => sub {... };
any ’/path’ => sub {... };
Michael T. Wolfinger RESTful RNA Folding 15 / 24

The Perl Dancer Micro Framework
Dynamic Routes
Besides static routes, Perl Dancer can handle dynamic routes
get ’/sequence/:id’ => sub {
# do something with params->{id}
...
};
get ’/user/:gid/:uid’ => sub {
# use params->{gid} and params->{uid}
...
};
get qr{/ (\w+) / \d{2,3} (.+)? } => sub {
...
};
Michael T. Wolfinger RESTful RNA Folding 16 / 24

RESTfold: A R ESTful approach for RNA folding
RESTfold: A RESTful interface for RNA folding
1
2
3
Ajax magic
input sequence
view result
Michael T. Wolfinger RESTful RNA Folding 17 / 24

RESTfold: A R ESTful approach for RNA folding
Scripted Interaction with RESTfold 1
AJAX request
curl -i -H "Accept: application/json" -H ’X-Requested-With: XMLHttpRequest’
-X POST -d "sequence=GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGU
UCGAUCCACAGAAUUCGCACCA" http://rest.tbi.univie.ac.at/fold
JSON response
HTTP/1.1 200 OK
Date: Sat, 16 Feb 2013 12:09:44 GMT
Server: Apache/2.2.20 (Ubuntu)
X-Powered-By: Perl Dancer 1.3070
Set-Cookie: RNA.session=99041400312760626954; path=/;
expires=Sat, 16-Feb-2013 12:09:55 GMT; HttpOnly
Content-Length: 260
Content-Type: application/json; charset=utf-8
{
"sid" : "5586904282384",
"reply_RNA_sequence" : "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGU
CCUGUGUUCGAUCCACAGAAUUCGCACCA",
"result_link" : "http://rest.tbi.univie.ac.at/fold/data/5586904282384"
}
Michael T. Wolfinger RESTful RNA Folding 18 / 24

RESTfold: A R ESTful approach for RNA folding
Scripted Interaction with RESTfold 2
AJAX request
curl -i -H "Accept: application/json" -H ’X-Requested-With: XMLHttpRequest’
-X GET http://rest.tbi.univie.ac.at/fold/data/5586904282384
JSON response
HTTP/1.1 200 OK
Date: Sat, 16 Feb 2013 12:10:17 GMT
Server: Apache/2.2.20 (Ubuntu)
X-Powered-By: Perl Dancer 1.3070
Content-Length: 232
Content-Type: application/json; charset=utf-8
{
"done" : 1,
"sequence" : "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGA
UCCACAGAAUUCGCACCA",
"structure" :"((((((.....((((((.((......)).))))))...((((..((((........))
))..))))))))))...."
"energy" : "-21.70"
}
Michael T. Wolfinger RESTful RNA Folding 19 / 24

RESTfold: A R ESTful approach for RNA folding
RESTfold workflow
1(C) POST sequence and parameters to http://<domain>/fold
2(S) Create persistent reusource for results
http://<domain>/fold/data/<uid>
3(S) Execute RNAfold (or queue in Grid Engine)
4(S) Return JSON object with results resource to client
5(C) GET http://<domain>/fold/data/<uid>
6(S) Return JSON object with computational results
Michael T. Wolfinger RESTful RNA Folding 20 / 24

RESTfold: A R ESTful approach for RNA folding
Benefits of RESTful RNA folding Web Services
ViennaRNA REST API
Allows for efficient automation
High scalability (server side)
Short, non-redundant code for human/machine interface
No CGI required
Michael T. Wolfinger RESTful RNA Folding 21 / 24

Summary
Summary
REST is an architectural design style for Web Applications
REST heavily relies on ready-to-use HTTP properties
RESTful architectures scale very well with data traffic
Perl Dancer is a new framework for building RESTful Web Services
RESTfold is the first step towards a suite of RESTful Web Services
for RNA folding
Michael T. Wolfinger RESTful RNA Folding 22 / 24

Summary
References
REST API Design Rulebook, Mark Masse, O’Reilly 2011
REST und HTTP, Stefan Tilkov, dpunkt Verlag 2009
Service Design Patterns, Robert Daigneau, Addison-Wesley 2011
Web Architecture course by Erik Wilde
Michael T. Wolfinger RESTful RNA Folding 23 / 24

Summary
Acknowledgements
Ronny Lorenz
Fabian Amman
RNA-REG SFB
All TBI and CIBIV folks
Michael T. Wolfinger RESTful RNA Folding 24 / 24