ArticlePDF Available

New genetic variants of TET2 and ASXL1 identified by next generation sequencing and pyrosequencing in a patient with MDS-RS-MLD and secondary acute myeloid leukemia

Authors:
  • Institute of Human Genetics, Poznań, Poland
  • Institute of Human Genetics, Poznan, Poland
Article

New genetic variants of TET2 and ASXL1 identified by next generation sequencing and pyrosequencing in a patient with MDS-RS-MLD and secondary acute myeloid leukemia

Abstract and Figures

Myelodysplastic syndromes (MDS) are a heterogeneous group of myeloid neoplasms characterized by the presence of cytopenias, ineffective hematopoiesis and frequent transformation into secondary acute myeloid leukemia (secAML). Recent genomic studies provide unprecedented insight into the molecular landscape of clonal proliferation in MDS. Genetic diversity of both MDS and secAML subclones cannot be defined by a single somatic mutation. Mutations of the founding clone may survive over implemented chemotherapy and allogenic hematopoietic cell transplantation (alloHCT), but new subclonal mutations may also appear. Next generation sequencing (NGS) makes it possible to define the mutational profile of disease subclones during the treatment course and has a potential in pre- and post-alloHCT monitoring. Understanding the molecular pathophysiology of MDS may soon allow for monitoring the course of disease and personalized treatment depending on the mutational landscape. In the present paper we report, for the first time in MDS, ASXL1 c.1945G>T, TET2 c.4044+2dupT and c.4076G>T sequence variants. Moreover, we detected RUNX1 c.509-2A>C and SF3B1 c.1874G>T sequence variants. Furthermore, we verify the clinical utility of NGS and pyrosequencing in MDS and secAML.
This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike
4.0 International (CC BY-NC-SA 4.0). License (http://creativecommons.org/licenses/by-nc-sa/4.0/)
524
Case report DOI: https://doi.org/10.5114/ceji.2021.111166
Correspondence: Monika Małgorzata Adamska, Department of Hematology and Bone Marrow Transplantation, Poznan University
of Medical Sciences, Poland, e-mail: mmadamskaa@gmail.com
Submitted: 4.12.2020; Accepted: 5.07.2021
New genetic variants of TET2 and ASXL1
identified by next generation sequencing and
pyrosequencing in a patient with MDS-RS-MLD
and secondary acute myeloid leukemia
MONIKA MAŁGORZATA ADAMSKA1*, EWELINA KOWAL-WIŚNIEWSKA1,2*,
KATARZYNA KIWERSKA2, ADAM USTASZEWSKI2, JOANNA CZERWIŃSKA-RYBAK1,
ZUZANNA KANDUŁA1, MARZENA WOJTASZEWSKA1, MARTA BARAŃSKA1,
ŁUKASZ PRUCHNIEWSKI1, KRZYSZTOF LEWANDOWSKI1, MAŁGORZATA JARMUŻ-SZYMCZAK1,2,
LIDIA GIL1
1Department of Hematology and Bone Marrow Transplantation, Poznan University of Medical Sciences, Poland
2Institute of Human Genetics, Polish Academy of Sciences, Poznan, Poland
*These authors contributed equally to this study
Abstract
Myelodysplastic syndromes (MDS) are a heterogeneous group of myeloid neoplasms characterized
by the presence of cytopenias, ineffective hematopoiesis and frequent transformation into secondary
acute myeloid leukemia (secAML). Recent genomic studies provide unprecedented insight into the mo-
lecular landscape of clonal proliferation in MDS. Genetic diversity of both MDS and secAML subclones
cannot be defined by a single somatic mutation. Mutations of the founding clone may survive over imple-
mented chemotherapy and allogenic hematopoietic cell transplantation (alloHCT), but new subclonal
mutations may also appear. Next generation sequencing (NGS) makes it possible to define the mutational
profile of disease subclones during the treatment course and has a potential in pre- and post-alloHCT
monitoring. Understanding the molecular pathophysiology of MDS may soon allow for monitoring the
course of disease and personalized treatment depending on the mutational landscape. In the present
paper we report, for the first time in MDS, ASXL1 c.1945G>T, TET2 c.4044+2dupT and c.4076G>T
sequence variants. Moreover, we detected RUNX1 c.509-2A>C and SF3B1 c.1874G>T sequence vari-
ants. Furthermore, we verify the clinical utility of NGS and pyrosequencing in MDS and secAML.
Key words: NGS, myelodysplastic syndrome, secondary acute myeloid leukemia, allogenic
hematopoietic cell transplantation, DNA sequence variants/mutations.
(Cent Eur J Immunol 2021; 46 (4): 524-530)
Introduction
Myelodysplastic syndromes (MDS) represent a het-
erogeneous group of clonal hematological malignancies
characterized by the presence of cytopenias resulting from
ineffective hematopoiesis, multilineage dysplasia and
high risk of transformation to secondary acute myeloid
leukemia (secAML) [1, 2]. Whole genome sequencing
identified more than 45 genes involved in MDS molec-
ular pathophysiology, which encode proteins involved
in pre-mRNA splicing (SRSF2, SF3B1, U2AF1, ZRSR2),
DNA methylation (TET2, DNMT3A, IDH1/2), histone
modification (ASXL1, EZH2), signal transduction and the
TP53 pathway. Among them also cohesion components
(SMC1A, RAD21, STAG1, STAG2, SMC3) and transcrip-
tion factors (RUNX1, ETV6, GATA2) were found [1, 3].
Various somatic mutations were associated with overall
prognosis and specific MDS morphological features [2].
Understanding molecular mechanisms of genetic disease
evolution may allow for targeted MDS treatment. Measur-
able residual disease (MRD) and donor chimerism (DC)
monitoring remain essential in the management strategy of
MDS patients after allogenic hematopoietic cell transplan-
tation (alloHCT). Next generation sequencing (NGS) ap-
plication enables detection of sequence variants and their
further monitoring. Therefore in this study we intended
to evaluate the diagnostic utility of targeted NGS, Sanger
sequencing (SSeq) and pyrosequencing in monitoring mu-
Central European Journal of Immunology
2021; 46(4)
New genetic variants of TET2 and ASXL1 identified by next generation sequencing and pyrosequencing
in a patient with MDS-RS-MLD and secondary acute myeloid leukemia
525
tational dynamics with samples collected sequentially at
different stages of MDS/secAML.
Material and methods
DNA was isolated from bone marrow samples (BM),
peripheral blood samples (PB) and saliva samples (SAL) by
a standard phenol : chloroform procedure. Samples collect-
ed in 2009-2018 from a patient with MDS/secAML were
analyzed in order to examine the mutational profile during
the course of the disease (Fig. 1). DNA samples isolated
from PB of six healthy controls were used to establish the
limit of allele frequency (AF) detection by pyrosequencing.
Molecular analysis was performed in accordance with the
Declaration of Helsinki and Ethics Committee approval
(563/14) with written informed consent obtained from the
patient. Both MDS and secAML diagnoses were estab-
lished according to the 2016 World Health Organization
criteria [2]. Treatment response and cytogenetic and ge-
netic risk were evaluated according to the 2017 European
LeukemiaNet (ELN) recommendations [4].
Targeted NGS was performed in a BM sample taken
in January 2015 at the stage of secAML relapse after the
first alloHCT. 67 exons (ex.) (91 amplicons) of nine genes
SF3B1 (ex. 12-16), U2AF1 (ex. 2,6), SRSF2 (ex. 1),
ZRSR2 (whole coding region), TET2 (ex. 3-11), ASXL1
(ex. 12), DNMT3A (ex. 2-23), TP53 (ex. 2-11) and RUNX1
(ex. 3-8) – were paired-end sequenced using the targeted
NGS (MiSeq system (Illumina)). The sequencing coverage
accounted for 31-9095 with mean 250 read length. Bioin-
formatic analyses comprised mapping reads using the bwa-
mem algorithm (BWA, 0.7.10) [5] to the reference genome
UCSC Genome Browser (GRCh37/hg19). The detection
of variants was performed using GATK (3.5) software [6]
with their further annotation completed by snpEff (4.2) [7]
based on the dbSNP142 database. For further validation
we selected only nonsynonymous substitutions and indels,
novel variants or those already annotated with mean AF
< 1%. Next, detected variants were confirmed with SSeq
and pyrosequencing. Primer sequences, amplicon lengths
and localization and PCR conditions are listed in Table 1.
Pyrosequencing was carried out according to the manu-
facturer’s protocol at PyroMark Q48 Autoprep (Qiagen).
SSeq was performed according to the protocol described
by Kiwerska et al. [8]. The obtained results were analyzed
in relation to the patient’s clinical data.
Case report
The patient, a 54-year-old man, was diagnosed with
MDS with ring sideroblasts and multilineage dysplasia
(MDS-RS-MLD) in April 2008 (3% BM blasts, 74%
BM ring sideroblasts, normal karyotype and intermediate
disease risk according to the Revised International Prog-
nostic Scoring System (IPSS-R)). In November 2010 due
to transformation to secAML the patient underwent con-
ventional chemotherapy with daunorubicin and cytarabine
(without hypomethylating agents) followed by alloHCT
(May 2011). Second alloHCT (preceded by treatment
with chemotherapy with daunorubicin and cytarabine) was
performed in February 2015 and third alloHCT (preced-
ed by hypomethylating agents) was performed in March
2018 (Fig. 1). Targeted NGS was performed in a BM sam-
ple taken at the moment of the resistance to the imple-
mented therapy for the secAML relapse (January 2015;
with PB DC = 42% and BM blasts = 6%) and revealed
the presence of the following DNA sequence variants:
c.4044+2dupT (splicing variant) and c.4076G>T (p.Ar-
g1359Leu) in TET2, c.1945G>T (p.Gly649*) in ASXL1
and c.1874G>T (p.Arg625Leu) in SF3B1, with AF of:
25.3%, 26.6%, 27.9%, 25.3%, respectively. Presence of all
detected variants was confirmed using SSeq and pyrose-
quencing in both BM and SAL. For each DNA sequence
variant the sensitivity of the pyrosequencing method (AF
percentage above which the tested sample is considered
as positive) was established. To do so, twice the standard
deviation of AF for healthy controls + the highest value of
AF observed in controls was counted. The cut-off values
for c.4044+2dupT TET2, c.4076G>T TET2, c.1945G>T
ASXL1 and c.1874G>T SF3B1 DNA variants were de-
termined as: 11.5%, 2.4%, 2%, 4.4%, respectively. AF
values obtained by pyrosequencing corresponded to those
obtained by NGS. Moreover, for analyzed DNA sequence
variants, AF levels obtained by pyrosequencing in BM and
SAL were very similar (Fig. 1).
In retrospective analysis of BM (May 2009; Novem-
ber 2010) with pyrosequencing and SSeq, c.4044+2dupT
and c.4076G>T TET2, c.1945G>T ASXL1 and c.1874G>T
SF3B1 DNA sequence variants were detected. In May
2009 at the MDS stage of disease, AF was 49.2%, 34.5%,
44.1%, 44.7%, respectively (Fig. 1). All detected variants
were reported in hematological malignancies according to
the Catalogue of Somatic Mutations in Cancer (COSMIC)
database [9]; however, except for c.1874G>T SF3B1,
the remaining three variants had not been identified in
MDS patients so far. In November 2010 transformation to
secAML occurred; the patient underwent chemotherapy
and was qualified for alloHCT. Using pyrosequencing,
AF of above-mentioned variants was determined as 47%,
35.5%, 33.6% and 39.6%, respectively (Fig. 1). AlloHCT
from an unrelated donor was performed in May 2011 in
complete remission (CR) according ELN 2017 treatment
response criteria. Since January 2014 loss of PB DC (70%,
56%, 41%) has been observed and the patient was consid-
ered for second alloHCT, but relapse of the disease was
diagnosed with 51% of BM blasts. The patient received
chemotherapy, but he did not achieve CR according to the
ELN 2017 treatment response criteria (no CR). Second al-
loHCT from the same donor was performed in February
2015 with 8.4% BM blasts and PB DC 27%. Two years
Central European Journal of Immunology 2021; 46(4)
Monika Małgorzata Adamska et al.
526
100
75
50
25
0
C G T G A
5
ASXL1 c.1945G > T
G: 55.9% T: 44.1%
200
150
100
50
0
175
150
125
100
75
50
25
0
175
150
125
100
75
50
25
0
200
150
100
50
0
C G T G A
5
C G T G A
5
G: 92.7% T: 7.3%
G: 100% T: 0%
150
125
100
75
50
25
0
C G T A
SF3B1 c.1874G > T
G: 55.3% T: 44.7%
C G T A
C G T A
G: 92.3% T: 7.7%
G: 97.8% T: 2.2%
200
150
100
50
0
200
150
100
50
0
200
150
100
50
0
C T A C T
C T A C T
C T A C T
TET2 c.4044 + 2dupT
–: 50.8% T: 49.2%
G: 83.6% T: 16.4%
G: 91.6% T: 8.4%
250
200
150
100
50
0
C G T C
TET2 c.4076 G> T
G: 66.5% T: 34.5%
250
200
150
100
50
0
250
200
150
100
50
0
C G T C
C G T C
G: 93% T: 7%
Fig. 1. A) Data concerning percentage content of bone marrow blasts, ring sideroblasts, peripheral blood chimerism, implemented treatment, performed molecular
analysis and additional information during the course of the patient’s disease. B) Allele frequency results for selected DNA sequence variants (obtained by NGS and
pyrosequencing) in BM, PB and SAL as well as information about AF for healthy control and AF cut-off value for selected DNA sequence variants. C) Electrophero-
grams presenting results of pyrosequencing (c.1945G>T ASXL1; c.1874G>T SF3B1; c.4044+2dupT TET2; c.4076G>T TET2) performed in: I – May 2009, II – January
2017, III – May 2018
BM – bone marrow, PB – peripheral blood, SAL – saliva, HC – healthy control, MDS-RS-SLD – myelodysplastic syndrome with ring sideroblasts and multilineage dysplasia, secAML – secondary AML, lightning – transformation
of MDS to secAML, NGS – next generation sequencing, CH – chemotherapy, AZA – azacitidine, alloHCT – allogenic hematopoietic cell transplantation, allo-haploHCT – allogenic haploidentical hematopoietic cell transplantation)
* Bone marrow chimerism
G: 97.2% T: 2.8%
A
B
CI
II
III
Central European Journal of Immunology
2021; 46(4)
New genetic variants of TET2 and ASXL1 identified by next generation sequencing and pyrosequencing
in a patient with MDS-RS-MLD and secondary acute myeloid leukemia
527
Table 1. Primer sequences, genomic localization of the amplified sequences and reaction conditions
Gene Sequence
alteration
Primer Primer sequence 5’-3’ Annealing
temperature
Product size Localization (GRCh37/hg19) Sequencing
method
TET2 c.4044+2dupT F biotin-CCACTCTTATGGCACCAACATAT 55°C 87bp chr4:106,182,949-106,183,035 Pyrosequencing
R CAATTGCTGCCAATGATTATTTA
S TGCTGCCAATGATTATTTAAAC Sequencing primer
F GGGATTCAAAATGTAAGGG 60°C 323bp chr4:106,182,817-106,183,139 Sanger
Sequencing
R TGCAGTGGTTTCAACAATTAAG
c.4076G>T F ACTTTCGCATTCACACACACTTT 61°C 161bp chr4:106,190,734-106,190,894 Pyrosequencing
R biotin-CCATTCTGCATGTTGTGCAAGTC
S TGAACACAGAGCACCA Sequencing primer
F TCATTCCATTTTGTTTCTGGA 55°C 400bp chr4:106,190,629-106,191,028 Sanger
Sequencing
R GCCATGTGGAACTGTGAGTC
ASXL1 c.1945G>T F GAGGTCACCACTGCCATAGAGAG 55°C 135bp chr20:31,022,398-31,022,532 Pyrosequencing
R biotin-CACAGGCCTCACCACCAT
S GGGGGGGGTGGCCCG Sequencing primer
F ACCACTGCCATAGAGAGGCG 67°C 419bp chr20:31,022,404-31,022,822 Sanger
Sequencing
R GGTTTGGGAGGACAGTAGGG
SF3B1 c.1874G>T F biotin-TTAAGAAGGGCAATAAAGAAGGAA 55°C 151bp chr2:198,267,412-198,267,562 Pyrosequencing
R TTTACATTTTAGGCTGCTGGTCT
S ATAGATAACATGGATGAGTA Sequencing primer
F TTGATTATGGAAAGAAATGGTTG 60°C 435bp chr2:198,267,189-198,267,623 Sanger
Sequencing
R AGCCCAAAGGTTTGAGTCC
RUNX1 c.509-2A>C F biotin-TGAAGACAGTGATGGTCAGAGTGA 61°C 76bp chr21:36,231,843-36,231,918 Pyrosequencing
R CCACCAACCTCATTCTGTTTTGTT
S CATTCTGTTTTGTTCTCTATCGT Sequencing primer
F GGTAACTTGTGCTGAAGGGC 65°C 312bp chr21:36,231,673-36,231,984 Sanger
Sequencing
R GGTTGAACCCAAGGAATCTG
Central European Journal of Immunology 2021; 46(4)
Monika Małgorzata Adamska et al.
528
later (January 2017) pancytopenia, 13.5% of BM blasts and
PB DC of 91% were reported. In BM and SAL obtained
from the patient in January 2017 none of the previously
detected DNA sequence variants were found with SSeq
due to the high DC. On the other hand, all analyzed vari-
ants were confirmed in BM with pyrosequencing. In SAL
DNA sequence variants were undetectable, probably due to
concurrent high DC at disease relapse. Based on leukemic
evolution theory and the possibility of additional mutation
acquisition we decided to check whether any additional
mutation occurred in a BM sample after second relapse of
the disease. Using the pyrosequencing method, the pres-
ence of RUNX1 (c.509-2A>C), SRSF2 (c.284C>A), TET2
(c.4638G>C) and DNMT3A (c.1014+1G>T; c.2390A>G)
DNA sequence variants was demonstrated. Pyrosequenc-
ing revealed the presence of the RUNX1 (c.509-2A>C)
DNA sequence variant with AF 4.87%. Importantly, the
RUNX1 variant was not observed at earlier disease stages.
Salvage chemotherapy was implemented, resulting in CR
(according ELN 2017 treatment response criteria) and
the patient was qualified for maintenance treatment with
azacitidine. Subsequent relapse with 16% of BM blasts
occurred; thus the patient received chemotherapy, result-
ing in CR (according ELN 2017 treatment response crite-
ria). The patient was qualified for allogenic haploidentical
hematopoietic cell transplantation (allo-haploHCT) from
his daughter (March 2018). Since May 2018 acute graft-
versus-host disease with pancytopenia has been observed.
BM biopsy revealed low cellularity and DC of 100%.
In BM and PB obtained from the patient in May 2018 none
of the previously detected variants were found with SSeq
and pyrosequencing. Four months after allo-haploHCT the
patient died from severe graft-versus-host disease with sec-
ondary cytopenia, refractory to the treatment.
Discussion
Genetic findings mentioned above indicated that four
sequence variants identified with NGS were detected in pa-
tient samples since the MDS phase of disease (May 2009)
and were persistently reported after transformation to
secAML (November 2010, January 2015, January
2017) with the additional RUNX1 c.509-2A>C DNA se-
quence variant reported since January 2017. Importantly,
c.4044+2dupT, c.4076G>T TET2, and c.1945G>T ASXL1
DNA sequence variants were detected for the first time
in MDS. Moreover, the presence of c.4044+2dupT and
c.4076G>T TET2, c.1945G>T ASXL1 and c.1874G>T
SF3B1 DNA sequence variants was confirmed with py-
rosequencing and SSeq in both BM and SAL (January
2015). It should be noted that AF detected during pyrose-
quencing of BM and SAL was very similar (Fig. 1), which
highlights the diagnostic utility of SAL testing. However,
it is worth noting that the analysis of the mutation presence
in SAL is limited by the low amount of leukemic cells as
well as presence of high DC in recipients of alloHCT. With
clinical suspicion of disease relapse, BM evaluation re-
mains necessary, but our results suggest the clinical useful-
ness of noninvasive testing with SAL or PB in monitoring
the course of disease. Nevertheless, this should be tested
on a larger group of patients first.
Comparing pyrosequencing AF results obtained in
May 2009, November 2010 and January 2015 and taking
into account DC loss (2015 – 42%), we observed a slight
AF decrease in tested samples. At the moment of secAML
relapse (January 2017) with DC = 91% using the same
method, four variants previously identified with targeted
NGS, as well as the RUNX1 variant, were detected only
in BM but not SAL. Progressive disease in both MDS and
secAML is characterized by the emergence of subclones
influenced by selection pressure after implemented chemo-
therapy [10]. In May 2018, after allo-haploHCT (CR, DC
= 100%) pyrosequencing results were negative for both
BM and PB. Thus, pyrosequencing results corresponded
to DC results and additionally introduced information
concerning presence of DNA sequence variants in patients
after alloHCT. With this approach we are able to confirm
the presence of key sequence variants previously detected
by NGS. Moreover, the detected DNA sequence variants in
selected genes and their prognostic value could influence
the therapeutic strategy.
Myelodysplastic syndromes and secAML are very heter-
ogenous diseases and the presence of multiple genetic found-
ing clones translates to different sensitivity to the applied
therapy. Moreover, the increasing number of early driver
somatic mutations steadily reduces leukemia-free survival
[11]. Sequence variants of TET2 and ASXL1 genes are as-
sociated with clonal hematopoiesis of indeterminate poten-
tial (CHIP). However, CHIP is associated with AF < 10%
and presence of single mutations, whereas MDS and AML
are associated with higher AF and 2 mutations [12]. The
prognostic significance of TET2 DNA sequence variants in
MDS remains unclear [13]. According to Smith et al., TET2
sequence variants in MDS patients do not affect the survival
and risk of AML transformation [14]. Furthermore, low ex-
pression of the TET2 gene is associated with poor prognosis
in MDS patients. Moreover, metaanalysis also revealed that
the presence of TET2 DNA sequence variants does not have
a significant impact on overall survival. MDS patients with
TET2 mutations have increased response rates to hypometh-
ylating agents compared to patients without those mutations.
However, treatment with hypomethylating agents does not
prolong the overall survival (OS) in MDS patients with TET2
mutations compared to those without. Thus, TET2 status
may be used as an additional factor for predicting patients’
response to hypomethylating agents [15]. The SF3B1 variant
reported here was found to correlate with ring sideroblasts
MDS subtype 2, and this was observed in our case too.
Talati et al. associated this variant with favorable prognosis
in MDS [16].
Central European Journal of Immunology
2021; 46(4)
New genetic variants of TET2 and ASXL1 identified by next generation sequencing and pyrosequencing
in a patient with MDS-RS-MLD and secondary acute myeloid leukemia
529
Furthermore, patients with SF3B1 mutations showed
better treatment responses to erythropoiesis-stimulating
agents with no differences in response to hypomethylat-
ing agents or lenalidomide [17]. It was also demonstrated
that the presence of ASXL1 somatic variants translates to
adverse outcome as well as disease relapse and shorter sur-
vival after alloHCT in both MDS and MDS/AML patients
[18]. It is worth noting that the implemented therapy may
also affect time to relapse. The use of anti-cancer treatment
results in multiple dynamic changes leading to the subclon-
al architecture of cancer, driving disease progression and
treatment resistance, and is called ‘clonal evolution’ [19].
Mutations in the RUNX1 gene are associated with adverse
prognosis in MDS [20], so acquisition of the RUNX1 mu-
tation and its co-occurrence with previously detected DNA
variants could reflect disease progression and its influence
on the response to the therapy. Importantly, based on Ping
Wu’s results, co-occurrence of ASXL1 and RUNX1 DNA
sequence variants is related to poor response to hypometh-
ylating agents such as azacytidine or decitabine and their
influence on shorter survival [21]. Although the rate of
relapse or treatment related mortality is high, alloHCT rep-
resents the only curative treatment for high-risk MDS, and
it remains crucial to carefully monitor the persistence of
genetic alterations after alloHCT [22]. Targeted sequenc-
ing of 40 genes in 87 MDS patients undergoing alloHCT
identified TET2, DNMT3A and TP53 mutations to be as-
sociated with reduced overall survival [23]. Both literature
data and our results suggest a significant need to screen
MDS patients for the presence of DNA sequence variants
in genes of proven clinical relevance. This information
could help in treatment management and further course of
disease monitoring.
Conclusions
The appropriate MRD monitoring in MDS remains a
challenge as the quantity of disease clones is lower than in
AML [24]. Our results revealed that the variants previous-
ly described for AML (c.4044+2dupT TET2, c.1945G>T
ASXL1) were present at the MDS stage of disease.
It confirms that the molecular landscape of secAML
changes with the disease progression (acquiring c.509-
2A>C RUNX1 variant). We suggest: 1) NGS to detect the
mutational profile of early MDS and 2) tracking changes
in the molecular landscape of MDS/secAML during the
course of the disease as essential for improving further
treatment. Our paper is the first report of c.4044+2dupT,
c.4076G>T TET2 and c.1945G>T ASXL1 DNA sequence
variants in MDS.
The authors declare no conflict of interest.
References
1. Kennedy JA, Ebert BL (2017): Clinical implications of ge-
netic mutations in myelodysplastic syndrome. J Clin Oncol
35: 968-974.
2. Arber DA, Orazi A, Hasserjian R, et al. (2016): The 2016 re-
vision to the World Health Organization classification of my-
eloid neoplasms and acute leukemia. Blood 127: 2391-2405.
3. Gill H, Leung AY, Kwong YL (2016): Molecular and cellular
mechanisms of myelodysplastic syndrome: implications on
targeted therapy. Int J Mol Sci 17: 440.
4. Döhner H, Estey E, Grimwade D, et al. (2017): Diagnosis and
management of AML in adults: 2017 ELN recommendations
from an international expert panel. Blood 129: 424-447.
5. Li H, Durbin R (2010): Fast and accurate long-read alignment
with Burrows-Wheeler transform. Bioinformatics 26: 589-595.
6. Van der Auwera GA, Carneiro MO, Hartl C, et al. (2013):
From FastQ data to high confidence variant calls: the Genome
Analysis Toolkit best practices pipeline. Curr Protoc Bioinfor-
matics 43: 11.10.1-11.10.33.
7. Cingolani P, Platts A, Wang le L, et al. (2012): A program
for annotating and predicting the effects of single nucleotide
polymorphisms, SnpEff: SNPs in the genome of Drosophila
melanogaster strain w1118; iso-2; iso-3. Fly (Austin) 6: 80-92.
8. Kiwerska K, Szaumkessel M, Paczkowska J, et al. (2017):
Combined deletion and DNA methylation result in silencing
of FAM107A gene in laryngeal tumors. Sci Rep 7: 5386.
9. Tate JG, Bamford S, Jubb HC, et al. (2019): COSMIC: the
Catalogue Of Somatic Mutations In Cancer. Nucleic Acids
Res 47(D1): D941-D947.
10. Jacoby MA, Duncavage EJ, Chang GS, et al. (2018): Sub-
clones dominate at MDS progression following allogeneic
hematopoietic cell transplant. JCI Insight 3: e98962.
11. Papaemmanuil E, Gerstung M, Malcovati L, et al. (2013):
Clinical and biological implications of driver mutations in
myelodysplastic syndromes. Blood 122: 3616-3627; quiz
3699.
12. Jaiswal S, Fontanillas P, Flannick J, et al. (2014): Age-relat-
ed clonal hematopoiesis associated with adverse outcomes.
N Engl J Med 371: 2488-2498.
13. Visconte V, Tiu RV, Rogers HJ (2017): Pathogenesis of
myelodysplastic syndromes: an overview of molecular and
non-molecular aspects of the disease. Blood Res 49: 216-227.
14. Smith AE, Mohamedali AM, Kulasekararaj A, et al. (2010):
Next-generation sequencing of the TET2 gene in 355 MDS
and CMML patients reveals low-abundance mutant clones
with early origins, but indicates no definite prognostic value.
Blood 116: 3923-3932.
15. Lin Y, Lin Z, Cheng K, et al. (2017): Prognostic role of TET2
deficiency in myelodysplastic syndromes: A meta-analysis.
Oncotarget 8: 43295-43305.
16. Talati C, Sallman D, List A (2017): Lenalidomide: myelodys-
plastic syndromes with del(5q) and beyond. Semin Hematol
54: 159-166.
17. Migdady Y, Barnard J, Al Ali N, et al. (2018): Clinical out-
comes with ring sideroblasts and SF3B1 mutations in my-
elodysplastic syndromes: MDS clinical research consortium
analysis. Clin Lymphoma Myeloma Leuk 18: 528-532.
18. Della Porta MG, Galli A, Bacigalupo A, et al. (2016): Clin-
ical effects of driver somatic mutations on the outcomes of
patients with myelodysplastic syndromes treated with allo-
geneic hematopoietic stem-cell transplantation. J Clin Oncol
34: 3627-3637.
Central European Journal of Immunology 2021; 46(4)
Monika Małgorzata Adamska et al.
530
19. Greaves M, Maley CC (2012): Clonal evolution in cancer.
Nature 481: 306-313.
20. Haferlach T, Nagata Y, Grossmann V, et al. (2014): Land-
scape of genetic lesions in 944 patients with myelodysplastic
syndromes. Leukemia 28: 241-247.
21. Wu P, Weng J, Li M, et al. (2019): Co-occurrence of RUNX1
and ASXL1 mutations underlie poor response and outcome
for MDS patients treated with HMAs. Am J Transl Res 11:
3651-3658.
22. Anthias C, Dignan FL, Morilla R, et al. (2014): Pre-transplant
MRD predicts outcome following reduced-intensity and my-
eloablative allogeneic hemopoietic SCT in AML. Bone Mar-
row Transplant 49: 679-683.
23. Bejar R, Stevenson KE, Caughey B, et al. (2014): Somatic
mutations predict poor outcome in patients with myelodys-
plastic syndrome after hematopoietic stem-cell transplanta-
tion. J Clin Oncol 32: 2691-2698.
24. Nassereddine S, Nishihori T, Padron E, et al. (2017): Inte-
grating genomics in myelodysplastic syndrome to predict
outcomes after allogeneic hematopoietic cell transplantation.
Clin Lymphoma Myeloma Leuk 17: 7-13.
ResearchGate has not been able to resolve any citations for this publication.
Article
Full-text available
COSMIC, the Catalogue Of Somatic Mutations In Cancer (https://cancer.sanger.ac.uk) is the most detailed and comprehensive resource for exploring the effect of somatic mutations in human cancer. The latest release, COSMIC v86 (August 2018), includes almost 6 million coding mutations across 1.4 million tumour samples, curated from over 26 000 publications. In addition to coding mutations, COSMIC covers all the genetic mechanisms by which somatic mutations promote cancer, including non-coding mutations, gene fusions, copy-number variants and drug-resistance mutations. COSMIC is primarily hand-curated, ensuring quality, accuracy and descriptive data capture. Building on our manual curation processes, we are introducing new initiatives that allow us to prioritize key genes and diseases, and to react more quickly and comprehensively to new findings in the literature. Alongside improvements to the public website and data-download systems, new functionality in COSMIC-3D allows exploration of mutations within three-dimensional protein structures, their protein structural and functional impacts, and implications for druggability. In parallel with COSMIC's deep and broad variant coverage, the Cancer Gene Census (CGC) describes a curated catalogue of genes driving every form of human cancer. Currently describing 719 genes, the CGC has recently introduced functional descriptions of how each gene drives disease, summarized into the 10 cancer Hallmarks.
Article
Full-text available
Larynx squamous cell carcinoma (LSCC) is characterized by complex genotypes, with numerous abnormalities in various genes. Despite the progress in diagnosis and treatment of this disease, 5-year survival rates remain unsatisfactory. Therefore, the extended studies are conducted, with the aim to find genes, potentially implicated in this cancer. In this study, we focus on the FAM107A (3p14.3) gene, since we found its significantly reduced expression in LSCC by microarray profiling (Affymetrix U133 Plus 2.0 array). By RT-PCR we have confirmed complete FAM107A downregulation in laryngeal cancer cell lines (15/15) and primary tumors (21/21) and this finding was further supported by FAM107A protein immunohistochemistry (15/15). We further demonstrate that a combined two hit mechanism including loss of 3p and hypermethylation of FAM107A promoter region (in 9/15 cell lines (p < 0.0001) and in 15/21 primary tumors (p < 0.0001)) prevails in the gene transcriptional loss. As a proof of principle, we show that Decitabine - a hypomethylating agent – restores FAM107A expression (5 to 6 fold increase) in the UT-SCC-29 cell line, characterized by high DNA methylation. Therefore, we report the recurrent inactivation of FAM107A in LSCC, what may suggest that the gene is a promising tumor suppressor candidate involved in LSCC development.
Article
Full-text available
Tet methylcytosine dioxygenase2 gene (TET2) is one of the most frequently mutated gene in myeloid neoplasm, but the prognostic role of TET2 aberrations in myelodysplastic syndromes (MDS) remains unclear. Therefore, we performed a meta-analysis. Fourteen eligible studies with 1983 patients were included in this meta-analysis. Among these, 2 studies evaluated the impact that the TET2 expression level had on the prognosis. The combined hazard ratios (HR) estimated for overall survival (OS) was 1.00 (95%CI: 0.74 to 1.37; p=0.989) when comparing those with TET2 mutations with those without. Among the patients treated with hypomethylating agents (HMAs) or hematopoietic stem cell transplantation (HSCT), the pooled HR for OS was 1.02 (95% CI: 0.77-1.35, p=0.89) and 1.54 (95%CI: 0.69 to 3.44; p=0.29), respectively. We also conducted an analysis of the response rate to HMAs, and the OR was 1.73 (95%CI: 1.11 to 2.70; p=0.016). Additionally, subgroup analyses showed the pooled HR for OS was 0.93(95%CI: 0.44 to 1.98; P=0.849) in WHO-classified CMML patients and 1.02(95%CI: 1.02 to 3.46; p=0.042) in studies evaluated TET2 expression level. The analysis suggested TET2 mutations had no significant prognostic value on MDS. However, the response rates to HMAs were significantly different between those with and without TET2 mutations, and the low expression level of TET2 gene was significantly associated with a poor OS in MDS patients.
Article
The molecular determinants of the clinical response to Hypomethylating agents (HMAs) in patients with myelodysplastic syndromes (MDS) are unclear. We analyzed 84 adult patients with MDS who received hypomethylating agents (HMAs) and identified somatic mutations and their relationship to clinical response and survival. The results showed in the MDS patients with ASXL1 mutations,the most frequent co-occurring mutations were RUNX1 mutations, with a significant higher frequency of 43% compared to 17% in wild-type ASXL1 (P = 0.032). ASXL1 mutation demonstrated a significant negative overall response rate (8% vs. 29.4%, x2 = 5.228, P = 0.022), particularly when co-occurring with RUNX1 mutations (P = 0.008). And all patients with RUNX1 and ASXL1 mutations died with a shorter median overall survival of only 14 months (P = 0.002). Moreover, TP53 mutations were associated with unfavorable-risk cytogenetic changes, and responded well to HMAs, with the exception of one case with RUNX1 and ASXL1 gene mutation. In a word, RUNX1 mutations are frequently found in MDS patients with ASXL1-mutations, and Co-occurrence of RUNX1 and ASXL1 mutations are associated with poor response to HMAs and inferior survival.
Article
Background: Recurrent somatic mutations in SF3B1 have been identified in patients with myelodysplastic syndromes (MDS) and are associated with ring sideroblasts (RS) and relatively favorable clinical outcomes. The 2016 World Health Organization classification categorizes patients with ≥ 5% RS and SF3B1 mutation as MDS-RS, in contrast to its prior MDS-RS classification (≥ 15% RS, no genotyping data). Treatment responses in MDS patients with mutated SF3B1 are not well described. Patients and methods: Patients with MDS and known SF3B1 mutational status were identified from MDS Clinical Research Consortium institutions and grouped when possible as 5% to 15% or ≥ 15% RS. Patients with wild-type versus mutated SF3B1 were matched 2:1 to analyze treatment response. Results: Of 471 patients identified, 16% showed SF3B1 mutation. More patients with mutated SF3B1 were lower-risk MDS. We found that 50% were RS-positive compared to 19% of wild-type patients (P < .001). Having the mutation was associated with better overall survival (hazard ratio = 0.48, P = .001) and longer leukemia-free survival (hazard ratio = 0.5, P < .005). Patients with RS and the mutation had the best outcome. Regarding treatment response, 14 (35%) of 40 erythroid-stimulating agent-treated patients with mutation experienced response versus 9 (16%) of 56 wild-type patients (P = .032), with no differences in response to hypomethylating agents or lenalidomide. Conclusion: SF3B1 mutations in MDS are commonly associated with RS and show better outcomes, with mutated/positive RS presence being significantly better than isolated RS or presence of mutation or neither. Patients with mutation showed better responses to an erythroid-stimulating agent. A new categorization incorporating SF3B1 mutation status, regardless of RS percentage, shows clinical value.
Article
Allogeneic hematopoietic cell transplantation (alloHCT) is a potentially curative treatment for myelodysplastic syndromes (MDS), but patients who relapse after transplant have poor outcomes. In order to understand the contribution of tumor clonal evolution to disease progression,we applied exome and error-corrected targeted sequencing coupled with copy number analysis to comprehensively define changes in the clonal architecture of MDS in response to therapy using 51 serially acquired tumor samples from 9 patients who progressed after an alloHCT. We show that small subclones before alloHCT can drive progression after alloHCT. Notably, at least one subclone expanded or emerged at progression in all patients. Newly acquired structural variants (SVs) were present in an emergent/expanding subclone in 8 of 9 patients at progression, implicating the acquisition of SVs as important late subclonal progression events. In addition, pretransplant therapy with azacitidine likely influenced the mutation spectrum and evolution of emergent subclones after alloHCT. Although subclone evolution is common, founding clone mutations are always present at progression and could be detected in the bone marrow as early as 30 and/or 100 days after alloHCT in 6 of 8 (75%) patients, often prior to clinical progression. In conclusion, MDS progression after alloHCT is characterized by subclonal expansion and evolution, which can be influenced by pretransplant therapy.
Article
Myelodysplastic syndrome (MDS) is clonal disorder characterized by ineffective hematopoiesis and a tendency to evolve into acute myeloid leukemia (AML). Genetic studies have enabled the identification of a set of recurrently mutated genes central to the pathogenesis of MDS, which can be organized into a limited number of cellular processes, including RNA splicing, epigenetic and traditional transcriptional regulation, and signal transduction. The sequential accumulation of mutations drives disease evolution from asymptomatic clonal hematopoiesis to frank MDS, and, ultimately, to secondary AML. This detailed understanding of the molecular landscape of MDS, coupled with the emergence of cost-and time-effective methodologies for DNA sequencing has led to the introduction of genetic studies into the clinical realm. Here, we review recent advances in our genetic understanding of MDS, with a particular focus on the emerging role for mutational data in clinical management as a potential tool to assist in diagnosis, risk stratification, and therapeutic decision-making. (C) 2017 by American Society of Clinical Oncology
Article
The first edition of the European LeukemiaNet (ELN) recommendations for diagnosis and management of acute myeloid leukemia (AML) in adults published in 2010 has found broad acceptance by physicians and investigators caring for patients with AML. Recent advances, for example, in the discovery of the genomic landscape of the disease, in the development of assays for genetic testing and for detecting minimal residual disease, as well as in the development of novel anti-leukemic agents, prompted an international panel to provide updated evidence- and expert opinion-based recommendations. The recommendations include a revised version of the ELN genetic categories, a proposal for a response category based on minimal residual disease status, and criteria for progressive disease.
Article
Myelodysplastic syndrome (MDS) is a heterogeneous group of clonal hematopoietic neoplastic disorders most commonly occurring in the elderly population with a tendency to progress to acute leukemia. Although epigenetic therapies have improved the outcomes of MDS patients, allogeneic hematopoietic cell transplantation (HCT) remains the only curative option for these patients. Molecular characterization of MDS using next generation sequencing has expanded not only the knowledge on MDS but also the depth of understanding of evolution and contribution of recurrent somatic mutations in precursor conditions. Rapidly evolving genomic information on MDS may provide clinicians with better risk stratification tools and may also aid in supplying useful information to allow comprehensive therapeutic decision making for MDS patients. In this concise review, we summarize the current knowledge and understanding of recurrent somatic mutations in MDS and discuss salient genomic information predicting response and influencing therapeutic outcomes in the context of allogeneic HCT, and the potential application of these findings into future clinical practice.
Article
Purpose: The genetic basis of myelodysplastic syndromes (MDS) is heterogeneous, and various combinations of somatic mutations are associated with different clinical phenotypes and outcomes. Whether the genetic basis of MDS influences the outcome of allogeneic hematopoietic stem-cell transplantation (HSCT) is unclear. Patients and methods: We studied 401 patients with MDS or acute myeloid leukemia (AML) evolving from MDS (MDS/AML). We used massively parallel sequencing to examine tumor samples collected before HSCT for somatic mutations in 34 recurrently mutated genes in myeloid neoplasms. We then analyzed the impact of mutations on the outcome of HSCT. Results: Overall, 87% of patients carried one or more oncogenic mutations. Somatic mutations of ASXL1, RUNX1, and TP53 were independent predictors of relapse and overall survival after HSCT in both patients with MDS and patients with MDS/AML (P values ranging from .003 to .035). In patients with MDS/AML, gene ontology (ie, secondary-type AML carrying mutations in genes of RNA splicing machinery, TP53-mutated AML, or de novo AML) was an independent predictor of posttransplantation outcome (P = .013). The impact of ASXL1, RUNX1, and TP53 mutations on posttransplantation survival was independent of the revised International Prognostic Scoring System (IPSS-R). Combining somatic mutations and IPSS-R risk improved the ability to stratify patients by capturing more prognostic information at an individual level. Accounting for various combinations of IPSS-R risk and somatic mutations, the 5-year probability of survival after HSCT ranged from 0% to 73%. Conclusion: Somatic mutation in ASXL1, RUNX1, or TP53 is independently associated with unfavorable outcomes and shorter survival after allogeneic HSCT for patients with MDS and MDS/AML. Accounting for these genetic lesions may improve the prognostication precision in clinical practice and in designing clinical trials.