A New Species of Vietnamophryne with an Extended Description of Vietnamophryne orlovi

Abstract

We describe Vietnamophryne cuongi sp. nov., a new species of microhylid frog from northern Vietnam, based on morphological and molecular differences. Although superficially similar to remaining Vietnamophryne members, the new species differs by a number of diagnostic morphological characters, such as body size, habitus, head dimensions, finger and toe morphology, skin texture, as well as colour pattern. Phylogenetic analyses based on a fragment of the mitochondrial 16S gene place the new species to be sister to V. orlovi, from which it differed by 2.4% genetic divergence. We also describe the first female known of V. orlovi, collected in the forest of Phia Oac-Phia Den National Park, Cao Bang Province. The latter species, for which we provide an extended description herein, was recently described based on the single male type specimen only from the same site in northern Vietnam. Vietnamophryne cuongi sp. nov. is only known from three specimens, two adult females and a juvenile, from the evergreen tropical forest of Ba Vi National Park, Hanoi. As such, it is likely to be at high risk of habitat loss. Considering its high ecological specialization and the small known distribution range of the new species, we propose Endangered as IUCN Red List status.

Full text

DOI: 10.30906/1026-2296-2021-28-6-355-368
A NEW SPECIES OF Vietnamophryne WITH AN EXTENDED DESCRIPTION
OF Vietnamophryne orlovi
Thanh Vinh Nguyen,1Chung Van Hoang,2,3,4 Jiang Jianping,2
Nikolai L. Orlov,5Hoa Thi Ninh,6Huy Quoc Nguyen,6
Tao Thien Nguyen,6* and Thomas Ziegler7,8
Submitted July 9, 2021
We describe Vietnamophryne cuongi sp. nov., a new species of microhylid frog from northern Vietnam, based on
morphological and molecular differences. Although superficially similar to remaining Vietnamophryne members,
the new species differs by a number of diagnostic morphological characters, such as body size, habitus, head di-
mensions, finger and toe morphology, skin texture, as well as colour pattern. Phylogenetic analyses based on a
fragment of the mitochondrial 16S gene place the new species to be sister to V. orlovi, from which it differed by
2.4% genetic divergence. We also describe the first female known of V. orlovi, collected in the forest of Phia
Oac-Phia Den National Park, Cao Bang Province. The latter species, for which we provide an extended descrip-
tion herein, was recently described based on the single male type specimen only from the same site in northern
Vietnam. Vietnamophryne cuongi sp. nov. is only known from three specimens, two adult females and a juvenile,
from the evergreen tropical forest of Ba Vi National Park, Hanoi. As such, it is likely to be at high risk of habitat
loss. Considering its high ecological specialization and the small known distribution range of the new species, we
propose Endangered as IUCN Red List status.
Keywords: Vietnamophryne; morphology; taxonomy; new species; Hanoi.
INTRODUCTION
Frogs of the family Microhylidae form one of the
most speciose groups of amphibians with pantropical dis-
tribution. Currently, some 709 species are recognized, in-
habiting areas from the tropics and subtropics of Africa,
Madagascar, Southern and Northern America, and South,
East, and Southeast Asia to the islands of the Austral-
asian archipelago and northernmost Australia. The fam-
ily Microhylidae is currently divided in 12 subfamilies.
Asterophryinae is the most speciose subfamily within
Microhylidae, currently consisting of 350 species inhab-
iting the tropical forests of northern Australia, New Gui-
nea, and adjacent Australasian islands westwards to Sula-
wesi, southern Philippines, and crossing the Wallace line
in Bali (Frost, 2021). The genus Siamophryne was re-
cently described bv Suwannapoom et al. (2018) from
1026-2296/2021/2806-0355 © 2021 Folium Publishing Company
Russian Journal of Herpetology Vol. 28, No. 6, 2021, pp. 355 – 368
1Department of Zoology and Conservation, VNU University of Science, Vietnam National University, Hanoi, 334 Nguyen Trai Street, Thanh
Xuan District, Hanoi, Vietnam.
2CAS Key Laboratory of Mountain Ecological Restoration and Bioresource Utilization and Ecological Restoration and Biodiversity Conservation
Key Laboratory of Sichuan Province, Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, China.
3University of Chinese Academy of Sciences, Beijing 810000, China.
4Forest resources and environment center, 300 Ngoc Hoi Road, Thanh Tri, Hanoi, Vietnam.
5Department of Herpetology, Zoological Institute, Russian Academy of Sciences 199034, St. Petersburg, Russia.
6Vietnam National Museum of Nature and Institute of Genome Research, Vietnam Academy of Science and Technology, 18 Hoang Quoc Viet
Road, Hanoi, Vietnam.
7AG Zoologischer Garten Köln, Riehler Strasse 173, D-50735 Cologne, Germany.
8Institute of Zoology, University of Cologne, Zülpicher Strasse 47b, D-50674 Cologne, Germany.
* Corresponding author: Tao Thien Nguyen; e-mail: nguyenthientao@gmail.com

southern Indochina and Poyarkov et al. (2018) subse-
quently described Vietnamophryne from northern and
eastern Indochina. The discovery of the new genera,
which are sister to each other within the mainly Austral-
asian microhylid subfamily Asterophryinae, strongly
support the “out of Indo-Eurasia” biogeographic scena-
rio for the Asterophryinae (Kurabayashi et al., 2011),
suggesting that its colonization route was from Asia to
Australia, and not via Antarctica as suggested earlier.
Kurabayashi et al. (2011) predicted, that the “biogeogra-
phic findings on Gastrophrynoides imply the possible
occurrence of further microhylid taxa with unexpected
evolutionary backgrounds and give a basis for future
paleontological and biogeographic studies of Asian
anurans.”
Vietnamophryne so far contained four species from
Cao Bang Province in northern Vietnam, Gia Lai and Ha
Tinh provinces in central Vietnam, and Chiang Rai Prov-
ince in northern Thailand. They are secretive miniatur-
ized frogs (SVL < 21 mm) with a mostly semi-fossorial
lifestyle (Poyarkov et al., 2018). During recent field work
in May 2019 in Phia Oac-Phia Den NP, Cao Bang Prov-
ince, Vietnam, and in August 2019 in Ba Vi National
Park, Hanoi Capital, Vietnam (Fig. 1) we encountered
four specimens of miniaturized microhylid frogs. Molec-
ular analyses based on a fragment of the mitochondrial
16S gene revealed them to be representatives of Vietna-
mophryne. The single individual from Cao Bang Prov-
ince proved to be the first female known of V. orlovi,
which was recently described based on a single male
from the same site by Poyarkov et al. (2018). The three
specimens from Hanoi Capital, two adult females and a
juvenile, revealed to be genetically sister to V. orlovi,
with diverging morphological characters. We thus herein
extend the definition of V. orlovi based on the first col-
lected female and describe the new taxon from Ba Vi Na-
tional Park, Hanoi Capital, due to morphological and mo-
lecular differences as a new Vietnamophryne species
herein.
MATERIAL AND METHODS
Sampling. Field surveys were conducted in Phia
Oac-Phia Den NP, Cao Bang Province, Vietnam in May
2019 by H. Q. Nguyen and in Ba Vi NP, Hanoi, Vietnam
(Fig. 1) in August 2019 by T. V. Nguyen and H. Q. Ngu-
yen. Geographic coordinates and elevation were obtained
using a Garmin GPSMAP 78S (WGS 84 data). Four
specimens were collected in the field. All specimens
were photographed in life prior to anaesthetization and
subsequent euthanazation with ethylacetate and fixation
in 95% ethanol with subsequent storing in 70% ethanol.
Four specimens (VNMN 010357 – 010359, VNMN
011309) were subsequently deposited in the Vietnam
National Museum of Nature (VNMN) Hanoi, Vietnam.
Tissues for genetic analyses were taken from liver prior
to preservation and storage in 95% ethanol.
Molecular data and phylogenetic analyses. DNA
extraction and sequencing: we used Qiagen DNA extrac-
tion kits, the protocols of Kuraishi et al. (2013), modified
by Nguyen et al. (2014), for DNA extraction, amplifica-
tion, and sequencing. Fragments of the mitochondrial
16S rRNA gene were amplified using the primers follow-
ing Kuraishi et al. (2013). Forward and reverse primers
from 5¢to 3¢used for DNA amplification and sequencing
with directions of sequencing indicated: H3056:
CTCCGGTCTGAACTCAGATCACGTAGG and tValL:
CGTACCTTTTGCATCATGGTC. The PCR included an
initial denaturation for 5 min at 94°C and 35 cycles of
30 sec at 94°C, 30 sec at 55°C, and 7 min at 72°C. Total
DNA was amplified using PCR Eppendorf. PCR volume
consisted of 25 ìl, including 12 ìl of Mastermix, 8 ìl
of water, 1 ìl of each primer at concentration of
10 pmol/ìl, and 3 ìl of DNA. For the phylogenetic anal-
yses, in addition to the newly collected specimens, all
species belonging to the genus Vietnamophryne for
which homologous sequences were available were in-
cluded in the phylogenetic analysis. Siamophryne troglo-
dytes and Scaphiophryne boribory were included in the
analysis as an outgroup. Locality information and acces-
sion numbers for all sequences included in the analysis
can be found in Table 1.
Chromas Pro software (Technelysium Pty Ltd., Te-
wantin, Australia) was used to edit the sequences, which
were aligned using the ClustalW (Thompson et al., 1997)
option in MEGA 7.0 (Kumar et al., 2016) with default
parameters and subsequently optimized manually in
BioEdit 7.0.5.2 (Hall, 1999). We then checked the initial
356 Thanh Vinh Nguyen et al.
Fig. 1. Map showing the type locality of Vietnamophryne cuongi sp.
nov. (Red circle) in Ba Vi NP, Cao Bang Province and the type locality
of V. orlovi in Phia Oac-Phia Den NP, Hanoi, Vietnam (black circle).

alignments by eye and adjusted slightly. Phylogenetic
trees were constructed by using maximum likelihood
(ML) and Bayesian inference (BI). Prior to ML and Ba-
yesian analyses, we chose the optimum substitution mod-
els for entire sequences using by Kakusan 4 (Tanabe,
2011) based on the Akaike information criterion (AIC).
The best model selected for ML was the general time re-
versible model (GTR: Tavaré 1986) with a gamma shape
parameter (G: 0.306 in ML and 0.359 in BI). The BI sum-
marized two independent runs of four Markov Chains for
10,000,000 generations. A tree was sampled every 100
generations and a consensus topology was calculated for
70,000 trees after discarding the first 30,001 trees
(burnin = 30,001) (Nguyen et al., 2017). We checked pa-
rameter estimations and convergence using Tracer ver-
sion 1.5 (Rambaut et al., 2018). The strength of nodal
support in the ML tree was analyzed using non-paramet-
ric bootstrapping (MLBS) with 1000 replicates. We re-
garded tree nodes in the ML tree with bootstrap values of
75% or greater as sufficiently resolved (Hillis and Bull
1993; Huelsenbeck and Hillis, 1993), and nodes with a
BPP of 95% or greater as significant in the BI analysis
(Leaché and Reeder, 2002). Pairwise comparisons of un-
corrected sequence divergences (p-distance) were calcu-
lated for 16S rRNA fragments. Resulting DNAsequences
from this analysis were submitted to GenBank (Acces-
sion Numbers: MT819964 – MT819968) (Table 1).
Morphological analysis. Sex of adult individuals
was determined using gonadal dissection. All measure-
ments were taken from fixed specimens using a digital
caliper to a 0.1 mm precision; morphometrics followed
Poyarkov et al. (2014), Suwannapoom et al. (2018), Po-
yarkov et al. (2018) and Hoang et al. (2021): (1) snout-
vent length (SVL; length from tip of snout to cloaca);
(2) head length (HL; length from tip of snout to hind bor-
der of jaw angle); (3) snout length (SL; length from ante-
rior corner of eye to tip of snout); (4) eye length (EL; dis-
tance between anterior and posterior corners of eye);
(5) nostril-eye length (N-EL; distance between anterior
corner of eye and nostril center); (6) head width (HW;
maximum width of head at level of mouth angles in ven-
tral view); (7) internarial distance (IND; distance be-
tween central points of nostrils); (8) interorbital distance
(IOD; shortest distance between medial edges of eyeballs
in dorsal view); (9) upper eyelid width (UEW; maximum
distance between medial edge of eyeball and lateral edge
of upper eyelid); (10) forelimb length (FLL; length of
straightened forelimb from limb base to tip of third fin-
ger); (11) lower arm and hand length (LAL; distance be-
tween elbow and tip of third finger); (12) hand length
(HAL; distance between proximal end of outer palmar
(metacarpal) tubercle and tip of third finger); (13) inner
palmar tubercle length (IPTL; maximum distance be-
tween proximal and distal ends of inner palmar tubercle);
A New Species of Vietnamophryne 357
TABLE 1. GenBank Accession Numbers and Associated Samples that Were Used in This Study
No. Species Locality Voucher Accession No. Reference
1Vietnamophryne
cuongi sp. nov.
Ba Vi NP, Hanoi, Vietnam VNMN
010357 – 010359
MT819964 –
MT819967
This study
2V. vuquangensis Vu Quang NP, Ha Tinh Province, Vietnam VNMN010487 MW763017 Hoang et al. (2021)
VNMN010488 MW763018 Hoang et al. (2021)
VNMN010489 MW763019 Hoang et al. (2021)
VNMN010490 MW763020 Hoang et al. (2021)
VNMN010491 MW763021 Hoang et al. (2021)
VNMN010492 MW763022 Hoang et al. (2021)
VNMN010498 MW763023 Hoang et al. (2021)
VNMN010517 MW763024 Hoang et al. (2021)
VNMN010518 MW763025 Hoang et al. (2021)
VNMN010519 MW763026 Hoang et al. (2021)
VNMN010520 MW763027 Hoang et al. (2021)
VNMN010521 MW763028 Hoang et al. (2021)
VNMN010528 MW763029 Hoang et al. (2021)
3V. inexpectata Kon Chu Rang NR, Gia Lai, Vietnam ZMMU A-5820 MH004403 Poyarkov et al. (2018)
4V. occidentalis Doi Tung Mt., Chiang Rai, Thailand ZMMU A-5822 MH004406 Poyarkov et al. (2018)
5V. orlovi Phia Oac-Phia Den NP, Cao Bang, Vietnam ZMMU A-5821 MH004404 Poyarkov et al. (2018)
6V. orlovi Phia Oac-Phia Den NP, Cao Bang, Vietnam VNMV011309 MT819967 This study
Outgroup
7Siamophryne troglodytes Sai Yok, Kanchanaburi, Thailand. ZMMU NAP-06651 MG682553 Suwannapoom et al. (2018)
8Scaphiophryne boribory Madagascar: Fierenana 2002B56 EU341114 Wollenberg et al. (2008)

(14) outer palmar tubercle length (OPTL; maximum di-
ameter of outer palmar tubercle); (15) hindlimb length
(HLL; length of straightened hindlimb from groin to tip
of fourth toe); (16) tibia length (TL; distance between
knee and tibiotarsal articulation); (17) foot and tibiotar-
sus length (FTL; length from tibiotarsal joint to end of
fourth toe); (18) foot length (FL; distance between distal
end of tibia and tip of fourth toe); (19) inner metatarsal
tubercle length (IMTL; maximum length of inner meta-
tarsal tubercle); (20) outer metatarsal tubercle length
(OMTL; maximum length of outer metatarsal tubercle);
(21) tympanum length, maximum tympanum diameter
(TYD); (22) tympanum-eye distance (TED); (23 – 26)
finger lengths (1 – 3FLO, 4FLI; for outer side (O) of
first, inner side (I) of fourth, distance between tip and
junction of neighboring finger); (27) first finger width
(1FW), measured at distal phalanx; (28 – 30) finger disk
diameters (2 – 4FDW); (31) first toe length (1TOEL),
distance between distal end of inner metatarsal tubercle
and tip of first toe; (32 – 35) second to fifth toe lengths
(outer lengths for toes II – IV, inner length for toe V);
(36 – 40) toe disk diameters (1 – 5TDW).
We obtained comparative morphological data from
original descriptions for the following species of Vietna-
mophryne reported for Indochina and surrounding parts
of Southeast Asia: Vietnamophryne inexpectata Poyar-
kov, Suwannapoom, Pawangkhanant, Aksornneam, Du-
ong, Korost et Che, 2018; Vietnamophryne occidentalis
Poyarkov, Suwannapoom, Pawangkhanant, Aksornne-
am, Duong, Korost, et Che, 2018; Vietnamophryne orlovi
Poyarkov, Suwannapoom, Pawangkhanant, Aksornne-
am, Duong, Korost et Che, 2018; Vietnamophryne vuqu-
angensis Hoang, Jiang, Nguyen, Orlov, Le, Nguyen,
Nguyen, Nguyen et Ziegler, 2021.
RESULTS
Sequence variation. Results of the phylogenetic
analyses are shown in Fig. 2.
The 16S rRNA gene fragment consisted of 1068
sites: 917 sites were conserved and 137 sites were vari-
able, of which 93 were parsimony-informative. The tran-
sition-transversion bias was estimated as 4.535. Nucleo-
tide frequencies were A= 35.12%, T= 22.50%, C=
= 24.89%, and G= 17.50%. The ML and Bayesian anal-
yses produced topologies with –ln L= 3161.2016 and
3200.6404, respectively. The best model selected for ML
was the general time reversible model (GTR: Tavaré,
1986) with a gamma shape parameter (G: 0.448 in ML
and 0.504 in BI). Phylogenetic analyses employing ML
and BI methods were nearly identical, with most well-
supported nodes on the ML tree also being well-sup-
ported on the Bayesian tree, thus only the BI tree is pre-
sented in Fig. 2. In both analyses, the population from Ba
Vi National Park (hereafter Vietnamophryne sp.) was re-
covered as sister to V. orlovi, recently described from
northern Vietnam (Poyarkov et al., 2018).
Interspecific uncorrected p-distances of Vietnamo-
phryne representatives (Table 2) ranged from 1.9 – 2.0%
(between V. orlovi versus V. occidentalis) to 5.9 – 6.2%
(between Vietnamophryne sp. versus V. vuquangensis).
The genetic divergence of Vietnamophryne sp. versus
other Vietnamophryne ranged from 2.0 – 2.3% (V. orlovi)
to 4.9 – 5.8% (V. inexpectata), and thus being higher than
genetic distances between the accepted and recognized
species V. orlovi versus V. occidentalis (1.9 – 2.0%), indi-
cating already taxonomic significance of the molecular
divergence between Vietnamophryne sp. versus other
Vietnamophryne.
TAXONOMY
The collected specimens were assigned to the genus
Vietnamophryne based on the following character states
(Poyarkov et al., 2018): (1) Small-sized (SVL 14.2 –
20.5 mm); (2) both maxillae and dentaries eleutherogna-
thine, no maxillary teeth; (3) vertebral column procoe-
lous with eight presacral vertebrae lacking neural crests;
(4) no cranial sagittal crest; (5) frontoparietals connected
by long non-calcified suture; (6) nasals wide, calcified,
not contacting medially; (7) vomeropalatines and neopa-
latine not expanded, not calcified (possibly, cartilagi-
nous), vomerine spikes absent; (8) cultriform process of
358 Thanh Vinh Nguyen et al.
Fig. 2. Bayesian inference (BI) tree based on the partial 16S rRNA
mitochondrial gene. Values at nodes correspond to BI/ML support val-
ues, respectively. Numbers above and under branches are ML bootstrap
values and Bayesian posterior probabilities. Siamophryne troglodytes
and Scaphiophryne boribory were used as the outgroup.

parasphenoid broad and short, abruptly obtuse anteriorly;
(9) clavicles absent; (10) omosternum absent; (11) ster-
num small, non-calcified, completely cartilaginous, xi-
phisternum flat, rounded; (12) distinct dorsal crest pres-
ent on urostyle at three-quarters of its length, absent on
ilium; (13) terminal phalanges small, bobbin-shaped;
(14) no disks on digits, digit tips rounded; (15) first finger
reduced to nub or shortened, all phalanges present and
ossified; (16) subarticular tubercles absent; (17) toe web-
bing absent; (18) tympanum distinct; (19) single trans-
verse smooth palatal fold; (20) pupil round; (21) snout
rounded, subequal to or shorter than eye length; (22) skin
on dorsum warty to shagreened; and (23) semi-fossorial
(mostly subterranean) lifestyle.
Based on molecular (0.4% genetic divergence) and
morphological accordance, the adult female specimen
from Phia Oac-Phia Den NP, Cao Bang Province, Viet-
nam could be identified as V. orlovi, thus extending the
original diagnosis, which was based only on the male ho-
lotype. Vietnamophryne sp. differed from V. orlovi and
V. occidentalis by 2.0 – 2.3% and 2.0 – 2.1% genetic di-
vergence, and in addition by distinct morphological char-
acters, so that we describe it as a new taxon in the follow-
ing (Table 2).
Vietnamophryne orlovi Poyarkov,
Suwannapoom, Pawangkhanant,
Aksornneam, Duong, Korost et Che, 2018
(Figs.3–4;Tables3–4)
Specimen examined. One adult female VNMN
0110309, collected on 18 May 2019, in the forest of Phia
Oac-Phia Den NP, Cao Bang Province, Vietnam.
Morphological characters of the specimen from Phia
Oac-Phia Den NP (see Table 3), match the description of
Poyarkov et al. (2018): body miniaturized, SVL 17.1, in
good state of preservation. Body habitus stout (Fig. 4),
head notably longer than wide (HW/HL 0.98); snout
comparatively long, rounded in dorsal view (Fig. 4),
truncate in lateral view (Fig. 4), snout length greater than
eye length (SL/EL 1.31); eyes medium-sized (EL/SVL
0.11); eye to nostril distance 0.11 of SVL; eyes slightly
protuberant in dorsal and lateral views (Fig. 4), pupil
round, horizontal (Fig. 4); dorsal surface of head slightly
convex, canthus rostralis distinct, rounded; loreal region
concave; nostril rounded, lateral, located closer to tip of
snout than to eye; tympanum well discernible, circular,
comparatively small (TL/SVL 0.47), located distantly
from eye (TED/SVL 0.04), tympanic rim not elevated
above skin of temporal area, supratympanic fold present,
distinct, glandular; vomerine teeth and spikes absent, sin-
gle transverse palatal fold with smooth edge present
across palate anteriorly to pharynx, tongue spatulate and
free behind, papillae on tongue absent, vocal sac opening
absent.
Forelimbs comparatively short, around one-third of
hindlimb length (FLL/HLL 0.35); hand shorter than
lower arm, almost one-third of forelimb length (HAL/
FLL 0.41); fingers short, round in cross-section, first fin-
ger well developed, half of length of second finger
(1FLO/2FLO 0.50); relative finger lengths: I < IV < II <
III (Fig. 4E). Finger webbing and dermal fringes on fin-
gers absent. First fingertip rounded; first finger well de-
veloped. Tips of three outer fingers II-IV rounded, not di-
lated, finger disks absent, terminal grooves absent; longi-
A New Species of Vietnamophryne 359
TABLE 2. Uncorrected p-Distance Matrix Showing Percentage Pair Wise Genetic Divergence rRNA-16S rRNA between Members of the Vietna-
mophryne Species Group
No. Species 1 2 3 4 5 6
1Vietnamophryne cuongi sp. nov. 0.0 – 0.1
2Vietnamophryne orlovi VNMN011309 2.0 – 2.2 0
3Vietnamophryne orlovi MH004404 2.2 – 2.3 0.4 0
4Vietnamophryne vuquangensis 5.9 – 6.2 5.6 0.058 0 – 0.3
5Vietnamophryne occidentalis 2.0 – 2.1 1.9 2 5.3 – 5.5 0
6Vietnamophryne inexpectata 4.9 – 5.1 4.8 4.7 4.2 – 4.5 4 0
Fig. 3. Vietnamophryne orlovi lateral view in life (VNMN 011309).
Photo by H. Q. Nguyen.

360 Thanh Vinh Nguyen et al.
Fig. 4. Dorsolateral view (A), ventral view (B), lateral view of head (C), tongue (D), right hand (E), left foot (F), dorsolateral view (G), ventral
view (H) in preservative of female specimen (VNMN 011309) of Vietnamophryne orlovi. Photos by H. Q. Nguyen.

A New Species of Vietnamophryne 361
TABLE 3. Measurements (in mm) and Proportions of the Type Series of Vietnamophryne cuongi sp. nov.
Species
Vietnamophryne
inexpectata
Vietnamophryne
occidentalis Vietnamophryne orlovi Vietnamophryne cuongi sp. nov. Vietnamophryne
vuquangensis
ZMMU
A-5820
M*
ZMMU
A-5822
M*
ZMMU
A-5821
M*
VNMN
011309
F
VNMN
010357
F
VNMN
010358
F*
VNMN
010359
J
F
(min – max)
n=9
M
(min – max)
n=4
SVL 14.2 20.5 15.4 17.1 18.1 16.9 14.2 15.2 – 17.3 14.1 – 14.9
HL 5.4 6.9 6.7 5.7 4.9 4.9 3.8 3.6 – 4.7 3.5 – 3.7
SL 1.8 2.1 2.5 2.4 2.5 2.2 1.9 1.9 – 2.2 1.8 – 2.1
EL 1.9 2.5 1.8 1.8 1.9 1.5 1.5 1.6 – 1.9 1.5 – 1.6
N-EL 0.9 1.4 2 1.2 1 0.9 0.9 1 – 1.2 0.9 – 1
HW 5.4 6.8 5.8 5.6 6 5.5 4.1 4.3 – 5.8 4.2 – 4.4
IND 1.5 2.4 1.8 1.7 2.2 2.1 1.7 1.5 – 1.7 1.2 – 1.5
IOD 1.6 2.3 1.9 2 2.6 2.6 2.3 1.8 – 2.1 1.7 – 2.2
UEW 0.9 1.1 0.8 0.8 1.2 1.1 0.9 0.8 – 1.3 0.8 – 0.9
FLL 7.4 12.9 8.2 9.1 9.9 8.5 7.5 7.9 – 9 7.7 – 8
LAL 5.9 9.7 5.7 7 7.5 6.8 5.3 6 – 6.9 5.7 – 6.2
HAL 3.2 5.6 3.2 3.7 3.7 3.6 2.9 3 – 3.7 3 – 3.3
IPTL 0.5 0.7 0.6 0.6 0.4 0.4 ? 0.5 – 0.6 0.2 – 0.5
OPTL 0.5 0.6 0.7 0.8 0.6 0.6 ? 0.6 – 0.7 0.3 – 0.6
HLL 21.4 28.8 22.1 25.7 27.2 25 20.5 23.3 – 25.4 21 – 22.8
TL 7.2 10 7.1 8 8.5 7.5 6.3 7.1 – 7.6 6.7 – 7.1
FTL 9.6 14.6 11 12.4 11.3 11.9 9.4 10.5 – 11.9 9.7 – 10.4
FL 6.6 8.2 7.1 8 8.1 7.5 6.2 6.8 – 8 5.9 – 7.1
IMTL 0.5 0.9 0.7 0.7 0.9 0.7 0.6 0.5 – 0.8 0.5 – 0.7
TYD 1.1 1 0.9 1.3 1.6 1.4 1 0.8 – 1.1 0.8 – 0.9
TED 0.5 0.4 0.7 0.6 0.8 0.8 0.9 0.6 – 0.7 0.6 – 0.7
1FLO 0.3 0.8 0.6 0.6 0.5 0.4 0.3 0.5 – 0.7 0.6 – 0.6
2FLO 1 1.9 1.2 1.3 0.9 1 0.6 1.1 – 1.4 1.2 – 1.4
3FLO 1.7 3.6 1.7 2.3 1.6 1.5 1 1.6 – 2.2 1.9 – 2
4FLI 1.1 2.1 1 1.4 1.1 0.9 0.2 1 – 1.3 1.1 – 1.3
1FW 0.2 0.4 0.2 0.2 0.2 0.2 0.1 0.2 – 0.3 0.2 – 0.2
2FDW 0.3 0.6 0.3 0.3 0.3 0.4 0.2 0.3 – 0.4 0.2 – 0.3
3FDW 0.3 0.7 0.4 0.5 0.4 0.4 0.3 0.3 – 0.4 0.3 – 0.3
4FDW 0.3 0.6 0.3 0.3 0.3 0.3 0.3 0.3 – 0.4 0.2 – 0.3
1TOEL 0.4 1 0.7 0.4 0.3 0.5 0.3 0.2 – 5 0.3 – 0.6
2TOEL 1.4 2.2 1.6 1.2 1.5 1.5 1 1.1 – 1.5 1 – 1.5
3TOEL 2.4 3.8 3.1 3 2.6 2.9 1.9 2.2 – 2.9 2.4 – 2.7
4TOEL 3.9 5.8 4.1 4.7 4.6 4.8 3.7 3.9 – 4.6 3.8 – 4.4
5TOEL 1.6 2.8 1.8 1.8 2.2 2 1.6 1.4 – 1.9 1.6 – 2.1
1TDW 0.3 0.5 0.3 0.3 2.9 0.4 0.1 0.2 – 0.4 0.3 – 0.3
2TDW 0.4 0.6 0.5 0.5 0.5 0.5 0.4 0.3 – 0.5 0.3 – 0.4
3TDW 0.5 0.8 0.6 0.5 0.7 0.7 0.6 0.4 – 0.6 0.4 – 0.4
4TDW 0.6 0.9 0.7 0.6 0.7 0.7 0.6 0.4 – 0.7 0.4 – 0.5
5TDW 0.4 0.6 0.4 0.4 0.4 0.4 0.4 0.3 – 0.4 0.4 – 0.4
FLL/SVL 0.52 0.63 0.53 0.53 0.55 0.51 0.53 0.5 – 0.58 0.52 – 0.55
FLL/HLL 0.35 0.45 0.37 0.35 0.36 0.34 0.37 0.33 – 0.39 0.34 – 0.36
HAL/FLL 0.43 0.43 0.39 0.41 0.37 0.42 0.38 0.36 – 0.41 0.39 – 0.42
HLL/SVL 1.51 1.4 1.44 1.5 1.5 1.48 1.45 1.36 – 1.58 1.49 – 1.57
HW/HL 1 0.99 0.87 0.98 1.23 1.14 1.1 1.1 – 1.31 1.17 – 1.24
SL/EL 0.95 0.84 1.39 1.31 1.33 1.42 1.26 1.03 – 1.3 1.19 – 1.28
SL/SVL 0.13 0.1 0.16 0.14 0.14 0.13 0.13 0.12 – 0.13 0.13 – 0.14
EL/SVL 0.13 0.12 0.12 0.11 0.1 0.09 0.1 0.1 – 0.12 0.11 – 0.11
N-EL/EL 0.47 0.56 1.11 0.65 0.51 0.58 0.61 0.55 – 0.71 0.56 – 0.63
N-EL/SVL 0.06 0.07 0.13 0.07 0.05 0.05 0.06 0.06 – 0.07 0.06 – 0.07

tudinal furrow on dorsal surface of fingers absent; subar-
ticular tubercles under fingers indistinct; nuptial pad ab-
sent; two palmar tubercles: inner palmar tubercle small,
rounded; outer palmar tubercle rounded, slightly longer
than inner palmar tubercle (IPTL/OPTL 0.84); palmar
surface smooth, supernumerary palmar tubercles absent.
Hindlimbs short and thick, tibia length less than half
of snout-vent length (TL/SVL 0.47); tibiotarsal articula-
tion of adpressed limb reaching eye level; foot length
equal to tibia length (FL/TL 1); relative toe lengths: I <
II < V < III < IV; tarsus smooth, tarsal fold absent; tips of
toes rounded, tips of toes III and IV slightly dilated
(Fig. 4F), terminal grooves or dermal fringes on toes ab-
sent; toes rounded in cross-section; toe webbing absent
between all toes; subarticular tubercles under toes indis-
tinct; single metatarsal tubercle: inner metatarsal tubercle
rounded, flattened (IMTL/SVL ratio 0.04).
Skin on anterior dorsal and dorsolateral surfaces
smooth, shagreened on posterior dorsum and dorsal sur-
faces of hindlimbs; small flat tubercles loosely scattered
on sacral area and dorsal surfaces of limbs; dorsal surface
of forelimbs smooth; upper eyelids smooth, supratympa-
nic folds with low glandular ridges; ventral sides of
trunk, head and limbs completely smooth; well-devel-
oped distinct dermal ridge present on midline of head
dorsal surface, running from tip of snout to sacral area
(Fig. 3).
Coloration of holotype in preservative. Dorsum
black-brown, numerous small whitish speckles densely
scattered on dorsal surfaces of head, body, and limbs
(Fig. 4A, G); posterior parts of dorsum and dorsal sur-
faces of hindlimbs with tiny whitish pustules; whitish
stripe from snout tip toward eye along canthus rostralis,
continuing to superciliary area and indistinct on supra-
tympanic fold; dorsal surfaces of forearms and hindlimbs
black-brown with numerous rare whitish tubercles and
pustules; lateral sides of head dark brown with whitish
mottling on upper jaw and mouth corners (Fig. 4); can-
thus rostralis ventrally dark brown; ventrally bright
milky-white with weak dark brown marbling, marbling
more scarce on ventral part of thighs and vent area, den-
ser anteriorly toward chest and throat area (Fig. 4B, H);
fingers and toes dorsally gray-brown, ventrally gray-
brown with irregular beige or whitish blotches
(Fig. 4E, F). Pupil round, white, iris uniform dark brown
(Fig. 4C).
Extended diagnosis. From other congeners, Vietna-
mophryne orlovi can be distinguished by the following
combination of morphological traits after Poyarkov et al.,
2018 (changes in italic): 1) miniaturized body size, SVL
of single male 15.4 mm (single female 17.1 mm); 2) body
habitus stout, FLL/SVL and HLL/SVL ratios 0.53 (0.53)
and 1.43 (1.50), respectively; 3) head longer than wide,
HW/HL ratio 0.87 (0.98); 4) snout comparatively long,
rounded in dorsal and lateral views, snout length greater
than eye length (SL/EL ratio 1.41 (1.31)); 5) eye medi-
um-sized, eye length/snout-vent length ratio 0.12 (0.11);
eye to nostril distance 0.13 (0.11) of SVL; 6) tympanum
comparatively small, rounded, 0.06 (0.07) of SVL; well
separated from eye (TED/SVL ratio 0.04 (0.04)); 7) tips
of all digits rounded, not expanded in F1 – F4, T1, T2,
and T5, weakly expanded in T3 and T4; 8) finger 1 well
developed, half of finger 2 length (1FLO/2FLO ratio
0.48 (0.50), relative finger lengths: I < IV < II < III (I < II
< IV < III), relative toe lengths: I < II < III < IV (I < II < V
< III < IV); 9) subarticular tubercles under fingers and
toes weak, indistinct; 10) outer metatarsal tubercle ab-
sent, inner metatarsal tubercle small, rounded (0.04
(0.04) of SVL); 11) skin of ventral surface completely
smooth, skin of dorsal and lateral surfaces smooth anteri-
362 Thanh Vinh Nguyen et al.
Species
Vietnamophryne
inexpectata
Vietnamophryne
occidentalis Vietnamophryne orlovi Vietnamophryne cuongi sp. nov. Vietnamophryne
vuquangensis
ZMMU
A-5820
M*
ZMMU
A-5822
M*
ZMMU
A-5821
M*
VNMN
011309
F
VNMN
010357
F
VNMN
010358
F*
VNMN
010359
J
F
(min – max)
n=9
M
(min – max)
n=4
TYD/SVL 0.08 0.05 0.06 0.07 0.09 0.08 0.07 0.05 – 0.06 0.05 – 0.06
TYD/EL 0.58 0.4 0.5 0.69 0.85 0.93 0.69 0.41 – 0.54 0.5 – 0.54
TED/SVL 0.04 0.02 0.05 0.04 0.04 0.05 0.06 0.03 – 0.05 0.04 – 0.05
1FLO/2FLO 0.3 0.42 0.5 0.5 0.62 0.43 0.41 0.44 – 0.5 0.43 – 0.49
ITML/SVL 0.04 0.04 0.05 0.04 0.05 0.04 0.04 0.03 – 0.05 0.03 – 0.05
3FLO/4FLI 1.55 1.71 1.7 1.69 1.37 1.65 5.61 1.52 – 1.9 1.54 – 1.75
IPTL/OPTL 1 1.17 0.86 0.84 0.7 0.7 ? 0.78 – 0.94 0.78 – 0.86
TL/SVL 0.51 0.49 0.46 0.47 0.47 0.45 0.45 0.42 – 0.49 0.46 – 0.48
FL/TL 0.92 0.82 1 1 0.95 0.99 0.99 0.93 – 1.06 0.88 – 0.99
Note. *, Holotype; M, male; F, female; J, juvenile; ?, unclear, for other abbreviations see Material and methods.
TABLE 3 (continued)

A New Species of Vietnamophryne 363
TABLE 4. Selected Diagnostic Characters for the Species in the Genus Vietnamophryne
Species Sex SVL
White
spots on
dorso-
lateral
Ratio head width
and head length
Ratio snout length
and eye length Tympanum length Finger 1 length Ventral coloration Dorsal skin texture
Vietnamophryne
cuongi sp. nov.
M??????? ?
F 16.9 – 18.1 present Head wider than
long (HW/HL
1.10 – 1.23)
Snout length greater
than eye length
(SL/EL 1.33 – 1.42)
Larger tympanum
(TYD/SVL
0.08 – 0.09)
Well developed,
about half of second
finger (1FLO/2FLO
0.43 – 0.62)
Ventrally milky-
white coloration
with gray marbling
Mostly smooth skin
on dorsum with
somewhat enlarged
flat pustules
V. orlovi M 15.4 present Head longer
than wide
(HW/HL 0.87)
Snout length greater
than eye length
(SL/EL 1.39)
Smaller
tympanum
(TYD/SVL 0.06)
Well developed,
half of second finger
(1FL/2FL 0.50)
Ventrally bright
lemon-yellow with
dark brown marbling
Smooth anteriorly,
somewhat shagreened
posteriorly with small flat
pustules loosely scattered
on posterior dorsum
F 17.1 present Head longer
than wide
(HW/HL 0.98)
Snout length greater
than eye length
(SL/EL 1.31)
Smaller
tympanum
(TYD/SVL 0.07).
Well developed,
half of second finger
(1FLO/2FLO 0.50)
Ventrally bright
lemon-yellow with
dark brown marbling
Smooth anteriorly,
somewhat shagreened
posteriorly with small flat
pustules loosely scattered
on posterior dorsum
V. vuquangensis M 14.1 – 14.9 present Head wider than
long, (HW/HL
1.17 – 1.24)
Snout length greater
than eye length
(SL/EL 1.19 – 1.28)
Tympanum relatively
faint, comparatively
small, rounded,
0.05 – 0.06 of SVL
Well developed, less
than half of second
finger (1FLO/2FLO
0.43 – 0.49)
Ventrally ivory-lemon
to lemon-yellow
with weak
dark-brown marbling
Shagreened with small
flat pustules loosely
scattered on dorsum
F 15.2 – 17.3 present Head wider than
long, (HW/HL
1.10 – 1.31)
Snout length greater
than eye length
(SL/EL 1.03 – 1.30)
Tympanum compara-
tively small, rounded,
0.05 – 0.06 of SVL
well developed, less
than half of second
finger (1FLO/2FLO
0.44 – 0.50)
Ventrally bright
lemon-yellow with
weak dark-brow
marbling
Mostly smooth, slightly
shagreened posteriorly,
lacking enlarged tubercles
V. inexpectata M 14.2 present Head as long
as wide,
(HW/HL 1)
Snout length greater
than eye length
(SL/EL 0.95)
Larger tympanum
(TYD/SVL 0.09)
Rudimentary, slightly
protuberant as nub
(1FLO/2FLO 0.30)
Ventrally grayish-
beige coloration
with gray marbling
Warty skin on posterior
and shagreened skin on
anterior parts of dorsum
F??????? ?
V. occidentalis M 20.5 absent Head less wider
than long
(HW/HL 0.99)
Snout length greater
than eye length
(SL/EL 0.84)
Tympanum
comparatively small,
rounded, 0.05 of SVL
Well developed,
half of F2 length
(1FL/2FL ratio 0.43)
Ventrally bright
orange-red with sparse
dark brown marbling
Completely smooth,
posteriorly with loosely
scattered small flat
tubercles present
F??????? ?

orly, somewhat shagreened posteriorly with small flat
pustules loosely scattered on posterior dorsum and dorsal
surface of hindlimbs; 12) dorsomedial vertebral skin
ridge distinct, discernible only on midline of dorsum and
head (discernible from head to vent); 13) dorsally red-
dish-brown, pustules on posterior dorsum whitish; lateral
sides of head dark brown with whitish mottling; ventrally
lemon-yellow with fine brown marbling.
Vietnamophryne cuongi sp. nov.
(Figs.5–6;Tables3–4)
Holotype. VNMN 010358, adult female, collected in
evergreen tropical forest at Ba Vi National Park, Hanoi
Capital, Vietnam (21°03¢32.9¢¢ N 105°21¢36.2¢¢ Eatanele
-
vation of 975 m a.s.l.) on 27 August 2019 by T. V. Nguyen.
Paratype. Adult female VNMN 010357 same loca-
tion than given for holotype.
Referred specimen. Juvenile VNMN 010359 same
location than given for holotype.
Diagnosis. Vietnamophryne cuongi sp. nov. is distin-
guished from all of its congeners by a combination of the
following morphological characters: (1) miniaturized
body size, SVL (female, n= 2) 16.9 – 18.1 mm; (2) body
habitus stout, FLL/SVL and FLL/HLL ratios 0.51 – 0.55
and 0.34 – 0.36, respectively; (3) head longer than wide,
HW/HL ratio 1.14 – 1.23; (4) snout long, rounded in dor-
sal and lateral views, snout length greater than eye length
(SL/EL ratio 1.33 – 1.42); (5) eye medium-sized, N-EL/
EL ratio 0.51 – 0.58; eye to nostril distance 0.13 – 0.14
of SVL; (6) tympanum comparatively large and rounded,
0.08 – 0.09 of SVL; well separated from eye (TED/SVL
ratio 0.04 – 0.05); (7) tips of all digits rounded, not ex-
panded in F1 – F4, T1, T2, and T5, weakly expanded in
T3 and T4; (8) first finger (F1) well developed, approxi-
mately less than half of F2 length (1FLO/2FLO ratio
0.43 – 0.49), third finger (F3) approximately less than
double of F4 length (3FL/4FL ratio 1.37 – 1.65), relative
finger lengths: I < II < IV < III, relative toe lengths: I < II
< V < III < IV; (9) subarticular tubercles under fingers
and toes weak, indistinct; (10) outer metatarsal tubercle
absent, inner metatarsal tubercle small, rounded (0.04 –
0.05 of SVL); (11) skin of ventral surface completely
smooth, skin of dorsal and lateral surfaces smooth anteri-
orly, lateral dorsum and dorsal surface of hindlimbs have
small dark-brown pustules loosely scattered; (12) dorso-
medial vertebral skin ridge distinct, discernible on dor-
sum and head from snout to cloaca; (13) dorsally black-
brown, pustules on lateral dorsum white-brown, lateral
sides of head dark brown, ventrally beige with weak gray
marbling.
Description of holotype. Body miniaturized, habitus
stout (SVL 16.9mm) specimen in good state of preserva-
tion. Head wider than long (HW/HL 1.14), snout com-
paratively long, rounded in dorsal view, truncate in lat-
eral view (Fig. 6A, B), snout length greater than eye
length (SL/EL 1.42); nostril rounded, lateral, located al-
most same distance from tip of snout and eye; dorsal sur-
face of head slightly convex, canthus rostralis distinct,
rounded; region weakly concave; pupil round, horizontal;
eyes medium-sized (EL/SVL 0.09); eye to nostril dis-
tance 0.05 of SVL; eyes slightly protuberant in dorsal and
lateral views; loreal region weakly concave; tympa-
num well discernible, circular, comparatively large
(TYD/SVL 0.08); located distantly from eye (TED/SVL
0.05), tympanic rim not elevated above skin of temporal
364 Thanh Vinh Nguyen et al.
Fig. 5. Female holotype (VNMN 010358) of Vietnamophryne cuongi sp. nov. in life and habitat of Vietnamophryne cuongi sp.nov.inBaViNP,
Hanoi, Vietnam. Photos by T. V. Nguyen.

A New Species of Vietnamophryne 365
Fig. 6. Dorsolateral view (A), ventral view (B), lateral view of head (C), tongue (D), left hand (E), left foot (F), dorsolateral view (G), ventral view
(H) in preservative of the holotype (VNMN 010358) of Vietnamophryne cuongi sp. nov. Photos by H. Q. Nguyen.

area, supratympanic fold present, distinct, glandular
(Fig. 6C); vomerine teeth and spikes absent, single trans-
verse palatal fold with smooth edge present across palate
anteriorly to pharynx; tongue spatulate and free behind,
papillae on tongue absent, and vocal sac opening not dis-
cernible (Fig. 6D).
Forelimbs comparatively short, around one-third of
hindlimb length (FLL/HLL 0.34); hand shorter than
lower arm, almost one-third of forelimb length (HAL/
FLL 0.42); fingers short, round in cross-section, first fin-
ger well developed, less than half of length of second fin-
ger (1FLO/2FLO 0.43); relative finger lengths: I < IV <
II < III (Fig. 6E). Webbing and dermal fringes absent.
First fingertip rounded; tips of three outer fingers II-IV
rounded, not dilated, finger disks absent, terminal
grooves absent; longitudinal furrow on dorsal surface of
fingers absent; subarticular tubercles under fingers indis-
tinct; nuptial pad absent; two palmar tubercles: inner pal-
mar tubercle small, rounded; outer palmar tubercle
rounded, slightly longer than inner palmar tubercle
(IPTL/OPTL 70%); palmar surface smooth, supernumer-
ary palmar tubercles absent.
Hindlimbs short and thick, tibia length less than half
of snout-vent length (TL/SVL 0.45); tibiotarsal articula-
tion of adpressed limb reaching eye level; foot length is
nearly as long as tibia length (FL/TL 0.99); relative toe
lengths: I < II < V < III < IV; tarsus smooth, tarsal fold
absent; tips of toes rounded, tips of toes III and IV slight-
ly dilated (Fig. 6F), terminal grooves on toes absent; der-
mal fringes on toes absent; toes rounded in cross-section;
toe webbing absent between all toes; subarticular tuber-
cles under toes indistinct; single metatarsal tubercle: in-
ner metatarsal tubercle rounded, flattened (IMTL/SVL
0.04).
Skin on anterior dorsal and dorsolateral surfaces
smooth; small tubercles prominent on lateral parts of dor-
sum, sacral area, and dorsal surfaces of hindlimbs; dorsal
surface of forelimbs smooth (Fig. 5); upper eyelids
smooth, supratympanic folds with low glandular ridges;
ventral sides of trunk, and head smooth (Fig. 6); well-de-
veloped distinct dermal ridge present on midline of head
dorsal surface, running from tip of snout to sacral area
(Fig. 6C).
Color of holotype in life. Dorsum brown, anteriorly
black-brown, numerous small white speckles scattered
on dorsal surfaces of head, body, and limbs (Fig. 5); pos-
terior parts of dorsum and dorsal surfaces of hindlimbs
with dark-brown pustules; canthus rostralis with narrow
whitish stripe formed by tiny flat tubercles, stripe from
snout tip toward eye along canthus rostralis, continuing
to super ciliary area and indistinct on supratympanic fold;
dorsal surfaces of forearms red-brown interspersed gray-
brown; dorsal surfaces of hindlimbs reddish-brown with
rare dark-brown tubercles and pustules; lateral sides of
head dark brown with whitish mottling on lower jaw and
mouth corners; canthus rostralis ventrally dark brown,
dorsally with lacking white stripe; supratympanic fold
with brick-red glandular tubercles lacking white stripe;
ventrally beige with weak gray marbling, marbling den-
ser anteriorly toward throat area, more scarce on ventral
part of thighs, vent area, and chest; fingers and toes dor-
sally gray-brown, ventrally gray-brown with irregular
beige or paler blotches. Pupil round, black, iris uniform
dark brown (Fig. 5).
Color of holotype in preservative. Dorsal surface
gray with white-gray spots created from rare dark-brown
tubercles and pustules collapsed; ventral surface, includ-
ing throat white with dark-gray marbling denser anteri-
orly; thighs, vent area, and chest white with marbling to
lesser extent (Fig. 6).
Etymology. The new species is named in honor of
our colleague Dr. Pham The Cuong from the Institute of
Ecology and Biological Resources, Vietnam Academy of
Science and Technology in Hanoi, in recognition of his
numerous scientific contributions towards a better under-
standing of the amphibian diversity of Vietnam. We re-
commend “Cuong’s Dwarf Frog” as the common English
name of the new species and the common name in Viet-
namese as “Nhái lùn cýõ
Ìng.”
Distribution and ecology. Vietnamophryne cuongi
sp. nov. is currently known only from Ba Vi NP, Hanoi,
Vietnam. Specimens of the new species were found near
a small pond with rotten leaves in evergreen tropical for-
ests of Ba Vi NP on elevations between 975 – 1106 m
a.s.l. (Fig. 5).
Comparison
Vietnamophryne cuongi sp. nov. is markedly distinct
from all other congeners for which comparable se-
quences are available by genetic distances in the 16S
mtDNA gene fragment (p= 2.0 – 6.2%) which are in ad-
dition extending genetic distances between V. occidenta-
lis and V. orlovi (p= 1.9 – 2.0%). Vietnamophryne cuon-
gi sp. nov. differs in head ratios (head width and head
length, eye to nostril distance and eye length, first finger
length and second finger length), tympanum length, ven-
tral coloration, and dorsal skin texture (Table 4).
Vietnamophryne cuongi sp. nov. is a medium-sized
species of Vietnamophryne (SVL 16.9 – 18.1 mm in fe-
males n= 2), and can thus be distinguished on the basis
of size from the smaller Vietnamophryne vuquangensis
(SVL 15.2 – 17.3 in females n=9.
In having a larger tympanum (TYD/SVL 0.07 –
0.09) Vietnamophryne cuongi sp. nov. can be distin-
366 Thanh Vinh Nguyen et al.

guished from the smaller Vietnamophryne occidentalis
(TYD/SVL 0.05), Vietnamophryne vuquangensis (TYD/
SVL 0.05 – 0.06 in males; 0.05 – 0.06 in females).
In having finger 1 about half of finger 2 (1FLO/
2FLO 0.43 – 0.62) Vietnamophryne cuongi sp. nov. can
be distinguished from Vietnamophryne inexpectata
which has finger 1 rudimentary, slightly protuberant as
nub (1FLO/2FLO 0.30).
In having snout length greater than eye length
(SL/EL 1.26 – 1.42) Vietnamophryne cuongi sp. nov. can
be distinguished from V. occidentalis which has snout
length subequal to eye length (SL/EL 0.86), V. inexpecta-
ta which has snout length subequal to eye length (SL/EL
0.96).
In having head wider than long (HW/HL 1.10 –
1.23) Vietnamophryne cuongi sp. nov. can be distin-
guished from V. orlovi (head longer than wide HW/HL
0.87 – 0.98), V. inexpectata (as long as wide HW/HL 1)
and V. occidentalis (head less longer than wide HW/HL
0.99).
In having most of the dorsal skin smooth, Vietnamo-
phryne cuongi sp. nov. can be distinguished from V. orlo-
vi (smooth anteriorly, somewhat shagreened posteriorly
with small flat pustules loosely scattered on posterior
dorsum), V. vuquangensis (dorsal skin shagreened with
small flat pustules loosely scattered on dorsum), V. inex-
pectata (warty dorsal skin and shagreened skin on the an-
terior dorsum) and V. occidentalis (dorsal skin com-
pletely smooth, posteriorly with loosely scattered small
flat tubercles present.
In having milky white ventral coloration with gray
marbling, Vietnamophryne cuongi sp. nov. can be further
distinguished from V. orlovi (ventrally lemon-yellow
with fine brown marbling), V. occidentalis (ventrally
bright orange-red with sparse dark brown marbling),
V. inexpectata (ventrally grayish-beige coloration with
gray marbling) and V. vuquangensis (ventrally lemon-
yellow with weak dark-brow marbling).
DISCUSSION
In this study a new microhylid, asterophryine anuran
species could be added to the batrachofauna of Indo-
china. Speciation within the genus Vietnamophryne was,
most likely, a comparatively recent event due to the small
genetic distances observed among species. Interspecific
uncorrected p-distances of the Vietnamophryne species
group showed up to be 3.1 – 5.1% in Poyarkov et al.
(2018) (Table 2). In this study we could extend the range
within the genus from 1.9 – 2.0% (V. occidentalis vs.
V. orlovi) to 5.9 – 6.2% (V. vuquangensis vs. V. cuongi).
The new species of Vietnamophryne from Ba Vi NP dif-
fered from all other group members in 16S rRNA se-
quences. It revealed to be most closely related genealogi-
cally to V. orlovi from Phia Oac Phia Den NP. The molec-
ular divergence, although small (2.0 – 2.3%), revealed to
be higher than known genetic distances between V. occi-
dentalis vs. V. orlovi. As the new species further showed
distinct morphological compared with its sister species
V. orlovi, we decided to describe it as a new taxon herein,
besides an extended diagnosis of V. orlovi due to a new
finding, which at the same time represents the first fe-
male known.
Vietnamophryne is a genus of small miniaturized
frogs. Although the specimens were mostly recorded in
soil or under large tree-trunks, suggesting a semi-fossori-
al lifestyle, they lack obvious adaptations for digging.
Due to their secretive underground biology, they have
been encountered by herpetologists only recently and
have remained almost unnoticed despite 200 years of her-
petological studies in Indochina (Poyarkov et al., 2018).
This leads to the prediction that members of the genus
Vietnamophryne may be discovered in other areas of
Indochina, including central and northern Vietnam, Laos
and northern Myanmar (Poyarkov et al., 2018). The sta-
tus and distribution of Vietnamophyne members in Indo-
china certainly still needs further research.
The mountain forest in Ba Vi National Park, as well
as other mountain forests of northern Vietnam, belong to
the richest areas in terms of herpetofauna, but they are
under serious threat by deforestation. Therefore, even the
loss of only a small area of evergreen forest can lead to a
serious decline in the diversity of Vietnamophryne spe-
cies. Thus, further measures to protect the evergreen for-
est should be actively promoted to protect the diversity of
Vietnamophryne species. Based on these findings we
herein propose as IUCN Red List Status Endangered.
Acknowledgments. We would like to thank the manage-
ment board of Ba Vi NP for their permission to work in the
field. We thank E. Sterling (New York, NY, USA) and K. Koy
(Berkeley, CA, USA) for providing the map. This research is
supported by the World Academy of Sciences (TWAS), CAS-
TWAS president fellowship program. Research of T. T. Nguyen
is funded by the Vietnam National Foundation for Science and
Technology Development (NAFOSTED) under Grant Number
106.05 – 2019.334. RFBR grants 19-54-53010 and 19-54-
54003-Vietnam for N. Orlov in frame of state theme AAAA-
A19-119020590095-9.
REFERENCES
Frost D. R. (2021), Amphibian Species of the World: An On-
line Reference. Version 6.1. http://research.amnh.org/her-
petology/amphibia/index.html (accessed June 8, 2021).
A New Species of Vietnamophryne 367

Hall T. A. (1999), “BioEdit: a user-friendly biological se-
quence alignment editor and analysis program for Windows
95/98/NT,” Nucl. Acid Sci.,41,95–98.
Hillis D. M. and Bull J. J. (1993), “An empirical test of boot-
strapping as a method for assessing confidence in phylogen-
etic analysis,” Syst. Biol.,42(2), 182 – 192.
Hoang V. C., Jiang J. P., Nguyen Q. H., Orlov N. L.,
Le V. M., Nguyen V. H., Nguyen V. T., Nguyen T. T., and
Ziegler T. (2021), “A new species of Vietnamophryne from
Vietnam,” Rev. Suisse Zool.,128(1), 207 – 219.
Huelsenbeck J. P. and Hillis D. M. (1993), “Success of phylo-
genetic methods in the four-taxon case,” Syst. Biol.,42(3),
247 – 264.
Jobb G., Haeseler A. V., and Strimmer K. (2004), “TREE-
FINDER: A powerful graphical analysis environment for
molecular phylogenetics,” BMC Evol. Biol.,4, 18.
Katoh K. and Standley D. M. (2013), “MAFFT multiple se-
quence alignment software version 7: improvements in per-
formance and usability,” Mol. Biol. Evol.,30, 772 – 780.
Kumar S., Stecher G., and Tamura K. (2016), “MEGA7:
Molecular Evolutionary Genetics Analysis version 7.0 for
bigger datasets,” Mol. Biol. Evol.,33(7), 1870 – 1874.
Kurabayashi A., Matsui M., Belabut D. M., Yong H. S., Ah-
mad N., Sudin A., and Sumida M. (2011), “From Antarc-
tica or Asia? New colonization scenario for Australian –
New Guinean narrow mouth toads suggested from the find-
ings on a mysterious genus Gastrophrynoides,” BMC Evol.
Biol.,11, 175.
Kuraishi N., Matsui M., Hamidy A., Belabut D. M., Ah-
mad N., Panha S., Sudin A., Yong H. S., Jiang J. P.,
Ota H., Thong H. T., and Nishikawa K. (2012), “Phylo-
genetic and taxonomic relationships of the Polypedates leu-
comystax complex (Amphibia),” Zool. Scripta,42,54–70.
Leaché A. D. and Reeder T. W. (2002), “Molecular syste-
matics of the eastern fence lizard (Sceloporus undulatus): a
comparison of parsimony, likelihood, and Bayesian ap-
proaches,” Syst. Biol.,51(1), 44 – 68.
Nguyen T. T., Matsui M., Eto K., and Orlov N. L. (2014),
“A preliminary study of phylogenetic relationships and tax-
onomic problems of Vietnamese Rhacophorus (Anura:
Rhacophoridae),” Russ. J. Herpetol.,21(4), 274 – 280.
Poyarkov N. A., Vassilieva A. B., Orlov N. L., Galo-
yan E. A., Tran D., Le D. T. T., Kretova V. D., and Geiss-
ler P. (2014), “Taxonomy and distribution of narrow-mouth
frogs of the genus Microhyla Tschudi, 1838 (Anura: Micro-
hylidae) from Vietnam with descriptions of five new spe-
cies,” Russ. J. Herpetol.,21(2): 89 – 148.
Poyarkov N. A., Suwannapoom C., Pawangkhanant P., Ak-
sornneam A., Duong V. T., Korost D. V., and Che J.
(2018), “A new genus and three new species of miniatur-
ized microhylid frogs from Indochina (Amphibia: Anura:
Microhylidae: Asterophryinae),” Zool. Res.,38(3), 1 – 26.
Rambaut A., Drummond A. J., Xie D., Baele G., and Su-
chard M. A. (2018), “Posterior summarization in Bayesian
phylogenetics using tracer 1.7,” Syst. Biol.,67(5), 901 –
904.
Suwannapoom C., Sumontha M., Tunprasert J., Ruang-
suwan T., Pawangkhanant P., Korost D. V., and Poyar-
kov N. A. (2018), “A striking new genus and species of
cave-dwelling frog (Amphibia: Anura: Microhylidae:
Asterophryinae) from Thailand,” PeerJ,6, e4422
Tanabe A. S. (2011), “Kakusan 4 and Aminosan: two pro-
grams for comparing nonpartitioned, proportional and sepa-
rate models for combined molecular phylogenetic analyses
of multilocus sequence data,” Mol. Ecol. Resources,11,
914 – 921.
Tavaré S. (1986), “Some probabilistic and statistical problems
in the analysis of DNA sequences,” Lect. Math. Life Sci.,
17,57–86.
Thompson J. D., Gibson T. J., Plewniak F., Jeanmougin F.,
and Higgins D. G. (1997), “The CLUSTAL X windows in-
terface: flexible strategies for multiple sequence alignment
aided by quality analysis tools,” Nucl. Acids Res.,25(24),
4876 – 4882.
Wollenberg K. C., Vieites D. R., van der Meijden A.,
Glaw F., Cannatella D. C., and Vences M. (2008), “ Pat-
terns of endemism and species richness in Malagasy cophy-
line frogs support a key role of mountainous areas for spe-
ciation,” Int. J. Org. Evol.,62(8), 1890 – 1907.
368 Thanh Vinh Nguyen et al.