Available via license: CC BY 4.0
Content may be subject to copyright.
microorganisms
Article
A Pectin-Rich, Baobab Fruit Pulp Powder Exerts Prebiotic
Potential on the Human Gut Microbiome In Vitro
Martin Foltz 1, *, Alicia Christin Zahradnik 1, Pieter Van den Abbeele 2, Jonas Ghyselinck 3
and Massimo Marzorati 3,4
Citation: Foltz, M.; Zahradnik, A.C.;
Van den Abbeele, P.; Ghyselinck, J.;
Marzorati, M. A Pectin-Rich, Baobab
Fruit Pulp Powder Exerts Prebiotic
Potential on the Human Gut
Microbiome In Vitro. Microorganisms
2021,9, 1981. https://doi.org/
10.3390/microorganisms9091981
Academic Editor: Garry X. Shen
Received: 29 July 2021
Accepted: 10 September 2021
Published: 17 September 2021
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
Copyright: © 2021 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
1Döhler GmbH, 64295 Darmstadt, Germany; aliciachristin.Zahradnik@doehler.com
2Cryptobiotix SA, 9052 Ghent, Belgium; pieter.vandenabbeele@cryptobiotix.eu
3ProDigest BV, 9052 Ghent, Belgium; jonas.ghyselinck@prodigest.eu (J.G.);
massimo.marzorati@prodigest.eu (M.M.)
4Center of Microbial Ecology and Technology (CMET), Ghent University, 9000 Ghent, Belgium
*Correspondence: martin.foltz@doehler.com; Tel.: +49-6151-306-2524
Abstract:
Increasing insight into the impact of the gut microbiota on human health has sustained the
development of novel prebiotic ingredients. This exploratory study evaluated the prebiotic potential
of baobab fruit pulp powder, which consists of pectic polysaccharides with unique composition as
compared to other dietary sources, given that it is rich in low methoxylated homogalacturonan (HG).
After applying dialysis procedures to remove simple sugars from the product (simulating their ab-
sorption along the upper gastrointestinal tract), 48 h fecal batch incubations were performed. Baobab
fruit pulp powder boosted colonic acidification across three simulated human adult donors due to the
significant stimulation of health-related metabolites acetate (+18.4 mM at 48 h), propionate (+5.5 mM
at 48 h), and to a lesser extent butyrate (0.9 mM at 48 h). Further, there was a trend of increased
lactate levels (+2.7 mM at 6h) and reduced branched chain fatty acid (bCFA) levels (
−
0.4 mM at
48 h). While Bacteroidetes levels increased for all donors, donor-dependent increases in
Bifidobacteria
,
Lactobacilli, and Firmicutes were observed, stressing the potential interindividual differences in mi-
crobial composition modulation upon Baobab fruit pulp powder treatment. Overall, Baobab fruit
pulp powder fermentation displayed features of selective utilization by host microorganisms and,
thus, has promising prebiotic potential (also in comparison with the ‘gold standard’ prebiotic inulin).
Further research will be required to better characterize this prebiotic potential, accounting for the
interindividual differences, while aiming to unravel the potential resulting health benefits.
Keywords:
baobab fruit pulp powder; prebiotic; pectin; interindividual variation;
in vitro
; gut
microbiota; dialysis
1. Introduction
The human gut harbors an enormous number of bacteria which strongly affect human
health [
1
,
2
]. The vast majority of these bacteria reside in the colon with an abundance of
approximately 10
11
bacterial cells per mL of content [
3
]. Colonic bacteria ferment nutrients
and fibers that are undigestible to the host, thereby producing a multitude of metabolites.
Among these metabolites, the health-promoting short-chain fatty acids (SCFAs) acetate,
propionate, and butyrate have received large interest in the past few decades [
4
,
5
]. The
extent and the nature of metabolites produced strongly depend on the bacterial commu-
nity composition, which is shaped by myriad parameters, with the diet being of utmost
importance [
6
–
8
]. Currently, it is well understood that each human individual harbors a
unique microbiome which interacts distinctly with the diet [
9
,
10
]. While there is a need for
better controlling and registering the factors that drive the interindividual variation in gut
microbiome composition [
11
], it is also crucial to include multiple human subjects when
screening new ingredients to account for such interindividual differences.
Microorganisms 2021,9, 1981. https://doi.org/10.3390/microorganisms9091981 https://www.mdpi.com/journal/microorganisms
Microorganisms 2021,9, 1981 2 of 14
Increased understanding of the gut microbiota has triggered research toward improv-
ing human health through stimulation of beneficial gut bacteria. In this aspect, prebiotic
substrates have gained a lot of attention [
12
,
13
]. While the definition of a prebiotic has
evolved over the past decades, a consensus was recently reached defining prebiotics as
substrates that are selectively utilized by host microorganisms conferring a health ben-
efit [
14
]. While prebiotics can, thus, be administered to any host microbial ecosystem
(e.g., vagina, skin), many prebiotic strategies have focused on dietary applications. In this
respect, substrates such as inulin, fructooligosaccharides, and galactooligosaccharides are
considered ‘gold standard’ given their well-documented effects on the gut microbiome. A
potential issue of aforementioned prebiotics is their relatively rapid fermentation in the
proximal colon, which could result in limited tolerance (e.g., bloating and abdominal pain)
at high doses [
15
,
16
]. Such findings have stimulated the development of novel prebiotics
including pectin-based poly- and oligosaccharides. Pectins are a group of complex het-
eropolysaccharides found in the cell walls of all plants and mainly consist of galacturonans
(homogalacturonan (HG), substituted galacturonans, and rhamnogalacturonan-II) and
rhamnogalacturonan-I (RG-I) [
17
,
18
]. Different combinations of these components, as well
as variations within each component, allow for a wide range of pectic polysaccharides
to be formed. The varying composition of monosaccharides and their length puts pectin-
based fibers as potential prebiotics, as they need to be fermented with specific enzymatic
machinery [19].
The baobab fruit is derived from the baobab tree (Adansonia digitate L.) indigenous
to Africa, particularly Sudan, Ghana, Malawi, Burkina Faso, and Uganda, and it is a
potential source of pectins. Baobab fruit is subdivided into pericarp, resistant outer shell,
endocarp, and the inner ripe fruit. The ripe pulp is floury, dry, and powdery, including
red fibrous structures and seeds. Although the nutritional values of baobab pulp vary
among different regions, its fiber content is around 70–80% of its dry mass [
20
]. Despite
abundant commercial claims on the health effects mediated by baobab, scientific data on
its composition, potential mechanism of action, and effects are scarce. So far, only two
preliminary studies have been reported investigating the effects of baobab in humans. In
a single-blinded crossover study, the influence of 15 g baobab extract formulated into a
smoothie was investigated in 20 subjects. Baobab exerted a reduced feeling of hunger,
which was likely caused by the increased fiber content in the baobab treatment (11 g) as
compared to the control (2 g) [
21
]. Furthermore, baobab fruit powder tested at two doses
(18.5 g and 37 g) after white bread consumption significantly reduced postprandial blood
glucose response when compared to the control treatment [
22
]. Lastly,
in vitro
studies on
the prebiotic potential of baobab are also lacking.
Although
in vivo
studies are fundamental to demonstrate a health effect on the host,
an important hurdle to understand the prebiotic modulation of the human gut microbiome
in vivo
is the limited access to the site of activity. The use of fecal samples in
in vitro
fer-
mentation models might help in uncovering the enigmas of gut–bacterial interactions [
23
]
and in evaluating and screening of novel potential prebiotics. While dynamic gut models
have been applied before, the high reproducibility and especially higher throughput of
short-term incubation models have been proposed to be critical for further broadening the
understanding of the gut microbiome [
24
]. With respect to gaining an understanding of
potential prebiotic effects of novel substrates, such models allow the inclusion of multiple
test products, while simultaneously addressing interindividual differences among human
subjects [25].
This study aimed to investigate the prebiotic potential of a novel ingredient rich
in pectin-based polysaccharides (baobab fruit pulp powder). This ingredient is unique
compared to other pectic polysaccharides given its high content of low methoxylated
HG. A 48 h
in vitro
incubation strategy with the human fecal microbiota of three different
human donors (to account for interindividual differences) was applied to investigate the
potential modulation of microbial fermentation products (acidification, gas production,
SCFAs, and branched chain fatty acids (bCFAs)) and levels of five specific taxonomic
Microorganisms 2021,9, 1981 3 of 14
groups (Bifidobacteria,Lactobacilli,Firmicutes, Bacteroidetes, and Akkermansia muciniphila).
To our knowledge, this is the first study demonstrating the potential of baobab fruit pulp
powder to modulate the human gut microbiota.
2. Materials and Methods
2.1. Products
Baobab fruit pulp powder (BP) tested in the current study was provided by Döhler
GmbH (Darmstadt, Germany) (Table S1). BP contains a soluble fiber fraction predominantly
consisting of pectic polysaccharides (42.5% of dry mass). Pectic polysaccharides had a
low degree of methylation (11%). Acetyl esterificiation of pectic oligosaccharides was
found in trace amounts only. In other words, it mainly consisted of low methoxylated
HG. Furthermore, BP contained an insoluble fiber fraction (13% of dry mass) consisting of
hemicellulose, cellulose, and cell-wall material bound to pectin, starch (2.7% of dry mass),
and proteins (2.8% of dry mass). Lastly, BP also comprised a substantial amount of glucose,
fructose, and sucrose (30% of dry mass). Unless otherwise stated, all other chemicals were
obtained from Carl Roth (Karlsruhe, Germany).
2.2. Dialysis of Test Product
As glucose, fructose, and sucrose (present in BP) are absorbed in the small intestine
in vivo
, upper gastrointestinal absorption was simulated via a dialysis procedure. This
allowed testing the relevant fraction of the test product that would reach the GI tract
(Figure 1). Dialysis was performed as previously by Van den Abbeele et al. [
26
] with minor
modifications. Briefly, 100 mL of a baobab fruit pulp powder suspension (64.4 g/L) was
prepared in dH
2
O and introduced into a cylindrical dialysis membrane with a molecular
weight cutoff of 0.5 kDa (Spectrum Europe BV, Paris, France). After sealing, the membrane
was submerged in 600 mL of dialysis fluid (3.75 g/L NaHCO
3
in dH
2
O; pH 7) for 24 h at
4
◦
C to prevent the growth of bacteria. During the dialysis procedure, sugars moved from
the intestinal content to the dialysis suspension. On the other hand, due to osmotic pressure,
water also moved from the dialysis solution toward the compartment simulating the
intestinal content. This additional dilution of the test product was calculated by measuring
both the initial (~100 g) and the final weight of the intestinal content. This dilution was
then accounted for when adding the dialyzed product to the colonic incubations so that
a fixed amount of test product was dosed, which was equivalent to 4 g of non-dialyzed
test product/L colonic medium. In other words, when high quantities of water entered
the intestinal content compartment, lower amounts of water were dosed at the start of the
colonic incubation.
Microorganisms 2021, 9, x FOR PEER REVIEW 4 of 14
Figure 1. Schematic representation of the experimental design in this study to investigate the
prebiotic potential of baobab fruit pulp powder (BP). (A) First, upper gastrointestinal absorption
was simulated through dialysis of the baobab fruit pulp powder. Second, 48 h fecal batch
incubations were performed to assess the prebiotic potential of the dialyzed baobab fruit pulp
powder on fermentation products ( ) and levels of specific taxonomic groups via qPCR ( ) com-
pared to ‘no substrate control’ incubations for three healthy adult donors. (B) Sampling scheme to
evaluate the effect of the dialyzed baobab fruit pulp powder. SCFA = short-chain fatty acid, bCFA =
branched-chain fatty acid, qPCR = quantitative polymerase chain reaction.
2.3. Short-Term Colonic Batch Incubations
Short-term colonic batch incubations were performed to simulate the proximal colon
of three healthy adults as previously described by Van den Abbeele et al. [25] with minor
modifications. Briefly, 13 mL of concentrated colonic background medium (25.2 g/L
K
2
HPO
4
, 79.0 g/L KH
2
PO
4
, 9.7 g/L NaHCO
3
(Chem-Lab NV, Zedelgem, Belgium), 9.7 g/L
yeast extract, 9.7 g/L peptone (Oxoid, Aalst, Belgium), 4.8 g/L mucin, 2.4 g/L cysteine, 9.7
g/L Tween
®
80 (Sigma-Aldrich, Bornem, Belgium)) was administered to 120 mL penicillin
bottles already containing 50 mL of dialyzed test product (diluted with dH
2
O to a final
concentration of 4 g/L (in final volume of 70 mL)). This medium was previously
demonstrated to facilitate growth of a broad spectrum of microbes belonging to various
phyla (Actinobacteria, Bacteroidetes, Firmicutes, and Proteobacteria) [27]. Additionally,
for each donor, a reference ‘no substrate control’ incubation was initiated simultaneously.
The advantage of comparing such a ‘no substrate control’ is that any changes observed
between this condition and the BP-treated condition can be attributed to BP treatment. All
reactors were sealed with a rubber stopper and flushed with nitrogen to remove oxygen
prior to inoculation.
Fresh fecal samples were collected from three healthy adults and immediately stored
in an airtight container with an AnaeroGen
®
sachet (Oxoid). Fecal samples were stored at
4 °C in the anaerobic container until further processing. Fecal inocula were prepared by
making a 7.5% (w/v) suspension of each of the freshly collected fecal samples with
anaerobic phosphate buffer (8.8 g/L K
2
HPO
4
, 6.8 g/L KH
2
PO
4
, 0.1 g/L sodium
thioglycolate, 0.015 g/L sodium dithionite). After homogenization (10 min, BagMixer 400,
Interscience, Louvain-La-Neuve, Belgium) and removal of large particles via
centrifugation (2 min, 500× g), 7 mL of inoculum was added to each penicillin bottle,
yielding a total volume of 70 mL inside each reactor. Once the inoculum was added, the
incubation started and lasted for a period of 48 h. Bottles were maintained at 37 °C and
No substrate control Baobab fruit pulp powder (BP)
A. Reactor configuration in vitro incubations
B. Analysis and timeline of faecal microbiome incubations (hours)
0 h 6 h 24 h 48h
SCFA/bCFA/lactate/pH/gas
qPCR for Bifidobacteria, Lactobacilli,
Bacteroidetes, Firmicutes and
Akkermansia muciniphila
Faecal inoculum
A B C
Step A: Dialysis to simulate
small intestinal absorption
(0.5 kDa – 24 h)
Step 2: Fermentation by
faecal microbiome of three
human adult donors (48 h)
A B C
Figure 1.
Schematic representation of the experimental design in this study to investigate the prebiotic
Microorganisms 2021,9, 1981 4 of 14
potential of baobab fruit pulp powder (BP). (
A
) First, upper gastrointestinal absorption was simu-
lated through dialysis of the baobab fruit pulp powder. Second, 48 h fecal batch incubations were
performed to assess the prebiotic potential of the dialyzed baobab fruit pulp powder on fermentation
products (
Microorganisms 2021, 9, x FOR PEER REVIEW 4 of 14
Figure 1. Schematic representation of the experimental design in this study to investigate the
prebiotic potential of baobab fruit pulp powder (BP). (A) First, upper gastrointestinal absorption
was simulated through dialysis of the baobab fruit pulp powder. Second, 48 h fecal batch
incubations were performed to assess the prebiotic potential of the dialyzed baobab fruit pulp
powder on fermentation products ( ) and levels of specific taxonomic groups via qPCR ( ) com-
pared to ‘no substrate control’ incubations for three healthy adult donors. (B) Sampling scheme to
evaluate the effect of the dialyzed baobab fruit pulp powder. SCFA = short-chain fatty acid, bCFA =
branched-chain fatty acid, qPCR = quantitative polymerase chain reaction.
2.3. Short-Term Colonic Batch Incubations
Short-term colonic batch incubations were performed to simulate the proximal colon
of three healthy adults as previously described by Van den Abbeele et al. [25] with minor
modifications. Briefly, 13 mL of concentrated colonic background medium (25.2 g/L
K
2
HPO
4
, 79.0 g/L KH
2
PO
4
, 9.7 g/L NaHCO
3
(Chem-Lab NV, Zedelgem, Belgium), 9.7 g/L
yeast extract, 9.7 g/L peptone (Oxoid, Aalst, Belgium), 4.8 g/L mucin, 2.4 g/L cysteine, 9.7
g/L Tween
®
80 (Sigma-Aldrich, Bornem, Belgium)) was administered to 120 mL penicillin
bottles already containing 50 mL of dialyzed test product (diluted with dH
2
O to a final
concentration of 4 g/L (in final volume of 70 mL)). This medium was previously
demonstrated to facilitate growth of a broad spectrum of microbes belonging to various
phyla (Actinobacteria, Bacteroidetes, Firmicutes, and Proteobacteria) [27]. Additionally,
for each donor, a reference ‘no substrate control’ incubation was initiated simultaneously.
The advantage of comparing such a ‘no substrate control’ is that any changes observed
between this condition and the BP-treated condition can be attributed to BP treatment. All
reactors were sealed with a rubber stopper and flushed with nitrogen to remove oxygen
prior to inoculation.
Fresh fecal samples were collected from three healthy adults and immediately stored
in an airtight container with an AnaeroGen
®
sachet (Oxoid). Fecal samples were stored at
4 °C in the anaerobic container until further processing. Fecal inocula were prepared by
making a 7.5% (w/v) suspension of each of the freshly collected fecal samples with
anaerobic phosphate buffer (8.8 g/L K
2
HPO
4
, 6.8 g/L KH
2
PO
4
, 0.1 g/L sodium
thioglycolate, 0.015 g/L sodium dithionite). After homogenization (10 min, BagMixer 400,
Interscience, Louvain-La-Neuve, Belgium) and removal of large particles via
centrifugation (2 min, 500× g), 7 mL of inoculum was added to each penicillin bottle,
yielding a total volume of 70 mL inside each reactor. Once the inoculum was added, the
incubation started and lasted for a period of 48 h. Bottles were maintained at 37 °C and
No substrate control Baobab fruit pulp powder (BP)
A. Reactor configuration in vitro incubations
B. Analysis and timeline of faecal microbiome incubations (hours)
0 h 6 h 24 h 48h
SCFA/bCFA/lactate/pH/gas
qPCR for Bifidobacteria, Lactobacilli,
Bacteroidetes, Firmicutes and
Akkermansia muciniphila
Faecal inoculum
A B C
Step A: Dialysis to simulate
small intestinal absorption
(0.5 kDa – 24 h)
Step 2: Fermentation by
faecal microbiome of three
human adult donors (48 h)
A B C
) and levels of specific taxonomic groups via qPCR (
Microorganisms 2021, 9, x FOR PEER REVIEW 4 of 14
Figure 1. Schematic representation of the experimental design in this study to investigate the
prebiotic potential of baobab fruit pulp powder (BP). (A) First, upper gastrointestinal absorption
was simulated through dialysis of the baobab fruit pulp powder. Second, 48 h fecal batch
incubations were performed to assess the prebiotic potential of the dialyzed baobab fruit pulp
powder on fermentation products ( ) and levels of specific taxonomic groups via qPCR ( ) com-
pared to ‘no substrate control’ incubations for three healthy adult donors. (B) Sampling scheme to
evaluate the effect of the dialyzed baobab fruit pulp powder. SCFA = short-chain fatty acid, bCFA =
branched-chain fatty acid, qPCR = quantitative polymerase chain reaction.
2.3. Short-Term Colonic Batch Incubations
Short-term colonic batch incubations were performed to simulate the proximal colon
of three healthy adults as previously described by Van den Abbeele et al. [25] with minor
modifications. Briefly, 13 mL of concentrated colonic background medium (25.2 g/L
K
2
HPO
4
, 79.0 g/L KH
2
PO
4
, 9.7 g/L NaHCO
3
(Chem-Lab NV, Zedelgem, Belgium), 9.7 g/L
yeast extract, 9.7 g/L peptone (Oxoid, Aalst, Belgium), 4.8 g/L mucin, 2.4 g/L cysteine, 9.7
g/L Tween
®
80 (Sigma-Aldrich, Bornem, Belgium)) was administered to 120 mL penicillin
bottles already containing 50 mL of dialyzed test product (diluted with dH
2
O to a final
concentration of 4 g/L (in final volume of 70 mL)). This medium was previously
demonstrated to facilitate growth of a broad spectrum of microbes belonging to various
phyla (Actinobacteria, Bacteroidetes, Firmicutes, and Proteobacteria) [27]. Additionally,
for each donor, a reference ‘no substrate control’ incubation was initiated simultaneously.
The advantage of comparing such a ‘no substrate control’ is that any changes observed
between this condition and the BP-treated condition can be attributed to BP treatment. All
reactors were sealed with a rubber stopper and flushed with nitrogen to remove oxygen
prior to inoculation.
Fresh fecal samples were collected from three healthy adults and immediately stored
in an airtight container with an AnaeroGen
®
sachet (Oxoid). Fecal samples were stored at
4 °C in the anaerobic container until further processing. Fecal inocula were prepared by
making a 7.5% (w/v) suspension of each of the freshly collected fecal samples with
anaerobic phosphate buffer (8.8 g/L K
2
HPO
4
, 6.8 g/L KH
2
PO
4
, 0.1 g/L sodium
thioglycolate, 0.015 g/L sodium dithionite). After homogenization (10 min, BagMixer 400,
Interscience, Louvain-La-Neuve, Belgium) and removal of large particles via
centrifugation (2 min, 500× g), 7 mL of inoculum was added to each penicillin bottle,
yielding a total volume of 70 mL inside each reactor. Once the inoculum was added, the
incubation started and lasted for a period of 48 h. Bottles were maintained at 37 °C and
No substrate control Baobab fruit pulp powder (BP)
A. Reactor configuration in vitro incubations
B. Analysis and timeline of faecal microbiome incubations (hours)
0 h 6 h 24 h 48h
SCFA/bCFA/lactate/pH/gas
qPCR for Bifidobacteria, Lactobacilli,
Bacteroidetes, Firmicutes and
Akkermansia muciniphila
Faecal inoculum
A B C
Step A: Dialysis to simulate
small intestinal absorption
(0.5 kDa – 24 h)
Step 2: Fermentation by
faecal microbiome of three
human adult donors (48 h)
A B C
) compared to ‘no substrate control’
incubations for three healthy adult donors. (
B
) Sampling scheme to evaluate the effect of the dialyzed
baobab fruit pulp powder. SCFA = short-chain fatty acid, bCFA = branched-chain fatty acid, qPCR =
quantitative polymerase chain reaction.
2.3. Short-Term Colonic Batch Incubations
Short-term colonic batch incubations were performed to simulate the proximal colon
of three healthy adults as previously described by Van den Abbeele et al. [
25
] with mi-
nor modifications. Briefly, 13 mL of concentrated colonic background medium (25.2 g/L
K
2
HPO
4
, 79.0 g/L KH
2
PO
4
, 9.7 g/L NaHCO
3
(Chem-Lab NV, Zedelgem, Belgium), 9.7 g/L
yeast extract, 9.7 g/L peptone (Oxoid, Aalst, Belgium), 4.8 g/L mucin, 2.4 g/L cysteine,
9.7 g/L Tween
®
80 (Sigma-Aldrich, Bornem, Belgium)) was administered to 120 mL peni-
cillin bottles already containing 50 mL of dialyzed test product (diluted with dH
2
O to
a final concentration of 4 g/L (in final volume of 70 mL)). This medium was previously
demonstrated to facilitate growth of a broad spectrum of microbes belonging to various
phyla (Actinobacteria, Bacteroidetes, Firmicutes, and Proteobacteria) [
27
]. Additionally,
for each donor, a reference ‘no substrate control’ incubation was initiated simultaneously.
The advantage of comparing such a ‘no substrate control’ is that any changes observed
between this condition and the BP-treated condition can be attributed to BP treatment. All
reactors were sealed with a rubber stopper and flushed with nitrogen to remove oxygen
prior to inoculation.
Fresh fecal samples were collected from three healthy adults and immediately stored
in an airtight container with an AnaeroGen
®
sachet (Oxoid). Fecal samples were stored at
4
◦
C in the anaerobic container until further processing. Fecal inocula were prepared by
making a 7.5% (w/v) suspension of each of the freshly collected fecal samples with anaer-
obic phosphate buffer (8.8 g/L K
2
HPO
4
, 6.8 g/L KH
2
PO
4
, 0.1 g/L sodium thioglycolate,
0.015 g/L sodium dithionite). After homogenization (10 min, BagMixer 400, Interscience,
Louvain-La-Neuve, Belgium) and removal of large particles via centrifugation (2 min,
500×g)
, 7 mL of inoculum was added to each penicillin bottle, yielding a total volume of
70 mL inside each reactor. Once the inoculum was added, the incubation started and lasted
for a period of 48 h. Bottles were maintained at 37
◦
C and were continuously mixed in a
temperature-controlled shaker (90 rpm). Given the high technical reproducibility of the
assay as demonstrated before [
28
], it was opted to test three donors in single repetition
rather than testing one donor in technical triplicate. This approach allowed understanding
potential interpersonal differences. While samples for the analysis of fermentation products
were collected at 0, 6, 24, and 48 h, samples for the analysis of specific taxonomic groups
were collected at 0, 24, and 48 h.
2.4. Microbial Metabolic Activity
The extent of acidification during the short-term incubations is a measure for the
degree of bacterial fermentation activity. The pH was measured immediately using a
SenseLine F410 (ProSense, Oosterhout, The Netherlands). As the incubations were per-
formed in a closed incubation system, one could determine the accumulation of gases in the
headspace by penetrating the rubber septum with a needle connected to a pressure meter
(Hand-held pressure indicator CPH6200; Wika, Echt, The Netherlands). Furthermore, short-
chain fatty acids (SCFAs) and branched-chain fatty acids (bCFAs) were quantified by gas
chromatography (GC) coupled to flame ionization detection (FID) as previously described
by De Weirdt et al. [
29
]. Lastly, lactate was quantified using a commercially available
enzymatic assay kit (R-Biopharm, Darmstadt, Germany) according to the manufacturer’s
Microorganisms 2021,9, 1981 5 of 14
instructions. All these aforementioned endpoints do not determine the instantaneous
microbial activity, yet they reflect the activity during the preceding incubation period.
2.5. Quantification of Specific Taxonomic Groups
Luminal samples were subjected to quantitative polymerase chain reaction (qPCR)
to quantify specific populations of the simulated human gut microbiota. DNA isolation
and qPCR analyses were performed as described by Van den Abbeele et al. [
28
]. Briefly,
a StepOnePlus
™
real-time PCR system (Applied Biosystems, Foster City, CA, USA), was
used to quantify five taxonomic groups of interest, i.e., Lactobacillus spp. [
30
], Bifidobacterium
spp. [
31
], Akkermansia muciniphila [
32
], Bacteroidetes [
33
], and Firmicutes [
33
]. All protocols
started with 10 min incubation at 95
◦
C and terminated with a melting curve from 60
◦
C to
95
◦
C. Forty cycles were performed with a denaturation phase of 15 s at 95
◦
C, an annealing
phase of 30 s at 60
◦
C, and an elongation step of 30 s at 72
◦
C in each cycle. The primers
used are presented in Table 1.
Table 1. Primers used for qPCR quantification of 5 specific taxonomic groups.
Taxonomic Group Primer Sequences 50–30and
30–50Reference
Lactobacillus spp.
AGCAGTAGGGAATCTTCCA
CGCCACTGGTGTTCYTCCATATA
[30]
Bifidobacterium spp. TCGCGTCYGGTGTGAAAG
CCACATCCAGCYTCCAC [31]
Akkermansia muciniphila
CAGCACGTGAAGGTGGGGAC
CCTTGCGGTTGGCTTCAGAT
[32]
Bacteroidetes
GGAACATGTGGTTTAATTCGATGAT
AGCTGACGACAACCATGCAG
[33]
Firmicutes
GGAGYATGTGGTTTAATTCGAAGCA
AGCTGACGACAACCATGCAC
[33]
2.6. Statistics
For exploratory data analysis, principal component analysis (PCA) was performed for
both metabolic (acidification, acetate, propionate, butyrate, and bCFAs) and qPCR data via
the online tool Clustvis (https://biit.cs.ut.ee/clustvis/, accessed on 7 May 2021) [
34
]. To
statistically evaluate differences in microbial metabolite production between ‘no substrate
control’ and treatment incubations at each timepoint, two-way paired Student t-tests were
performed. Differences were considered significant when p< 0.05, although different levels
of significance were distinguished: * p< 0.05, ** p< 0.01. Statistical analysis was performed
with Microsoft Excel (version 365, Microsoft, Redmond, WA, USA).
3. Results
3.1. Baobab Fruit Pulp Powder Stimulated Microbial Metabolic Activity from 0–24 h with Some
Interindividual Differences
To gain insight into the overall changes in microbial activity upon BP treatment, a
principal component analysis (PCA) was performed (Figure 2). The PCA accounted for
86.6% of the observed variation of the dataset, thus providing optimal insight into the
underlying changes. First, differential clustering of ‘no substrate control’ versus BP-treated
incubations indicated the occurrence of treatment effects. Furthermore, a marked time-
course effect was observed with main fermentation of BP occurring between 0 and 24 h.
Interestingly, within clusters of time/treatment, interindividual differences among the
three donors were observed.
Microorganisms 2021,9, 1981 6 of 14
Microorganisms 2021, 9, x FOR PEER REVIEW 6 of 14
t-tests were performed. Differences were considered significant when p < 0.05, although
different levels of significance were distinguished: * p < 0.05, ** p < 0.01. Statistical analysis
was performed with Microsoft Excel (version 365, Microsoft, Redmond, WA, USA).
3. Results
3.1. Baobab Fruit Pulp Powder Stimulated Microbial Metabolic Activity from 0–24 h with Some
Interindividual Differences
To gain insight into the overall changes in microbial activity upon BP treatment, a
principal component analysis (PCA) was performed (Figure 2). The PCA accounted for
86.6% of the observed variation of the dataset, thus providing optimal insight into the
underlying changes. First, differential clustering of ‘no substrate control’ versus BP-
treated incubations indicated the occurrence of treatment effects. Furthermore, a marked
time-course effect was observed with main fermentation of BP occurring between 0 and
24 h. Interestingly, within clusters of time/treatment, interindividual differences among
the three donors were observed.
Figure 2. Principal component analysis (86.8%) of the metabolic activity data recorded along the 48 h incubations (pH,
gas, acetate, lactate, propionate, butyrate, bCFA). Different symbol shapes indicate different conditions (‘no substrate
control’ vs. baobab fruit pulp powder), while different colors reflect different timepoints. Letters inside symbols refer to
the respective donor (A, B, or C).
3.2. Baobab Fruit Pulp Powder Stimulated Acetate, Propionate, Lactate, and Butyrate
Production
The average changes in microbial metabolic activity across donors allowed
identifying potential consistent effects of BP (Figure 3). Gas production, acidification (pH),
and total SCFA production are considered general fermentation markers and were
consistently impacted by BP within 6 h after initiation of the incubation. The pH decrease
and increase in total SCFA levels with BP was due to the marked stimulation of mostly
acetate and propionate. Furthermore, butyrate only mildly increased, still reaching
significance at the 24 h timepoint. pH decreases were further explained by the stimulatory
effect of BP on lactate pro duction. Although nonsignificant (p = 0.14), lactate was increased
approximately sixfold upon treatment after 6 h of incubation. Lastly, BP tended to reduce
the production of bCFAs at 48 h (p = 0.14).
Figure 2.
Principal component analysis (86.8%) of the metabolic activity data recorded along the 48 h incubations (pH, gas,
acetate, lactate, propionate, butyrate, bCFA). Different symbol shapes indicate different conditions (‘no substrate control’ vs.
baobab fruit pulp powder), while different colors reflect different timepoints. Letters inside symbols refer to the respective
donor (A, B, or C).
3.2. Baobab Fruit Pulp Powder Stimulated Acetate, Propionate, Lactate, and Butyrate Production
The average changes in microbial metabolic activity across donors allowed identifying
potential consistent effects of BP (Figure 3). Gas production, acidification (pH), and total
SCFA production are considered general fermentation markers and were consistently
impacted by BP within 6 h after initiation of the incubation. The pH decrease and increase
in total SCFA levels with BP was due to the marked stimulation of mostly acetate and
propionate. Furthermore, butyrate only mildly increased, still reaching significance at the
24 h timepoint. pH decreases were further explained by the stimulatory effect of BP on
lactate production. Although nonsignificant (p= 0.14), lactate was increased approximately
sixfold upon treatment after 6 h of incubation. Lastly, BP tended to reduce the production
of bCFAs at 48 h (p= 0.14).
Microorganisms 2021, 9, x FOR PEER REVIEW 7 of 14
Figure 3. Effect of baobab fruit pulp powder fermentation on microbial fermentation products (A–H) during 48 h
incubations. Average (±SEM) values across the three donors tested (n = 1 per donor) at 6 h, 24 h, and 48 h of incubations
for the ‘no substrate control’ (black) and upon treatment with baobab fruit pulp powder (green). Statistically significant
differences are indicated with asterisks (* p < 0.05, ** p < 0.01).
Upon plotting the kinetics of metabolite production for each individual donor
(Figure 4), interindividual differences were visualized. This pointed out that BP strongly
increased acetate and propionate levels within 6 h for donors A/B, while rather increasing
lactate levels for donor C at this time point. Acetate, propionate, and butyrate production
was rather delayed to the 6–24 h time interval for this donor.
In terms of overall kinetics, a peculiar finding was that lactate was exclusively
detected at the initial 6 h timepoint in all incubations. The transient nature of lactate is
likely explained through cross-feeding mechanisms in which lactate is consumed for the
production of, e.g., acetate, propionate, and/or butyrate.
6h 24h 48h
5.8
6.0
6.2
6.4
6.6
Time (hours)
A
** **
**
6h 24h 48h
0
20
40
60
Time (hours)
B
*
*
6h 24h 48h
0
20
40
60
Time (hours)
C
*
*
**
6h 24h 48h
0
10
20
30
40
Time (hours)
E
*
*
*
6h 24h 48h
0
5
10
15
Time (hours)
F
*
6h 24h 48h
0
1
2
3
4
5
Time (hours)
G
**
6h 24h 48h
0
1
2
3
4
Time (hours)
H
Figure 3.
Effect of baobab fruit pulp powder fermentation on microbial fermentation products (
A
–
H
) during 48 h incubations.
Average (
±
SEM) values across the three donors tested (n= 1 per donor) at 6 h, 24 h, and 48 h of incubations for the ‘no
substrate control’ (black) and upon treatment with baobab fruit pulp powder (green). Statistically significant differences are
indicated with asterisks (* p< 0.05, ** p< 0.01).
Microorganisms 2021,9, 1981 7 of 14
Upon plotting the kinetics of metabolite production for each individual donor (
Figure 4
),
interindividual differences were visualized. This pointed out that BP strongly increased
acetate and propionate levels within 6 h for donors A/B, while rather increasing lactate
levels for donor C at this time point. Acetate, propionate, and butyrate production was
rather delayed to the 6–24 h time interval for this donor.
Microorganisms 2021, 9, x FOR PEER REVIEW 8 of 14
Figure 4. Temporal changes in microbial metabolic activity markers (acetate, propionate, butyrate, lactate, and pH) for
three different healthy adult donors (donor A, donor B, donor C) during 48 h fecal batch incubations for the ‘no substrate
control’ (black) and upon treatment with baobab fruit pulp powder (right) (A–F). Temporal profiles of reference conditions
indicate absolute values while profiles of treatments with baobab fruit pulp powder represent changes as compared to the
reference conditions.
3.3. Baobab Fruit Pulp Powder Altered the Abundance of Specific Members of the Microbial
Community in a Donor-Dependent Fashion
The PCA-based quantification of specific microbiota members (Bifidobacteria,
Lactobacilli, Bacteroidetes, Firmicutes, and Akkermansia muciniphila) again explained a high
degree of variation (80.3%, Figure 5). At the start of the experiment (0 h), donors A and B
comprised similar levels of the targeted taxonomic groups, while being distinctly different
from donor C. Overall, weak clustering of corresponding time/treatment samples for the
three different donors indicated that interindividual variation was more profound with
regard to community composition as compared to metabolic activity (Figure 2). Metabolic
functional redundancy between distinct bacterial groups could explain this observation.
In terms of a treatment effect, when considered within a given donor, BP
administration strongly impacted the five targeted taxonomic groups at 24 h of donors A
and C, but not of donor B, as compared to their respective ‘no substrate control’
incubations. As a remark, differences versus 0 h were more pronounced at 24 h than at 48
h.
Concentration (mM)
Acidity (pH)
Concentration (mM)
Acidity (pH)
Concentration (mM)
Acidity (pH)
C D
E F
aaaaaaaaaaaa
a
aaa
a
a
a
aaaaaaaaaaaa
a
aaa
a
a
a
A B
No substrate control - donor A BP - donor A
BP - donor B
BP - donor C
No substrate control - donor B
No substrate control - donor C
Figure 4.
Temporal changes in microbial metabolic activity markers (acetate, propionate, butyrate, lactate, and pH) for
three different healthy adult donors (donor A, donor B, donor C) during 48 h fecal batch incubations for the ‘no substrate
control’ (black) and upon treatment with baobab fruit pulp powder (right) (
A
–
F
). Temporal profiles of reference conditions
indicate absolute values while profiles of treatments with baobab fruit pulp powder represent changes as compared to the
reference conditions.
In terms of overall kinetics, a peculiar finding was that lactate was exclusively detected
at the initial 6 h timepoint in all incubations. The transient nature of lactate is likely ex-
plained through cross-feeding mechanisms in which lactate is consumed for the production
of, e.g., acetate, propionate, and/or butyrate.
3.3. Baobab Fruit Pulp Powder Altered the Abundance of Specific Members of the Microbial
Community in a Donor-Dependent Fashion
The PCA-based quantification of specific microbiota members (Bifidobacteria,
Lactobacilli
,
Bacteroidetes,Firmicutes, and Akkermansia muciniphila) again explained a high degree of
Microorganisms 2021,9, 1981 8 of 14
variation (80.3%, Figure 5). At the start of the experiment (0 h), donors A and B comprised
similar levels of the targeted taxonomic groups, while being distinctly different from
donor C. Overall, weak clustering of corresponding time/treatment samples for the three
different donors indicated that interindividual variation was more profound with regard to
community composition as compared to metabolic activity (Figure 2). Metabolic functional
redundancy between distinct bacterial groups could explain this observation.
Microorganisms 2021, 9, x FOR PEER REVIEW 9 of 14
Figure 5. Principal component analysis (80.3 %) based on the quantification of five specific taxonomic groups during the
48 h incubations. qPCRs targeted Bifidobacteria, Lactobacilli, Bacteroidetes, Firmicutes, and Akkermansia muciniphila. Different
symbol shapes indicate different treatments (‘no substrate control’ vs. baobab fruit pulp powder), while different colors
indicate different timepoints. Letters inside symbols refer to the respective donor (A, B, or C).
A first observation when inspecting the underlying qPCR data (Figure 6) was that
cell densities increased between 0 and 24 h and decreased between 24 and 48 h. This may
indicate cell death and lysis between 24 and 48 h. After 24 h of incubation, BP stimulated
Bifidobacteria, Bacteroidetes, and Firmicutes for donor A, while it only enriched Bacteroidetes
for donor B. Meanwhile, for donor C, baobab fruit pulp powder strongly increased
Lactobacilli and Bacteroidetes levels and moderately stimulated Firmicutes. Consistent with
the metabolic data, these findings confirm a donor-dependent treatment response, a part
of the consistent stimulation of Bacteroidetes members (Figure 4).
Figure 5.
Principal component analysis (80.3%) based on the quantification of five specific taxonomic groups during the
48 h incubations. qPCRs targeted Bifidobacteria,Lactobacilli,Bacteroidetes,Firmicutes, and Akkermansia muciniphila. Different
symbol shapes indicate different treatments (‘no substrate control’ vs. baobab fruit pulp powder), while different colors
indicate different timepoints. Letters inside symbols refer to the respective donor (A, B, or C).
In terms of a treatment effect, when considered within a given donor, BP administra-
tion strongly impacted the five targeted taxonomic groups at 24 h of donors A and C, but
not of donor B, as compared to their respective ‘no substrate control’ incubations. As a
remark, differences versus 0 h were more pronounced at 24 h than at 48 h.
A first observation when inspecting the underlying qPCR data (Figure 6) was that
cell densities increased between 0 and 24 h and decreased between 24 and 48 h. This may
indicate cell death and lysis between 24 and 48 h. After 24 h of incubation, BP stimulated
Bifidobacteria,Bacteroidetes, and Firmicutes for donor A, while it only enriched Bacteroidetes for
donor B. Meanwhile, for donor C, baobab fruit pulp powder strongly increased Lactobacilli
and Bacteroidetes levels and moderately stimulated Firmicutes. Consistent with the metabolic
data, these findings confirm a donor-dependent treatment response, a part of the consistent
stimulation of Bacteroidetes members (Figure 4).
Microorganisms 2021,9, 1981 9 of 14
Microorganisms 2021, 9, x FOR PEER REVIEW 9 of 14
Figure 5. Principal component analysis (80.3 %) based on the quantification of five specific taxonomic groups during the
48 h incubations. qPCRs targeted Bifidobacteria, Lactobacilli, Bacteroidetes, Firmicutes, and Akkermansia muciniphila. Different
symbol shapes indicate different treatments (‘no substrate control’ vs. baobab fruit pulp powder), while different colors
indicate different timepoints. Letters inside symbols refer to the respective donor (A, B, or C).
A first observation when inspecting the underlying qPCR data (Figure 6) was that
cell densities increased between 0 and 24 h and decreased between 24 and 48 h. This may
indicate cell death and lysis between 24 and 48 h. After 24 h of incubation, BP stimulated
Bifidobacteria, Bacteroidetes, and Firmicutes for donor A, while it only enriched Bacteroidetes
for donor B. Meanwhile, for donor C, baobab fruit pulp powder strongly increased
Lactobacilli and Bacteroidetes levels and moderately stimulated Firmicutes. Consistent with
the metabolic data, these findings confirm a donor-dependent treatment response, a part
of the consistent stimulation of Bacteroidetes members (Figure 4).
Figure 6.
Effect of baobab fruit pulp powder on five specific taxonomic groups during 48 h incubations as determined
through qPCR. Changes in absolute abundances (log (16SrRNA gene copies/mL)) of Bifidobacteria (
A
), Lactobacilli (
B
),
Bacteroidetes (
C
), Firmicutes (
D
), and Akkermansia muciniphila (
E
) after 24 h and 48 h of incubation as compared to 0 h upon
dosing of baobab fruit pulp powder (green) versus a ‘no substrate control’ (black) for three healthy adults (donor A, donor
B, donor C) (n= 1).
4. Discussion
The present study investigated the prebiotic potential of baobab fruit pulp powder,
rich in pectin-based fibers with a low degree of methyl esterification and consisting mainly
of homogalacturonan (HG). This composition is unique versus other pectic polysaccharides.
Thus, 48 h
in vitro
incubations with fecal microbiota of three human adult donors were
performed to investigate the potential selective utilization of baobab fruit pulp fiber by host
microorganisms, a first essential feature to qualify as a prebiotic [
14
]. A second essential
feature is that a health benefit should follow from such selective utilization. While health
effects are to be demonstrated in the final target host, health-promoting metabolites (SCFAs)
were quantified during the current study to obtain first insights. Overall, this exploratory
study demonstrated that baobab fruit pulp powder displays promising prebiotic potential.
Depending on the donor, distinct microbial communities were present, confirming the
importance of assessing interindividual variation.
First, baobab fruit pulp powder consistently stimulated specific health-related metabo-
lites, i.e., mostly acetate and propionate. Other consistent changes included the increase in
lactate levels at the start of the incubation (6 h), followed by increased butyrate levels (24 h).
Furthermore, there was a tendency to lower levels of bCFA. The stimulation of acetate and
propionate is in line with other studies that investigated pectin-rich fruit fibers [
35
,
36
]. This
specific modulation of metabolite production suggests a specific utilization of baobab fruit
pulp powder by host microorganisms able to produce such metabolites, thus confirming
its prebiotic potential. Additionally, given the well-documented health benefits of acetate,
propionate, and butyrate as reviewed by Rivière et al. [
37
], this also suggests that baobab
fruit pulp powder could confer health benefits upon its consumption. bCFAs are on the
other hand indicative for proteolytic fermentation [
38
], which is associated with formation
of metabolites such as phenol and indole that exert detrimental health effects [
39
,
40
]. The
tendency to lower bCFA levels upon baobab treatment, thus, further supports potential
beneficial effects of baobab fruit pulp powder supplementation.
Investigation of changes in five specific taxonomic groups further confirmed the
selective utilization of baobab fruit pulp powder by specific host microorganisms. Key
Microorganisms 2021,9, 1981 10 of 14
contributors to baobab fruit pulp powder fermentation likely included Bacteroidetes mem-
bers that increased for each of the three donors tested. This is in line with the finding that
Bacteroides spp. possess a versatile enzymatic potential, allowing them to depolymerize
the backbone of HG [
19
], a key constituent of baobab fruit pulp powder. As Bacteroides
spp. are among the most abundant producers of propionate [
10
,
41
], their involvement
in baobab fruit pulp powder fermentation is further supported as propionate indeed in-
creased upon baobab fruit pulp powder supplementation. Depolymerization of HG by
Bacteroides spp. likely facilitated fermentation of degradation fragments of HG by other
microbial groups. According to the current study, such contributing microbes seem to differ
among donors. Donor A was, for example, the only donor for which Bifidobacteria increased.
In contrast, for donor C, a marked increase in Lactobacilli was noted, which coincided
with profound increases in lactate, i.e., the sole and main end product of carbohydrate
metabolism by Lactobacilli [
42
]. Stimulation of Lactobacilli by pectin has indeed been re-
ported before [
43
]. Moreover, when mixing baobab fruit powder with fermented soybeans
(Tempeh—traditional Japanese fermented food), an enhancement of lactic acid bacteria was
observed [
44
]. While baobab fruit pulp powder increased lactate levels for all donors at
6 h, lactate was fully consumed at subsequent timepoints, indicating that baobab fruit pulp
powder stimulated cross-feeding interactions with lactate-consuming microorganisms,
potentially including propionate [
45
] and/or butyrate-producing [
46
]Firmicutes members,
a phylum that indeed increased for donors A and C. Overall, these findings, even if only
based on qPCR analysis (that has low taxonomic resolution as opposed to next-generation
sequencing), suggest the involvement of specific host microorganisms in the fermentation
of baobab fruit pulp powder, highlighting its prebiotic potential. Future research should,
however, account for the marked interindividual differences among human subjects, which
were apparent even after testing as few as three donors in the current study. The existence
of marked interindividual differences is in line with observations during human
in vivo
studies [9,10].
Now that the prebiotic potential of BP was confirmed in this first study, a next research
question is how this potential relates to known prebiotic substrates. To put the findings of
this study in perspective, the results were compared to those of a recent study where three
different types of inulin, the ‘gold standard’ prebiotic [
47
], were tested using the exact same
in vitro
approach [
25
] (Figure 7). However, a key difference between both studies was that,
while inulin sources were tested at 5 g/L, baobab fruit pulp powder was administered at
dose of 4 g/L of which up to 33% (simple sugars) was removed upon preceding dialysis
(Table S1), resulting in a colonic test dose of only ~2.6 g fiber/L. Despite being dosed at
around half the dose of inulin, baobab fruit pulp powder exerted similar (IN1) or even more
profound effects on propionate production (IN2/IN3). Furthermore, effects on acetate and
total SCFA were more attenuated but still on the same order of magnitude. In contrast,
gas production, lactate, and mostly the increase in butyrate and decrease in bCFA levels
were more specific to inulin. In comparison to such ‘gold standard’ prebiotics, baobab fruit
pulp powder, thus, seems an interesting potential prebiotic with a likely complementary
mode of action. The marked propionate production with more attenuated gas production
could be of particular interest for specific applications. It will be important to confirm these
findings in studies in which BP is directly compared with known prebiotic substrates such
as inulin.
Microorganisms 2021,9, 1981 11 of 14
Microorganisms 2021, 9, x FOR PEER REVIEW 11 of 14
indicating that baobab fruit pulp powder stimulated cross-feeding interactions with
lactate-consuming microorganisms, potentially including propionate [45] and/or
butyrate-producing [46] Firmicutes members, a phylum that indeed increased for donors
A and C. Overall, these findings, even if only based on qPCR analysis (that has low
taxonomic resolution as opposed to next-generation sequencing), suggest the
involvement of specific host microorganisms in the fermentation of baobab fruit pulp
powder, highlighting its prebiotic potential. Future research should, however, account for
the marked interindividual differences among human subjects, which were apparent even
after testing as few as three donors in the current study. The existence of marked
interindividual differences is in line with observations during human in vivo studies
[9,10].
Now that the prebiotic potential of BP was confirmed in this first study, a next
research question is how this potential relates to known prebiotic substrates. To put the
findings of this study in perspective, the results were compared to those of a recent study
where three different types of inulin, the ‘gold standard’ prebiotic [47], were tested using
the exact same in vitro approach [25] (Figure 7). However, a key difference between both
studies was that, while inulin sources were tested at 5 g/L, baobab fruit pulp powder was
administered at dose of 4 g/L of which up to 33% (simple sugars) was removed upon
preceding dialysis (Table S1), resulting in a colonic test dose of only ~2.6 g fiber/L. Despite
being dosed at around half the dose of inulin, baobab fruit pulp powder exerted similar
(IN1) or even more profound effects on propionate production (IN2/IN3). Furthermore,
effects on acetate and total SCFA were more attenuated but still on the same order of
magnitude. In contrast, gas production, lactate, and mostly the increase in butyrate and
decrease in bCFA levels were more specific to inulin. In comparison to such ‘gold
standard’ prebiotics, baobab fruit pulp powder, thus, seems an interesting potential
prebiotic with a likely complementary mode of action. The marked propionate production
with more attenuated gas production could be of particular interest for specific
applications. It will be important to confirm these findings in studies in which BP is
directly compared with known prebiotic substrates such as inulin.
Figure 7. Effect of baobab fruit pulp powder (BP) fermentation on bacterial metabolic parameters
during 48 h fecal batch incubations of three healthy adults compared to a ‘no substrate control’
control and three different types of inulin (IN1, IN2, IN3) as tested by Van den Abbeele et al. [25].
BP data were obtained as disclosed in this study. BP was administered at ~2.6 g fiber/L, while inulin
was tested at 5 g/L. Average differences between treated and ‘no substrate control’ incubations for
three donors were calculated for each parameter. Subsequently, all values were standardized within
each parameter to enable comparisons across parameters on a single scale.
Blank BP IN1 IN2 IN3
pH
Gas production
Total SCFA
Lactate
Acetate
Propionate
Butyrate
bCFA
-2
-1
0
1
2
2
1
0
–1
–2
Figure 7.
Effect of baobab fruit pulp powder (BP) fermentation on bacterial metabolic parameters
during 48 h fecal batch incubations of three healthy adults compared to a ‘no substrate control’
control and three different types of inulin (IN1, IN2, IN3) as tested by Van den Abbeele et al. [
25
]. BP
data were obtained as disclosed in this study. BP was administered at ~2.6 g fiber/L, while inulin
was tested at 5 g/L. Average differences between treated and ‘no substrate control’ incubations for
three donors were calculated for each parameter. Subsequently, all values were standardized within
each parameter to enable comparisons across parameters on a single scale.
5. Conclusions
In conclusion, this exploratory
in vitro
study allowed attributing an interesting prebi-
otic potential to baobab fruit pulp powder with changes in both fermentation products and
specific taxonomic groups, suggesting selective fermentation by host microorganisms. Al-
though subject to interindividual variation at the microbial composition level, baobab fruit
pulp powder constituently stimulated the production of health-related acetate, propionate,
and to lesser extent butyrate. These effects were seemingly distinctly different from those
exerted by the ‘gold standard’ prebiotic inulin that rather increases butyrate production. To
our knowledge, this is the first evidence demonstrating the potential of baobab fruit pulp
powder to modulate the human gut microbiota. Overall, our findings strongly support
further research toward the potential of baobab fruit pulp powder as a prebiotic substrate.
Such studies should account for the investigation of effects across multiple donors given the
observed interindividual variation during the current study. Performing
in vitro
studies
with a fecal inoculum of a single human donor could result in conclusions that are not
representative of a broader number of donors. For example, if only donor C was tested, the
conclusion would have been that baobab fruit pulp powder strongly stimulates Lactobacilli.
While valid for donor C, this was not the case for donors A/B. Overall, this study supports
further research toward the prebiotic potential of baobab fruit pulp powder and other
pectin-based products, as well as their potential health-promoting effects.
Supplementary Materials:
The following are available online at https://www.mdpi.com/article/10
.3390/microorganisms9091981/s1, Table S1. Nutritional composition of tested baobab fruit pulp powder.
Author Contributions:
Conceptualization, M.F. and M.M.; methodology, J.G. and P.V.d.A.; formal
analysis, A.C.Z., J.G. and P.V.d.A.; investigation, J.G. and P.V.d.A.; resources, M.F.; writing—original
draft preparation, P.V.d.A.; writing—review and editing, M.F., J.G., and M.M.; supervision, M.F. and
P.V.d.A.; project administration, M.M. All authors have read and agreed to the published version of
the manuscript.
Funding:
The studies described in this manuscript were performed at the request of and were funded
by Döhler, 94295 Darmstadt, Germany.
Microorganisms 2021,9, 1981 12 of 14
Institutional Review Board Statement:
The study was conducted according to the guidelines of the
Declaration of Helsinki and approved by Ethics Committee of University Hospital Ghent (reference
number B670201836585).
Informed Consent Statement: The study participants gave informed consent.
Acknowledgments:
Henk Schols is acknowledged for compositional analysis and pectin characteri-
zation of baobab fruit pulp powder and sharing his deep insights into plant carbohydrates.
Conflicts of Interest:
M.F. and A.C.Z. are employees of Döhler. While M.F. participated in the design
of the study, the interpretation of the data, and the revision of the manuscript, M.F. did not participate
in the collection and analyses of data.
References
1. Robles Alonso, V.; Guarner, F. Linking the Gut Microbiota to Human Health. Br. J. Nutr. 2013,109, S21–S26. [CrossRef]
2.
Bäckhed, F.; Ley, R.E.; Sonnenburg, J.L.; Peterson, D.A.; Gordon, J.I. Host-Bacterial Mutualism in the Human Intestine. Science
2005,307, 1915–1920. [CrossRef]
3.
Sender, R.; Fuchs, S.; Milo, R. Revised Estimates for the Number of Human and Bacteria Cells in the Body. PLoS Biol.
2016
,
14, e1002533. [CrossRef] [PubMed]
4.
Louis, P.; Hold, G.L.; Flint, H.J. The Gut Microbiota, Bacterial Metabolites and Colorectal Cancer. Nat. Rev. Microbiol.
2014
,12,
661–672. [CrossRef] [PubMed]
5.
Louis, P.; Flint, H.J. Formation of Propionate and Butyrate by the Human Colonic Microbiota. Environ. Microbiol.
2017
,19, 29–41.
[CrossRef]
6.
Rinninella, E.; Raoul, P.; Cintoni, M.; Franceschi, F.; Miggiano, G.A.D.; Gasbarrini, A.; Mele, M.C. What Is the Healthy Gut
Microbiota Composition? A Changing Ecosystem across Age, Environment, Diet, and Diseases. Microorganisms
2019
,7, 14.
[CrossRef]
7.
Han, Y.; Xiao, H. Whole Food–Based Approaches to Modulating Gut Microbiota and Associated Diseases. Annu. Rev. Food Sci.
Technol. 2020,11, 119–143. [CrossRef]
8.
Zmora, N.; Suez, J.; Elinav, E. You Are What You Eat: Diet, Health and the Gut Microbiota. Nat. Rev. Gastroenterol. Hepatol.
2019
,
16, 35–56. [CrossRef] [PubMed]
9.
Healey, G.R.; Murphy, R.; Brough, L.; Butts, C.A.; Coad, J. Interindividual Variability in Gut Microbiota and Host Response to
Dietary Interventions. Nutr. Rev. 2017,75, 1059–1080. [CrossRef]
10.
Salonen, A.; Lahti, L.; Salojärvi, J.; Holtrop, G.; Korpela, K.; Duncan, S.H.; Date, P.; Farquharson, F.; Johnstone, A.M.;
Lobley, G.E.; et al. Impact of Diet and Individual Variation on Intestinal Microbiota Composition and Fermentation Products in
Obese Men. ISME J. 2014,8, 2218–2230. [CrossRef] [PubMed]
11.
Vujkovic-Cvijin, I.; Sklar, J.; Jiang, L.; Natarajan, L.; Knight, R.; Belkaid, Y. Host Variables Confound Gut Microbiota Studies of
Human Disease. Nature 2020,587, 448–454. [CrossRef]
12.
Roberfroid, M.; Gibson, G.R.; Hoyles, L.; McCartney, A.L.; Rastall, R.; Rowland, I.; Wolvers, D.; Watzl, B.; Szajewska, H.;
Stahl, B.; et al. Prebiotic Effects: Metabolic and Health Benefits. Br. J. Nutr. 2010,104, S1–S63. [CrossRef]
13.
Neri-Numa, I.A.; Pastore, G.M. Novel Insights into Prebiotic Properties on Human Health: A Review. Food Res. Int.
2020
,
131, 108973. [CrossRef]
14.
Gibson, G.R.; Hutkins, R.; Sanders, M.E.; Prescott, S.L.; Reimer, R.A.; Salminen, S.J.; Scott, K.; Stanton, C.; Swanson, K.S.;
Cani, P.D.; et al.
Expert Consensus Document: The International Scientific Association for Probiotics and Prebiotics (ISAPP)
Consensus Statement on the Definition and Scope of Prebiotics. Nat. Rev. Gastroenterol. Hepatol.
2017
,14, 491–502. [CrossRef]
[PubMed]
15. Livesey, G. Tolerance of Low-Digestible Carbohydrates: A General View. Br. J. Nutr. 2001,85, S7–S16. [CrossRef] [PubMed]
16. Marteau, P.; Seksik, P. Tolerance of Probiotics and Prebiotics. J. Clin. Gastroenterol. 2004,38, S67–S69. [CrossRef]
17.
Caffall, K.H.; Mohnen, D. The Structure, Function, and Biosynthesis of Plant Cell Wall Pectic Polysaccharides. Carbohydr. Res.
2009,344, 1879–1900. [CrossRef]
18.
Beukema, M.; Faas, M.M.; de Vos, P. The Effects of Different Dietary Fiber Pectin Structures on the Gastrointestinal Immune
Barrier: Impact via Gut Microbiota and Direct Effects on Immune Cells. Exp. Mol. Med. 2020,52, 1364–1376. [CrossRef]
19.
Luis, A.S.; Briggs, J.; Zhang, X.; Farnell, B.; Ndeh, D.; Labourel, A.; Baslé, A.; Cartmell, A.; Terrapon, N.; Stott, K.; et al. Dietary
Pectic Glycans Are Degraded by Coordinated Enzyme Pathways in Human Colonic Bacteroides. Nat. Microbiol.
2018
,3, 210–219.
[CrossRef]
20.
Muthai, K.U.; Karori, M.S.; Muchugi, A.; Indieka, A.S.; Dembele, C.; Mng’omba, S.; Jamnadass, R. Nutritional Variation in Baobab
(Adansonia digitata L.) Fruit Pulp and Seeds Based on Africa Geographical Regions. Food Sci. Nutr.
2017
,5, 1116–1129. [CrossRef]
[PubMed]
21.
Garvey, R.; Clegg, M.; Coe, S. The Acute Effects of Baobab Fruit (Adansonia digitata) on Satiety in Healthy Adults. Nutr. Health
2017,23, 83–86. [CrossRef] [PubMed]
Microorganisms 2021,9, 1981 13 of 14
22.
Coe, S.A.; Clegg, M.; Armengol, M.; Ryan, L. The Polyphenol-Rich Baobab Fruit (Adansonia digitata L.) Reduces Starch Digestion
and Glycemic Response in Humans. Nutr. Res. 2013,33, 888–896. [CrossRef]
23.
Hernandez-Sanabria, E.; Vázquez-Castellanos, J.F.; Raes, J. In Vitro Ecology: A Discovery Engine for Microbiome Therapies. Nat.
Rev. Gastroenterol. Hepatol. 2020,17, 711–712. [CrossRef] [PubMed]
24.
Pérez-Burillo, S.; Molino, S.; Navajas-Porras, B.; Valverde-Moya, Á.J.; Hinojosa-Nogueira, D.; López-Maldonado, A.;
Pastoriza, S.
;
Rufián-Henares, J.Á. An in Vitro Batch Fermentation Protocol for Studying the Contribution of Food to Gut Microbiota Composi-
tion and Functionality. Nat. Protoc. 2021,16, 1–24. [CrossRef] [PubMed]
25.
Van den Abbeele, P.; Duysburgh, C.; Ghyselinck, J.; Goltz, S.; Berezhnaya, Y.; Boileau, T.; De Blaiser, A.; Marzorati, M. Fructans
with Varying Degree of Polymerization Enhance the Selective Growth of Bifidobacterium Animalis Subsp. Lactis BB-12 in the
Human Gut Microbiome In Vitro. Appl. Sci. 2021,11, 598. [CrossRef]
26.
Van den Abbeele, P.; Kamil, A.; Fleige, L.; Chung, Y.; De Chavez, P.; Marzorati, M. Different Oat Ingredients Stimulate Specific
Microbial Metabolites in the Gut Microbiome of Three Human Individuals in Vitro. ACS Omega
2018
,3, 12446–12456. [CrossRef]
27.
Van den Abbeele, P.; Moens, F.; Pignataro, G.; Schnurr, J.; Ribecco, C.; Gramenzi, A.; Marzorati, M. Yeast-Derived Formulations
Are Differentially Fermented by the Canine and Feline Microbiome As Assessed in a Novel In Vitro Colonic Fermentation Model.
J. Agric. Food Chem. 2020,68, 13102–13110. [CrossRef]
28.
Van den Abbeele, P.; Verstrepen, L.; Ghyselinck, J.; Albers, R.; Marzorati, M.; Mercenier, A. A Novel Non-Digestible, Carrot-
Derived Polysaccharide (CRG-I) Selectively Modulates the Human Gut Microbiota While Promoting Gut Barrier Integrity: An
Integrated in Vitro Approach. Nutrients 2020,12, 1917. [CrossRef]
29.
De Weirdt, R.; Possemiers, S.; Vermeulen, G.; Moerdijk-Poortvliet, T.C.W.; Boschker, H.T.S.; Verstraete, W.; Van de Wiele, T.
Human Faecal Microbiota Display Variable Patterns of Glycerol Metabolism. FEMS Microbiol. Ecol.
2010
,74, 601–611. [CrossRef]
30.
Furet, J.-P.; Firmesse, O.; Gourmelon, M.; Bridonneau, C.; Tap, J.; Mondot, S.; Doré, J.; Corthier, G. Comparative Assessment
of Human and Farm Animal Faecal Microbiota Using Real-Time Quantitative PCR. FEMS Microbiol. Ecol.
2009
,68, 351–362.
[CrossRef]
31.
Rinttilä, T.; Kassinen, A.; Malinen, E.; Krogius, L.; Palva, A. Development of an Extensive Set of 16S RDNA-Targeted Primers for
Quantification of Pathogenic and Indigenous Bacteria in Faecal Samples by Real-Time PCR. J. Appl. Microbiol.
2004
,97, 1166–1177.
[CrossRef]
32.
Collado, M.C.; Derrien, M.; Isolauri, E.; de Vos, W.M.; Salminen, S. Intestinal Integrity and Akkermansia Muciniphila, a Mucin-
Degrading Member of the Intestinal Microbiota Present in Infants, Adults, and the Elderly. Appl. Environ. Microbiol.
2007
,73,
7767–7770. [CrossRef]
33.
Guo, X.; Xia, X.; Tang, R.; Zhou, J.; Zhao, H.; Wang, K. Development of a Real-Time PCR Method for Firmicutes and Bacteroidetes
in Faeces and Its Application to Quantify Intestinal Population of Obese and Lean Pigs. Lett. Appl. Microbiol.
2008
,47, 367–373.
[CrossRef]
34.
Metsalu, T.; Vilo, J. ClustVis: A Web Tool for Visualizing Clustering of Multivariate Data Using Principal Component Analysis
and Heatmap. Nucleic Acids Res. 2015,43, W566–W570. [CrossRef] [PubMed]
35.
Larsen, N.; Bussolo de Souza, C.; Krych, L.; Barbosa Cahú, T.; Wiese, M.; Kot, W.; Hansen, K.M.; Blennow, A.; Venema, K.;
Jespersen, L. Potential of Pectins to Beneficially Modulate the Gut Microbiota Depends on Their Structural Properties. Front.
Microbiol. 2019,10, 223. [CrossRef]
36.
Tingirikari, J.M.R. In-Vitro Prebiotic Analysis of Microbiota Accessible Pectic Polysaccharides. Curr. Microbiol.
2019
,76, 1452–1460.
[CrossRef] [PubMed]
37.
Rivière, A.; Selak, M.; Lantin, D.; Leroy, F.; De Vuyst, L. Bifidobacteria and Butyrate-Producing Colon Bacteria: Importance and
Strategies for Their Stimulation in the Human Gut. Front. Microbiol. 2016,7, 979. [CrossRef] [PubMed]
38.
Davila, A.-M.; Blachier, F.; Gotteland, M.; Andriamihaja, M.; Benetti, P.-H.; Sanz, Y.; Tomé, D. Intestinal Luminal Nitrogen
Metabolism: Role of the Gut Microbiota and Consequences for the Host. Pharmacol. Res. 2013,68, 95–107. [CrossRef]
39.
Nowak, A.; Libudzisz, Z. Influence of Phenol, p-Cresol and Indole on Growth and Survival of Intestinal Lactic Acid Bacteria.
Anaerobe 2006,12, 80–84. [CrossRef] [PubMed]
40.
Kikugawa, K.; Kato, T. Formation of a Mutagenic Diazoquinone by Interaction of Phenol with Nitrite. Food Chem. Toxicol. Int. J.
Publ. Br. Ind. Biol. Res. Assoc. 1988,26, 209–214. [CrossRef]
41.
Reichardt, N.; Duncan, S.H.; Young, P.; Belenguer, A.; McWilliam Leitch, C.; Scott, K.P.; Flint, H.J.; Louis, P. Phylogenetic
Distribution of Three Pathways for Propionate Production within the Human Gut Microbiota. ISME J.
2014
,8, 1323–1335.
[CrossRef] [PubMed]
42.
Walter, J. Ecological Role of Lactobacilli in the Gastrointestinal Tract: Implications for Fundamental and Biomedical Research.
Appl. Environ. Microbiol. 2008,74, 4985–4996. [CrossRef]
43. Chatterjee, E.; Manuel, G.A.S. Effect of Fruit Pectin on Growth of Lactic Acid Bacteria. J. Probiotics Health 2016,4. [CrossRef]
44.
Afolabi, O.R.; Popoola, T.O.S. The Effects of Baobab Pulp Powder on the Micro Flora Involved in Tempe Fermentation. Eur. Food
Res. Technol. 2005,220, 187–190. [CrossRef]
Microorganisms 2021,9, 1981 14 of 14
45. Ng, S.K.C.; Hamilton, I.R. Lactate Metabolism by Veillonella Parvula. J. Bacteriol. 1971,105, 999–1005. [CrossRef]
46.
Duncan, S.H.; Louis, P.; Thomson, J.M.; Flint, H.J. The Role of PH in Determining the Species Composition of the Human Colonic
Microbiota. Environ. Microbiol. 2009,11, 2112–2122. [CrossRef]
47.
Le Bastard, Q.; Chapelet, G.; Javaudin, F.; Lepelletier, D.; Batard, E.; Montassier, E. The Effects of Inulin on Gut Microbial
Composition: A Systematic Review of Evidence from Human Studies. Eur. J. Clin. Microbiol. Infect. Dis.
2020
,39, 403–413.
[CrossRef] [PubMed]
