Access to this full-text is provided by MDPI.
Content available from International Journal of Molecular Sciences (IJMS)
This content is subject to copyright.
International Journal of
Molecular Sciences
Article
Recombinase Polymerase Amplification Assay with and
without Nuclease-Dependent-Labeled Oligonucleotide Probe
Aleksandr V. Ivanov, Irina V. Safenkova, Anatoly V. Zherdev and Boris B. Dzantiev *
Citation: Ivanov, A.V.; Safenkova,
I.V.; Zherdev, A.V.; Dzantiev, B.B.
Recombinase Polymerase
Amplification Assay with and
without Nuclease-Dependent-Labeled
Oligonucleotide Probe. Int. J. Mol. Sci.
2021,22, 11885. https://doi.org/
10.3390/ijms222111885
Academic Editor: Emilia Pedone
Received: 6 October 2021
Accepted: 29 October 2021
Published: 2 November 2021
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
Copyright: © 2021 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
A.N. Bach Institute of Biochemistry, Research Centre of Biotechnology of the Russian Academy of Sciences,
Leninsky Prospect 33, 119071 Moscow, Russia; a.ivanov@fbras.ru (A.V.I.); safenkova@inbi.ras.ru (I.V.S.);
zherdev@inbi.ras.ru (A.V.Z.)
*Correspondence: dzantiev@inbi.ras.ru; Tel.: +7-4-(95)-9543142
Abstract:
The combination of recombinase polymerase amplification (RPA) and lateral flow test
(LFT) is a strong diagnostic tool for rapid pathogen detection in resource-limited conditions. Here,
we compared two methods generating labeled RPA amplicons following their detection by LFT:
(1) the basic one with primers modified with different tags at the terminals and (2) the nuclease-
dependent one with the primers and labeled oligonucleotide probe for nuclease digestion that was
recommended for the high specificity of the assay. Using both methods, we developed an RPA-LFT
assay for the detection of worldwide distributed phytopathogen—alfalfa mosaic virus (AMV). A
forward primer modified with fluorescein and a reverse primer with biotin and fluorescein-labeled
oligonucleotide probe were designed and verified by RPA. Both labeling approaches and their related
assays were characterized using the
in vitro
-transcribed mRNA of AMV and reverse transcription
reaction. The results demonstrated that the RPA-LFT assay based on primers-labeling detected
10
3
copies of RNA in reaction during 30 min and had a half-maximal binding concentration 22 times
lower than probe-dependent RPA-LFT. The developed RPA-LFT was successfully applied for the
detection of AMV-infected plants. The results can be the main reason for choosing simple labeling
with primers for RPA-LFT for the detection of other pathogens.
Keywords: RNA virus; RPA probe with tetrohydrofuran; lateral flow test; nfoRPA
1. Introduction
Recombinase polymerase amplification (RPA) is an isothermal approach that is actively
applied for the field and low-equipment detection of DNA or RNA targets [
1
,
2
]. RPA is
based on recombinase-dependent hybridization of primers with a target DNA, followed
by strand-displacing DNA polymerization by BsuI polymerase. This generates plenty of
double-stranded (ds) DNA amplicons at 37–42
◦
C for 15–20 min [
3
]. The addition of reverse
transcription (RT) reaction to RPA allows the use of RNA molecules as target molecules.
The amplicons can be detected in different ways: visualization by gel electrophoresis, by
real-time detection using fluorescent dye or probes, and by specific and affine recognition
of tag-labeled amplicons in lateral flow test (LFT) [
1
,
3
]. The LFT is the most popular
tool for sensitive and rapid detection of amplicons that is effective in resource-limited
conditions [
4
]. To realize RPA-LFT, two different specific tags should be included in the
amplicons during the RPA process. The tags can be low molecular, such as fluorescein
(FAM), biotin, digoxygenin, etc., or a single-stranded (ss) DNA tail. The tags are affinely
captured by receptor molecules at LFT that are located at specific zones and interact with
tag-labeled amplicons that pass through the test strip [5–7].
The easiest way to obtain the labeled amplicon is by using forward and reverse RPA
primers labeled at the 5
0
ends with different tags (the scheme is presented in Figure 1A).
This approach is actively applied for the RPA-LFT detection of pathogens and species
identification [
8
–
11
]. However, the probability of the cross-dimerization of the labeled RPA
primers is high due to the typical RPA primers being rather long (28–35 nt), and there are no
Int. J. Mol. Sci. 2021,22, 11885. https://doi.org/10.3390/ijms222111885 https://www.mdpi.com/journal/ijms
Int. J. Mol. Sci. 2021,22, 11885 2 of 12
stages with the temperature denaturation of DNA. Cross-dimers can lead to false positive
signals for several reasons. Thus, labeled cross-dimers can be bound in the test zones or
can be used as an RPA template for the synthesis of the by-product-labeled amplicon. To
solve this problem, Piepenburg et al. [
3
] suggested using an additional oligonucleotide
probe with a tag to reduce the nonspecific product. This approach is widely used in
RPA-LFT assays [
12
]. The oligonucleotide probe is annealed within the region limited
by primers and usually does not overlap with primers. The probe consists of tag (e.g.,
FAM) at 5
0
end; 30–35 nt oligonucleotide, tetrahydrofuran (THF) residue, which replaces a
nucleotide; short (approximately 15 nt) oligonucleotide; and 3
0
-blocking modification (e.g.,
phosphate or PEG) [
3
] (see Figure 1B). This approach supposes that RPA forward primer
is unmodified, and the reverse has a tag (e.g., biotin). The probe specifically binds to the
synthetized amplicon after the THF site is recognized and destructed by Nfo endonuclease
IV, and 30–35 nt oligonucleotide part acts as a primer for BsuI polymerase, replacing the
short part of the probe with blocking modification [
13
]. As a result, two populations of
amplicons were synthesized, with one tag from a reverse primer that is not detected by
LFT and a secondary one with two tags detected by LFT (see scheme in Figure 1B). The
probe is unable to form a stable complex with a nonspecific amplicon. This significantly
decreases the formation of labeled by-product amplicons [
14
]. Some research proposed
a solution for decreasing the false-positive signal of RPA-LFT by the optimization of the
probe design [
15
], using blocking antiprimers [
16
] and the proper combination of probe–
primer sets [
17
,
18
] to avoid their cross-dimerization. However, there is no research about
the direct comparison of RPA-LFT based on the generation of labeled amplicons through
forward and reverse primers and through the oligonucleotide probe and reverse primer. In
this study, a comparison of both ways with the same target and considering specificity and
sensitivity of the RPA-LFT was performed for the first time.
Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 2 of 12
RPA primers is high due to the typical RPA primers being rather long (28–35 nt), and there
are no stages with the temperature denaturation of DNA. Cross-dimers can lead to false
positive signals for several reasons. Thus, labeled cross-dimers can be bound in the test
zones or can be used as an RPA template for the synthesis of the by-product-labeled am-
plicon. To solve this problem, Piepenburg et al. [3] suggested using an additional oligo-
nucleotide probe with a tag to reduce the nonspecific product. This approach is widely
used in RPA-LFT assays [12]. The oligonucleotide probe is annealed within the region
limited by primers and usually does not overlap with primers. The probe consists of tag
(e.g., FAM) at 5′ end; 30–35 nt oligonucleotide, tetrahydrofuran (THF) residue, which re-
places a nucleotide; short (approximately 15 nt) oligonucleotide; and 3′-blocking modifi-
cation (e.g., phosphate or PEG) [3] (see Figure 1B). This approach supposes that RPA for-
ward primer is unmodified, and the reverse has a tag (e.g., biotin). The probe specifically
binds to the synthetized amplicon after the THF site is recognized and destructed by Nfo
endonuclease IV, and 30–35 nt oligonucleotide part acts as a primer for BsuI polymerase,
replacing the short part of the probe with blocking modification [13]. As a result, two pop-
ulations of amplicons were synthesized, with one tag from a reverse primer that is not
detected by LFT and a secondary one with two tags detected by LFT (see scheme in Figure
1B). The probe is unable to form a stable complex with a nonspecific amplicon. This sig-
nificantly decreases the formation of labeled by-product amplicons [14]. Some research
proposed a solution for decreasing the false-positive signal of RPA-LFT by the optimiza-
tion of the probe design [15], using blocking antiprimers [16] and the proper combination
of probe–primer sets [17,18] to avoid their cross-dimerization. However, there is no re-
search about the direct comparison of RPA-LFT based on the generation of labeled ampli-
cons through forward and reverse primers and through the oligonucleotide probe and
reverse primer. In this study, a comparison of both ways with the same target and consid-
ering specificity and sensitivity of the RPA-LFT was performed for the first time.
Figure 1. Scheme of RPA-LFT with the generation of labeled amplicons and their detection, based
on (A) both labeled primers, (B) labeled THF probe, and labeled reverse primer.
Alfalfa mosaic virus (AMV), a positive ssRNA virus that belongs to the Bromoviridae
family, is a worldwide distributed phytopathogen [19,20] and was chosen as a target for
RT-RPA-LFTs with both labeling approaches. AMV has caused outbreaks around the
Figure 1.
Scheme of RPA-LFT with the generation of labeled amplicons and their detection, based on
(A) both labeled primers, (B) labeled THF probe, and labeled reverse primer.
Alfalfa mosaic virus (AMV), a positive ssRNA virus that belongs to the Bromoviridae
family, is a worldwide distributed phytopathogen [
19
,
20
] and was chosen as a target for
RT-RPA-LFTs with both labeling approaches. AMV has caused outbreaks around the world
and infected more than 150 plant species, damaging the harvest of different varieties, such
as soybean [
21
,
22
], lucerne [
23
,
24
], potato [
25
,
26
], chayote [
27
], etc. The virus contains
Int. J. Mol. Sci. 2021,22, 11885 3 of 12
three genomic RNAs that encode four proteins. The most abundant structural protein, coat
protein (CP), is coded by RNA3 and proceeds from the subgenomic RNA4 [
28
,
29
]. RNA4 is
most present among the AMV RNAs in host plant cells during the infection [
30
,
31
]. There
are several assays for AMV detection, including immunoassay [
32
,
33
], RT-PCR [
34
,
35
],
and RT-LAMP [
36
]. Despite the advantages of RPA, no RPA systems (e.g., RPA-LFT) were
developed for the detection of AMV RPA.
Hence, the main task of this research was the development of RT-RPA-LFTs of AMV
RNA based on two different methods of labeled amplicons’ generation, comparison of
their specificity and sensitivity, and a verification test system with improved analytical
characteristics by using infected and healthy plant material.
2. Results and Discussion
2.1. Primers and Probe Selections for RT-RPA-LFT
First, primers for RPA were designed. Previous researchers proposed several primers
pairs for PCR (see Supplementary Materials (SM), Table S1). Most of them recognized
RNA3, particularly gene of AMV coat protein. RNA3 and subgenomic-proceeded RNA4
are most presented in the host cell, so they are preferred targets for detection. Moreover,
some previously proposed primers were predicted to form self- or cross-dimers (SM, Table
S1). From the described predecessors, primer pairs were chosen that are nondimerizing and
produce amplicons shorter than 400 bp, which is demanded by RPA. The pair was named
AMV F1/AMV R1 (sequences are presented in Table 1and SM, Table S1). These primers
have 21–23 nt lengths; however, the use of primers shorter than 25 nt in RPA is possible but
not recommended [
12
]. Therefore, RPA primers AMV F3/AMV R3 (Table 1) were designed
by extension of AMV F1/AMV R1 primers to make them a more appropriate length for
RPA. Such primer extension can improve RPA sensitivity [
10
,
37
]. Additionally, a new pair
for the AMV CP gene, AMV F4/AMV R4, was designed (Table 1). Recognition sites of the
primers and the length of possible amplicons generated by these primers are presented in
SM, Section S1. For the following primers, combinations that produce amplicons shorter
than 400 bp were selected.
Table 1. Sequences of primers used in the research.
Name 50-30Sequence 50Modification
AMV F1 * CCATCATGAGTTCTTCACAAAAG FAM/none
AMV R1 * TCGTCACGTCATCAGTGAGAC biotin
AMV F3
ATTACTTCCATCATGAGTTCTTCACAAAAG
FAM/none
AMV R3
CATCCTCAGTCGTCACGTCATCAGTGAGAC
biotin
AMV F4
TTACGCAAAGCTCAACTGCCGAAGCCTCC
FAM/none
AMV R4
GAATCTCACGCCGAGCCCATTAAAAGAG
biotin
AMV THF probe
(FAM)-
AAACCGACGAATACTATACTGCCACAGACG-
(THF)-
GCTGCGTGTGGCAA-Pi
FAM
* Primers were proposed by Xu and Nie [34].
Verification of the primers in nine different combinations (F1-R1, F1-R3, F1-R4, F3-R1,
F3-R3, F3-R4, F4-R1, F4-R3, F4-R4) were performed using AMV RNA3
∆
(SM, Section S2)
by RT-qPCR (SM, Section S3, Figure S2A,B). Due to the RT-qPCR curves being very similar
for all primer pairs, RT-RPA-LFTs for all designed pairs were also carried out.
For RT-RPA-LFT, FAM-labeled forward primers and biotin-labeled reverse primers
(see Table 1) were used in the same nine combinations. As a result, FAM- and biotin-labeled
amplicons were formed during RPA and detected by LFT strip containing streptavidin
immobilized at the test zone and conjugate of gold nanoparticles (GNPs) with antibodies
specific to FAM. The lengths of the amplicons differed from 150 to 367 bp (SM, Section
Int. J. Mol. Sci. 2021,22, 11885 4 of 12
S1, Table S2) based on the selected pair. The selected pair was compared when no target
RNA was added to buffer (negative sample), or 10
7
copies AMV RNA3 were added
(positive sample; Figure 2). Pair F1-R1 demonstrated negligible signals for negative and
positive samples. Pair combinations F3-R1 and F4-R1 demonstrated no nonspecific signal
in the RPA-LFT of negative samples. However, signals of positive samples were moderate
(<10 a.u.) and within the use of these primers pairs. The other primer combinations showed
pronounced signals with positive samples and weak visible signals with negative samples
(See Figure 2). To improve the results, LFT was performed at 37
◦
C, as applied in previous
research concerning RT-RPA-LFT of viruses [
9
]. Increasing LFT temperature enhanced the
signals of positive samples with all pairs besides F1-R1 and F3-R1. However, the conditions
were not eliminated, and nonspecific signals of negative controls were obtained for all
pairs. The F4-R4 primers’ combination was chosen because the positive control had the
highest signal, and the nonspecific signal was conterminal to the visually detectable (2 a.u.).
RT-PCR based on the F4-R4 pair detected 10
4
copies of AMV RNA3 according to agarose
gel electrophoresis (SM, Section S3, Figure S3) that corresponded to RT-PCR based on the
proposed earlier F1-R1 pair.
Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 4 of 12
beled amplicons were formed during RPA and detected by LFT strip containing streptav-
idin immobilized at the test zone and conjugate of gold nanoparticles (GNPs) with anti-
bodies specific to FAM. The lengths of the amplicons differed from 150 to 367 bp (SM,
Section S1, Table S2) based on the selected pair. The selected pair was compared when no
target RNA was added to buffer (negative sample), or 107 copies AMV RNA3 were added
(positive sample; Figure 2). Pair F1-R1 demonstrated negligible signals for negative and
positive samples. Pair combinations F3-R1 and F4-R1 demonstrated no nonspecific signal
in the RPA-LFT of negative samples. However, signals of positive samples were moderate
(<10 a.u.) and within the use of these primers pairs. The other primer combinations
showed pronounced signals with positive samples and weak visible signals with negative
samples (See Figure 2). To improve the results, LFT was performed at 37 °C, as applied in
previous research concerning RT-RPA-LFT of viruses [9]. Increasing LFT temperature en-
hanced the signals of positive samples with all pairs besides F1-R1 and F3-R1. However,
the conditions were not eliminated, and nonspecific signals of negative controls were ob-
tained for all pairs. The F4-R4 primers’ combination was chosen because the positive con-
trol had the highest signal, and the nonspecific signal was conterminal to the visually de-
tectable (2 a.u.). RT-PCR based on the F4-R4 pair detected 104 copies of AMV RNA3 ac-
cording to agarose gel electrophoresis (SM, Section S3, Figure S3) that corresponded to
RT-PCR based on the proposed earlier F1-R1 pair.
Figure 2. Signal in test zone of LFT strip after RPA of positive (107 copies of target) and negative (TE
buffer) sample controls. LFT was performed at different temperatures. The dashed line represents
a signal visible to the naked eye (2 a.u.).
For the selected F4-R4 pair, we designed a specific probe that was annealed to DNA
between the annealing sites of the primers (SM, Section S1). The probe consisted of the
FAM-tag at 5′ end, 30 nt part, THF residue, 14 nt part, and 3′ blocking phosphate (Pi; see
Table 1). Therefore, the probe composition and location fully complied with the recom-
mendations [3] and can be generated together with the R4 primer FAM- and biotin-labeled
ds amplicon with a length of 99 bp.
Figure 2.
Signal in test zone of LFT strip after RPA of positive (10
7
copies of target) and negative (TE
buffer) sample controls. LFT was performed at different temperatures. The dashed line represents a
signal visible to the naked eye (2 a.u.).
For the selected F4-R4 pair, we designed a specific probe that was annealed to DNA
between the annealing sites of the primers (SM, Section S1). The probe consisted of the FAM-
tag at 5
0
end, 30 nt part, THF residue, 14 nt part, and 3
0
blocking phosphate (Pi; see Table 1).
Therefore, the probe composition and location fully complied with the recommendations [
3
]
and can be generated together with the R4 primer FAM- and biotin-labeled ds amplicon
with a length of 99 bp.
2.2. Characterization of RT-RPA-LFTs of AMV RNA3
RT-RPA-LFTs with F4-R4 primers were performed based on two different methods of
labeled amplicons. The first method was based on the generation of labeled RPA amplicons
Int. J. Mol. Sci. 2021,22, 11885 5 of 12
with a length of 150 bp through FAM-labeled F4 primer and biotin-labeled R4 primer. The
length of 150 bp was found to be optimal for LFT of FAM- and biotin-labeled dsDNA
amplicon [
38
]. The second method was based on the generation of labeled RPA amplicons
with a length of 99 bp through the FAM-labeled probe and biotin-labeled R4 primer. The
F4 primer was used for amplification without the FAM tag. For both methods, the assay
was carried out with different amounts of AMV RNA3
∆
(from 10
8
copies in reaction to 10
copies). RT-RPA-LFT with labeled primers detected AMV RNA3 diluted in TE buffer from
10
5
copies in reaction (Figure 3A). The detection limit of RT-RPA-LFT based on the labeled
probe was higher and equal to 10
6
copies of RNA per reaction. The half-maximal-binding
concentrations of RNA for assay based on primers labeling was 50 times lower than for
assay based on probe labeling (sigmoidal fits and their parameters are given in SM, Figure
S4, Table S3). There were no visually detectable nonspecific signals in either assay. In the
case of the instrumental detection of RT-RPA-LFT with labeled primers, a very insignificant
background was observed (see Figure 3A).
Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 5 of 12
2.2. Characterization of RT-RPA-LFTs of AMV RNA3
RT-RPA-LFTs with F4-R4 primers were performed based on two different methods
of labeled amplicons. The first method was based on the generation of labeled RPA am-
plicons with a length of 150 bp through FAM-labeled F4 primer and biotin-labeled R4
primer. The length of 150 bp was found to be optimal for LFT of FAM- and biotin-labeled
dsDNA amplicon [38]. The second method was based on the generation of labeled RPA
amplicons with a length of 99 bp through the FAM-labeled probe and biotin-labeled R4
primer. The F4 primer was used for amplification without the FAM tag. For both methods,
the assay was carried out with different amounts of AMV RNA3Δ (from 108 copies in
reaction to 10 copies). RT-RPA-LFT with labeled primers detected AMV RNA3 diluted in
TE buffer from 105 copies in reaction (Figure 3A). The detection limit of RT-RPA-LFT
based on the labeled probe was higher and equal to 106 copies of RNA per reaction. The
half-maximal-binding concentrations of RNA for assay based on primers labeling was 50
times lower than for assay based on probe labeling (sigmoidal fits and their parameters
are given in SM, Figure S4, Table S3). There were no visually detectable nonspecific signals
in either assay. In the case of the instrumental detection of RT-RPA-LFT with labeled pri-
mers, a very insignificant background was observed (see Figure 3A).
Figure 3. Dependences of RT-RPA-LFT signal from initial amount of synthetic AMV RNA3 performed by different ways
of amplicon labeling: (A) the target RNA diluted in TE buffer; (B) the target RNA in potato total DNA. The black dashed
line marks visibility to the eye of the signal.
The same experiments with the target AMV RNA3Δ diluted in total DNA extracted
from potato leaves were performed (Figure 3B). These experiments model the extraction
of AMV RNA from infected plants. The addition of the unspecific DNA caused significant
enhancement of RT-RPA-LFT for both labeling types (Figure 3). It shifted the calibration
curves toward lower concentrations. The half-maximal-binding concentrations decreased
10 and 23 times for assay based on primers- and probe labeling, respectively (see SM,
Section S4). The difference between the half-maximal binding of primers labeling from
probe labeling in the presence of unspecific DNA was 22 times. In the case of RT-RPA-
LFT based on primer labeling, the gradual increment of the signal at a low concentration
of initial RNA in the range of 10–104 appeared. Moreover, the addition of total DNA com-
pletely removed false-positive signal (from 1.1 ± 0.5 a.u. to 0.4 ± 0.5 a.u.) of null samples
while labeled F4-R4 primers were used. These effects increased RT-RPA-LFT sensitivity
to 103 of initial copies of AMV RNA3Δ. The supplementation of the target RNA by total
plant DNA did not have an impact on unspecific signals for RT-RPA-LFT with the THF
probe (Figure 3).
Specificity of the RT-RPA-LFTs based on the primers and the probe in presence of
other widespread potato viruses (PVX, PVY, PVS, and PLRV) was tested using 108 copies
of purified viral RNAs spiked with total potato DNA/RNA. The same amount of spiked
Figure 3.
Dependences of RT-RPA-LFT signal from initial amount of synthetic AMV RNA3 performed by different ways of
amplicon labeling: (
A
) the target RNA diluted in TE buffer; (
B
) the target RNA in potato total DNA. The black dashed line
marks visibility to the eye of the signal.
The same experiments with the target AMV RNA3
∆
diluted in total DNA extracted
from potato leaves were performed (Figure 3B). These experiments model the extraction of
AMV RNA from infected plants. The addition of the unspecific DNA caused significant
enhancement of RT-RPA-LFT for both labeling types (Figure 3). It shifted the calibration
curves toward lower concentrations. The half-maximal-binding concentrations decreased
10 and 23 times for assay based on primers- and probe labeling, respectively (see SM,
Section S4). The difference between the half-maximal binding of primers labeling from
probe labeling in the presence of unspecific DNA was 22 times. In the case of RT-RPA-
LFT based on primer labeling, the gradual increment of the signal at a low concentration
of initial RNA in the range of 10–10
4
appeared. Moreover, the addition of total DNA
completely removed false-positive signal (from 1.1
±
0.5 a.u. to 0.4
±
0.5 a.u.) of null
samples while labeled F4-R4 primers were used. These effects increased RT-RPA-LFT
sensitivity to 10
3
of initial copies of AMV RNA3
∆
. The supplementation of the target RNA
by total plant DNA did not have an impact on unspecific signals for RT-RPA-LFT with the
THF probe (Figure 3).
Specificity of the RT-RPA-LFTs based on the primers and the probe in presence of
other widespread potato viruses (PVX, PVY, PVS, and PLRV) was tested using 10
8
copies
of purified viral RNAs spiked with total potato DNA/RNA. The same amount of spiked
AMV RNA3 was used as a positive control. Both methods of RT-RPA-LFT demonstrated
specific signals with AMV RNA3 and no signal in the presence of other tested viruses
(Figure 4).
Int. J. Mol. Sci. 2021,22, 11885 6 of 12
Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 6 of 12
AMV RNA3 was used as a positive control. Both methods of RT-RPA-LFT demonstrated
specific signals with AMV RNA3 and no signal in the presence of other tested viruses
(Figure 4).
The developed RT-RPA-LFT assay can be considered rapid. The time of RT-RPA was
20 min, followed by 10 min of LFT, in total.
Figure 4. Test of specificity RT-RPA-LFT with AMV, PVX, PVY, PLRV, and PVS: (A) when labeled
primers were used; (B) when THF probe was used.
These experiments clearly demonstrated that the sensitivity of the simpler method of
amplicon labeling using modified primers can exceed the sensitivity of the approach with
a THF probe up to three orders, as in our case. Certainly, amplification with a probe is a
derivative process concerning primer-based amplification. Thus, the sensitivity of Nfo-
RPA is limited by the sensitivity of basic RPA with primers only. Concurrently, there was
no difference in specificity between the labeling ways (see Figure 4). The specificity and
sensitivity of RT-RPA-LFT based on labeled primers increased when AMV RNA3 was
added in the presence of abundance nontarget DNA concentration (approx. 200 ng/µL or
40 ng/µL in final RPA mix). RPA is known to tolerate unspecified DNA in samples [39,40].
However, there have been no data declaring the stimulating effect of total unspecified
DNA on RPA or RPA-LFT as of yet. There was evidence about inhibition of RPA by the
presence of a high concentration of total unspecified DNA in the RPA test with the ex-
oRPA kit [40] and the nfoRPA kit, followed by LFT [41]. The concentration of total
DNA/RNA in our experiments was not as high as one that inhibits RPA. Additionally, we
used plant DNA/RNA, but human DNA could have another effect. It is feasible that DNA
could weakly interact with the primers that sequester them and reduce their cross-dimer-
ization. Another explanation could be the blocking effect of charged nucleic acid polymer
to the nitrocellulose membrane in the test zone.
RT-RPA-LFT of the spiked samples had a higher sensitivity (103 copies per reaction
or 20 copies/µL) than RT-qPCR performed with the same primers or previously developed
primers (104 copies per reaction or 1000 copies/µL; see SM, Figures S2B and S3). None of
the previous research provided sensitivity data for the proposed PCR tests. Hence, a com-
parison of analytic characteristics of the developed test system is unfeasible. Based on the
experience of previous works on the detection of other RNA plant viruses [9,11,42,43], we
considered the developed test as appropriate for the detection of real AMV in infected
plants.
2.3. Verification of the RT-RPA-LFT by Testing AMV Infected Plants
To verify the developed RT-RPA-LFT system, total nucleic acid was extracted from
the leaves of healthy potato plants (H1-H3), and from the leaves of potato (I1, I2, I4, I6, I7,
I8) and tobacco (I3, I5) that were artificially infected with AMV. The RT-RPA-LFT was
performed with the samples using FAM-labeled F4 and biotin-labeled R4 primers because
this method tends to be more sensitive and specific in previous experiments. The assay
detected none or minimal nonsignificant signals when healthy samples were used (Figure
Figure 4.
Test of specificity RT-RPA-LFT with AMV, PVX, PVY, PLRV, and PVS: (
A
) when labeled
primers were used; (B) when THF probe was used.
The developed RT-RPA-LFT assay can be considered rapid. The time of RT-RPA was
20 min, followed by 10 min of LFT, in total.
These experiments clearly demonstrated that the sensitivity of the simpler method
of amplicon labeling using modified primers can exceed the sensitivity of the approach
with a THF probe up to three orders, as in our case. Certainly, amplification with a probe
is a derivative process concerning primer-based amplification. Thus, the sensitivity of
Nfo-RPA is limited by the sensitivity of basic RPA with primers only. Concurrently, there
was no difference in specificity between the labeling ways (see Figure 4). The specificity
and sensitivity of RT-RPA-LFT based on labeled primers increased when AMV RNA3 was
added in the presence of abundance nontarget DNA concentration (approx. 200 ng/
µ
L or
40 ng/
µ
L in final RPA mix). RPA is known to tolerate unspecified DNA in samples [
39
,
40
].
However, there have been no data declaring the stimulating effect of total unspecified
DNA on RPA or RPA-LFT as of yet. There was evidence about inhibition of RPA by the
presence of a high concentration of total unspecified DNA in the RPA test with the exoRPA
kit [
40
] and the nfoRPA kit, followed by LFT [
41
]. The concentration of total DNA/RNA
in our experiments was not as high as one that inhibits RPA. Additionally, we used plant
DNA/RNA, but human DNA could have another effect. It is feasible that DNA could
weakly interact with the primers that sequester them and reduce their cross-dimerization.
Another explanation could be the blocking effect of charged nucleic acid polymer to the
nitrocellulose membrane in the test zone.
RT-RPA-LFT of the spiked samples had a higher sensitivity (10
3
copies per reaction or
20 copies/
µ
L) than RT-qPCR performed with the same primers or previously developed
primers (10
4
copies per reaction or 1000 copies/
µ
L; see SM, Figures S2B and S3). None
of the previous research provided sensitivity data for the proposed PCR tests. Hence, a
comparison of analytic characteristics of the developed test system is unfeasible. Based on
the experience of previous works on the detection of other RNA plant viruses
[9,11,42,43]
,
we considered the developed test as appropriate for the detection of real AMV in in-
fected plants.
2.3. Verification of the RT-RPA-LFT by Testing AMV Infected Plants
To verify the developed RT-RPA-LFT system, total nucleic acid was extracted from
the leaves of healthy potato plants (H1-H3), and from the leaves of potato (I1, I2, I4,
I6, I7, I8) and tobacco (I3, I5) that were artificially infected with AMV. The RT-RPA-LFT
was performed with the samples using FAM-labeled F4 and biotin-labeled R4 primers
because this method tends to be more sensitive and specific in previous experiments. The
assay detected none or minimal nonsignificant signals when healthy samples were used
(Figure 5A)
. All samples of AMV-infected plants produced pronounced positive signals in
RT-RPA-LFT (Figure 5A). Moreover, the RPA-LFT assay was checked for AMV detection in
some infected samples after fast crude extraction. RT-RPA-LFT was able to detect the AMV
even in samples after this crude extraction: 1 min maceration in plastic bags with plastic
Int. J. Mol. Sci. 2021,22, 11885 7 of 12
mesh, and with the addition of a TE buffer (Figure 5B). However, only potato samples (I1, I2,
I4) were detectable, whereas both tobacco samples (I3, I5) showed no signal. Additionally,
the signal of some positive samples had high dispersion. Feasibly, tobacco contains some
metabolites that affected RT-RPA or made the structure of the tobacco leaf more resistant to
grinding and prevented the release of viral RNA. The results of the developed RT-RPA-LFT
were correlated with the results of RT-qPCR (Figure 5C and SM, Section S5, Figure S5).
Int. J. Mol. Sci. 2021, 22, x FOR PEER REVIEW 7 of 12
5A). All samples of AMV-infected plants produced pronounced positive signals in RT-
RPA-LFT (Figure 5A). Moreover, the RPA-LFT assay was checked for AMV detection in
some infected samples after fast crude extraction. RT-RPA-LFT was able to detect the
AMV even in samples after this crude extraction: 1 min maceration in plastic bags with
plastic mesh, and with the addition of a TE buffer (Figure 5B). However, only potato sam-
ples (I1, I2, I4) were detectable, whereas both tobacco samples (I3, I5) showed no signal.
Additionally, the signal of some positive samples had high dispersion. Feasibly, tobacco
contains some metabolites that affected RT-RPA or made the structure of the tobacco leaf
more resistant to grinding and prevented the release of viral RNA. The results of the de-
veloped RT-RPA-LFT were correlated with the results of RT-qPCR (Figure 5C and SM,
Section S5, Figure S5).
Figure 5. Verification of RT-RPA-LFT test for AMV detection. H—healthy samples, I—infected sam-
ples: (A) extraction of total DNA/RNA by kit; (B) rapid crude extraction of DNA/RNA by grinding;
(C) comparison of RT-RPA-LFT and RT-qPCR with samples from healthy and infected plants. The
results for each sample are presented as distinct squares in the heat maps.
Therefore, the developed system can be used for the sensitive, specific, and rapid
diagnostics of AMV infection, particularly in potato plants. As the application of the oli-
gonucleotide probe for nuclease digestion is dispensable, it makes the RT-RPA-LFT more
accessible for field diagnostics because it avoids using a nfoRPA kit or a complex synthesis
of the probe. Therefore, the developed RPA-LFT is a disposable device and allows one
analysis to be performed under any conditions, including in-field diagnostics.
3. Materials and Methods
3.1. Reagents
Kits for Nfo-RPA were manufactured by TwisDx (Maidenhead, UK). Unlabeled pri-
mers were synthesized by Evrogen. Biotin- and FAM-labeled primers were synthesized
by Syntol (Moscow, Russia). Kits of total DNA/RNA extraction from plants and an RNAse
inhibitor (RNAsin) were purchased from Syntol. A FAM-labeled THF-containing oligo-
nucleotide probe was synthesized by BioResearch (Risskov, Denmark). The mix for PCR
contained SYBR Green I, dNTP, Tersus polymerase, and Moloney murine leukemia virus
(MMLV) revertase, and the kits for DNA extraction from gels were purchased from Evro-
gen (Moscow, Russia). T7 RNA polymerase, DNAse I, RNA cleanup kit, and NTPs were
purchased from Neb (Ipswich, MA, USA). Mouse monoclonal IgG (clone 2A3c) specific to
fluorescein (anti-FAM) was produced by Bialexa (Moscow, Russia). Recombinant strep-
tavidin and goat anti-mouse IgG were produced by Imtek (Moscow, Russia). Ethylenedi-
aminetetraacetic acid (EDTA), HAuCl4, bovine serum albumin (BSA), and dithiothreitol
(DTT) were purchased from Sigma-Aldrich (St. Louis, MI, USA). Salts, buffers, organic
solvents, and other compounds were analytical grade.
Figure 5.
Verification of RT-RPA-LFT test for AMV detection. H—healthy samples, I—infected samples: (
A
) extraction
of total DNA/RNA by kit; (
B
) rapid crude extraction of DNA/RNA by grinding; (
C
) comparison of RT-RPA-LFT and
RT-qPCR with samples from healthy and infected plants. The results for each sample are presented as distinct squares in the
heat maps.
Therefore, the developed system can be used for the sensitive, specific, and rapid
diagnostics of AMV infection, particularly in potato plants. As the application of the
oligonucleotide probe for nuclease digestion is dispensable, it makes the RT-RPA-LFT more
accessible for field diagnostics because it avoids using a nfoRPA kit or a complex synthesis
of the probe. Therefore, the developed RPA-LFT is a disposable device and allows one
analysis to be performed under any conditions, including in-field diagnostics.
3. Materials and Methods
3.1. Reagents
Kits for Nfo-RPA were manufactured by TwisDx (Maidenhead, UK). Unlabeled
primers were synthesized by Evrogen. Biotin- and FAM-labeled primers were synthe-
sized by Syntol (Moscow, Russia). Kits of total DNA/RNA extraction from plants and an
RNAse inhibitor (RNAsin) were purchased from Syntol. A FAM-labeled THF-containing
oligonucleotide probe was synthesized by BioResearch (Risskov, Denmark). The mix for
PCR contained SYBR Green I, dNTP, Tersus polymerase, and Moloney murine leukemia
virus (MMLV) revertase, and the kits for DNA extraction from gels were purchased from
Evrogen (Moscow, Russia). T7 RNA polymerase, DNAse I, RNA cleanup kit, and NTPs
were purchased from Neb (Ipswich, MA, USA). Mouse monoclonal IgG (clone 2A3c) spe-
cific to fluorescein (anti-FAM) was produced by Bialexa (Moscow, Russia). Recombinant
streptavidin and goat anti-mouse IgG were produced by Imtek (Moscow, Russia). Ethylene-
diaminetetraacetic acid (EDTA), HAuCl
4
, bovine serum albumin (BSA), and dithiothreitol
(DTT) were purchased from Sigma-Aldrich (St. Louis, MI, USA). Salts, buffers, organic
solvents, and other compounds were analytical grade.
For LFT-producing nitrocellulose membrane CNPC12, PT R5 fiberglass membrane,
sample pad membrane GFB-R4, and absorbent pad AP045 were purchased from Advanced
Microdevices (Ambala Cantt, India).
Int. J. Mol. Sci. 2021,22, 11885 8 of 12
3.2. In Vitro Transcription of AMV RNA3
A sequence containing the AMV RNA3 CP (GenBank accession K02703) gene flanked
with the T7 promoter and the T7 terminator was synthesized and cloned in a pCORE 006
vector by Cloning Facility (Moscow, Russia). A sequence of the CP gene without the flanks
is given in SM, Section S1. The DNA template for
in vitro
transcription was synthesized by
PCR. The PCR was performed using 200 nM pCORE F (5
0
-CTCGACGCTGCCGAGATTGC-
3
0
) and AMV RNA3 R (5
0
- GCATCCCTTAGGGGCATTCATGC-3
0
) primers and 2
µ
M dNTP,
5 u. of Tersus polymerase, and corresponding Tersus buffer. PCR cycles comprise the
denaturation cycle at 95
◦
C for 20 s, primers annealing at 60
◦
C for 20 s, and elongation at
72
◦
C for 60 s. PCR was carried out within 40 cycles. The target DNA amplicon of the RNA3
gene was purified with 1% agarose gel electrophoresis, followed by the DNA extraction by
the DNA gel extraction kit. The DNA fragment containing a T7 promoter, and an RNA3
gene was used as a template for “runoff” with an
in vitro
transcription. The DNA fragment
was added to up to 165 ng/
µ
L (290 nM) of reaction mix containing 166 mM HEPES-KOH
pH 7.5, 32 mM MgCl
2
, 40 mM DTT, 2 mM spermidine, 100 mg/mL BSA, 7 mM each
NTP (NEB), 2 U/
µ
L RNAsin, and 5 U/
µ
L T7 polymerase (NEB). The transcription was
performed for 3 h at 37
◦
C. DNA template was removed from the transcription mix by
treatment with 0.08 U/
µ
L DNAse I in the presence of the corresponding buffer at 37
◦
C
for 30 min. The reaction was stopped by EDTA addition up to 20 mM and heating at
75
◦
C for 10 min. The transcribed fragment was called AMV RNA3
∆
(the sequence is
presented in SM, Section S1), and it was purified by the RNA cleanup kit according to the
manufacturer’s manual. The integrity of the RNA was assessed by electrophoresis in 1%
agarose gel in Tris/Borate/EDTA (TBE) buffer (SM, Section S2). The concentration of AMV
RNA3 was measured by NanoDrop ND-2000 spectrophotometer (ThermoFischer Scientific,
Waltham, MA, USA).
3.3. Preparation of Conjugate of Gold Nanoparticles with Antibodies
Conjugation of gold nanoparticles (GNPs) with mouse monoclonal antibodies specific
to fluorescein (anti-FAM) was prepared as described in [
9
]. Briefly, to synthesize the GNP
with a diameter of 22 nm, 1 mL of 1% HAuCl4and 95 mL of deionized water were mixed
and heated to a boiling point, then 4 mL of 1% sodium citrate was added and boiled for
25 min. The final concentration of the GNP was 1 nM, which corresponded to an optical
density at 520 nm (OD
520
) equal to 1.0. For the conjugate synthesis, anti-FAM and GNPs
were adjusted to pH 9.0, mixed with a final ratio of 10
µ
g of anti-FAM per 1 mL of 1 nM
GNP solution, incubated for 1 h at 20 ◦C, blocked with BSA to 0.25%, and separated from
the unbinding proteins via centrifugation at 10,000×gfor 30 min at 4 ◦C.
3.4. Preparation of Lateral Flow Test Strips
The GNP–anti-FAM conjugate (OD
520
= 4.0) was dispensed at 3.2
µ
L per 1 mm
of strip width on a PT R5 fiberglass membrane. Streptavidin 1 mg/mL and goat anti-
mouse IgG were dispensed at 0.15
µ
L per 1 mm of strip width on test and control zones
of nitrocellulose membrane CNPC12 using an IsoFlow Dispenser (Imagene Technology,
Lebanon, NH, USA). Test strips were assembled using the sample membrane GFB-R4,
final adsorbing membrane AP045, and the abovementioned fiberglass and nitrocellulose
membranes. The multi-membrane composites were cut and packed according to Byzova
et al. [44].
3.5. Sample Collection and Characterization
Healthy (n= 3) potato plants and plants (potato, tobacco) artificially infected by AMV
(n= 8) were grown
in vitro
and provided by Dr. Y.A. Varitsev and Dr. P.A. Galushko
(A.G. Lorch Russian Potato Research Center, Kraskovo, Russia). For precise extraction
of total nucleic acid, samples of potato leaves (150 mg) were homogenized by mortar
and pestle. The extraction of total RNA from the samples was performed using a com-
Int. J. Mol. Sci. 2021,22, 11885 9 of 12
mercial total plant DNA/RNA extraction kit (Syntol, Moscow, Russia) according to the
manufacturer’s protocols.
Crude extraction was performed by grinding 150 mg of plant material in a plastic
bag with a ziplock containing plastic mesh. The extraction was performed in 1 mL of
DNA/RNA-friendly 20 mM Tris-HCl pH 8.0, EDTA 0.2 mM (TE buffer) [
45
]. Potato virus
X (PVX), potato virus Y (PVY), potato leafroll virus (PLRV), and potato virus S (PVS) were
collected and purified by Dr. Y.A. Varitsev. Genomic RNA of these viruses was extracted
by Syntol extraction kit.
3.6. Primers and Probe Designs
Primers and probes for RPA were designed according to the recommendations of
TwisDx (UK) [
12
]. Predictions of dimerizations were obtained using OligoCalc [
46
] and
ThermoFisher’s Multiple Primer Analyzer (ThermoFisher Scientific) online software.
3.7. Real-Time Quantitative PCR (qPCR) of AMV RNA3 ∆
The designed primers were checked in RT-qPCR, performed by Light Cycler 96 (Roche,
Basel, Switzerland). Commercial premix (Evrogen) containing SYBR Green I, polymerase,
dNTPs, and buffer was supplemented with 6 U/
µ
L MMLV, 0.2 U/
µ
L RNAse inhibitor,
and 2 mM DTT. Primers were added in different combinations at a concentration of
200 nM. Transcribed AMV RNA3
∆
or total extract from plants was added in different
concentrations. The PCR analysis comprised the RT stage at 42
◦
C for 20 min, then
denaturation at 95
◦
C for 5 min, followed by 45 cycles. Each cycle contained denaturation
at 95
◦
C for 30 s, primer annealing at 55
◦
C for 30 s, and elongation at 72
◦
C for 40 s. SYBR
Green fluorescence was detected within the elongation stages. A cycle threshold (Ct) was
computed automatically by Light Cycler software (Roche, Basel, Switzerland).
3.8. Two Variants of RPA-LFT for Detection of AMV RNA3 ∆
RPA reaction was performed as recommended by the manufacturer, with minor
modifications. In the case of RPA based on labeled primers, 300 nM FAM- and biotin-
labeled primers were used. In the case of a probe generating a labeled amplicon, 200 nM
FAM-labeled probe, 300 nM unlabeled forward, and biotin-labeled primers were added
in the RPA reaction. Primers of interest were added to the TwistDx rehydration buffer,
then 6 U/
µ
L MMLV reverse transcriptase and 0.2 U/
µ
L RNAse inhibitor 10 mM DTT were
appended. Then, 10
µ
L of a solution containing AMV RNA3, plant extracts, or control
buffer was added to the mixture. In addition, TE buffer was used as a negative control and
for the dilution of AMV RNA3. A lyophilized pellet from the nfoRPA kit was dissolved
in the mix. To start the reaction, 14 mM magnesium acetate was added. RPA was carried
out at 39
◦
C for 20 min using BioRad T100 Thermal Cycler (Hercules, CA, USA). After the
reaction, 5
µ
L of the RPA mix solution was added to 65
µ
L of 50 mM phosphate-buffered
saline, pH 7.4, 100 mM NaCl (PBS), and used as a sample for LFT. The test strip was
submerged in the tested sample for 5 min at 20
◦
C or 37
◦
C. The qualitative results were
estimated visually after 10 min.
To quantify the results, the test strips were scanned using a Canon 9000 F Mark II
scanner (Canon, Tokyo, Japan), and the digital images were analyzed with a TotalLab
TL120 (Nonlinear Dynamics, Newcastle upon Tyne, UK). The dependences of the color
intensity of the LFT test line on the AMV RNA3 concentration were constructed using
Origin Pro 9.0 (OriginLab, Northampton, MA, USA). The measured value of 2 arbitrary
units according to the appearance of the visible test zone. For the calibration curve, each
point was measured in duplicate at least.
4. Conclusions
We compared two approaches to obtain labeling RPA products for LFT detection—
using only primers and primers with the oligonucleotide probe. The probe-based approach
demonstrated no false-positive signal but had lower sensitivity than the approach with
Int. J. Mol. Sci. 2021,22, 11885 10 of 12
labeled primers. We found that the presence of the DNA/RNA of the potato plant in the
RT-RPA-LFT assay eliminated nonspecific background signal and improved the specificity
and sensitivity of the approach based on labeled primers. As a result, a primer-based
RT-RPA-LFT assay that detected 10
3
copies of AMV RNA3 was developed. The total
time of amplification and detection was 30 min. Using the primer-based approach, the
first test that clearly identifies AMV-infected plants in resource-limited conditions was
developed. The test can be applied in field experiments because it complies with the basic
requirements for an RPA kit—labeled primers, room temperature for LFT, and rapid and
equipment-free extraction of plant total DNA/RNA. The obtained results can be the main
reason for choosing simple labeling with primers for RT-RPA-LFT for the detection of
other pathogens.
Supplementary Materials:
The following are available online at https://www.mdpi.com/article/10
.3390/ijms222111885/s1.
Author Contributions:
Conceptualization, A.V.Z. and I.V.S.; methodology, A.V.I. and I.V.S.; valida-
tion, A.V.I.; formal analysis A.V.I. and I.V.S.; investigation, A.V.I.; resources, I.V.S.; data curation, I.V.S.;
writing—original draft preparation, A.V.I. and I.V.S.; writing—review and editing, A.V.I., I.V.S., and
A.V.Z.; visualization, A.V.I.; supervision, B.B.D.; project administration, I.V.S. and A.V.Z.; funding
acquisition, B.B.D. All authors have read and agreed to the published version of the manuscript.
Funding:
The article was written with the support of the Ministry of Science and Higher Education
of the Russian Federation in accordance with Agreement No. 075-15-2020-907 dated 16.11.2020 on
the provision of a grant in the form of subsidies from the Federal Budget of the Russian Federation.
The grant was provided for state support for the creation and development of a world-class scientific
center: “Agrotechnologies for Future”.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement:
The data presented in this study are available on request from the
corresponding author.
Acknowledgments:
The authors are grateful to Yu. A. Varitsev and P.A. Galushka (A.G. Lorch
Russian Potato Research Center, Kraskovo, Russia) for the provision of viruses and plant materials.
Conflicts of Interest:
The authors declare no conflict of interest. The funders had no role in the design
of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or
in the decision to publish the results.
References
1.
Lobato, I.M.; O’Sullivan, C.K. Recombinase polymerase amplification: Basics, applications and recent advances. Trends Anal.
Chem. 2018,98, 19–35. [CrossRef]
2.
Li, J.; Macdonald, J.; von Stetten, F. Review: A comprehensive summary of a decade development of the recombinase polymerase
amplification. Analyst 2018,144, 31–67. [CrossRef] [PubMed]
3.
Piepenburg, O.; Williams, C.H.; Stemple, D.L.; Armes, N.A. DNA detection using recombination proteins. PLoS Biol.
2006
,4, e204.
[CrossRef] [PubMed]
4.
Zheng, C.; Wang, K.; Zheng, W.; Cheng, Y.; Li, T.; Cao, B.; Jin, Q.; Cui, D. Rapid developments in lateral flow immunoassay for
nucleic acid detection. Analyst 2021,146, 1514–1528. [CrossRef] [PubMed]
5.
Sang, P.; Hu, Z.; Cheng, Y.; Yu, H.; Xie, Y.; Yao, W.; Guo, Y.; Qian, H. Nucleic acid amplification techniques in immunoassay: An
integrated approach with hybrid performance. J. Agric. Food Chem. 2021,69, 5783–5797. [CrossRef] [PubMed]
6.
Liu, Y.; Zhan, L.; Qin, Z.; Sackrison, J.; Bischof, J.C. Ultrasensitive and highly specific lateral flow assays for point-of-care diagnosis.
ACS Nano 2021,15, 3593–3611. [CrossRef] [PubMed]
7. Pumford, E.A.; Lu, J.; Spaczai, I.; Prasetyo, M.E.; Zheng, E.M.; Zhang, H.; Kamei, D.T. Developments in integrating nucleic acid
isothermal amplification and detection systems for point-of-care diagnostics. Biosens. Bioelectron. 2020,170, 112674. [CrossRef]
8.
El-Tholoth, M.; Branavan, M.; Naveenathayalan, A.; Balachandran, W. Recombinase polymerase amplification-nucleic acid lateral
flow immunoassays for Newcastle disease virus and infectious bronchitis virus detection. Mol. Biol. Rep.
2019
,46, 6391–6397.
[CrossRef]
9.
Ivanov, A.V.; Safenkova, I.V.; Zherdev, A.V.; Dzantiev, B.B. Nucleic acid lateral flow assay with recombinase polymerase
amplification: Solutions for highly sensitive detection of RNA virus. Talanta 2020,210, 120616. [CrossRef]
Int. J. Mol. Sci. 2021,22, 11885 11 of 12
10.
Ivanov, A.V.; Safenkova, I.V.; Drenova, N.V.; Zherdev, A.V.; Dzantiev, B.B. Development of lateral flow assay combined with
recombinase polymerase amplification for highly sensitive detection of Dickeya solani. Mol. Cell. Probes
2020
,53, 101622.
[CrossRef]
11.
Ivanov, A.V.; Shmyglya, I.V.; Zherdev, A.V.; Dzantiev, B.B.; Safenkova, I.V. The challenge for rapid detection of high-structured
circular rna: Assay of potato spindle tuber viroid based on recombinase polymerase amplification and lateral flow tests. Plants
2020,9, 1369. [CrossRef] [PubMed]
12. TwistAmp ®DNA Amplification Kits Assay Design Manual; TwistDx™: Cambridge, UK, 2018.
13.
Harrison, L.; Brame, K.L.; Geltz, L.E.; Landry, A.M. Closely opposed apurinic/apyrimidinic sites are converted to double strand
breaks in Escherichia coli even in the absence of exonuclease III, endonuclease IV, nucleotide excision repair and AP lyase cleavage.
DNA Repair 2006,5, 324–335. [CrossRef]
14.
Gao, W.; Huang, H.; Zhang, Y.; Zhu, P.; Yan, Y.; Fan, J.; Chen, X. Recombinase Polymerase Amplification-Based Assay for Rapid
Detection of Listeria monocytogenes in Food Samples. Food Anal. Methods 2017,10, 1972–1981. [CrossRef]
15.
Liu, X.; Yan, Q.; Huang, J.; Chen, J.; Guo, Z.; Liu, Z.; Cai, L.; Li, R.; Wang, Y.; Yang, G.; et al. Influence of design probe and
sequence mismatches on the efficiency of fluorescent RPA. World J. Microbiol. Biotechnol. 2019,35, 95. [CrossRef] [PubMed]
16.
Ivanov, A.V.; Safenkova, I.V.; Zherdev, A.V.; Dzantiev, B.B. Multiplex assay of viruses integrating recombinase polymerase
amplification, barcode—anti-barcode pairs, blocking anti-primers, and lateral flow assay. Anal. Chem.
2021
,93, 13641–13650.
[CrossRef]
17.
Wang, L.; Zhao, P.; Si, X.; Li, J.; Dai, X.; Zhang, K.; Gao, S.; Dong, J. Rapid and specific detection of Listeria monocytogenes with an
isothermal amplification and lateral flow strip combined method that eliminates false-positive signals from primer-dimers. Front.
Microbiol. 2019,10, 2959. [CrossRef] [PubMed]
18.
Wu, H.; Zhao, P.; Yang, X.; Li, J.; Zhang, J.; Zhang, X.; Zeng, Z.; Dong, J.; Gao, S.; Lu, C. A Recombinase polymerase amplification
and lateral flow strip combined method that detects Salmonella enterica serotype typhimurium with no worry of primer-dependent
artifacts. Front. Microbiol. 2020,11, 1015. [CrossRef]
19. Hull, R. Alfalfa mosaic virus. Adv. Virus Res. 1969,15, 365–433.
20.
Alfalfa Mosaic Virus. Plant Pathology, Necrosis, Alfalfa, Virus, Capsid, Icosahedron, Protoplast, Nucleotide; Loc Publishing: Van Nuys,
CA, USA, 2011.
21.
Mueller, E.E.; Grau, C.R. Seasonal progression, symptom development, and yield effects of Alfalfa mosaic virus epidemics on
soybean in Wisconsin. Plant Dis. 2007,91, 266–272. [CrossRef]
22.
Hobbs, H.A.; Domier, L.L.; Nelson, B.D. First report of Alfalfa mosaic virus and Soybean dwarf virus on soybean in North Dakota.
Plant Dis. 2012,96, 1829. [CrossRef]
23.
Al-Saleh, M.A.; Amer, M.A. Biological and molecular variability of Alfalfa mosaic virus affecting alfalfa crop in Riyadh region.
Plant Pathol. J. 2013,29, 410–417. [CrossRef] [PubMed]
24.
Al-Shahwan, I.M.; Abdalla, O.A.; Al-Saleh, M.A.; Amer, M.A. Detection of new viruses in alfalfa, weeds and cultivated plants
growing adjacent to alfalfa fields in Saudi Arabia. Saudi J. Biol. Sci. 2017,24, 1336–1343. [CrossRef] [PubMed]
25.
Halabi, M.H.; Oladokun, J.O.; Nath, P.D. Evidence of occurring alfalfa mosaic virus in potato plants in Assam, India. Virusdisease
2019,30, 571–573. [CrossRef]
26.
Nie, X.; Dickison, V.; Singh, M.; De Koeyer, D.; Xu, H.; Bai, Y.; Hawkins, G. Potato tuber necrosis induced by Alfalfa mosaic virus
depends on potato cultivar rather than on virus strain. Plant Dis. 2020,104, 340–347. [CrossRef] [PubMed]
27.
Parrella, G.; Troiano, E.; Faure, C.; Marais, A.; Candresse, T. First report of Alfalfa mosaic virus in Chayote in Italy. Plant Dis.
2020
,
105, 698. [CrossRef]
28.
Dore, J.M.; Pinck, M.; Pinck, L. Competitive multiplication of RNA3 species of different strains of alfalfa mosaic virus. J. Gen.
Virol. 1989,70 Pt 3, 777–782. [CrossRef]
29.
van der Kuyl, A.C.; Neeleman, L.; Bol, J.F. Complementation and recombination between alfalfa mosaic virus RNA3 mutants in
tobacco plants. Virology 1991,183, 731–738. [CrossRef]
30.
Reusken, C.B.; Neeleman, L.; Brederode, F.T.; Bol, J.F. Mutations in coat protein binding sites of alfalfa mosaic virus RNA 3 affect
subgenomic RNA 4 accumulation and encapsidation of viral RNAs. J. Virol. 1997,71, 8385–8391. [CrossRef]
31.
Sanchez-Navarro, J.A.; Zwart, M.P.; Elena, S.F. Effects of the number of genome segments on primary and systemic infections
with a multipartite plant RNA virus. J. Virol. 2013,87, 10805–10815. [CrossRef] [PubMed]
32.
McLaughlin, M.R.; Barnett, O.W.; Burrows, P.M.; Baum, R.H. Improved ELISA conditions for detection of plant viruses. J. Virol.
Methods 1981,3, 13–25. [CrossRef]
33.
Ali, A. Rapid detection of fifteen known soybean viruses by dot-immunobinding assay. J. Virol. Methods
2017
,249, 126–129.
[CrossRef]
34.
Xu, H.; Nie, J. Identification, characterization, and molecular detection of Alfalfa mosaic virus in potato. Phytopathology
2006
,96,
1237–1242. [CrossRef]
35.
Samarfard, S.; Bejerman, N.E.; Sharman, M.; Trucco, V.; Giolitti, F.; Dietzgen, R.G. Development and validation of PCR assays
for detection of alfalfa dwarf disease-associated viruses in Australian lucerne pastures. Australas Plant Pathol. 2017,47, 215–225.
[CrossRef]
36.
Almasi, M.A. Tracking and identification of Alfalfa mosaic virus (AMV) by loop mediated isothermal amplification assay. J. Crop
Biotechnol. 2016,5, 73–84.
Int. J. Mol. Sci. 2021,22, 11885 12 of 12
37.
Munawar, M.A.; Martin, F.; Toljamo, A.; Kokko, H.; Oksanen, E. RPA-PCR couple: An approach to expedite plant diagnostics and
overcome PCR inhibitors. Biotechniques 2020,69, 270–280. [CrossRef] [PubMed]
38.
Safenkova, I.V.; Ivanov, A.V.; Slutskaya, E.S.; Samokhvalov, A.V.; Zherdev, A.V.; Dzantiev, B.B. Key significance of DNA-target
size in lateral flow assay coupled with recombinase polymerase amplification. Anal. Chim. Acta
2020
,1102, 109–118. [CrossRef]
[PubMed]
39.
Ng, B.Y.C.; Wee, E.J.H.; West, N.P.; Trau, M. Rapid DNA detection of Mycobacterium tuberculosis-towards single cell sensitivity
in point-of-care diagnosis. Sci. Rep. 2015,5, 15027. [CrossRef]
40.
Clancy, E.; Higgins, O.; Forrest, M.S.; Boo, T.W.; Cormican, M.; Barry, T.; Piepenburg, O.; Smith, T.J. Development of a rapid
recombinase polymerase amplification assay for the detection of Streptococcus pneumoniae in whole blood. BMC Infect. Dis.
2015
,
15, 481. [CrossRef]
41.
Rohrman, B.; Richards-Kortum, R. Inhibition of recombinase polymerase amplification by background DNA: A lateral flow-based
method for enriching target DNA. Anal. Chem. 2015,87, 1963–1967. [CrossRef] [PubMed]
42.
Zhang, S.; Ravelonandro, M.; Russell, P.; McOwen, N.; Briard, P.; Bohannon, S.; Vrient, A. Rapid diagnostic detection of plum pox
virus in Prunus plants by isothermal AmplifyRP((R)) using reverse transcription-recombinase polymerase amplification. J. Virol.
Methods 2014,207, 114–120. [CrossRef] [PubMed]
43.
Zhao, C.; Sun, F.; Li, X.; Lan, Y.; Du, L.; Zhou, T.; Zhou, Y. Reverse transcription-recombinase polymerase amplification combined
with lateral flow strip for detection of rice black-streaked dwarf virus in plants. J. Virol. Methods
2019
,263, 96–100. [CrossRef]
[PubMed]
44.
Byzova, N.A.; Safenkova, I.V.; Chirkov, S.N.; Zherdev, A.V.; Blintsov, A.N.; Dzantiev, B.B.; Atabekov, I.G. Development of
immunochromatographic test systems for express detection of plant viruses. Appl. Biochem. Microbiol.
2009
,45, 204–209.
[CrossRef]
45.
Green, M.R.; Sambrook, J.; Sambrook, J. Molecular Cloning: A Laboratory Manual, 4th ed.; Cold Spring Harbor Laboratory Press:
Cold Spring Harbor, NY, USA, 2012.
46.
Kibbe, W.A. OligoCalc: An online oligonucleotide properties calculator. Nucleic Acids Res.
2007
,35, W43–W46. [CrossRef]
[PubMed]
Available via license: CC BY 4.0
Content may be subject to copyright.
