Biodiversity & Evaluation: Perspectives and Paradigm shifts(2015) 247 GENETIC STRUCTURE AND MOLECULAR PHYLOGENY ANALYSIS OF ZICRONA CAERULEA USING COI GENE SEQUENCES

Abstract

For the past few years, DNA barcoding has become an efficient method for the identification of species. In this study we test the efficiency of DNA barcoding for true bug, Zicrona caerulea (Hemiptera: Heteroptera), an ecologically and economically important as well as morphologically diverse insect taxon. These bugs are useful predators of leaf beetles of the genus Altica, larvae of various beetles and caterpillars of moths, and it also feeds on plants. The study emphasizes the use of DNA barcodes for the identification of Zicrona caerulea and to represent an important step in building-up a comprehensive barcode library for the true bugs. As part of our study we analyzed DNA barcodes of Zicrona caerulea isolated from Kerala and its phylogenetic status with other related taxonomic groups. The PCR amplified cytochrome oxidase subunit I gene (COI) partial sequence of Zicrona caerulea has 1.11% difference to that of Zicrona caerulea (GenBank Accession: GQ292256) of Seoul, Korea and 1.68% difference to Zicrona caerulea (KM023126) Bremen, Germany.

Full text

Biodiversity & Evaluatio n: Perspectives and Paradigm shifts(2015)
247
GENETIC STRUCTURE AND MOLECULAR PHYLOGENY ANALYSIS OF
ZICRONA CAERULEA
USING COI GENE SEQUENCES
Priya Bhaskaran, K. P. and Sebastian, C. D
#
Molecular Biology Laboratory, Department of Zoology, University of Calicut, Kerala, India
Dr. Sebastian C. D., Department of Zoology, University of Calicut, Kerala, India
# drcdsebastian@gmail.com
Abstract
For the past few years, DNA barcoding has become an efficient method for the identification of
species. In this study we test the efficiency of DNA barcoding for true bug, Zicrona caerulea (Hemiptera:
Heteroptera), an ecologically and economically important as well as morphologically diverse insect taxon.
These bugs are useful predators of leaf beetles of the genus Altica, larvae of various beetles and caterpillars of
moths, and it also feeds on plants. The study emphasizes the use of DNA barcodes for the identification of
Zicrona caerulea and to represent an important step in building-up a comprehensive barcode library for the
true bugs. As part of our study we analyzed DNA barcodes of Zicrona caerulea isolated from Kerala and its
phylogenetic status with other related taxonomic groups. The PCR amplified cytochrome oxidase subunit I gene
(COI) partial sequence of Zicrona caerulea has 1.11% difference to that of Zicrona caerulea (GenBank
Accession: GQ292256) of Seoul, Korea and 1.68% difference to Zicrona caerulea (KM023126) Bremen,
Germany.
Keywords:
Zicrona caerulea , DNA barcoding, phylogenetic status, cytochrome oxidase subunit I gene
Introduction
Bug monitoring and control methods rely on timely and accurate identification of species present.
Proper identification of bug species is problematic, time-consuming and requires an expert taxonomist,
authenticated specimens, old literature, etc. Also nymphs and damaged specimen cannot be easily
assigned to proper species [1],[2].
The DNA barcoding aims at identifying organisms by assessing their degree of DNA sequence similarity to a set
of reference taxa. The standard sequence used for this purpose is the mitochondrial COI gene fragment
amplified by the "universal primers" and other primers [3]. DNA barcoding is generally considered as a reliable,
cost-effective and easy molecular identification tool with a wide applicability across metazoan taxa [4],[5]. As
such it would be very useful to routinely identify difficult taxa of economic and medical importance. This
particularly holds for many insect taxa that comprise large numbers of notorious pest species or disease vectors,
whose identification often requires highly specialized taxonomic skills. To analyze diversity among and within
species, molecular systematic provides an overview of molecular methods currently used. Precise determination
of closely related species, ecotypes or intraspecies variability can be done using DNA based taxonomy. This
complements with traditional methods for species description and identification. Due to its simple genome
structure, mitochondrial DNA is one of the most widely used molecular markers for phylogenetic studies in
animals [6].
Several studies showed that it is a reliable tool for the molecular identification of Lepidoptera [4],[7],
Hymenoptera [5],[8], Coleoptera[9] and Diptera species [10]. However, studies on the Hemiptera are lagging
behind inspite of its usefulness in phylogenetic analysis. Though mtDNA sequence data have proved valuable in
determining phylogenetic relationships, the choice of gene is also of great significance. [11]. First, the
universal prim
most, if not all, animal phyla [3],[12]. Second, COI appears to possess a greater range of phylogenetic signal
than any other mitochondrial gene. In common with other protein coding genes, its third-position nucleotides
show a high incidence of base substitutions, leading to a rate of molecular evolution that is about three times
greater than that of 12S or 16S rDNA. In fact, the evolution of this gene is rapid enough to allow the
discrimination of not only closely allied species, but also phylogeographic groups within a single species.
Although COI may be matched by other mitochondrial genes in resolving such cases of recent divergence, this
gene is more likely to provide deeper phylogenetic insights than alternatives such as cytochrome b because
changes in its amino acid sequence occur more slowly than those in this, or any other, mitochondrial gene.
Hence in this research activity we have given importance to sequence the COI gene sequence of the
economically important species which can serve as a molecular barcode for this species in future [2].
The experimental insect
, Zicrona caerulea
(Linnaeus, 1758), present in Eurasia and North America. They are
often called Stink-Bugs because they can produce a horrible smell. Most are phytophagous (feeding on plant
sap),but some are predacious, of the phytophagous species a few such as
Murgantia histrionica
, the Harlequin
bug are pests, in this case of cabbages and other related vegetable plants. When the eggs first hatch though the
young feed on the sap of the plants themselves, but then from their second instar onwards they are predacious.
They over-winter as adults, mostly in moss, or bark crevices. New adults of this univoltine species can be found
from July onwards [13].

Biodiversity & Evaluatio n: Perspectives and Paradigm shifts(2015)
248
Materials and Methods
The experimental insect,
Zicrona caerulea
(Stink-Bugs). The tissue from one of the thoracic legs was
homogenized and the extracted genomic DNA was isolated using Genomic DNA Purification Kit ( Origin).
Sequencing of genomic DNA
About 2 ng of genomic DNA was PCR amplified for mitochondrial cytochrome oxidase subunit I (COI) gene
using the forward primer with DNA sequence 5'-GGAATAGTAGGATCAGCAATAG -3' and reverse primer
with DNA sequence 5'- GGATCTCCTCCTCCTGAAGGATC -
TAE- agarose gel, for confirmation of the target gene amplification. After ascertaining the PCR amplification of
the corresponding COI fragment, the remaining portion of the PCR product was column purified using Mo Bio
UltraClean PCR Clean-up Kit (Mo Bio Laboratories, Inc. California). The purified PCR product was sequenced
at SciGenome Labs Private Ltd., Cochin. The forward and reverse sequences obtained were trimmed for the
primer sequences, assembled by using Clustal W and the consensus was taken for the analysis.
Phylogenetic analysis
The nucleotide sequence and peptide sequence were searched for its similarity using BLAST programme of
NCBI (www.ncbi.nlm.nih.gov/). The phylogenetic tree was plotted in neighbor joining method using MEGA 6
[14].
Results and Discussions
>
Zicrona caerulea
KERALA,Mitochondril cytochrome oxidase subunit I (COI)partial nucleotide
sequence,490 bases
TTTATTGGAGATGACCAAATTTATAATGTGGTAGTTACAGCTCATGCCTTTGTTATAATTTTCTTT
ATAGTTATACCAATTATAATTGGAGGATTTGGGAATTGACTAGTTCCTTTAATAATTGGAGCCCC
TGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGACTGTTACCCCCTTCATTAACACTCCT
AATAATTAGTAGATTAACAGAAGCAGGGGCCGGAACTGGGTGAACAGTTTATCCTCCTTTATCT
AGTAATCTTTCCCATAGAGGAGCTTCAGTTGATTTAGCTATTTTTTCATTACATTTAGCAGGAGTA
TCTTCTATTTTAGGAGCTGTAAATTTCATTTCTACGATTATTAATATACGACCAGCAGGAATAATT
CCTGAACGAATTCCTTTATTCGTTTGATCAGTTGGAATTACAGCATTATTATTACTTCTTTCATTA
CCTGTA
The PCR amplification of the CO I gene fragment of ,
Zicrona caerulea
yielded a single product of 490 bp. The
BLAST search using sequence revealed that the sequence obtained in this study was novel and the sequence was
deposited in NCBI GenBank. The intraspecies divergence ranges from 1.11% to 3.78%.
Zicrona caerulea
is
99% similar to
Zicrona caerulea
(GQ 292256) of Seoul, Korea.
Zicrona caerulea
s
howed 1.68% nucleotide
variation to
Zicrona caerulea
(KM 023126) of Bremen, Germany and 3.78% nucleotide variation to
Zicrona
caerulea
(KR 039919) of Ontario, Canada. The mitochondrial genome of closely allied species show sequence
diversity to enable their discrimination. The evolutionary divergence of
Zicrona caerulea
within the genus is
given in the Table 1.
The CO I gene in the mitochondrial genome has been proved to be an excellent source of information
for the set of closely related families belonging to the order Hemiptera. Variation in the nucleotide is
fundamental property of all living organisms which can be used for their identification and phylogenetic status.
The partial sequence of CO I gene of
Zicrona caerulea
shows 99% ,98%, 96% identical with that of
Zicrona
caerulea
isolated from Korea, Germany, Canada respectively. This indicates that there exsist geographical
variation within the species and all these species belongs to the same clade. The N-J tree with nucleotide
sequences revealed that it is closer to
Piezodorus lituratus, Podisus maculiventris
and
Podiscus serieventris
in
their mitochondrial CO I gene sequences. The tree built with the hemipteran entries was divided in to two major
clusters with a few smaller sub clusters with in them. The phylogenetic tree of DNA plotted using neighbor
joining method is attached as Figure 1.
Conclusion
In the present work, phylogenetically nearest relative of the experimental organism ,
Zicrona caerulea
is
Zicrona caerulea
(GQ 292256) from Korea. The N-J tree with nucleotide sequences revealed that it is closer
to
Piezodorus lituratus, Podisus maculiventris
and
Podiscus serieventris
in their mitochondrial CO I gene
sequences. The barcode generated for
Zicrona caerulea
can be used for its accurate taxonomic identification.

Biodiversity & Evaluatio n: Perspectives and Paradigm shifts(2015)
249
KM021946 Troilus luridus
KM022544 Troilus luridus
KM022736 Arma custos
GQ292257 Arma chinensis
KR043874 Podisus maculiventris
KR038161 Podisus serieventris
KR039919 Zicrona caerulea
KM023126 Zicrona caerulea
Zicrona caerulea KERALA
GQ292256 Zicrona caerulea
KM021760 Piezodorus lituratus
KR035779 Cosmopepla bimaculata
JQ240183 Oechalia schellenbergii
KJ459926 Tolumnia antennata
KM022331 Neottiglossa leporina
GQ292234 Eurydema dominulus
GQ292236 Eurydema dominulus
GQ292229 Eurydema gebleri
KJ541625 Eurydema ventralis
KJ866504 Carbula biguttata
KR041575 Coenus delius
KR039734 Harmostes reflexulus
KR042815 Stictopleurus plutonius
HQ106392 Stictopleurus punctiventris
KM022180 Rhacognathus punctatus
GU247472 Carbula insocia
Figure 1. Phylogenetic tree of
Zicrona caerulea
using neighbor joining method
Table 1
Evolutionary divergence between sequences of
Zicrona caerulea
References
[1]
Tembe S. S, Gaikwad S. S, Shouche Y. S & Ghate H. V: Barcoding True Bug Species of India, Third
International Barcode of Life Conference; Nov (
2009
); Mexico City.
[2]
S.K.M. Habeeb & K.P. Sanjayan Sequencing and Phylogenetic analysis of the mitochondrial
cytochrome c oxidase subunit I of Oxycarenus laetus (Hemiptera:Lygaeidae) International Journal of Plant,
Animal and Environmental Sciences ISSN 2231- 4490.vol.1,no.3,(
2011
),pp. 85-92.
[3]
O Folmer , M Black ,W Hoeh , R Lutz , R Vrijenhoek : DNA primers for amplification of mitochondrial
cytochrome C oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol , vol.3,
(
1994
), pp.294-299.
[4]
P D N Hebert ,T R Gregory : The promise of DNA barcoding for taxonomy. Syst Biol , vol 54, ( 2005),
pp.852-859.
[5]
M A Smith ,J J Rodriguez , J B Whitfield ,A R Deans , D H Janzen , W Hallwachs , P D N Hebert :
Extreme diversity of tropical parasitoid wasps exposed by iterative Integration of natural history, DNA
barcoding, morphology, and collections. Proc Natl Acad Sci USA vo1.105, (
2008
), pp.12359-12364.
[6]
K P Priya Bhaskaran and C D Sebastian ,Molecular barcoding of Green Bottle Fly,Lucilia
Sericata(Diptera:Calliphoridae) using COI gene sequences. Journal of Entomology and Zoology studies.,vol.
3,no.1, (
2015
) ,pp.10-12.
[7]
J M Burns ,D H Janzen , M Hajibabaei , W Hallwachs , P D N Hebert : DNA barcodes and cryptic species
of skipper butterflies in the genus Perichares in Area de Conservacion Guanacaste, Costa Rica. Proc Natl
Acad Sci USA , vol 105,(
2008
) pp. 6350-6355.
GU247472 Carbula insocia 67.59%
KJ541625 Eurydema ventralis 11.17%
KM021760 Piezodorus lituratus 10.70%
KJ866504 Carbula biguttata 11.37%
JQ240183 Oechalia schellenbergii 11.51%
GQ292234 Eurydema dominulus 11.59%
GQ292236 Eurydema dominulus 11.59%
KR041575 Coenus delius 12.88%
KR039734 Harmostes reflexulus 11.98%
KR043874 Podisus maculiventris 11.63%
KR038161 Podisus serieventris 11.63%
KR035779 Cosmopepla bimaculata 13.32%
KM022331 Neottiglossa leporine 11.77%
Zicrona caerulea KERALA
GQ292256 Zicrona caerulea 1.11%
KM023126 Zicrona caerulea 1.68%
KR039919 Zicrona caerulea 3.78%
KM022736 Arma custos 9.31%
KM022180 Rhacognathus punctatus 10.25%
GQ292257
Arma
chinensis
9.99%
KJ459926 Tolumnia antennata 11.03%
GQ292229 Eurydema gebleri 11.18%
KR042815 Stictopleurus plutonius 11.58%
KM021946 Troilus luridus 11.17%
KM022544 Troilus luridus 11.58%
HQ106392 Stictopleurus punctiventris 11.58%

Biodiversity & Evaluatio n: Perspectives and Paradigm shifts(2015)
250
[8]B L Fisher , M A Smith : A revision of Malagasy species of Anochetus Mayr and Odontomachus Latreille
(Hymenoptera: Formicidae). PLoS ONE , vol.3, (
2008
)e1787.
[9]
M H Greenstone ,D L Rowley , U Heimbach , J G Lundgren , R S Pfannenstiel , S A Rehner : Barcoding
generalist predators by polymerase chain reaction: carabids and spiders. Mol Ecol , vol14, ( 2005), pp.3247-
3266.
[10]
M A Smith , D M Wood , D H Janzen ,W Hallwachs , P D N Hebert : DNA barcodes affirm that 16
species of apparently generalist tropical parasitoid flies (Diptera, Tachinidae) are not all generalists. Proc
Natl Acad Sci USA ,vol. 104, (
2007
), pp. 4967-4972.
[11]
J C Avise. Phylogeography: The history and formation of species. Cambridge (Massachusetts):
Harvard University Press.pp. 447. (
2004
)
[12]
D X Zhang and G Hewitt . Insect mitochondrial control region: a review of its structure, evolution and
usefulness in evolutionary studies. Biochem. Syst. Ecol. Vol.25, (
1997
), pp .99-120.
[13]
M. Nayyar Azim. Taxonomic Survey of stink bugs (Heteroptero: pentatomidae).Halteres.vol.3(
2011
).pp
1-10.
[14]
Tamura, K., Stecher, G., Peterson, D., Filipski, A. and Kumar, S. MEGA6: Molecular Evolutionary
Genetics Analysis Version 6.
Molecular Biology and Evolution.
vol.30, no.12, (
2013
), pp. 2725 2729.
[15]
K P Priya Bhaskaran and C D Sebastian, Molecular barcoding of Green Bottle Fly, Lucilia Sericata
(Diptera: Calliphoridae) using COI gene sequences. Journal of Entomology and Zoology Studies., vol. 3, no.1,
(
2015
), pp.10-12.
[16]
Sreejith, K. and Sebastian C. D. (2014) Molecular evolutionary analysis of paddy pest, Cofana spectra (Distant)
(Hemiptera: Cicadellidae) using partial DNA sequence of cytochrome oxidase subunit I (COI) gene. International
Journal of Applied and Natural Sciences. 3(2): 135-140.
[17]
Jisha Krishnan, E. K. and Sebastian C. D. (2015) Species authentication and taxonomic relationship assessment
of Ceriagrion coromandelianum (Fabricius) (Zygoptera: Coenagrionidae) using the molecular marker Cytochrome
oxidase I gene. International Journal of Current Research (IJCB), 7(12): 23997-23999.
[18]
Jisha Krishnan, E. K. and Sebastian C. D. (2015) Analysis of evolutionary divergence of Neurothemis tullia
(Odonata:Libellulidae) using cytochrome oxidase subunit I gene. International Journal of Advanced Life Sciences
(IJALS), 8 (2): 110-114.
[19]
Priya Bhaskaran, K.P., Bindu, P.U., Akhilesh, V.P., Rukhsana, K., Jisha Krishnan, E.K. and Sebastian, C.D.
(2015) Profiling of Catalase and Hydrogen Peroxide activity in Tryptophan administered final instar larvae of
Bombyx mori L. International Journal of Pure and Applied Bioscience (IJPAB), 3(3): 201-207.
[20]
Bindu, P. U., Priya Bhaskaran, K. P., Akhilesh, V. P., Jisha Krishnan, E. K., Rukhsana, K. and Sebastian, C. D.
(2015) Toxicological effect of chlorantraniliprole on fat body and haemolymph metabolism in the final instar larvae
of silk insect, Bombyx mori L. International Journal of Science and Nature (IJSN), 6 (2): 177-182.
[21]
Priya Bhaskaran, K. P., Bindu, P. U., Rukhsana, K., Akhilesh, V. P., Jisha Krishnan, E. K. and Sebastian, C. D.
(2015) Antioxidant effect of Tryptophan on biochemical parameters in the haemolymph and fat body of final instar
larvae of silk insect, Bombyx mori. Journal of Applied Biology and Biotechnology (JABB), 3 (3), 11-15.
[22]
Rukhsana, K. and Sebastian C. D. (2015) Genetic diversity of the Cigarette beetle, Lasioderma serricorne
(Fabricius), derived from mitochondrial DNA sequences. International Journal of Pharma and Bio Sciences
(IJPBS), 6(3): 877-882.
[23]
Akhilesh, V. P., Femida, M. P. and Sebastian, C. D. (2015) Molecular phylogenetic study of Periplaneta
fuliginosa from Lakshadweep islands, India using cytochrome oxidase subunit gene sequence. International
Research Journal of Pharmacy (IRJP), 6(6): 382-385.
[24]
Rukhsana, K. and Sebastian C. D. (2015) Phylogeny and Molecular Taxonomy of Family Trichogrammatidae
(Insecta: Hymenoptera) Derived from Mitochondrial DNA Sequence Analysis. International Journal of Current
Biotechnology (IJCB), 3(5): 12-16.
[25]
Sreejith, K. and Sebastian C. D. (2015) Molecular phylogeny of Thaia subrufa (Hemiptera: Cicadellidae) based
on the Mitochondrial Cytochrome Oxidase Subunit I (COI) gene. Journal of Entomology and Zoology Studies
(JEZS), 3 (3): 135-139.
[26]
Akhilesh, V. P. and Sebastian C. D. (2015) DNA based phylogenetic analysis of aquatic beetle, Dytiscus
marginalis isolated from North Kerala, using mitochondrial COI marker. International Journal of Current
Research (IJCR), 7(5): 16426-16429.
[27]
Rukhsana, K. and Sebastian C. D. (2015) Genetic structure and molecular phylogeny analysis of Bracon
brevicornis Wesmael, a larval parasitoid of coconut black headed caterpillar, Opisina arenosella Walker. Research
in Biotechnology (RIB), 6(3): 17-23.
[28]
Jisha Krishnan, E. K. and Sebastian C. D. (2015) Genetic and phylogenetic assessment of sexually dimorphic
species, Diplacodes trivalis (Odonata: Libellulidae) using cytochrome oxidase I gene. International Journal of
Pure and Applied Bioscience (IJPAB), 3(2): 317-320.
[29]
Rukhsana, K. and Sebastian C. D. (2015) Molecular barcoding and phylogeny analysis of Green Leafhopper,
Goniozus nephantidis (Hymenoptera: Bethylidae), a larval parasitoid of coconut blackheaded caterpillar, Opisina
arenosella (Lepidoptera: Oecophoridae). International Research Journal of Pharmacy (IRJP), 6 (4): 239-241.
[30]
Jisha Krishnan, E. K. and Sebastian C. D. (2015) A preliminary check list of Odonates from Calicut University

Biodiversity & Evaluatio n: Perspectives and Paradigm shifts(2015)
251
Campus, Calicut, Kerala, South India. Journal of Entomology and Zoology Studies (JEZS), 3(2): 260-263.
[31]
Rukhsana, K., Vijesh Varghese, Akhilesh, V. P., Jisha Krishnan, E. K., Priya Bhaskaran, K. P., Bindu, P. U. and
Sebastian C. D. (2015) GC-MS determination of chemical components in the bioactive secretion of Anoplodesmus
saussurii (Humbert, 1865). International Journal of Pharma Sciences and Research (IJPSR), 6(4): 650-653.
[32]
Jisha Krishnan, E. K. and Sebastian C. D. (2015) Genetic variation and phylogeny assessment of Aciagrion
occidentale (Odonata: Coenagrionidae) using mitochondrila cytochrome oxidase subunit I gene. International
Journal of Science and Research (IJSR), 4(4): 1121-1123.
[33]
Sreejith, K. and Sebastian C. D. (2015) Molecular phylogeny and genetic analysis of green leafhopper,
Nephotettix virescence (Distant) using mitochondrial COI gene. Indian Journal of Science and Technology (IJST),
8 (1): 61-64.
[34]
Priya Bhaskaran, K. P. and Sebastian C. D. (2015) Molecular barcoding of green bottle fly, Lucilia sericata
(Diptera: Calliphoridae) using COI gene sequences. Journal of Entomology and Zoology Studies (JEZS), 3(1): 10-
12.
[35]
Rukhsana, K. and Sebastian C. D. (2014) Genetic structure and phylogeny analysis of coconut black headed
caterpillar, Opisina arenosella Walker (Lepidoptera: Oecophoridae). Asian Journal of Biological and Life Sciences
(AJBLS), 3(3): 163-166.
[36]
Sreejith, K. and Sebastian C. D. (2014) Phylogenetic analysis and sequencing of the mitochondrial cytochrome
oxidase subunit I (COI) of white backed plant hopper, Sogatella furcifera (Horvath). International Research
Journal of Pharmacy (IRJP), 5 (12): 887-890.
[37]
Akhilesh, V. P. and Sebastian C. D. (2014) Molecular barcoding and phylogeny analysis of Herpetogramma
stultalis (Lepidoptera: Crambidae) using cytochrome oxidase subunit I gene sequence. International Journal of
Advanced Life Sciences (IJALS), 7 (3): 463-466.
[38]
Bindu, P. U. and Sebastian C. D. (2014) Genetic structure of mitochondrial cytochrome oxidase subunit I gene
of the mosquito, Armigeres subalbatus. International Journal of Research (IJR), 1(10): 49-56.
[39]
Rukhsana, K., Akhilesh, V. P. and Sebastian C. D. (2014) Deciphering the molecular phylogenetics of the Asian
honey bee, Apis cerana and inferring the phylogeographical relationships using DNA barcoding. Journal of
Entomology and Zoology Studies (JEZS), 2(4): 218-220.
[40]
Pavana, E. and Sebastian C. D. (2014) Genetic diversity and phylogenetic analysis of lepidopteran species by
molecular barcoding using CO I gene sequences. International Journal of Science and Research (IJSR), 3(5): 450-
452.
[41]
Rukhsana, K., Ashitha, K. S., Mashoor, K. and Sebastian C. D. (2014) Molecular phylogeny analysis of
southern house mosquito, Culex quinquefasciatus (Diptera: Culicidae) derived from mitochondrial DNA sequences.
International Journal of Research. 1(4): 844-853.