Content uploaded by Zhaofu Yang
Author content
All content in this area was uploaded by Zhaofu Yang on Sep 24, 2021
Content may be subject to copyright.
Systematic Entomology (2021), 46, 827– 838
Revisiting the evolution of Ostrinia moths with
phylogenomics (Pyraloidea: Crambidae: Pyraustinae)
ZHAOFU YANG1,2, DAVID PLOTKIN3,4, JEAN-FRANÇOIS
LANDRY5, CAROLINE STORER3andAKITO Y. KAWAHARA3,4
1Key Laboratory of Plant Protection Resources and Pest Management, Ministry of Education, Northwest A&F University, Yangling,
China, 2Entomological Museum, College of Plant Protection, Northwest A&F University, Yangling, China, 3McGuire Center for
Lepidoptera and Biodiversity, Florida Museum of Natural History, University of Florida, Gainesville, FL, U.S.A., 4Entomology and
Nematology Department, University of Florida, Gainesville, FL, U.S.A. and 5Agriculture and Agri-Food Canada, Ottawa Research
and Development Centre, Ottawa, ON, Canada
Abstract. Reconstructing a robust phylogenetic framework is key to understanding
the ecology and evolution of many economically important taxa. The crambid moth
genus Ostrinia contains multiple agricultural pests, and its classication and phylogeny
has remained controversial because of the paucity of characters and the lack of
clear morphological boundaries for its species. To address these issues, we inferred a
molecular phylogeny of Ostrinia using a phylogenomic dataset containing 498 loci and
115 197 nucleotide sites and examined whether traditional morphological characters
corroborate our molecular results. Our results strongly support the monophyly of one
of the Ostrinia species groups but surprisingly do not support the monophyly of the
other two. Based on the extensive morphological examination and broadly representative
taxon sampling of the phylogenomic analyses, we propose a revised classication of
the genus, dened by three species groups (Ostrinia nubilalis species group, Ostrinia
obumbratalis species group, and Ostrinia penitalis species group), which differs from
the traditional classication of Mutuura & Munroe (1970). Morphological and molecular
evidence reveal the presence of a new North American species, Ostrinia multispinosa
Yang sp.n., closely related to O.obumbratalis. Our analyses indicate that the Ostrinia
ancestral larval host preference was for dicots, and that O.nubilalis (European corn
borer) and Ostrinia furnacalis (Asian corn borer) independently evolved a preference
for feeding on monocots (i.e., maize). Males of a few Ostrinia species have enlarged,
grooved midtibiae with brush organs that are known to attract females to increase mating
success during courtship, which may represent a derived condition. Our study provides
a strong evolutionary framework for this agriculturally important insect lineage.
Introduction
The genus Ostrinia Hübner, 1825, with 23 species and 35
described subspecies worldwide, has been the subject of exten-
sive study (Mutuura & Munroe, 1970; Ohno, 2003; Frolov
et al., 2007; Leraut, 2012) owing to the inclusion of several
major agricultural pests, such as the European corn borer
(Ostrinia nubilalis (Hübner, 1796)), the Asian corn borer
Correspondence: Zhaofu Yang, Key Laboratory of Plant Protec-
tion Resources and Pest Management, Ministry of Education, College
of Plant Protection, Northwest A&F University, 3 Taicheng Road, Yan-
gling, 712100, Shaanxi, China. E-mail: yangzhaofu@nwsuaf.edu.cn
(Ostrinia furnacalis (Guenée, 1854)) and the Adzuki bean
borer (Ostrinia scapulalis (Walker, 1859)). European corn
borer is one of the most devastating pests of maize (Zea mays
L.) and, in the eastern United States, it has been responsi-
ble for yield losses exceeding $1 billion annually (Mason
et al., 1996). The high rate of Asian corn borer infestation
causes heavy damage in corn and other crops in south-east Asia
and Australia, with 10–30% corn yield reduction in China and
the Philippines (Zhou et al., 1995; Yorobe & Quicoy, 2006),
while Adzuki bean borer is a dicot-feeding pest of hops
(Humulus lupulus, Cannabaceae), hemp (Cannabis sativa,
Cannabaceae) and legumes (Vigna sp., Fabaceae), and it occurs
© 2021 The Royal Entomological Society 827
828 Z. Yang et al.
in sympatry with both maize-feeding species across Eurasia
(Frolov et al., 2007).
Despite containing some of the most devastating insect pest
species worldwide, the classication of Ostrinia remains largely
untested. Species boundaries, phylogenetic relationships within
and among species groups, and the validity of subgroups remain
unclear (Kim et al., 1999; Frolov et al., 2007, 2012; Lassance
et al., 2013). The classication that has been generally accepted
until now was rst proposed by Mutuura & Munroe (1970),
and it was based on differences in morphology of the male
genitalia and male midtibia. These authors divided the genus
into three species groups: the ‘rst species group’ consists of
a single North American species, Ostrinia penitalis (Grote),
and is characterized by a dorsally trid juxta and unarmed
sacculus. The ‘second species group’ includes nine species,
geographically ranging from North America to Africa, Siberia
and East Asia, which possess an uncus that is either simple or
bid and a sacculus with dorsal spines. The ‘third species group’
consists of 10 species with a trilobate uncus and dorsally spined
sacculus, and with distribution limited to Europe, northwestern
Africa, Asia and neighboring islands. They further subdivided
the third group into three subgroups based on differences in the
morphology of the male midtibia.
Although the classication of Mutuura & Munroe (1970) has
widely been adopted, evidence suggests that the classication
may need to be changed. For example, Frolov (1981, 1984)
used genetic crossing experiments by examining representatives
of the three subgroups of the ‘third species group’ (Ostrinia
narynensis,O.nubilalis and O.scapulalis) to show that over-
all size of the male midtibia (small, medium or large) may be a
polymorphic trait with phenotypic variation, implying that the
division of subgroups based on male midtibial morphology is
unreliable. Frolov et al. (2007) proposed that Ostrinia orien-
talis Mutuura & Munroe, 1970 and O.narynensis Mutuura &
Munroe, 1970, which were originally placed in the rst subgroup
and the second subgroup by Mutuura and Munroe, respectively,
be synonymized with O.scapulalis (Walker, 1859) in the third
subgroup. From a taxonomic standpoint, Ostrinia remains one
of the most problematic groups in terms of species delineation
within Pyraustinae.
There have been a few phylogenetic studies conducted on
Ostrinia, but all have their limitations on either gene or taxon
sampling. Based on partial mitochondrial COII gene fragments
from eight representatives of two groups, Kim et al. (1999)
supported that the ‘second species group’ is sister to the ‘third
species group’. The sister-group relationship recovered between
the ‘second’ and the ‘third’ species groups was later supported
by Yang et al. (2011) based on a single-locus mitochondrial
COI analysis, and by Lassance et al. (2013) who performed a
multilocus analysis using COI and four nuclear genes (EF-1𝛼,
MDH,IDH,RpS5). However, the phylogenetic relationships
of the genus Ostrinia were not condently resolved in these
studies due to limited gene and taxon sampling, especially in
the ‘rst species group’. The study of Zhou et al. (2020), based
on mitogenomes, showed that Ostrinia palustralis,whichwas
classied as part of Mutuura and Munroe’s second species
group, may be the sister lineage to the remaining two species
groups. However, the study of Zhou et al. (2020) included
only six of the 23 described Ostrinia species. Thus, a full
understanding of the phylogenetic relationships could not be
achieved.
An important aspect of the evolution of Ostrinia is their
larval host plant associations. European corn borer and Asian
corn borer preferentially feed on maize, but Adzuki bean borer
and the remaining Ostrinia species mostly feed on dicots
(Frolov et al., 2007, 2012). This has led to the hypothesis
that the ancestral condition of Ostrinia larval feeding diet was
a dicot, and that host preferences shifted to monocots over
time (Alexandre et al., 2013; Bourguet et al., 2014). Resolving
phylogenetic relationships of Ostrinia is critical in order to
understand how these pest species evolved their ability to
become severe crop pests. An evolutionary analysis of larval
host plants in Ostrinia has yet to be formally conducted.
Here, we use anchored hybrid enrichment (AHE) of 498 loci
and close to two-thirds of the known Ostrinia species to resolve
its phylogenetic relationships, revise its classication and exam-
ine the evolution of larval host plant feeding. Specically, we
assemble AHE data for a phylogenomic analysis of Ostrinia in
order to (i) test the monophyly of the three species groups rec-
ognized by Mutuura & Munroe (1970); (ii) clarify whether the
‘rst species group’ is sister to a clade containing the other two
groups; (iii) understand the evolution of host plant associations
and morphological characters used to dene species groups and
subgroups.
Materials and methods
Taxon and gene sampling
We recovered DNA from 15 species Ostrinia (Table S1),
representing 65.2% of all described species. No DNA was
recovered from the samples of Ostrinia kurentzovi Mutuura
& Munroe, 1970; O.narynensis Mutuura & Munroe, 1970;
Ostrinia sanguinealis (Warren, 1892). Sequences of Ostrinia
dorsivittata (Moore, 1888) and Ostrinia erythrialis (Hamp-
son, 1913) were excluded due to high incidence of potential
cross-contamination. Four species such as Ostrinia avari-
alis Amsel, 1970; Ostrinia maysalis Leraut, 2012; Ostrinia
ovalipennis Ohno, 2003; Ostrinia putzufangensis Mutuura &
Munroe, 1970 could not be obtained for DNA sequencing.
Eight outgroups were sampled, including six newly sequenced
in this study and two from previous studies: seven from the
family Crambidae (six Pyraustinae and one Spilomelinae) and
one from the family Pyralidae (Bazinet et al., 2013; St Laurent
et al., 2018). Samples were dissected for identication based
on male genital features and compared with material deposited
in the Canadian National Collection of Insects, Arachnids and
Nematodes (CNC), as this collection has particularly strong
representation of the genus Ostrinia, including 43 types deter-
mined by specialists such as E. G. Munroe and A. Mutuura.
Genitalia preparation and photography followed Landry (2007)
and Yang et al. (2012), whereas genital terminology followed
Kristensen (2003). Tissue samples for DNA extraction are
© 2021 The Royal Entomological Society, Systematic Entomology,46, 827– 838
Revisiting the evolution of Ostrinia moths 829
preserved at the McGuire Center for Lepidoptera and Bio-
diversity, Florida Museum of Natural History, Gainesville,
Florida, U.S.A. and the Entomological Museum, Northwest
A&F University, Yangling, Shaanxi, China.
AHE, DNA extraction, sequencing and alignments
We used AHE phylogenomics to resolve relationships of
Ostrinia. AHE uses DNA probes designed to capture hun-
dreds of informative orthologous loci throughout the genome
(Lemmon et al., 2012). Across Lepidoptera, it has shown great
promise to resolve both shallow- and deep-level relationships
among species (Hamilton et al., 2016; Breinholt et al., 2018;
Johns et al., 2018; St Laurent et al., 2018; Espeland et al., 2019;
Kawahara et al., 2019; Carvalho et al., 2020; St Laurent
et al., 2020).
Genomic DNA was extracted from whole abdomens, before
removing the genitalia for dissection, using the OmniPrep
Genomic DNA Extraction Kit (G-Biosciences, St. Louis, MO,
U.S.A.). DNA concentration was quantied using a Qubit 2.0
uorometer and dsDNA BR Assay Kit (Invitrogen, Thermo
Fisher Scientic, Carlsbad, CA, U.S.A.). The LEP1 Agilent
Custom SureSelect probe set was used to target 855 loci across
Lepidoptera (Breinholt et al., 2018). Pooled library preparation,
hybridization enrichment and Illumina HiSeq 2500 sequencing
(PE150) were carried out by RAPiD Genomics (Gainesville, FL,
U.S.A.).
Data were processed following the pipeline described in
Breinholt et al. (2018). Briey, raw Illumina reads were
ltered for quality and trimmed with ! v. 0.4.0
(Krueger, 2015). Loci were assembled from matched reads pass-
ing quality ltering using Bombyx mori reference sequences
and iterative baited assembly (IBA.py; Breinholt et al. 2018),
which employs v. 7.0 (Edgar, 2010) and v.
2014-12-01 (Chang et al., 2015). Orthologous and single-copy
probe regions were determined by mapping reads to the B.mori
genome. Sequencing contamination was identied and removed
using (Camacho et al., 2009) and the custom python
script, contamination_lter.py (Breinholt et al., 2018). The
resulting probe regions were aligned with v.7.245 (Katoh
& Standley, 2013) and any remaining isoforms were collapsed
into 50% consensus sequences using FASconCAT-G_v1.02
with the parameters ‘-c -c -c -o -s’ (Kück & Longo, 2014).
v.1.18.1 was used to check probe regions for any
stop codons, indels and alignment errors and to correct reading
frames (Larsson, 2014). Targeted loci that were successfully
captured and were present in at least 12 of the 15 ingroup taxa
(80%) were concatenated into a single aligned dataset with
F-G v1.02 and used for phylogenomic analyses. The
raw data for newly generated AHE sequences, the concatenated
nucleotide alignment (Data S1) and the individual locus align-
ments are provided as supplementary materials on (doi:
10.5061/dryad.wwpzgmsj5). The raw sequence data that
support the ndings of this study are available in GenBank
of the National Center for Biotechnology Information at
https://www.ncbi.nlm.nih.gov (Bioproject PRJNA722535).
The associated SRA data accession numbers are provided in
Table S1.
Phylogenomics
The dataset was partitioned by gene and codon position (Data
S2). To obtain the most likely tree, this partitioning scheme
was used for 100 tree searches in - v. 1.5 (Nguyen
et al., 2015). Substitution model selection and merging of par-
titions (Data S3) were done in - with the ‘MFP +merge’
option (Kalyaanamoorthy et al., 2017). Nodal support of the
(ML) tree was estimated with 1000 ultra-
fast bootstrap replicates (; Minh et al., 2013) and
1000 replicates of the SH-like approximate likelihood ratio test
(-; Guindon et al., 2010), and the ‘bnni’ option was
used to reduce the risk of overestimating branch supports due
to severe model violations. When discussing branch support, we
refer to ‘strong support’ as relationships that have both
≥95 and - ≥80.
Coalescent-based species-tree methods
To account for possible effects of independent gene histories
and incomplete lineage sorting, species tree estimation was per-
formed under the multi-species coalescent model in -III
v. 5.5 (Zhang et al., 2018) from each individual gene. This
method uses gene trees as input and attempts to optimize
the species tree as the topology with the largest number of
induced quartet trees from the gene tree pool. Each maximum
likelihood gene tree was generated using the default settings
in -. The single-locus datasets were not partitioned by
codon position, and a single substitution model was selected
in each individual analysis by implementing
(Kalyaanamoorthy et al., 2017) in -. One likelihood
search was done on each single-locus dataset; in all analyses,
- performed at least 100 iterations before completing the
tree search. The resulting gene trees were subsequently input
into , which was run using default settings. Support
values on the topology (Data S4) are given as local
posterior probabilities (LPP; Sayyari & Mirarab, 2016).
Character evolution
Ancestral state reconstructions (ASRs) were performed on
the best tree (Data S5) from the analysis. To study the
evolution of Ostrinia larval host plant associations, we obtained
host plant records from published Ostrinia literature (Mutuura
& Munroe, 1970; Ishikawa et al., 1999) and scored these data
as two binary characters (Table S2). For the rst ASR host
plant analysis, we scored species as either feeding on only
dicots or feeding on both dicots and monocots; there are no
Ostrinia known to feed only on monocots. Since species that
feed on both monocots and dicots often have a preference for
one over the other, a second analysis was performed in which
© 2021 The Royal Entomological Society, Systematic Entomology,46, 827– 838
830 Z. Yang et al.
Fig. 1. Maximum likelihood tree of Ostrinia estimated in - using the anchored hybrid enrichment dataset. Support values are /-.
Nodes of importance are numbered in bold. The ancestral state reconstructions (ASRs) of larval host plant associations are represented as pies on
ingroup nodes. The ASRs of the male midtibiae are indicated with capital letters following tip labels as follows: (L) enlarged, (S) small.
each species was scored as preferring either monocots or dicots.
We distinguish between these two ASR analyses in later parts of
the text by referring to the former as ‘host association’ and the
latter as ‘host preference’. Host records for four species, Ostrinia
marginalis,Ostrinia multispinosa,Ostrinia peregrinalis and
Ostrinia quadripunctalis, are unknown and those species were
treated as having missing data. We also performed ASRs to
study the evolution of four morphological characters that are
historically important for Ostrinia classication: size of the male
midtibia, shape of the uncus, presence of spines on the sacculus
and shape of the juxta (Table S2, Figs. 1 and 2).
All ASR analyses were conducted using stochastic character
mapping, with the ‘make.simmap’ command in the package
v06-99 (Revell, 2012). The ‘SYM’ option was used
to treat forward and reverse character state transitions as having
equal rates. One thousand stochastic maps were generated for
each ASR analysis.
Results
Sequence capture and phylogenetic results
AHE captured 830 out of 855 loci from 15 species of Ostrinia.
We selected all loci (498/830) that were present at least12 out of
15 ingroups, resulting in a concatenated total length of 115 197
nucleotide sites and an average locus length of 231bp. All of
these loci were also represented by at least 3 out of 8 outgroups,
for a total of at least 17 species per locus.
Both (Fig. 1) and (Fig. S1) analyses of the
concatenated dataset recovered the genus Ostrinia as mono-
phyletic with strong bootstrap support (Node 1 in Fig. 1,
=100/- =100; LPP =100) and as the sister
group to the Pyraustinae outgroups. Within Ostrinia,the
analyses strongly supported the denition of three monophyletic
species groups (Nodes 2, 6, 8; =100/- =100;
=99/- =97; =100/- =100).
The Ostrinia obumbratalis species group (Clade I), con-
sisting of four taxa from Mutuura & Munroe’s ‘second
species group’, was recovered as sister to other Ostrinia
in both the (LPP =100) and trees (Node 2,
=100/- =100). The O.penitalis species group
(Clade II) currently includes O.penitalis, the only member of
the ‘rst species group’ sensu Mutuura & Munroe (1970) and
Ostrinia latipennis (formerly of the ‘second species group’)
with strong nodal support in both the (LPP =98)
and trees (Node 6; =99/- =97). The
clade consists of O.quadripunctalis +(Ostrinia kasmirica +all
members of the ‘third species group’), dened here as the
O.nubilalis species group (Clade III), was recovered as a
well-supported monophyletic group in the genus with strong
nodal support in both the (LPP =100) and trees
© 2021 The Royal Entomological Society, Systematic Entomology,46, 827– 838
Revisiting the evolution of Ostrinia moths 831
Fig. 2. Male genital characters of Ostrinia spp.
(Node 8; =100/- =100). Topological conicts
between the and trees occurred among relationships
within Ostrinia where relationships were characterized by low
branch support from both methods.
The ‘second species group’ recognized by Mutuura &
Munroe (1970) was recovered as paraphyletic in the
and analyses based on our phylogenomic data. Two
members (O.kasmirica,O.quadripunctalis) of the ‘second
species group’ were grouped with the O.nubilalis species
group (Clade III). In addition, one of the sampled taxa in
our dataset, originally recognized as O.obumbratalis PS1
in Yang et al. (2016), is now believed to be a new species,
O.multispinosa sp.n., that is sister to O.obumbratalis (the
‘second species group’) in both the (LPP =100) and
trees (Node 4, =100/- =100). It was
previously shown to have signicant COI barcode divergence
compared to O.obumbratalis (Yang et al., 2016). In the present
study, we found additional morphological differences to justify
treating O.multispinosa as distinct from O.obumbratalis (see
Classication section).
The ‘third species group’ with trilobed uncus as dened by
Mutuura & Munroe (1970) was recovered as monophyletic with
strong nodal support in both the (LPP =100) and
trees (Node 10, =100/- =100), which is consis-
tent with previous studies based on morphological and molecu-
lar data. In contrast, all three subgroups recognized by Mutuura
& Munroe (1970) based on male midtibia differences were
not recovered as monophyletic in either the or the
trees. These relationships were poorly supported in the
tree. In contrast, some branches in the tree received strong
support, which largely agree with previous DNA-based stud-
ies. Despite the relationships between the taxa not being fully
resolved (e.g., Nodes 12 and 13, <95/- <80),
O.furnacalis (the ‘rst subgroup’) was sister to Ostrinia zealis
(the ‘third subgroup’) and O.orientalis (the ‘rst subgroup’) was
sister to O.scapulalis (the ‘third subgroup’) with high nodal
support (Node 11, =100/- =60.0; Node 14,
=99/- =95.0) in our tree. The lowest support
value was found at Node 13. Ostrinia zaguliaevi, a species with a
strongly dilated midtibia and massive scales in the groove placed
within the ‘third subgroup’ by Mutuura & Munroe (1970), was
sister to all remaining members of the ‘third species group’ but
with low nodal support (Node 12, =71/- =41.0)
in our tree. These results suggested that the subgroup divi-
sions of Mutuura & Munroe (1970) are not supported. Two
important pests, O.furnacalis and O.nubilalis, were not sister
taxa, suggesting that similarities in phenotype, ecological niche
and host plant (maize) may be the result of convergence. Fur-
thermore, the position of O.scapulalis was congruent with other
studies that showed that polymorphism of male midtibia mor-
phology may lead to improper species groupings.
Character evolution
Our ASR analysis of Ostrinia larval host plant associations
(Node 1 in Figs 1, S2) showed a 52% probability that the
ancestral Ostrinia was associated only with dicots, only slightly
greater than the 48% probability of association with both dicots
and monocots. This margin was too small to conclusively
state that dicot association is the true ancestral state, but if it
was true, the results throughout the rest of the tree (Fig. S2)
would indicate at least three separate shifts to association with
both dicots and monocots, and three reversals to dicots only
(O.kasmirica,O.latipennis and O.orientalis). Host data were
missing for O.marginalis,O.multispinosa,O.peregrinalis and
O.quadripunctalis. Although the abovementioned analysis of
general host associations did not condently resolve the status
of the ancestral node, the subsequent ASR analysis that was
restricted to each species’ preferred host (Fig. S3) was much
more conclusive, showing a 95% probability that the ancestral
larval host preference of Ostrinia was a dicot.
The ASR analysis of male midtibia size (Fig. S4) showed
a 97% probability that the ancestral state was ‘small’, with
separate shifts to ‘enlarged’ midtibiae for three species:
O.scapulalis,O.zaguliaevi and O.zealis. The ASR analysis
of uncus shape (Fig. S5) showed an over 99.9% probability
that the ancestral state was ‘simple’ in the genus, with one
© 2021 The Royal Entomological Society, Systematic Entomology,46, 827– 838
832 Z. Yang et al.
independent shift to ‘bifurcated’ in O.marginalis, and a single
shift to ‘trilobed’ in the ‘third species group’. The ASR analysis
of the sacculus (Fig. S6) showed an over 99.9% probability
that the ancestral Ostrinia sacculus was spined, with loss of
spines in O.penitalis. The ASR analysis of the juxta (Fig. S7)
showed a 52% probability that the ancestral state was ‘two
V-shaped sclerites’, with a loss of anterior sclerites in the
O.obumbratalis species group (Clade I) and a reversal to the
ancestral condition in O.peregrinalis. In the clade comprising
all the other species, there was an independent loss of anterior
sclerites in O.palustralis, and a single shift to the ‘trid’ state
in O.penitalis.
Discussion
Phylogenetic relationships
Our phylogenetic analyses recover Ostrinia as monophyletic
with strong support in both and topologies, which
is consistent with a recent study that recovered the genus as
reciprocally monophyletic based on mitogenomic data (Zhou
et al., 2020). Since only six other genera of the diverse subfamily
Pyraustinae are included as outgroups, further phylogenomic
studies with broader taxon sampling are needed to unequivocally
demonstrate the monophyly of Ostrinia. But this is beyond the
scope of the present study.
In the analyses, three major well-supported clades are
recognized within Ostrinia.TheO.obumbratalis species group
(Clade I) is recovered as sister to the rest of Ostrinia.TheO.
penitalis species group (Clade II) and the O.nubilalis species
group (Clade III) are both strongly supported monophyletic and
sister to each other. The morphology-based classication and
phylogenetic relationships of the genus, proposed by Mutuura
& Munroe (1970), are uncorroborated by our results. The
monophyly of the ‘rst’ and the ‘second’ species groups of
Mutuura & Munroe (1970) is not supported. In contrast, the
‘third species group’ is recovered as monophyletic with strong
support, although the relationships among the members within
the species group are not well resolved due to the rapid
radiation of the ‘third species group’. Further investigation
of this species group radiation will be helpful to shed more
light on the evolutionary history of Ostrinia. Our ndings
conrm that a classication of Ostrinia species based primarily
on male genitalia and midtibia features is problematic, as
was also revealed by other studies using mitochondrial and
nuclear makers (Kim et al., 1999; Yang et al., 2011; Lassance
et al., 2013; Zhou et al., 2020).
In our analyses, the O.obumbratalis species group (Clade I)
consists of three New World species (O.marginalis,O.multi-
spinosa sp.n.,O.obumbratalis) and Siberian O.peregrinalis,
was recovered as sister to the remainder of the genus, and the
relationships within this clade are well resolved with strong
nodal support for all nodes. In other words, these species may
constitute the most basal elements of the genus, which is incon-
sistent with previous studies based on morphological, multilocus
and mitogenomic data. Within this species group, O.marginalis
and O.peregrinalis are distributed in the boreal regions of
North America and the northwestern Palaearctic, respectively,
and represent a vicariant species pair. The dark colouration and
reduced eyes in size adapted to diurnal activity in paludicolous
habitats are likely synapomorphies for both species. Interest-
ingly, these two species differ in several characters of the male
genitalia such as the sacculus, juxta and most strikingly the
uncus (bid in O.marginalis, simple rounded in O.peregri-
nalis). Genetic evidence suggests that they are closely related
to each other despite their allopatry and appreciable difference
in male genitalia. Thus, phylogenetic relationships inferred from
conspicuous morphological criteria alone, even those involving
internal morphology, could be misleading.
It is worth noting that O.peregrinalis is represented in
our dataset by a pinned museum specimen collected over
180 years ago. This may be the oldest specimen from which
molecular data have been successfully obtained using AHE.
However, signicantly fewer loci were captured from this spec-
imen compared to others in the analysis. Its placement in the
O.obumbratalis species group is strongly supported in both
trees (Figs 1, S1), but future analyses should be conducted with
better quality specimens of O.peregrinalis that have less missing
data. Regardless, our success at extracting DNA from such an
old specimen is another example of the value that traditionally
curated museum collections provide to the scientic community.
The O.penitalis species group (Clade II) includes an allopatric
species pair, O.latipennis and O.penitalis, which are consis-
tently recovered as sister to each other with strong support in
our analyses. The Nearctic O.penitalis, the only representa-
tive of the ‘rst species group’ of Mutuura & Munroe (1970)
and thought to be one of the earliest branching lineages in the
genus, is not supported as sister to all other Ostrinia species.
Results from the present study support the hypothesis of Zhou
et al. (2020), who proposed that O.penitalis is not sister to all
other Ostrinia species. The other species O.latipennis, known
in Eastern Palaearctic and Oriental regions, is part of Mutuura
& Munroe’s ‘second species group’ and our results contradict
Mutuura & Munroe’s hypothesis on the phylogenetic placement
of this species.
For other members of the ‘second species group’, we nd
inconsistencies in the placement of O.palustralis,whichis
either sister to the O.nubilalis species group (Clade III) in the
tree or sister to the O.penitalis species group (Clade II) in the
analysis (Fig. S1). Further investigation of the placement
of O.palustralis, which is not dened in this study, should be the
focus of future work. In addition, two former members of the
‘second species group’, O.kasmirica and O.quadripunctalis,
are here assigned to the O.nubilalis species group, contradicting
previous studies that found alternative placements of these
species based on morphological and limited mitochondrial DNA
sequences. Therefore, our analyses strongly support that the
‘second species group’ is paraphyletic, rather than monophyletic
as proposed by Mutuura & Munroe (1970).
The O.nubilalis species group (Clade III) is the most diverse
species group in the genus, including O.quadripunctalis +
(O.kasmirica +all members of the ‘third species group’).
We nd several well-supported sister relationships among the
© 2021 The Royal Entomological Society, Systematic Entomology,46, 827– 838
Revisiting the evolution of Ostrinia moths 833
investigated taxa of the clade with strong support. For the
monophyletic ‘third species group’, our results do not support
the monophyly of the ‘rst subgroup’ and the ‘third subgroup’
as all sampled members of these two subgroups were highly
mixed. This result suggests that the relationships among species
revealed in the present study conrmed that the male midtibia
used in Mutuura & Munroe’s (1970) classication may not the
convincing criterion to dene subgroups (Frolov et al., 2007).
Additionally, our results show that O.zaguliaevi of the ‘third
subgroup’ constitutes the basal branch of the ‘third species
group’ and is sister to the remaining species. We conrm that O.
orientalis is closely related to O.scapulalis, and that both are
valid species that are characterized by morphological, biologi-
cal and genetic differences revealed in many studies (Ishikawa
et al., 1999; Fu et al., 2004; Yang et al. 2008, Yang et al., 2011;
Yang & Zhang, 2011), which disagrees with the treatment by
Frolov et al. (2007) who considered them synonymous. No
representatives of the ‘second subgroup’, namely O.kurentzovi
and O.narynensis, were available for the present study; there-
fore, the monophyly of the subgroup needs verication and its
sister-group relationship remains unclear. The taxonomic status
of these two species and other species missing in the present
study could not be veried and require further sampling. Thus,
the incongruence of phylogeny between morphological and
molecular data needs further investigation by searching for
convincing synapomorphies and new characters for dening
the species groups and subgroups based on more comprehen-
sive taxon sampling. Additional sampling efforts would be
helpful to clarify the status of O.scapulalis and its closest
relatives.
Character evolution
The most commonly recorded larval host plant association
of Ostrinia is with dicots, including the plant families Aster-
aceae, Fabaceae, Gingiberaceae, Moraceae, Polygonaceae, and
Solanaceae (Ishikawa et al., 1999). Although our analysis of
general host plant associations was not conclusive (Fig. S2), our
results show that the ancestral larval host preference of Ostrinia
is most likely a dicot (Fig. S3) and the majority of species
retained most of their ancestral host preference, which is in line
with the hypotheses proposed by Mally et al. (2019) and Léger
et al. (2021) that eudicotyledons are the ancestral host plants
of the ‘basal lineages’ (sensu Léger et al.) of Pyraustinae (i.e.,
Portentomorphini, Euclastini, Tetridia). However, a few species,
such as the two major polyphagous pests (European corn borer
and Asian corn borer) shifted their primary host plants to mono-
cots (e.g., Poaceae; Figs S2, S3). This result implies that these
two morphologically indistinguishable species likely diverged
recently in complete allopatry and shifted their host preference
to maize, supporting the hypothesis that this may have occurred
when its cultivation spread 500years ago in Europe and East
Asia (Gay, 1999; Coates et al., 2005; Malausa et al., 2007;
Calcagno et al., 2017). According to Léger et al. (2021), shifts
to monocots in the genus Ostrinia and other Pyraustinae are sec-
ondarily derived; this is corroborated by our results.
Our ASR analysis of male midtibia size (Fig. S4) shows
that the ancestral state was likely small and lacked male brush
organs, with three separate shifts to larger midtibiae with brush
organs. These brush organs are thought to be used in courtship,
where the male displays its brushes and emitting volatile
chemicals as female attractants to increase mating success
(Mallet, 1984; Birch et al., 1990; Wagner, 1991). A similar
pattern is found in some unrelated ‘lower’ Lepidoptera, such
as Hepialidae (Wagner, 1991). The calling behavior of males
attracting females may represent a derived condition restricted
to a few taxa in the ‘third species group’.
Male genitalia are often the most informative set of characters
to dene taxa and relationships across Lepidoptera, particularly
at the species level (Okagaki et al., 1955; Kristensen, 2003). Our
ASR analysis of the uncus (Fig. S5), a structure that has the func-
tion to grasp the female during copulation (Ogata et al., 1957;
Solis & Metz, 2011), indicates that the common ancestor of the
genus had a ‘simple’ uncus, whereas ‘bid’ and ‘trilobed’ unci
may represent character reversals rather than retained plesiomor-
phies. Our ASR analysis of the juxta (Fig. S7) is essentially
inconclusive, with two character states both found to have near
50% chances of being the ancestral state of the genus. The shape
of the juxta is perhaps a more rapidly evolving character rela-
tive to other aspects of Ostrinia genital morphology; this would
be consistent with the results of a previous study in which the
common ancestor of the basal Pyraustinae lineages (sensu Léger
et al., 2021) is characterized by three different states (Mally
et al. 2019). In O.penitalis, a unique ‘trid’ juxta with a long,
mid-dorsal lanceolate process is a secondary specialization,
which may be analogous to the anchor-shaped juxtal process in
Anania hortulata (Yang & Landry, 2019). Our ASR analysis of
the sacculus (Fig. S6) indicates that the ancestor of the genus
had a spined sacculus, with a secondary loss in O.penitalis.
Overall, our ndings show that Mutuura & Munroe’s (1970)
classication does not fully hold true. We therefore provide a
new classication of Ostrinia based on our phylogenetic results.
Revised classication of Ostrinia
Based on the extensive morphological examination and
broadly representative taxon sampling of the phylogenomic
results, we propose a new classication of Ostrinia,dened
by three species groups corresponding to Clades I, II and
III (Fig. 1), which differs signicantly in species group and
subgroup composition from those proposed by Mutuura &
Munroe (1970). Our results show that the ‘rst’ and the
‘second’ species groups of Mutuura & Munroe were not recov-
ered as monophyletic, whereas the ‘third species group’ was
recovered as monophyletic.
Ostrinia obumbratalis species group (Clade I in Fig. 1): This
species group consists of four species in our tree (O.marginalis,
O.multispinosa sp.n.,O.obumbratalis and O.peregrinalis).
The following male genitalia traits may be synapomorphic
for this species group: phallus with a single large cornutus,
juxta without anterior sclerites (except for O.peregrinalis
with two juxtal arms). Within this species group, we describe
© 2021 The Royal Entomological Society, Systematic Entomology,46, 827– 838
834 Z. Yang et al.
a new species, O.multispinosa, which is closely related to
O.obumbratalis. Moreover, O.peregrinalis is found in Siberia
and eastern Europe, whereas the other three species are Nearc-
tic. A fth species, the African O.erythrialis, should be placed
in this group based on male genital features.
Ostrinia penitalis species group (Clade II in Fig. 1): This
species group consists of two species in our tree (O.latipennis,
O.penitalis). The tongue-shaped uncus of the male genitalia
may be a synapomorphy for these species. The number of
cornuti in the phallus differs: O.penitalis has a single large
cornutus, like the species in the O.obumbratalis species group,
whereas O.latipennis has two cornuti, a state shared with the
O.nubilalis species group. O.penitalis occurs in the Nearctic
and the Neotropics, whereas O.latipennis occurs in Eastern
Palaearctic and Oriental regions. O.ovalipennis, reported from
Japan, is likely to belong in this species group based on the
similarity of the male genitalia.
Ostrinia nubilalis species group (Clade III in Fig. 1): This is
the most speciose of the three groups, containing 60.1% of all
Ostrinia species. In our tree, it is represented by O.kasmirica,
O.quadripunctalis and members of the ‘third species group’
sensu Mutuura & Munroe (1970). Diagnostic characters include
having two cornuti in the phallus and a V-shaped juxta with both
anterior and posterior arms. The ‘third species group’ is recov-
ered as a well-supported monophylum of this species group, and
it is dened by having a trilobed uncus. However, the further
subdivision by Mutuura & Munroe (1970) into three subgroups
based on male midtibia is not supported. Species within the O.
nubilalis species group are distributed all over the world without
a clear distributional pattern following phylogenetic relation-
ships. Although we could not include the following species
in our analysis, O.dorsivittata,O.kurentzovi,O.maysalis,O.
narynensis,O.putzufangensis, they likely belong in the trilobed
group within this species group (Node 10, Fig. 1). Ostrinia
sanguinealis was considered as the member of the ‘second
species group’ by Mutuura & Munroe (1970). Given some
morphological traits shared with the member of the O.nubilalis
species group, for example, juxta with two V-shaped sclerites
and phallus with two cornuti, we believe that this species should
be placed in this species group regardless of its unique strongly
bid uncus (an autapomorphic trait). This species seems closely
related to O.kasmirica, which is characterized by a weakly
bid uncus and a small anterior juxtal arm.
Ostrinia multispinosa Yang s p.n ov. (Fig. 3A– D)
http://ZooBank LSID: urn:lsid:zoobank.org:act:80AE57ED-
45E9-40C9-9AF6-5B163860B8E7
Type material examined. Holotype, ♂, United States: Florida,
Putnam County, nr. Interlachen, Hwy 310 between Hwys 315
& 19, N 29.76233∘W 81.84347∘, 19 m, 16.VI.2006, P. Hebert,
K. Pickthorn, J. deWaard, 2 UV traps (CNC) [white, printed].
Labelled, BOLD sample ID and process ID: 06-FLOR-0419,
LOFLA419-06. [yellow, printed]. Genitalia slide number:
BIOZY00076. ♂|BIOZY00076 [pale green, printed]; ‘HOLO-
TYPE|Ostrinia multispinosa|Yang 2020| by ZF Yang 2020’
[red, partly printed, partly handwritten]. Paratypes, 1♂,2♀:1♂,
United States: Florida, Putnam County, Etoniah Creek State
Forest, Preservation site, N 29.73920∘W 81.84355∘,36m,
17.VI.2006, P. Hebert, K. Pickthorn, J. deWaard, 3 UV traps
(CNC) [white, printed]. Labelled, BOLD sample ID and pro-
cess ID: 06-FLOR-0845, LOFLA845-06 [yellow, printed]; 1♀,
United States: North Carolina, Craven County, Croatan National
Forest, Swamp forest Powerline Junction, W. side Sunset Dr.,
Havelock, 5.VII.2005, J. Bolling Sullivan, UV-light trap (CNC)
[white, printed]. Labelled, BOLD sample ID and process ID:
06-NCCC-658, LNC658-06 [yellow, printed]. Genitalia slide
number: BIOZY00077. ♀|BIOZY00077 [pale green, printed];
1♀, United States: North Carolina, National Forest, Swamp
Forest E. Sunset Drive, Havelok. N 34.52018∘W 76.56409∘,
8.VIII.2005, J. Bolling Sullivan, UV trap (USNM) [white,
printed]. BOLD sample ID and process ID: 06-NCCC-864,
LNC864-06 [yellow, printed]. The paratypes are provisionally
held in the CNC, Ottawa, pending agreement with the CBG
regarding their nal deposition.
Diagnosis. This species is very similar to O.obumbratalis in
external appearance, but the forewing transverse markings and
dentate subterminal band are somewhat less dened. The main
differences are in the male genitalia: in O.multispinosa,the
uncus is apically truncated, the sacculus has four spines, and the
length ratio of spined to unspined saccular areas is ca. 1.0; in O.
obumbratalis, the uncus is rounded, the sacculus has 1– 3 spines,
and ratio of spined to unspined saccular areas is less than 1.0.
Description. Head with frons smoothly scaled, pale brown-
ish yellow. Vertex whitish buff, roughly scaled. Labial pal-
pus off-white ventrally, dark brown dorsally, rst and second
palpomeres oblique, third palpomere hidden at apex of sec-
ond palpomere, porrect, fuscous, pointed apically. Maxillary
palpus fairly prominent, dark brown. Haustellum base covered
with whitish buff scales. Antenna thickened in male, basal seg-
ment large, yellowish buff dorsally, sensory surface expanded,
densely pilose; antenna of female more slender, liform. Tho-
rax whitish buff dorsally, white laterally (below wings). Tegula
fulvous, suffused with fuscous scales basally. Legs whitish buff,
suffused with fuscous scales. Forewing slender; apex rather
angulate, termen evenly curved to tornus; ground color above
pale buff, suffused with fulvous scales at costa; basal area fus-
cous; antemedial spot and discocellular spot fulvous; postmedial
fascia and subterminal band fulvous; cilia whitish buff; discal
cell half length of wing. Hindwing broadly triangular; ground
color and postmedial and subterminal bands as on forewing,
cilia white; discal cell less than half as long as wing. Abdomen
whitish buff, each segment white-banded posteriorly.
Forewing length. Female, 12.09 ±0.45 mm (n=2); male,
10.71 ±0.23 mm (n=2).
Male genitalia. Tegumen trapezoidal. Uncus tongue-shaped,
somewhat wider than long, basal part broadened, truncate
distally, laterally and distally with very few setae. Juxta with
posterior sclerites V-shaped; anterior sclerites absent. Vinculum
ventrally of moderate width, triangular. Valva rather slender;
costal margin widened in middle section, without a tuft of
specialized scales near apex; cucullus distally narrowed; apex
rounded; ventral margin slightly rounded. Sella boot-shaped, its
dorsal lobe bearing 12–13 dorsally projected, at setae with
comblike apices; its ventral part bearing 11– 12 strong spines
© 2021 The Royal Entomological Society, Systematic Entomology,46, 827– 838
Revisiting the evolution of Ostrinia moths 835
Fig. 3. Ostrinia multispinosa sp.nov. (A) Holotype male (USA: Florida, specimen 06-FLOR-0419, forewing length =9.2mm). (B) Paratype female
(USA: North Carolina, specimen 06-NCCC-864, forewing length =12.5 mm). (C) Male genitalia (holotype genitalia slide BIOZY00076, CNC). (D)
Female genitalia (paratype genitalia slide BIOZY00077, CNC).
beyond ventral and basal margin. Sacculus about half width of
valva in mid-section, length ratio of spined to unspined saccular
part ca. 1.0; sclerotized ridge with four inwardly directed spines.
Phallus about four times as long as wide and tapered distally;
a single large cornutus with rounded tip, equal in length to
diameter of phallus, somewhat sinuous basally.
Female genitalia. Ovipositor shorter than Segment 8, with
densely setose lobes. Posterior apophysis short, bent. Eighth ter-
gite triangular, slightly wrinkled dorsally; anterior margin ven-
trad of apophysis somewhat excurved, with irregular edge. Ante-
rior apophysis about as long as Segment 8, with strengthening
bar at approximately halfway to the tip. Sterigma somewhat
triangular, enlarged anteroventrally, strongly concave dorsally
at base. Antrum cylindrical, sclerotized for a short distance;
a collar-like sclerite around ostium, then a cystoid tube for a
short distance. Inception of ductus seminalis on anterior end.
Ductus bursae about 4/5 the length of corpus bursae, membra-
nous, straight. Corpus bursae membranous, oval in outline, with
a slender rhomboidal signum, its anterior and posterior extrem-
ities extended into spinelike processes. Appendix bursae small,
membranous, oblong.
Barcode: A 658bp barcode was obtained from the holo-
type (BOLD sample ID and process ID: 06-FLOR-0419,
LOFLA419-06). Six autapomorphies shown in underlined bold
italics are located at nucleotide positions 38 T (thymidine), 364
C (cytosine), 368 A (adenine), 427 C (cytosine), 533 C (cyto-
sine), 601 C (cytosine), which are diagnostic substitutions from
other members of Ostrinia.
AACTTTATATTTTATTTTTGGAATTTGAAGAGGAATA
TTAGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTA
© 2021 The Royal Entomological Society, Systematic Entomology,46, 827– 838
836 Z. Yang et al.
GGAAATCCTGGATCATTAATTGGAGATGATCAAATTTA
TAACACAATTGTAACAGCCCATGCATTTATTATAATTTT
TTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAA
TTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGC
ATTCCCCCGAATAAATAATATAAGATTTTGAATACTTCC
TCCTTCATTAACTCTTTTAATTTCAAGAAGAATTGTTGA
AAATGGAGCAGGAACTGGTTGAACTGTTTATCCACCA
CTTTCATCTAATATTGCCCATAGTGGAAGTTCTGTAGA
TTTAGCTATTTTTTCATTACATTTAGCAGGTATTTCATCA
ATCTTAGGAGCAATTAATTTTATTACAACAATTATTAATA
TACGAATTAATGGAATATCATTTGATCAAATACCATTAT
TTGTATGAGCTGTAGGAATTACAGCATTACTATTATTAT
TATC TTTACCTG TATTAGCTG GTGC TATTACTATATTATT
AACAGATCGAAATTTAAACACATCATTTTTTGACCCA
GCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTC.
Host plant. Unknown.
Distribution. Known only from the southeastern United
States (Florida, North Carolina). It is generally sympatric with
O.obumbratalis in Florida and North Carolina. However, the
new species may occur primarily in scrub and coastal forest
based on its distributional range.
Etymology. The specic name is derived from the Latin words
multi (many) and spinosus (with spines), in reference to the
sacculus bearing four spines.
Supporting Information
Additional supporting information may be found online in
the Supporting Information section at the end of the article.
Data S1. Concatenated nucleotide supermatrix used for ML
phylogenetic analysis.
Data S2. List of gene boundaries within the supermatrix used
as input for merging partitions with IQ-TREE.
Data S3. Best scheme for merging partitions, as determined
by ModelFinder in IQ-TREE.
Data S4. ASTRAL tree of Ostrinia in Newick format used
to generate Fig. S1.
Data S5. Maximum likelihood tree in Newick format used
to generate Fig. 1.
Figure S1. ASTRAL tree of Ostrinia. Support values are
local posterior probabilities.
Figure S2. Ancestral state reconstruction of the evolution of
larval host plant associations (black =dicots; red =monocots
&dicots).
Figure S3. Ancestral state reconstruction of the evolu-
tion of primary larval host preference (black =monocots;
red =dicots).
Figure S4. Ancestral state reconstruction of the evolution of
the male midtibia (black =enlarged; red =small).
Figure S5. Ancestral state reconstruction of the evolu-
tion of the uncus (black =simple; red =bifurcated;
green =trilobed).
Figure S6. Ancestral state reconstruction of the evolution of
the sacculus (black =spined; red =unarmed).
Figure S7. Ancestral state reconstruction of the evolution
of the juxta (black =trid; red =anterior sclerites of
juxta absent; green =anterior and posterior sclerites both
V-shaped).
Tabl e S 1 Specimens sampled and included in the present
study for molecular analysis.
Tabl e S 2. Morphological character state matrix.
Acknowledgements
We are grateful to Leif Aarvik, Paul D. N. Hebert, Houhun Li,
Marko Mutanen, Gregory R. Pohl and Bo Wikström for pro-
viding freshly collected specimens. We thank Torbjørn Ekrem,
Daniel Handeld, Axel Hausmann, Derek Sikes and Patrick
Strutzenberger for permission to access their BOLD data.
Zhaofu Yang would like to thank many colleagues including
Jaret C. Daniels, John B. Heppner, Deborah M. Lott, Jacque-
line Y. Miller, Andrei Sourakov and Keith Willmott for assis-
tance during his visit to the McGuire Center for Lepidoptera and
Biodiversity. Special thanks to James E. Hayden for construc-
tive suggestions and his help to locate specimens and genitalia
slides in the MGCL collection. Lisa Bartels and Connor Lee
assisted Jean-François Landry with locating specimens and gen-
italia slides and databasing of Ostrinia in the CNC. We thank
Nan Zhou for assistance with photography of the genitalia at
NWAFU. This study was supported by the National Natural Sci-
ence Foundation of China (31772508) and NSF DBI #1349345
and DEB 1557007 to Akito Y. Kawahara. The authors acknowl-
edge University of Florida Research Computing for provid-
ing computational resources and support that contributed to the
research results reported in this publication. The authors declare
that there are no conicts of interest.
Author Contributions
Conceived the study: Zhaofu Yang, Akito Y. Kawahara. Con-
ceived and performed molecular analyses: Zhaofu Yang,
David Plotkin, Caroline Storer. Obtained morphological data:
Zhaofu Yang, Jean-François Landry. Wrote and/or edited the
manuscript: Zhaofu Yang, Jean-François Landry, David Plotkin,
Caroline Storer, Akito Y. Kawahara. Prepared illustrations:
Zhaofu Yang.
Data availability statement
NCBI Sequence Read Archive accession numbers are provided
in Table S1. The raw data for newly generated AHE sequences,
© 2021 The Royal Entomological Society, Systematic Entomology,46, 827– 838
Revisiting the evolution of Ostrinia moths 837
the concatenated nucleotide alignment, and the individual locus
alignments are provided as supplementary materials that are
available on DRYAD (doi:10.5061/dryad.wwpzgmsj5).
References
Alexandre, H., Ponsard, S., Bourguet, D., Vitalis, R., Audiot, P.,
Cros-Arteil, S. & Streiff, R. (2013) When history repeats itself:
exploring the genetic architecture of host-plant adaptation in two
closely related lepidopteran species. PLoS One,8, e69211.
Bazinet, A.L., Cummings, M.P., Mitter, K.T. & Mitter, C.W. (2013)
Can RNA-Seq resolve the rapid radiation of advanced moths and
butteries (Hexapoda: Lepidoptera: Apoditrysia)? An exploratory
study. PLoS One,8, e82615. https://doi.org/10.1371/journal.pone
.0082615.
Birch, M.C., Poppy, G.M. & Baker, T.C. (1990) Scent and eversible
scent structures of male moths. Annual Review of Entomology,35,
25– 58.
Bourguet, D., Ponsard, S., Streiff, R., Meusnier, S., Audiot, P., Li,
J. & Wang, Z.Y. (2014) ‘Becoming a species by becoming a pest’
or how two maize pests of the genus Ostrinia possibly evolved
through parallel ecological speciation events. Molecular Ecology,23,
325– 342.
Breinholt, J.W., Earl, C., Lemmon, A.R., Lemmon, E.M., Xiao, L. &
Kawahara, A.Y. (2018) Resolving relationships among the megadi-
verse butteries and moths with a novel pipeline for anchored phy-
logenomics. Systematic Biology,67, 78– 93.
Calcagno, V., Mitoyen, C., Audiot, P. et al. (2017) Parallel evolution of
behaviour during independent host-shifts following maize introduc-
tion into Asia and Europe. Evolutionary Applications,10, 881– 889.
Camacho, C., Coulouris, G., Avagyan, V., Ma, N., Papadopoulos,
J., Bealer, K. & Madden, T.L. (2009) BLAST+: architecture and
applications. BMC Bioinformatics,10, 421.
Carvalho, A.P.S., St Laurent, R.A., Toussaint, E.F.A., Storer, C., Dexter,
K., Aduse-Poku, K. & Kawahara, A.Y. (2020) Is sexual conict
a driver of speciation? A case study with a tribe of brush-footed
butteries. Systematic Biology,70, 413– 420. https://doi.org/10.1093/
sysbio/syaa070.
Chang, Z., Li, G., Liu, J. et al. (2015) Bridger: a new framework for de
novo transcriptome assembly using RNA-seq data. Genome Biology,
16, 30.
Coates, B.S., Sumerford, D.V., Hellmich, R.L. & Lewis, L.C. (2005)
Partial mitochondrial genome sequences of Ostrinia nubilalis and
Ostrinia furnicalis [sic]. International Journal of Biological Sciences,
1, 13– 18.
Edgar, R.C. (2010) Search and clustering orders of magnitude faster than
BLAST. Bioinformatics,26, 2460– 2461.
Espeland, M., Breinholt, J., Barbosa, E. et al. (2019) Four hundred
shades of brown: higher level phylogeny of the problematic Euptychi-
ina (Lepidoptera, Nymphalidae, Satyrinae) based on hybrid enrich-
ment data. Molecular Phylogenetics and Evolution,131, 116– 124.
https://doi.org/10.1016/j.ympev.2018.10.039.
Frolov, A.N. (1981) Genetic analysis of ‘large’ tibia – the taxonomic
character of brush-leg borer Ostrinia scapulalis Wlk. (Lepidoptera,
Pyraustidae). Genetika,17, 2160– 2166 [in Russian.].
Frolov, A.N. (1984) Biotaxonomic analysis of harmful species of the
genus Ostrinia Hbn. Ethologiya Nasekomykh, Trudy Vsesoyuznogo
Entomologitsheskogo Obshchestva,6, 4–100 [in Russian.].
Frolov, A.N., Audiot, P., Bourguet, D. et al. (2012) From Russia with
lobe: genetic differentiation in trilobed uncus Ostrinia spp. follows
food plant, not hairy legs. Heredity,108, 147–156.
Frolov, A.N., Bourguet, D. & Ponsard, S. (2007) Reconsidering the
taxomony of several Ostrinia species in the light of reproductive
isolation: a tale for Ernst Mayr. Biological Journal of the Linnean
Society,91, 49– 72.
Fu, X., Tabata, J., Takanashi, T. et al. (2004) Female sex pheromone of
Ostrinia orientalis – throwing a light on the relationship between O.
orientalis and the European corn borer, O.nubilalis.Chemoecology,
14, 175– 180.
Gay, J.-P. (1999) Maïs, mythe et réalité. Atlantica, Biarritz. 619 pp. [In
French.]
Guindon, S., Dufayard, J.F., Lefort, V., Anisimova, M., Hordijk,
W. & Gascuel, O. (2010) New algorithms and methods to esti-
mate maximum-likelihood phylogenies: assessing the performance of
PhyML 3.0. Systematic Biology,59, 307– 321.
Hamilton, C.A., Lemmon, A.R., Lemmon, E.M. & Bond, J.E. (2016)
Expanding anchored hybrid enrichment to resolve both deep and
shallow relationships within the spider tree of life. BMC Evolutionary
Biology,16, 212.
Ishikawa, Y., Takanashi, T., Kim, C.G., Hoshizaki, S., Sadahiro, T.
& Huang, Y.P. (1999) Ostrinia spp. in Japan: their host plants
and sex pheromones. Entomologia Experimentalis et Applicata,91,
237– 244.
Johns, C.A., Toussaint, E.F.A., Breinholt, J.W. & Kawahara, A.Y. (2018)
Origin and macroevolution of micro-moths on sunken Hawaiian
islands. Proceedings of the Royal Society B, Biological Sciences,285,
20181047. https://doi.org/10.1098/rspb.2018.1047.
Kalyaanamoorthy, S., Minh, B.Q., Wong, T.K.F., von Haeseler, A. &
Jermiin, L.S. (2017) ModelFinder: fast model selection for accurate
phylogenetic estimates. Nature Methods,14, 587– 589.
Katoh, K. & Standley, D.M. (2013) MAFFT multiple sequence align-
ment software version 7: improvements in performance and usability.
Molecular Biology and Evolution,30, 772– 780.
Kawahara, A.Y., Plotkin, D., Espeland, M. et al. (2019) Phyloge-
nomics reveals the evolutionary timing and pattern of butteries and
moths. Proceedings of the National Academy of Sciences, USA,116,
22657– 22663.
Kim, C.G., Hoshizaki, S., Huang, Y.P., Tatsuki, S. & Ishikawa, Y. (1999)
Usefulness of mitochondrial COII gene sequences in examining phy-
logenetic relationships in the Asian corn borer, Ostrinia furnacalis,
and allied species (Lepidoptera: Pyralidae). Applied Entomology and
Zoology,34, 405– 412.
Kristensen, N.P. (2003) Lepidoptera, Moths and Butteries. Walter de
Gruyter, Berlin & New York, NY.
Krueger, F. (2015) Trim Galore. A Wrapper Tool Around Cutadapt
and FastQC to Consistently Apply Quality and Adapter Trimming
to FastQ Files, www.bioinformatics.babraham.ac.uk/projects/trim_
galore/.
Kück, P. & Longo, G.C. (2014) FASconCAT-G: extensive functions for
multiple sequence alignment preparations concerning phylogenetic
studies. Frontiers in Zoology,11, 81.
Landry, J.-F. (2007) Taxonomic review of the leek moth genus Acrole-
piopsis (Lepidoptera: Acrolepiidae) in North America. The Canadian
Entomologist,139, 319–353.
Larsson, A. (2014) AliView: a fastand lightweight alignment viewer and
editor for large datasets. Bioinformatics,30, 3276– 3278.
Lassance, J.M., Lienard, M.A., Antony, B. et al. (2013) Functional
consequences of sequence variation in the pheromone biosynthetic
gene pgFAR for Ostrinia moths. Proceedings of the National Academy
of Sciences, USA,110, 3967– 3972.
Léger, T., Mally, R., Neinhuis, C. & Nuss, M. (2021) Rening the
phylogeny of Crambidae with complete sampling of subfamilies
(Lepidoptera, Pyraloidea). Zoologica Scripta,50, 84– 99.
Lemmon, A.R., Emme, S.A. & Lemmon, E.M. (2012) Anchored
hybrid enrichment for massively high-throughput phylogenomics.
Systematic Biology,61, 727– 744.
© 2021 The Royal Entomological Society, Systematic Entomology,46, 827– 838
838 Z. Yang et al.
Leraut, P.J.A. (2012, 599) Zygènes, Pyrales 1 et Brachodides. Papillons
de nuit d’Europe,Vol.3. N.A.P. Éditions, Verrières-le-Buisson. [In
French.].
Malausa, T., Leniaud, L., Martin, J.F. et al. (2007) Molecular differenti-
ation at nuclear loci in French host races of the European corn borer
(Ostrinia nubilalis). Genetics,176, 2343– 2355.
Mallet, J. (1984) Sex roles in the ghost moth Hepialus humuli (L.) and a
review of mating in the Hepialidae (Lepidoptera). Zoological Journal
of the Linnean Society,79, 67– 82.
Mally, R., Hayden, J.E., Neinhuis, C., Jordal, B.H. & Nuss, M. (2019)
The phylogenetic systematics of Spilomelinae and Pyraustinae (Lepi-
doptera: Pyraloidea: Crambidae) inferred from DNA and morphology.
Arthropod Systematics & Phylogeny,77, 141–204.
Mason, C.E., Rice, M.E., Calvin, D.D. et al. (1996) European corn
borer ecology and management. North Central Regional Extension
Publication No. 327. Iowa State University, Ames, IA.
Minh, B.Q., Nguyen, M.A. & von Haeseler, A. (2013) Ultrafast
approximation for phylogenetic bootstrap. Molecular Biology and
Evolution,30, 1188– 1195.
Mutuura, A. & Munroe, E. (1970) Taxonomy and distribution of
the European corn borer and allied species: genus Ostrinia (Lepi-
doptera: Pyralidae). Memoirs of the Entomological Society of Canada,
102(S71), 1– 112.
Nguyen, L.-T., Schmidt, H.A., von Haeseler, A. & Minh, B.Q. (2015)
IQ-TREE: a fast and effective stochastic algorithm for estimating
maximum-likelihood phylogenies. Molecular Biology and Evolution,
32, 268– 274.
Ogata, M., Okada, Y., Okagaki, H. & Sibatan, A. (1957) Male genitalia
of Lepidoptera: morphology and nomenclature III. Appendages per-
taining to the tenth somite. Annals of the Entomological Society of
America,50, 237– 244.
Ohno, S. (2003) A new knotweed-boring species of the genus Ostrinia
Hübner (Lepidoptera: Crambidae) from Japan. Entomological Sci-
ence,6, 77– 83.
Okagaki, H., Sibatan, A., Ogata, M. & Okada, Y. (1955) Male genitalia
of Lepidoptera: morphology and nomenclature II. Morphological
signicance of sacculus and furca. Annals of the Entomological
Society of America,48, 438– 442.
Revell, L.J. (2012) Phytools: an R package for phylogenetic comparative
biology (and other things). Methods in Ecology and Evolution,3,
217– 223.
Sayyari, E. & Mirarab, S. (2016) Fast coalescent-based computation of
local branch support from quartet frequencies. Molecular Biology and
Evolution,33, 1654– 1668.
Solis, M.A. & Metz, M.A. (2011) Male genital homology based on mus-
culature originating from the tegumen in snout moths (Lepidoptera:
Pyraloidea). Arthropod Structure & Development,40, 435–448.
St Laurent, R.A., Hamilton, C.A. & Kawahara, A.Y. (2018) Museum
specimens provide phylogenomic data to resolve relationships of
sack-bearer moths (Lepidoptera, Mimallonidae). Systematic Entomol-
ogy,42, 729–761. https://doi.org/10.1111/syen.12301.
St Laurent, R.A., Mielke, C.G.C., Herbin, D., Dexter, M. & Kawahara,
A.Y. (2020) A new target capture phylogeny elucidates the systemat-
ics and evolution of wing coupling in sack-bearer moths. Systematic
Entomology,45, 653– 669.
Wagner, D.L. (1991) Mating systems in primitive Lepidoptera, with
emphasis on the reproductive behaviour of Korscheltellus gra-
cilis (Hepialidae). Zoological Journal of the Linnean Society,102,
277– 303.
Yang, R.S., Wang, Z.Y. & He, K.L. (2011) Genetic diversity and
phylogeny of the genus Ostrinia (Lepidoptera: Crambidae) inhabiting
China inferred from mitochondrial COI gene. Journal of Nanjing
Agricultural University,34, 73– 80 (in Chinese).
Yang, Z.F. & Landry, J.-F. (2019) Allopatric separation represents an
overlooked cryptic species in the Anania hortulata species com-
plex (Lepidoptera: Crambidae: Pyraustinae): congruence between
genetic and morphological evidence. The Canadian Entomologist,
151, 163– 168.
Yang, Z.F., Landry, J.-F., Handeld, L. et al. (2012) DNA barcoding
and morphology reveal three cryptic species of Anania (Lepidoptera:
Crambidae: Pyraustinae) in North America, all distinct from their
European counterpart. Systematic Entomology,37, 686– 705.
Yang, Z.F., Landry, J.-F. & Hebert, P.D.N. (2016) A DNA barcode
library for north American Pyraustinae (Lepidoptera: Pyraloidea:
Crambidae). PLoS One,11, e0161449.
Yang, Z.F. & Zhang, Y.L. (2011) Comparison of ultrastructure among
sibling species of Ostrinia (Lepidoptera: Crambidae) from China. The
Canadian Entomologist,143, 126–135.
Yang, R.S., Wang, Z.Y., He, K.L. & Bai, S.X. (2008) Sequence analysis
of mtDNA-COII gene and molecular phylogeny of Ostrinia spp.
from China (Lepidoptera: Crambidae). Acta Entomologica Sinica,51,
182– 189.
Yorobe, J.M.J. & Quicoy, C.B. (2006) Economic impact of Bt corn in
The Philippines. The Philippine Agriculture Scientist,89, 258– 267.
Zhang, C., Sayyari, E. & Mirarab, S. (2018) ASTRAL-III: increased
scalability and impacts of contracting low support branches. Compar-
ative Genomics: 15th International Workshop, RECOMB CG 2017,
Barcelona, Spain, October 4– 6, 2017, Proceedings (ed. by J. Mei-
danis and L. Nakhleh), pp. 53– 75. Springer International Publishing,
Cham.
Zhou, D.R., He, K.L., Wang, Z.Y., Ye, Z.H., Wen, L.P., Gao, Y.X. &
Song, Y.Y. (1995) Asian Corn Borer and Its Integrated Management.
Golden Shield Press, Beijing.
Zhou, N., Dong, Y.L., Qiao, P.P. & Yang, Z.F. (2020) Complete
mitogenomic structure and phylogenetic implications of the genus
Ostrinia (Lepidoptera: Crambidae). Insects,11, 232.
Accepted 19 April 2021
© 2021 The Royal Entomological Society, Systematic Entomology,46, 827– 838
