PreprintPDF Available

Selective ablation of adult GFAP-expressing tanycytes leads to hypogonadotropic hypogonadism in males

August 2021

DOI:10.1101/2021.07.31.454492

License
CC BY-ND 4.0

Authors:

Lucile Butruille

Muséum National d'Histoire Naturelle

Martine Batailler

French National Institute for Agriculture, Food, and Environment (INRAE)

Ariane Sharif

Inserm U1172 ; University of Lille, Lille, France

Show all 9 authorsHide

Preprints and early-stage research may not have been peer reviewed yet.

In adult mammals, neural stem cells emerge in three neurogenic regions, the subventricular zone of the lateral ventricle (SVZ), the subgranular zone of the dentate gyrus of the hippocampus (SGZ) and the hypothalamus. In the SVZ and the SGZ, neural stem/progenitor cells (NSPCs) express the glial fibrillary acidic protein (GFAP) and selective ablation of these NSPCs drastically decreases cell proliferation in vitro and in vivo . In the hypothalamus, GFAP is expressed by α-tanycytes, which are specialized radial glia-like cells in the wall of the third ventricle. To explore the role of these hypothalamic GFAP-positive tanycytes, we used transgenic mice expressing herpes simplex virus thymidine kinase (HSV-Tk) under the control of the mouse Gfap promoter and 4-week intracerebroventricular infusion of the antiviral agent ganciclovir (GCV) that kills dividing cells expressing Tk. While GCV drastically reduced the number and growth of hypothalamus-derived neurospheres from adult transgenic mice in vitro , it caused hypogonadism in vivo . The selective death of dividing tanycytes expressing GFAP indeed caused a marked decrease in testosterone levels and testicular weight, as well as vacuolization of the seminiferous tubules and loss of spermatogenesis. In addition, GCV-treated GFAP-Tk mice showed impaired sexual behavior, but no alteration in food intake or body weight. Our results also show that the selective ablation of GFAP-expressing tanycytes leads to a sharp decrease in the number of gonadotropin-releasing hormone (GnRH)-immunoreactive neurons and blunted LH secretion. Altogether, our data show that GFAP-expressing tanycytes play a central role in the regulation of male reproductive function. Main points Killing adult hypothalamic GFAP-expressing cells blunts neurosphere formation in vitro and leads to GnRH deficiency and hypogonadism in vivo . This work pinpoints an unreported role of dividing GFAP-expressing tanycytes in reproductive function.

Available via license: CC BY-ND 4.0

Content may be subject to copyright.

Selective ablation of adult GFAP-expressing tanycytes leads to hypogonadotropic

hypogonadism in males

Short running title: Ablation of α-tanycytes affects reproduction

Lucile Butruille

1,2

, Martine Batailler

, Marie-Line Cateau

, Ariane Sharif

, Valérie Leysen

Vincent Prévot

, Pascal Vaudin

, Delphine Pillon

and Martine Migaud

1 : CNRS, IFCE, INRAE, Université de Tours, PRC, Nouzilly, F-37380, France

2 : Present address : UMR 7221 Phyma, CNRS/Muséum National d’Histoire Naturelle, F-

75005 Paris France

3: Univ. Lille, Inserm, CHU Lille, Laboratory of Development and Plasticity of the

Neuroendocrine Brain, Lille Neurosciences & Cognition, UMR-S1172, F-59000 Lille, France

Correspondence to : Martine Migaud, INRAE, UMR 85 Physiologie de la Reproduction et

des Comportements, F-37380 Nouzilly, France ; Tel : (+33) 2 47 42 75 13 ; fax : (+33) 2 47

42 77 43

E-mail : Martine.Migaud@inrae.fr

Conflict of interest statement

The authors declare no conflict of interest.

Acknowledgments

L. Butruille received a grant from the Région Centre. This work was funded by the PHASE

department of INRAE. This project was funded by the Agence Nationale de la Recherche ANR-

16-CE37-0006 (to M.M) and the European Research Council (ERC) Synergy Grant WATCH

No 810331 (to VP). The authors thank the PAO experimental unit No. 1297 (EU0028; INRAE

Val de Loire) for animal care, Anne-Lyse Lainé and the members of the hormonal assay

platform, Nouzilly, France, for conducting testosterone and cortisol assays and the PIC platform

INRAE-Val de Loire UMR PRC. The authors wish to thank Dr Alexandre Surget, Dr Matthieu

Keller, Dr Julie Le Merrer and Dr Jérôme Becker for technical and scientific advice and for

their help with behavioural testing and Professor Michael Sofroniew for kindly donating the Tk

antibody.

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

ABSTRACT

In adult mammals, neural stem cells emerge in three neurogenic regions, the

subventricular zone of the lateral ventricle (SVZ), the subgranular zone of the dentate gyrus of

the hippocampus (SGZ) and the hypothalamus. In the SVZ and the SGZ, neural stem/progenitor

cells (NSPCs) express the glial fibrillary acidic protein (GFAP) and selective ablation of these

NSPCs drastically decreases cell proliferation in vitro and in vivo. In the hypothalamus, GFAP

is expressed by α-tanycytes, which are specialized radial glia-like cells in the wall of the third

ventricle. To explore the role of these hypothalamic GFAP-positive tanycytes, we used

transgenic mice expressing herpes simplex virus thymidine kinase (HSV-Tk) under the control

of the mouse Gfap promoter and 4-week intracerebroventricular infusion of the antiviral agent

ganciclovir (GCV) that kills dividing cells expressing Tk. While GCV drastically reduced the

number and growth of hypothalamus-derived neurospheres from adult transgenic mice in vitro,

it caused hypogonadism in vivo. The selective death of dividing tanycytes expressing GFAP

indeed caused a marked decrease in testosterone levels and testicular weight, as well as

vacuolization of the seminiferous tubules and loss of spermatogenesis. In addition, GCV-treated

GFAP-Tk mice showed impaired sexual behavior, but no alteration in food intake or body

weight. Our results also show that the selective ablation of GFAP-expressing tanycytes leads to

a sharp decrease in the number of gonadotropin-releasing hormone (GnRH)-immunoreactive

neurons and blunted LH secretion. Altogether, our data show that GFAP-expressing tanycytes

play a central role in the regulation of male reproductive function.

Key words, Adult neural stem/progenitor cells, Tanycytes, Hypothalamus, Reproduction,

GnRH, Hypogonadotropic hypogonadism, Sexual behaviours

Main points

Killing adult hypothalamic GFAP-expressing cells blunts neurosphere formation in vitro and

leads to GnRH deficiency and hypogonadism in vivo. This work pinpoints an unreported role

of dividing GFAP-expressing tanycytes in reproductive function.

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

INTRODUCTION

In the mammalian brain, neurogenesis consists in the formation of new neurons from

neural stem or progenitor cells (NSPCs). In adult, two discrete brain regions defined as

neurogenic niches, namely the subventricular zone of the lateral ventricles (SVZ) and the

subgranular zone of the hippocampal dentate gyrus (SGZ), have retained this neurogenic

potential. Within the specialized microenvironment of these niches, NSPCs exhibit a glial

morphology with numerous processes and express astroglial markers such as the glial fibrillary

acidic protein (GFAP) (Doetsch, Caille, Lim, Garcia-Verdugo, & Alvarez-Buylla, 1999;

Garcia, Doan, Imura, Bush, & Sofroniew, 2004; Imura, Kornblum, & Sofroniew, 2003;

Morshead, Garcia, Sofroniew, & van Der Kooy, 2003; Platel, Gordon, Heintz, & Bordey, 2009).

In vitro, SVZ and SGZ GFAP-positive cells have the ability to generate floating spherical

clusters called neurospheres, indicating their stemness potential (Seri, Garcia-Verdugo,

McEwen, & Alvarez-Buylla, 2001). Moreover, genetic lineage tracing experiments have

confirmed that the progeny of NSPCs derives from cells expressing GFAP (Garcia et al., 2004).

One strategy to elucidate the role of the NPSCs is to use the transgenic mouse line GFAP-Tk

in which the herpes simplex virus (HSV) thymidine kinase (Tk) is expressed under the control

of the Gfap promoter (GFAP-Tk). The antiviral agent ganciclovir (GCV) is a drug which, when

phosphorylated by Tk, becomes a toxic metabolite that kills DNA-synthesizing cells. In the

GFAP-Tk mouse model, only NSPCs are targeted and killed by GCV, without altering GFAP

expression in other cell types such as astrocytes (Garcia et al., 2004). When administered in

vitro or in vivo, GCV therefore selectively eliminates dividing cells expressing both GFAP and

Tk, leading to the sharp decrease in SVZ and SGZ neurogenesis (Garcia et al., 2004; Glover,

Schoenfeld, Karlsson, Bannerman, & Cameron, 2017; Morshead et al., 2003). Using this

strategy, cells expressing GFAP, capable of dividing, were shown to constitute the main

population of progenitor cells responsible for constitutive neurogenesis in the two neurogenic

niches (Garcia et al., 2004).

Recently, an additional discrete neurogenic niche located in the mediobasal

hypothalamus (MBH; for reviews see Yoo & Blackshaw, 2018 and Sharif , Fitzsimons, &

Lucassen, 2021) has been documented in various species including human (Pellegrino et al.,

2018), mice (Kokoeva, Yin, & Flier, 2007; Kokoeva, Yin, & Flier, 2005), rats (Pencea,

Bingaman, Wiegand, & Luskin, 2001; Xu et al., 2005), hamsters (Huang, DeVries, & Bittman,

1998; Kameda, Arai, & Nishimaki, 2003) and sheep (Batailler et al., 2014; Batailler, Derouet,

Butruille, & Migaud, 2016; Migaud, Batailler, Pillon, Franceschini, & Malpaux, 2011; Migaud

et al., 2010). The hypothalamus, a diencephalic structure located around the 3

ventricle (3V),

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

is involved in the control of critical physiological functions including food intake and

reproduction. Within the hypothalamus, the arcuate nucleus (AN), the location of the central

control of appetite and energy balance, contains orexigenic and anorexigenic neurons, including

Neuropeptide Y (NPY) and Pro-opiomelanocortin (POMC) neurons, respectively. Besides

these metabolic pathways, the hypothalamus also contains GnRH neurons whose cell bodies

and nerve endings are located respectively in the hypothalamic preoptic area (POA) and in the

median eminence (ME) (Gibson, Ingraham, & Dobrjansky, 2000). GnRH stimulates the

production by the pituitary gland of the gonadotrophic hormones, namely the luteinizing

hormone (LH) and follicle-stimulating hormone (FSH). In turn, these gonadotrophins regulate

gametogenesis and the production of sexual steroids including testosterone and estradiol by the

gonads (Knobil, 1990).

In the MBH, the radial glia-like cells lining the ventricular wall, namely the tanycytes,

have been identified as the endemic hypothalamic NSPCs that generate new neurons and glial

cells in the adult mouse hypothalamus (Lee et al., 2012; Li, Tang, & Cai, 2012; Robins et al.,

2013). Tanycytes have their cell body localized in the cellular layer lining the floor of the 3V

and send their unique process into the hypothalamic parenchyma. Four subpopulations of

tanycytes can be distinguished based on their dorsoventral position, α1, α2, β1 and β2 tanycytes,

the more dorsal to the more ventral, down to the ME (Akmayev, Fidelina, Kabolova, Popov, &

Schitkova, 1973). All tanycyte subtypes express NSPC markers including the sex-determining

region Y-box 2 (Sox2) (Batailler et al., 2014; Lee & Blackshaw, 2012; Li et al., 2012), nestin

(Batailler et al., 2014; Wei et al., 2002) and vimentin (Batailler et al., 2014; Bolborea & Dale

2013 ; Mullier, Bouret, Prevot, & Dehouck, 2010), but only α1 and a restricted population of

dorsal α2 express the transcript for GFAP and the GFAP protein and have been shown to harbor

neural stem cells functional properties (Campbell et al., 2017; Chaker et al., 2016; Robins et

al., 2013). In this study, we sought to investigate the role played by dividing GFAP-positive

cells in physiological functions controlled by the hypothalamus using the GFAP-Tk transgenic

mouse line.

MATERIALS AND METHODS

Animals

All the experiments were approved by the Val de Loire animal experimentation ethics

committee (CEEAVdL) and were in accordance with the Guidelines of the French Ministry of

Agriculture and European regulations on animal experimentation (2010/63/EU). Experiments

were performed in accordance with the local animal regulations (authorization N°

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

2015032613494293 of the French Ministry of Agriculture in accordance with the EEC

directive). Experiments were performed on the transgenic mouse strain GFAP-Tk generated as

described previously (Bush et al., 1998). Briefly, herpes-simplex virus thymidine kinase (HSV-

Tk) is expressed under the control of the mouse Gfap promoter. Proliferating GFAP-positive

cells expressing the transgene produce toxic nucleotide analogues in the presence of the

antiviral agent GCV, which promote their apoptosis. Wild type (WT) and transgenic (Tg) male

mice (2 months old) were obtained by mating transgenic females with non-transgenic males.

Experiments were performed on four groups, the vehicle-treated WT mice (WT ctr), the GCV-

treated WT mice (WT+GCV), the vehicle-treated Tg mice (Tg ctr) and the GCV-treated Tg

mice (Tg+GCV).

RNA extraction and RT-PCR

Total RNA was extracted from the testis and striatum of three 2 months old mice using

the RNeasy Mini Kit (Qiagen) and was used for random-primed cDNA synthesis with

SuperScript III reverse transcriptase (Thermo Fisher Scientific) following the manufacturer’s

instructions. Standard PCR was performed on cDNA aliquots using PlatiniumTaq (Thermo

Fisher Scientific) and the specific primers for the thymidine kinase Tk; Forward primer,

CGATGACTTACTGGCGGGTG; Reverse primer, GATACCGCACCGTATTGGCA) and

Glyceraldehyde-3-phosphate dehydrogenase (Gapdh; Forward primer,

CACCATCTTCCAGGAGCGAG; Reverse primer, GTTGAAGTCGCAGGAGACAAC)

genes. PCR consisted of a first denaturing step at 94 °C for 2 min, followed by 35 cycles of the

following steps at 94 °C for 30 sec, 55 °C for 30 sec, and 72 °C for 45 sec, ending with a 72 °C

extension step. PCR products were analysed on a 1.2 % agarose gel containing 0.5 μg/mL

ethidium bromide and visualized under a UV transilluminator.

Neurosphere cultures

Two WT and two Tg male mice (2 months old) per experiment (n = 3) were euthanized

by cervical dislocation and the region containing the mediobasal hypothalamus was dissected

out. Cells were mechanically dissociated using a cell scraper on a nylon membrane and

centrifuged 5 min at 1,000 rpm. The resulting single-cell suspensions were plated in a 25 ml

flask in DMEM/F12 (Gibco® 21331-020) supplemented with penicillin/streptomycin (PS),

B27 and 20 ng/ml each of EGF (Invitrogen 53003-018) and bFGF (Invitrogen 13256-029).

Cultures were incubated in humidified chambers with 5% CO

at 37°C. Neurospheres were

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

passaged by centrifuging 5 min at 1,000 rpm and incubating for 7 min in Accutase (Gibco®

A11105-01) before mechanically dissociating the spheres into single-cell suspension.

To examine the effect of GCV on neurosphere formation, tertiary neurospheres of WT

and Tg mice were cultivated in the presence or absence of GCV (10 µM final concentration,

Sigma G2536) for 2 weeks. During this long-term culture, the media was supplemented every

two days with growth factors. At the end of the 2 week-culture period, neurospheres were

counted and measured for all the conditions.

In vivo GCV administration

Two months old WT ctr (n=9), WT+GCV (n=8), Tg ctr (n=9) and Tg+GCV (n=11)

male mice were housed in pairs and the pairs were separated by a Plexiglas partition to maintain

visual and olfactory contact. GCV was administrated by intracerebroventricular infusion at a

rate of 0.11 µl/hr for 28 days using an osmotic micropump (Model 1004, Alzet®). Micropumps

connected to cannula (Brain Infusion Kit 2, Alzet®) were filled with 2 mM GCV or with saline

solution and primed for 48 hours at 37°C. For implantation, mice were anesthetized with 100

mg/kg ketamine and 10 mg/kg xylazine and fixed to a stereotaxic frame after loss of reflexes.

During surgery, the eyes were protected with ocry-gel and a local anesthetic (procaine) was

injected under the skin of the skull. A micropump was introduced subcutaneously and the

cannula was implanted into the 3V at 1.7 mm posterior to the Bregma and at a depth of 5 mm

(Paxinos atlas). Following surgery, all mice were injected with 0.1 mg/kg morphine analgesic

(0.3 mg/ml Buprecare®) and 6 ml/kg injectable antibiotic (10 mg/kg Depocilline).

Food intake and body weight assessment

Body weights and food intake were measured weekly for 5 weeks starting one week

before cannulation at week 0 (W0) until the end of the experiment at week 4 (W4), with week

1 (W1) corresponding to the surgery. To get accurate food intake measurement, mice were

housed individually while social interactions (odors, vocalization and sight) were maintained

with holes in the cage separator. Food intake was measured by giving a weighted amount of

food and measurement of the left over / refusals on a weekly basis (Ali & Kravitz, 2018).

Behavioral analysis

All the behavioral tests took place in the last week of treatment (W4).

Sexual behavior

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

All sexual behavioral experiments were performed during the dark phase of the

dark/light cycle, 1 hour after lights off. Tests were filmed with an infra-red light in a dark room.

Two weeks before W0, male mice were placed for a week with a receptive female (in oestrus

phase) to gain sexual experience. At W4, males were tested in an open field (50 x 50 cm) with

a receptive female for 30 minutes. Females were ovariectomized and implanted with Silastic

implants (Dow Corning) containing 50 μg of E2-benzoate (Sigma-Aldrich). Four hours before

the tests, females were given a subcutaneous injection of 1 mg of progesterone (Sigma-Aldrich)

diluted in 100 μL of oil to induce receptivity (Derouiche, Keller, Duittoz, & Pillon, 2015). The

numbers of anogenital investigations, the latencies and frequencies of mounts and intromissions

were recorded. The sexual preference of males was also evaluated. Males were placed in the

centre of a three-compartment chamber separated by Plexiglas with an opening at the base

permitting olfactory and visual contact. Following a 10 min period of habituation, a receptive

female (detected by a vaginal smear) and an unfamiliar male were each placed in one of the

side compartments of the chamber. The time spent by the tested male mouse near each

compartment was recorded for 10 min. Finally, the attractiveness of tested males was measured

using the same protocol as above. One oestrus female was placed in the centre of the chamber

and a Tg ctr and a Tg+GCV male were placed in the compartments on either side.

Anxiety levels

Anxiety level in the four groups was evaluated using the elevated plus maze and the

marble burying tests (Meirsman et al., 2016). The elevated plus maze consists of two closed

and two open cross-shaped arms (5 cm wide x 40 cm long) elevated 50 cm from the floor. Male

mice were placed in the centre of the device and were allowed to explore the arms for 5 minutes.

The number of entries and the time spent in each area of the device were recorded, i.e. the

closed arms, the open arms, the distal zones of the open arms and the centre of the device.

In the marble burying test, male mice were placed in a test cage (15 cm wide x 33 cm

long) containing fresh bedding. Twenty marbles were distributed evenly in the cage in 5 rows

and a lid was placed on top of the cage. Animals were left undisturbed for 15 minutes, after

which the number of marbles buried was recorded. A marble was counted as being buried if at

least 2/3 of it had been covered by bedding.

Tissue preparation

At W5, animals were anesthetized and blood was collected from the abdominal artery

and serum was frozen for posterior hormone quantification. Following intracardial perfusion

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

with 4% paraformaldehyde, testes, seminal vesicles and preputial glands were dissected out and

weighted. Testis samples were fixed by immersion in Bouin’s fixative solution for 48 hours and

were embedded in paraffin. Testis blocks were cut in 9 µm thick sections and stained with

haematoxylin and eosin for histology. The density of spermatogonia and spermatocytes per

seminiferous tubule (number of cells per mm²) was assessed. Three images per mouse (2-3

mice per group) and 3 seminiferous tubules per image were used for this quantification.

Immunohistochemistry

Coronal sections (25 μm thick) cut from the anterior POA in a caudal direction until the

premamillary recess, were collected using a cryostat (Leica CM 3050 S). The sections were

directly mounted on Superfrost Plus slides (Fisher Scientific, Illkirch, France) and stored at -

80°C until used for immunohistochemistry. For all antibodies (Table 1), normal serum IgGs of

appropriate species were used as negative controls. For each mouse five sections separated by

100 µm and 160 µ m at different rostro-caudal levels of the POA and the MBH respectively

were used for immunohistochemistry. To simultaneously permeabilize and block nonspecific

binding sites, sections were placed in a solution of 5% normal horse serum and 0.3% Triton X-

100 in TBS (TBSTH) for 30 min and incubated in the same buffer containing the primary

antibodies (Table 1). They were then incubated with secondary antibodies (Table 1) and

mounted in Fluoromount (SouthernBiotech, Birmingham, AL, USA) for observation.

Quantification of immunolabelled cells

The quantification of immune-positive cells was performed using a computerized image

analysis system, Mercator (Explora Nova, La Rochelle, France), consisting of a microscope

(Zeiss Axioscop) equipped with a motorized stage, a fluorescent lamp and a CDD video camera.

Under a magnification of 10X, three hypothalamic anatomical regions of interest (ROI), the

median eminence (ME), the arcuate nucleus (AN) and the ventromedial hypothalamus (VMH)

were determined (Robins et al., 2013). The cell bodies of the GnRH neurons were manually

quantified in the POA. Two methods of quantification were used, a manual quantification

resulting in a number or a density of immunolabelled nuclei, or an automatic quantification

with a grey level threshold to detect the immunolabelled area (Butruille, Batailler, Mazur,

Prevot, & Migaud, 2018). The number of GFAP-positive tanycytic cell bodies lining the

ventricular wall was quantified in WT ctr and Tg+GCV male mice.

Image capture for immunohistochemistry

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

All images (1,024 x 1,024 pixels) for figure preparation were acquired using a confocal

microscope (Zeiss, LSM 700, objective 40X) with Zen software (Carl Zeiss, Oberkochen,

Germany). Images shown in the figures were pseudo-coloured using LSM Image Browser

software (Carl Zeiss, Thornwood, NY), and Photoshop (Adobe Systems, San Jose, CA) was

used on the resulting tiff ﬁles only to adjust for brightness and contrast.

Hormone level measurements

Two hours before euthanasia, males were injected intraperitoneally with 15 IU of human

chorionic gonadotropin (hCG) (Intervet, France) diluted in physiological serum so that

testosterone contained in mouse testis is fully secreted (34). Plasma testosterone concentrations

were assayed using a RIA (radioactive immunoassay) using

H-testosterone as previously

described (Derouiche et al., 2015). The sensitivity of the assay was 0.06 ng/mL and the intra-

assay coefficient of variation was 8.5%.

Plasma cortisol concentrations were measured using a direct radio-immunoassay

method as previously described (Orgeur et al., 1999). The sensitivity of the assay was 0.25

ng/mL and the intra-assay coefficient of variation was 8.6%.

Serum FSH levels were measured using a commercial ELISA kit (Endocrine

Technologies, Inc., ERKR7014) following manufacturer’s instructions. The sensitivity was

0.05 ng/ml and the intra-assay coefficient of variations was 3.42%.

Serum LH levels were measured using a sensitive sandwich ELISA (Steyn et al., 2013).

The sensitivity was 0.25 ng/ml and the intra-assay coefficient of variations was 7.73%.

Statistical analysis

Statistical analyses were performed with GraphPad Prism5 software (GraphPad

Software, San Diego, CA). Data were compared using a non-parametric Kruskal-Wallis test

followed by a Dunn’s post-test. A one-way ANOVA followed by a Bonferroni post-test were

used to compare the size of the neurospheres after GCV treatment. A two-way ANOVA was

used to compare body weights and food intake, and to compare the number of entries and the

time spent in each area of the elevated plus maze. A Wilcoxon test was used to compare the

sexual preference and the attractiveness of males. Differences were considered statistically

significant for a p-value < 0.05. Data presented in the histograms are mean values ± standard

error of the mean (S.E.M.).

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

RESULTS

GFAP-expressing cells are the main source of hypothalamic proliferative cells in vitro

In the Tg mice model in which the herpes thymidine kinase is expressed under the

control of the Gfap promoter (GFAP-Tk), double-labelling was used to assess the overlapping

expression of GFAP and HSV-Tk at the single-cell level. Confocal analysis of cells showed

that 100% of the Tk-positive cells also expressed the astroglial marker GFAP regardless of the

rostro-caudal level of the hypothalamus (Fig 1). No Tk-positive/GFAP-negative cells were

found and only very few GFAP-positive cells with no detectable level of Tk could be observed.

These results confirm the limited expression of Tk in the GFAP-positive cells in the

hypothalamus as reported in previous study for the SVZ and SGZ (Garcia et al., 2004).

Confocal image analysis showed that the majority of Tk-positive/GFAP-positive cells

lay in the ependymal layer in the rostral part of the MBH corresponding more specifically to

the α-tanycytes subtypes (Fig 1A) and in the MBH parenchyma corresponding to astrocytes

(Fig 1A, B and C). A few cells were also observed in astrocytes of the ME (Fig 1B and C).

Regarding their anatomical localization, ventricular Tk-positive/GFAP-positive cells will be

referred to as GFAP-positive tanycytes in the remainder of this article.

To determine the relative contribution of GFAP-expressing cells to NSPCs isolated from

hypothalamic tissue, we used the neurosphere assay, which constitutes the best in vitro assay

for detecting the presence of putative neural progenitor cells (Marshall, Reynolds, & Laywell,

2007). The number of neurospheres was comparable in non-transgenic mice (WT ctr), in GCV-

treated non-transgenic (WT+GCV) mice or in saline-treated transgenic mice (Tg ctr; Fig 2A, B

and C respectively). In contrast, GCV almost completely prevented neurosphere formation from

adult hypothalamic tissue derived from transgenic mice (Tg+GCV; Fig 2D). The GCV

treatment reduced the number of neurospheres from Tg+GCV mice by 89.2±9.5% (Fig 2E).

Furthermore, neurospheres produced from Tg male mice treated with GCV were significantly

smaller than those from control mice (Fig 2F; Bonferroni multiple comparison, p<0.0001).

These results show that the ability of adult hypothalamic tissue to produce neurospheres in vitro

was drastically reduced following transgenic-targeted elimination of dividing GFAP-positive

cells.

In vivo ablation of GFAP-positive tanycytes modified the expression of NSPC markers in

the MBH

To determine whether GFAP-expressing tanycytes could constitute the major pool of

NSPCs in the adult hypothalamus, two months old WT and Tg mice were subjected to 4-week

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

saline and GCV infusion in the 3V using stereotaxically implanted cannulas and osmotic

minipumps (WT ctr; WT+GCV; Tg ctr; Tg+GCV).

In order to assess the effect of the GCV treatment on the expression of NSPC markers,

brain slices were cut and immunohistochemical analyses were performed. The expression of

NSPC markers, including GFAP (Fig 3A-D), vimentin (Fig 3E-G) and Sox2 (Fig 3H-K) was

quantified using immunolabelling techniques.

In Tg mice, the GCV treatment had no effect on the labelling of GFAP in the

parenchyma of the VMH (Kruskal-Wallis, p>0.05), AN (Kruskal-Wallis, p>0.05) or ME

(Kruskal-Wallis, p>0.05) globally, when compared with the WT, WT+GCV and Tg ctr groups

(Fig 3C). However, analysis of the GFAP-positive labelling located in the wall of the 3V

revealed that the number of GFAP-positive tanycytic cell bodies is dramatically decreased in

Tg+GCV mice when compared to WT ctr littermates (Mann-Whitney, p=0.0002; Fig 3D).

These results thus suggest that GCV treatment i.c.v. selectively promotes the ablation of GFAP-

positive tanycytes along the wall of the 3V without altering the GFAP-positive astrocytes of

the parenchyma. The expression of vimentin (Fig 3E-F), a type III intermediate filament protein

expressed in neural stem cells, was significantly reduced in the VMH, AN and ME of the

Tg+GCV group as compared to the WT, WT+GCV and Tg ctr groups (VMH: Kruskal-Wallis,

p=0.05; Dunn’s, p<0.05; AN: Kruskal-Wallis, p=0.03; Dunn’s, 0.008<p<0.07; ME: Kruskal-

Wallis, p=0.003; Dunn’s, 0.0004<p<0.01 Fig 3E-G). These results intriguingly suggest that the

ablation of dividing GFAP-positive tanycytes does not only cause depletion in the α-tanycyte

population in the wall of the 3V, but also in the β-tanycytes, which form the floor of the 3V in

the ME. In addition to a marked depletion of Sox2-positive tanycytes (Fig 3H, I), the density

of Sox2-positive cells in the parenchyma of the VMH (Fig 3J), was significantly lower in the

Tg+GCV group than in the WT+GCV and Tg ctr groups (Kruskal-Wallis, p=0.01; Dunn’s,

p=0.04 and p=0.05 respectively Fig 3J). A significant decrease in Sox2-positive cells density

was also observed in the AN (Kruskal-Wallis, p=0.02; Dunn’s, 0.005< p<0.03) and the ME

(Kruskal-Wallis, p=0.04; Dunn’s, 0.02<p<0.04; Fig 3K). Altogether, these results raise the

possibility that GFAP-expressing tanycytes may play a role in the renewal of all tanycytic

populations in the ventricular wall, as well as of transient amplifying cells in the parenchyma,

in the adult tuberal region of the hypothalamus.

In vivo ablation of hypothalamic GFAP-positive tanycytes did not affect body weight

and food intake and has no effect on anorexigenic/orexigenic peptide expression

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

As adult hypothalamic neurogenesis has been associated with the control of food intake

and metabolism (Kokoeva et al., 2005; Lee et al., 2012; Li, Tang, Purkayastha, Yan, & Cai,

2014; Pierce & Xu, 2010), animals and their food intake were therefore weighed daily from

week 0 (W0) to week 4 (W4) after GFAP-positive tanycytes ablation. A two-way ANOVA

demonstrated that the GCV administration did not modify the body weight or food intake of the

Tg-GCV mice when compared to the three control groups of mice (p>0.05, Fig S1A, and

p>0.05, Fig S1B, respectively).

The balance between anorexigenic neurons expressing proopiomelanocortin (POMC)

and orexigenic neurons expressing neuropeptide Y (NPY) mainly mediates metabolic activity

including feeding and body weight regulation. In transgenic GCV-treated mice, the number of

neurons immunolabelled for POMC (WT ctr: 37.78±8.45; WT+GCV: 32.06±9.31; Tg ctr:

45.84±10.9; Tg+GCV: 30.91±8.08; Kruskal-Wallis, p>0.05; Fig S1C) and NPY (WT ctr:

10.45±1.81; WT+GCV: 8.97±0.43; Tg ctr: 13.96±1.3; Tg+GCV: 13.72±2.43; Kruskal-Wallis,

p>0.05; Fig S1D) did not differ from the control groups. Taken together these data indicate that

ablation of hypothalamic GFAP-positive tanycytes did not cause any marked alteration in the

regulation of body weight or food intake during the four weeks of treatment. However, we

cannot exclude metabolic consequences at a longer term, as previously demonstrated by the

decrease in POMC neurons and the alteration of body weight and food intake 3 months and 10

months respectively after induced inflammation in hypothalamic NSCs (Li et al., 2012).

Ablation of hypothalamic GFAP-positive tanycytes causes hypogonadism

We next investigated the role of adult GFAP-expressing tanycytes on reproduction, a

major neuroendocrine function controlled by the hypothalamus. The effect of 4-week GCV

treatment on the weight of testes and seminal and preputial glands was examined. Tg+GCV

mice showed a stricking decrease in testis weight (Kruskal-Wallis, p<0.0001; Dunn’s, p<0.05;

Fig 4A). Following a human chorionic gonadotropin (hCG) injection, a stimulation that elicits

the release of the total testosterone content from the testis (Derouiche et al., 2015 ), a significant

decrease of about 50% of the mean plasma testosterone levels was observed in Tg+GCV

compared to control groups (Kruskal-Wallis, p=0.04, Dunn’s, p<0.05; Fig 4B). Anatomical

analysis of the testis sections showed that the three control groups, i.e. WT ctr (Fig 4C),

WT+GCV (Fig 4D) and Tg ctr (Fig 4E), had normal seminiferous tubules. In contrast, the GCV

treatment of Tg mice resulted in severe morphological alterations including vacuolization of

seminiferous epithelium and no visible spermatozoa in the tube lumen (Fig 4F). A

morphological analysis of the seminiferous tubules of the Tg+GCV mice showed that they only

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

contained Sertoli cells, spermatogonia and some spermatocytes. The stages downstream the

spermatogonia stage were affected by the GCV treatment and no spermatids or spermatozoa

could be observed in the tubules suggesting that in male Tg+GCV mice, spermatogenesis had

stopped at the leptotene spermatocyte stage which is known to be highly sensitive to

testosterone variations (Chang et al., 2004). Some of the seminiferous tubules also contained

apoptotic vesicles corresponding to phagocytosis of spermatogonia by the Sertoli cells. The

quantification of the different cell types in the seminiferous tubes uncovered that the Tg+GCV

mice have significantly less spermatogonia and spermatocytes than the control mice (Kruskal-

Wallis, p=0.0002; Dunn’s, p<0.05; Fig S2). Moreover, no Gfap expression was detected in the

testis of the control mice (data not shown) and the expression of the tk gene was undetectable

in testis of Tg mice as shown by RT-PCR (Fig S3), indicating that anatomical defects observed

in the testis were not due to a direct peripheral effect of the ganciclovir. These findings

demonstrate that the ablation of GFAP-positive tanycytes in Tg+GCV male mice causes rapid

and profound disruption of spermatogenesis and severe degradation of the testicular

morphology.

In addition, Tg+GCV mice showed a decrease in the weight of preputial glands which

produce pheromones (WT ctr: 62.67±4.28; WT+GCV: 68.34±5.35; Tg ctr: 61.53±3.13;

Tg+GCV: 47.83±3.39; Kruskal-Wallis, p=0.03; Dunn’s, p<0.05), whereas no change in the

seminal gland weight was observed between the four groups (WT ctr: 227.2±15.17; WT+GCV:

226.4±13.56; Tg ctr: 254.3±32.02; Tg+GCV: 219.32±4.5; Kruskal-Wallis, p>0.05).

The release of testosterone is triggered by the action of the pituitary hormone LH on

Leydig cells, we therefore analysed circulating LH levels. In Tg+GCV male mice, a significant

decrease in the mean serum LH concentrations was observed (Kruskal-Wallis, p=0.04; Dunn’s,

p<0.05; Fig 4G) compared to control groups except for WT+GCV mice. In contrast, no

significant difference was found in the mean levels of FSH, which regulate Sertoli cell function

(Kruskal-Wallis, p>0.05; Fig 4H) in the male mice of the four groups. Together these data

strongly suggest that 4-week delivery of GCV in the third ventricle of GFAP-Tk mice causes

severe hypogonadotropic hypogonadism.

We next sought to investigate the consequences of tanycytic depletion on the function

of the GnRH neuronal network within the hypothalamus. Tanycytes of the ME tightly control

the access of GnRH nerve terminals to the pituitary portal blood vessels (Parkash et al., 2015;

Prevot et al., 1999). Furthermore, tanycytes in the wall of the 3V have recently been shown to

be able to modulate the activity of neurons in the AN (Bolborea, Pollatzek, Benford, Sotelo-

Hitschfeld, & Dale, 2020), which is a key site for the feedback action of gonadal steroid in the

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

hypothalamus where reside kisspeptin neurons. While neither Kisspeptin immunoreactivity nor

the number of estradiol receptor alpha (ERα)-positive cells were affected by GCV treatment in

the AN (Kruskal-Wallis, p>0.05; Fig S4A, B), density of GnRH neuronal fibers were found to

be significantly decreased in the ME of GCV-treated mice (Kruskal-Wallis, p=0.02, Dunn’s,

p<0.05; Fig 5A-C). Surprisingly, this decreased density of GnRH neuronal fibers in the ME

was associated with a 50% loss in the number of GnRH-immunoreactive neuronal cell bodies

in the preoptic region (Kruskal-Wallis, p=0.002, Dunn’s, p<0.05; Fig 5D-F). These results

intriguingly suggest that morphofunctional interaction between GnRH axon terminals and

tanycytes is not only required for the control of GnRH release into the pituitary portal blood but

also GnRH expression and/or GnRH neuronal survival in the hypothalamus.

GFAP-expressing tanycytic depletion alters male sexual behaviour

To further explore the consequences of tanycytic depletion on reproduction, three main

well-established paradigms of sexual behaviour in male mice, namely the frequency of

anogenital investigations, the latency to the first mount and intromission and the frequency of

intromissions were analysed. To achieve this, male mice of the four experimental groups were

exposed to receptive females for 30 minutes. In this test, the GCV treatment did not induce any

change in the frequency of anogenital investigation in transgenic male mice (Kruskal-Wallis,

p>0.05; Fig 6A). In contrast, the Tg+GCV male mice exhibited increased latencies to the first

mount (Kruskal-Wallis, p=0.01; Dunn’s, p<0.05; Fig 6B) as well as for the first intromission

(Kruskal-Wallis, p=0.03 Dunn’s, p<0.05; Fig 6C) together with a lower frequency of

intromissions (Kruskal-Wallis, p=0.008; Mann-Whitney, p<0.05; Fig 6D). The attractiveness

of Tg ctr and Tg+GCV males towards receptive females was also analysed and showed that

receptive females spent as much time with Tg ctr males as with Tg+GCV males (Wilcoxon,

p>0.05; Fig 6E), suggesting that Tg+GCV males were as attractive for females as control males.

Conversely, to test whether the decrease in sexual performance of the Tg+GCV male mice was

due to a lack of sexual attraction towards females, we performed a sexual preference test by

exposing male mice of the four groups to both an unfamiliar male and a receptive female. Males

from all groups spent more time near the female than near the unfamiliar male (Wilcoxon, WT

ctr p=0.05, WT+GCV p=0.03, Tg ctr p=0.001 and Tg+GCV p=0.004; Fig 6F), indicating that

GCV treatment did not alter the sexual preference of the treated males for females. Altogether

these results show that GCV-treatment leads to an impairment of the copulative behaviour

without affecting sexual preference and attractivity in male mice.

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

Ablation of GFAP-positive tanycytes does not alter anxiety levels

The hypothalamus regulates stress and anxiety responses via the corticotropic axis and

tanycytes are also known to be morphologically associated with corticotropin releasing

hormone (CRH) axon terminals (see for review Prevot et al., 2018). To test whether ablating

GFAP-positive tanycytes might also lead to depressive/anxiety behaviour, two behavioural

studies were conducted, namely the elevated plus maze and the marble burying tests. The GCV

treatment did not modify the number of entries into each zone of the elevated plus maze (two-

way ANOVA, p>0.05; Fig S5A) and Tg+GCV male mice spent as much time in each area of

the elevated plus maze device as the three control groups (two-way ANOVA, p>0.05; Fig S5B).

The marble burying test, an anxiety test that partly depends on hippocampal function (Deacon,

2006) showed that animals buried the same number of marbles whichever group they belonged

to (Kruskal-Wallis, p>0.05; Fig S5C). Additionally, no significant difference was detected in

the mean plasma cortisol concentrations between the four groups (Kruskal-Wallis, p>0.05; Fig

S5D), consistent with the findings that the GCV treatment had no effect on the anxiety level in

transgenic mice.

DISCUSSION

It is now well established that adult dividing GFAP-positive cells constitute the unique

pool of NSPCs in the SVZ and SGZ (Doetsch et al., 1999; Garcia et al., 2004; Imura et al.,

2003; Morshead et al., 2003; Platel et al., 2009; Seri et al., 2001) and their ablation results in a

depletion of adult neurogenesis within the two canonical niches (Garcia et al., 2004; Morshead

et al., 2003). In the hypothalamus, tanycytes have been described as the NSPCs capable of

generating neurons and glial cells (Sousa-Ferreira, de Almeida, & Cavadas, 2014; Yoo &

Blackshaw, 2018). Despite strong morphological similarities, two recent single-cell RNA

sequencing (scRNA-Seq) studies showed much greater molecular diversity than previously

thought among tanycytes (Campbell et al., 2017; Chen, Wu, Jiang, & Zhang, 2017). Although

all populations express Sox2, Vimentin and Nestin, only the α-tanycyte subtypes express GFAP

(Campbell et al., 2017; Robins et al., 2013), while Fgf10 (fibroblast growth factor 10) and

BLBP (Brain Lipid-Binding Protein) are only expressed by the β subtypes (Goodman et al.,

2020; Haan et al., 2013; Robins et al., 2013), suggesting distinct roles of these two NSPCs

populations. In the current study, we used a Tk-transgenic mouse line in which only dividing

GFAP-positive NSPCs are selectively removed while non-stem GFAP-positive astrocytes are

spared by ganciclovir treatment (Garcia et al., 2004).

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

In the hypothalamus, dividing GFAP-positive NSPCs that were selectively targeted in

our study correspond mainly to one of the mitogenic regions identiﬁed in the tanycytic layer

lining the 3V wall, namely the α1 plus a dorsal subset of α2 tanycytes (Robins et al., 2013). In

vitro, selective ablation of dividing GFAP-expressing cells induced a strong reduction in the

neurospherogenic capacities of this region as measured in the neurosphere assay by a sharp

reduction in both the number and the size of neurospheres. In vivo, ablation of dividing GFAP-

expressing tanycytes resulted in decreased expression of NSPC markers including vimentin and

Sox2 thoughout the MBH of Tg mice. In agreement with these results, α-tanycytes expressing

GFAP and Sox2 were shown to self-renew, give rise to β-tanycytes and generate neurons and

astrocytes (Robins et al., 2013; Rodriguez et al., 2005; Xu et al., 2005). These results support

the assumption that GFAP-expressing α-tanycytes proliferate and show strong

neurospherogenic capacities in vitro (Robins et al., 2013; Rodriguez et al., 2005; Xu et al.,

2005), thus behaving like NSPCs, similarly to those of the two canonical niches, the SVZ and

the SGZ (Garcia et al., 2004).

Several studies have reported that newborn cells, most likely generated from tanycytes,

integrate the hypothalamic neuronal networks of the AN and ME and are engaged in the

regulation of energy homeostasis (Haan et al., 2013; Kokoeva et al., 2005; Lee et al., 2012; Li

et al., 2012). A decrease in hypothalamic new cell generation induces obesity and the

development of metabolic disorders associated with insulin resistance (Li et al., 2012). In turn,

obesity induced by a high fat diet was shown to impair hypothalamic neurogenesis and disrupt

energy balance (Li et al., 2012; Sousa-Ferreira et al., 2014). In addition, a 2-month high fat diet

induces a significant increase in the proliferation of β-tanycytes and the production of new cells

in the ME (Lee et al., 2012). In order to determine whether hypothalamic GFAP-expressing

tanycytes are implicated in metabolism regulation, we explored the effect of their ablation on

the regulation of body weight and food intake in transgenic male mice. The current study

demonstrates that the suppression of GFAP-expressing tanycytes had no effect on both

parameters, nor on the number of anorexigenic and orexigenic neurons i.e. POMC and NPY

neurons respectively. Two hypotheses could be formulated to explain these results. First, this

targeted population of NSPCs, corresponding mainly to the α1 and dorsal α2 tanycytes, would

not be directly involved in the regulation of food intake, unlike the β tanycytes (Lee et al., 2012;

Li et al., 2012). Alternatively, no effect was detected because the animals were unchallenged.

The exploration of whether a diet challenge could affect food intake in GFAP-expressing

tanycyte-depleted mice might bring insight to this question.

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

We then investigated the involvement of hypothalamic GFAP-expressing tanycytes in

the control of reproduction, a function also orchestrated by the hypothalamus. In a recent study

in sheep, a seasonal mammal, we showed that administration of the antimitotic drug AraC in

the 3V downregulates the production of hypothalamic new neurons identified by the expression

of Doublecortin and modifies the timing of reproduction (Batailler et al., 2018). In a model of

aged mice, GnRH was shown to stimulate the hypothalamic mitogenic activity (Zhang et al.,

2013). These data suggest a strong link between the hypothalamic neural stem cell niche and

the neural circuits controlling reproduction. The current study shows that the sexual behaviour

and sexual performance of male Tg+GCV mice are strongly altered after 4-week of GCV

treatment and thus without affecting the neural circuits involved in sexual partner olfaction and

recognition. This phenotype does not result from a higher level of anxiety in Tg+GCV mice as

they exhibit plasma cortisol concentrations and levels of anxiety comparable to those in the

control groups.

A thorough analysis of the reproductive system of the Tg+GCV male mice showed a

significant decrease in testis weight and a drastic reduction in testosterone secretion by the

Leydig’s cells. In turn, the drop of testosterone secretion triggered the vacuolization of the

seminiferous tubules likely due to the cessation of spermatogenesis and severe hypogonadism.

These decreased testosterone levels are also likely the cause of the strong alteration in sexual

behaviour seen in GCV-treated transgenic males.

Testosterone inhibits GnRH/LH secretion via a negative feedback onto the

hypothalamus. The drop in testosterone levels being associated with decreased circulating LH

levels in GCV-treated mice strongly suggests that the hypogonadism in these mice is due to a

central defect. In agreement, we found that GCV-mediated depletion in tanycytes results in

GnRH deficiency. GnRH immunoreactivity was indeed seen to be markedly decreased both at

the GnRH neuronal cell bodies in the POA and the termination field of GnRH neurons in the

ME. Interestingly, GCV treatment in transgenic mice did not affect FSH levels. These results

are consistent with previous studies in which the use of GnRH antagonists in humans induce an

immediate decrease in LH and testosterone secretions, while the decrease in FSH is delayed

and weaker because of its short half-life (Hall et al., 1988; Pavlou et al., 1986). Interestingly,

these antagonist treatments cause a rapid hypogonadism phenotype that is dependent on

fluctuations in pituitary hormones and testosterone, comparable to our data (Hall et al., 1988;

Pavlou et al., 1986). In ewes (Lincoln & Fraser, 1979), non-human primates (Pineda et al.,

1983), and ovariectomized rats (Culler & Negro-Vilar, 1986, 1987), the administration of a

GnRH antagonist as well as the hypothalamic-pituitary disconnection (Hamernik, Crowder,

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

Nilson, & Nett, 1986) suppressed pulsatile LH secretion but had a minimal effect on FSH

secretion, indicating that GnRH differentially controls the secretion of LH and FSH. However,

a GCV treatment of more than 4 weeks of Tg mice might also have altered FSH secretion.

Together with recent findings showing that the administration of the antimitotic AraC in the

lateral ventricle of female rats alters the neural circuitry that controls adult GnRH/LH release

and reduces the preovulatory surge in LH release (Mohr, DonCarlos, & Sisk, 2017), our results

point to a role for the adult hypothalamic neural stem cell niche in the control of the reproductive

function.

We do not know the cellular mechanisms inducing GnRH deficiency following the

suppression of hypothalamic GFAP-expressing tanycytes. Kisspeptin-54 being the most potent

secretagogue of the GnRH system (Messager et al., 2005), and having been reported to induce

a reduction in testicular weight as well as testicular degeneration in adult male rats when

chronically administrated (Thompson et al., 2006), was one of the candidates. However,

Kisspeptin expression in fibers located in the AN did not appear to be altered in GCV-treated

transgenic mice. Similarly, expression of gonadal steroid receptors such as the estrogen

receptor-α (ERα) appeared to be unaffected. Alternately, a more direct hypothesis involves the

β-tanycytes located in the ME, which mediate the release of GnRH into the pituitary portal

blood vessels by controlling the direct access of GnRH nerve endings to the vascular wall (see

for review Prevot et al., 2018) but also by setting up specific communication channels with

GnRH nerve terminals (see for review Clasadonte & Prevot, 2018) and supporting neuronal

survival (Chauvet, Privat, & Alonso, 1996; Prieto, Chauvet, & Alonso, 2000). However, this

view is somewhat contradicted by a recent study reporting the physiological consequences of

selective β-tanycytes ablation (Yoo et al., 2020). Although it shows, as in the present study, that

β-tanycytes ablation has no effect on food intake and body weight, the authors did not observe

any significant changes in serum levels of LH and FSH. This discrepancy could be explained

by the fact that the animals in this study were fed a diet containing tamoxifen for 3-weeks;

tamoxifen being a potent modulator of gonadal steroid receptors leading to confounding effects

on the activity of the gonadotropic axis. In particular, tamoxifen has been clinically shown to

increase androgen levels and sperm concentration in males with idiopathic oligozoospermia

(Dimakopoulou, Foran, Jayasena, & Minhas, 2020).

GFAP-expressing α1- and dorsal α2-tanycytes may communicate with GnRH fibers

traveling towards the ME, but do not interact morphologically with GnRH nerve terminals in

the ME. However, their ablation caused a marked alteration in β-tanycyte number and/or

morphology as evidenced by the significant decrease in vimentin labelling 4 weeks after GCV

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

treatment (Fig 3E-G). These results are in agreement with the finding that α-tanycytes

expressing GFAP self-renew and give rise to β-tanycytes (Dimakopoulou et al., 2020; Robins

et al., 2013; Rodriguez et al., 2005; Xu et al., 2005). The immunohistological changes observed

in our study likely resulting in significant structural alterations may hamper the tanycyte-to-

GnRH-neuron communication processes controlling reproduction (Prevot et al., 2018). Hence,

one is tempted to speculate that this alteration in the structure and function of hypothalamic

tanycytes may also account, at least in part, for the loss of GnRH immunoreactivity in the ME

with possible consequences for overall expression of GnRH in the cell bodies or for the very

survival of GnRH neurons in the preoptic region. This phenomenon, which could be due to an

alteration of the ability of tanycytes to fight against systemic inflammation at the blood-

cerebrospinal barriers (Bottcher et al., 2020; Li et al., 2012; Zhang et al., 2013), affecting fitness

and, maybe, viability of neuroendocrine systems (Osterstock et al., 2014) or promoting changes

in gene-miRNA micronetworks (Messina et al., 2016; Zhang et al., 2017) remains to be

explored.

In conclusion, our results established the importance of α-tanycytes in the production

and maintenance of the NSPC pool of the entire MBH. In particular, they show that the

elimination of these GFAP-expressing tanycytes severely impairs the activity and function of

GnRH neurons leading to hypogonadotropic hypogonadism and alters sexual behaviours in

male mice, highlighting their key role in the control of reproduction.

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

REFERENCES

Akmayev, I. G., Fidelina, O. V., Kabolova, Z. A., Popov, A. P., & Schitkova, T. A. (1973).

Morphological aspects of the hypothalamic-hypophyseal system. IV. Medial basal

hypothalamus. An experimental morphological study. Z Zellforsch Mikrosk Anat,

137(4), 493-512. doi: 10.1007/BF00307226

Ali, M. A., & Kravitz, A. V. (2018). Challenges in quantifying food intake in rodents. Brain

Res, 1693(Pt B), 188-191. doi: 10.1016/j.brainres.2018.02.040

Batailler M, Droguerre M, Baroncini M, Fontaine C, Prevot V, & Migaud M. (2014). DCX-

expressing cells in the vicinity of the hypothalamic neurogenic niche: a comparative

study between mouse, sheep, and human tissues. J Comp Neurol, 522(8), 1966-1985.

Batailler, M., Chesneau, D., Derouet, L., Butruille, L., Segura, S., Cognie, J., . . . Migaud, M.

(2018). Pineal-dependent increase of hypothalamic neurogenesis contributes to the

timing of seasonal reproduction in sheep. Sci Rep, 8(1), 6188. doi: 10.1038/s41598-018-

24381-4

Batailler, M., Derouet, L., Butruille, L., & Migaud, M. (2016). Sensitivity to the photoperiod

and potential migratory features of neuroblasts in the adult sheep hypothalamus. Brain

Struct Funct, 221(6), 3301-3314. doi: 10.1007/s00429-015-1101-0

Bolborea M, & Dale N. (2013 ). Hypothalamic tanycytes: potential roles in the control of

feeding and energy balance. Trends Neurosci, 36(2), 91-100.

Bolborea, M., Pollatzek, E., Benford, H., Sotelo-Hitschfeld, T., & Dale, N. (2020).

Hypothalamic tanycytes generate acute hyperphagia through activation of the arcuate

neuronal network. Proc Natl Acad Sci U S A, 117(25), 14473-14481. doi:

10.1073/pnas.1919887117

Bottcher, M., Muller-Fielitz, H., Sundaram, S. M., Gallet, S., Neve, V., Shionoya, K., . . .

Schwaninger, M. (2020). NF-kappaB signaling in tanycytes mediates inflammation-

induced anorexia. Mol Metab, 39, 101022. doi: 10.1016/j.molmet.2020.101022

Bush, T. G., Savidge, T. C., Freeman, T. C., Cox, H. J., Campbell, E. A., Mucke, L., . . .

Sofroniew, M. V. (1998). Fulminant jejuno-ileitis following ablation of enteric glia in

adult transgenic mice. Cell, 93(2), 189-201. doi: 10.1016/s0092-8674(00)81571-8

Butruille, L., Batailler, M., Mazur, D., Prevot, V., & Migaud, M. (2018). Seasonal

reorganization of hypothalamic neurogenic niche in adult sheep. Brain Struct Funct,

223(1), 91-109. doi: 10.1007/s00429-017-1478-z

Campbell, J. N., Macosko, E. Z., Fenselau, H., Pers, T. H., Lyubetskaya, A., Tenen, D., . . .

Tsai, L. T. (2017). A molecular census of arcuate hypothalamus and median eminence

cell types. Nat Neurosci, 20(3), 484-496. doi: 10.1038/nn.4495

Chaker, Z., George, C., Petrovska, M., Caron, J. B., Lacube, P., Caille, I., & Holzenberger, M.

(2016). Hypothalamic neurogenesis persists in the aging brain and is controlled by

energy-sensing IGF-I pathway. Neurobiol Aging, 41, 64-72. doi:

10.1016/j.neurobiolaging.2016.02.008

Chang, C., Chen, Y. T., Yeh, S. D., Xu, Q., Wang, R. S., Guillou, F., . . . Yeh, S. (2004).

Infertility with defective spermatogenesis and hypotestosteronemia in male mice

lacking the androgen receptor in Sertoli cells. Proc Natl Acad Sci U S A, 101(18), 6876-

6881. doi: 10.1073/pnas.0307306101

Chauvet, N., Privat, A., & Alonso, G. (1996). Aged median eminence glial cell cultures promote

survival and neurite outgrowth of cocultured neurons. Glia, 18(3), 211-223. doi:

10.1002/(SICI)1098-1136(199611)18:3<211::AID-GLIA5>3.0.CO;2-1

Chen, R., Wu, X., Jiang, L., & Zhang, Y. (2017). Single-Cell RNA-Seq Reveals Hypothalamic

Cell Diversity. Cell Rep, 18(13), 3227-3241. doi: 10.1016/j.celrep.2017.03.004

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

Clasadonte, J., & Prevot, V. (2018). The special relationship: glia-neuron interactions in the

neuroendocrine hypothalamus. [Review]. Nat Rev Endocrinol, 14(1), 25-44. doi:

10.1038/nrendo.2017.124

Culler, M. D., & Negro-Vilar, A. (1986). Evidence that pulsatile follicle-stimulating hormone

secretion is independent of endogenous luteinizing hormone-releasing hormone.

Endocrinology, 118(2), 609-612. doi: 10.1210/endo-118-2-609

Culler, M. D., & Negro-Vilar, A. (1987). Pulsatile follicle-stimulating hormone secretion is

independent of luteinizing hormone-releasing hormone (LHRH): pulsatile replacement

of LHRH bioactivity in LHRH-immunoneutralized rats. Endocrinology, 120(5), 2011-

2021. doi: 10.1210/endo-120-5-2011

Deacon, R. M. (2006). Digging and marble burying in mice: simple methods for in vivo

identification of biological impacts. Nat Protoc, 1(1), 122-124. doi:

10.1038/nprot.2006.20

Derouiche, L., Keller, M., Duittoz, A. H., & Pillon, D. (2015). Developmental exposure to

Ethinylestradiol affects transgenerationally sexual behavior and neuroendocrine

networks in male mice. Sci Rep, 5, 17457. doi: 10.1038/srep17457

Dimakopoulou, A., Foran, D., Jayasena, C. N., & Minhas, S. (2020). Stimulation of Leydig and

Sertoli cellular secretory function by anti-oestrogens: Tamoxifen. Curr Pharm Des. doi:

10.2174/1381612826666200213095228

Doetsch, F., Caille, I., Lim, D. A., Garcia-Verdugo, J. M., & Alvarez-Buylla, A. (1999).

Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell,

97(6), 703-716.

Garcia, A. D., Doan, N. B., Imura, T., Bush, T. G., & Sofroniew, M. V. (2004). GFAP-

expressing progenitors are the principal source of constitutive neurogenesis in adult

mouse forebrain. Nat Neurosci, 7(11), 1233-1241. doi: 10.1038/nn1340

Gibson, M. J., Ingraham, L., & Dobrjansky, A. (2000). Soluble factors guide gonadotropin-

releasing hormone axonal targeting to the median eminence. [Research Support, U.S.

Gov't, P.H.S.]. Endocrinology, 141(9), 3065-3071. doi: 10.1210/endo.141.9.7656

Glover, L. R., Schoenfeld, T. J., Karlsson, R. M., Bannerman, D. M., & Cameron, H. A. (2017).

Ongoing neurogenesis in the adult dentate gyrus mediates behavioral responses to

ambiguous threat cues. [Comparative Study]. PLoS Biol, 15(4), e2001154. doi:

10.1371/journal.pbio.2001154

Goodman, T., Nayar, S. G., Clare, S., Mikolajczak, M., Rice, R., Mansour, S., . . . Hajihosseini,

M. K. (2020). Fibroblast growth factor 10 is a negative regulator of postnatal

neurogenesis in the mouse hypothalamus. Development, 147(13). doi:

10.1242/dev.180950

Haan, N., Goodman, T., Najdi-Samiei, A., Stratford, C. M., Rice, R., El Agha, E., . . .

Hajihosseini, M. K. (2013). Fgf10-expressing tanycytes add new neurons to the

appetite/energy-balance regulating centers of the postnatal and adult hypothalamus. The

Journal of neuroscience : the official journal of the Society for Neuroscience, 33(14),

6170-6180. doi: 10.1523/JNEUROSCI.2437-12.2013

Hall, J. E., Brodie, T. D., Badger, T. M., Rivier, J., Vale, W., Conn, P. M., . . . Crowley, W. F.,

Jr. (1988). Evidence of differential control of FSH and LH secretion by gonadotropin-

releasing hormone (GnRH) from the use of a GnRH antagonist. J Clin Endocrinol

Metab, 67(3), 524-531. doi: 10.1210/jcem-67-3-524

Hamernik, D. L., Crowder, M. E., Nilson, J. H., & Nett, T. M. (1986). Measurement of

messenger ribonucleic acid for luteinizing hormone beta-subunit, alpha-subunit, growth

hormone, and prolactin after hypothalamic pituitary disconnection in ovariectomized

ewes. Endocrinology, 119(6), 2704-2710. doi: 10.1210/endo-119-6-2704

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

Huang, L., DeVries, G. J., & Bittman, E. L. (1998). Photoperiod regulates neuronal

bromodeoxyuridine labeling in the brain of a seasonally breeding mammal. J Neurobiol,

36(3), 410-420.

Imura, T., Kornblum, H. I., & Sofroniew, M. V. (2003). The predominant neural stem cell

isolated from postnatal and adult forebrain but not early embryonic forebrain expresses

GFAP. J Neurosci, 23(7), 2824-2832.

Kameda, Y., Arai, Y., & Nishimaki, T. (2003). Ultrastructural localization of vimentin

immunoreactivity and gene expression in tanycytes and their alterations in hamsters

kept under different photoperiods. Cell and tissue research, 314(2), 251-262. doi:

10.1007/s00441-003-0789-y

Knobil, E. (1990). The GnRH pulse generator. [Research Support, Non-U.S. Gov't

Research Support, U.S. Gov't, P.H.S.]. Am J Obstet Gynecol, 163(5 Pt 2), 1721-1727. doi:

10.1016/0002-9378(90)91435-f

Kokoeva MV, Yin H, & Flier JS. (2007). Evidence for constitutive neural cell proliferation in

the adult murine hypothalamus. J Comp Neurol, 505(2), 209-220.

Kokoeva, M. V., Yin, H., & Flier, J. S. (2005). Neurogenesis in the hypothalamus of adult mice:

potential role in energy balance. Science, 310(5748), 679-683. doi:

10.1126/science.1115360

Lee DA, & Blackshaw S. (2012). Functional implications of hypothalamic neurogenesis in the

adult mammalian brain. Int J Dev Neurosci, 30(8), 615-621.

Lee, D. A., Bedont, J. L., Pak, T., Wang, H., Song, J., Miranda-Angulo, A., . . . Blackshaw, S.

(2012). Tanycytes of the hypothalamic median eminence form a diet-responsive

neurogenic niche. Nature neuroscience, 15(5), 700-702. doi: 10.1038/nn.3079

Li, J., Tang, Y., & Cai, D. (2012). IKKbeta/NF-kappaB disrupts adult hypothalamic neural stem

cells to mediate a neurodegenerative mechanism of dietary obesity and pre-diabetes.

[Research Support, N.I.H., Extramural

Research Support, Non-U.S. Gov't]. Nature cell biology, 14(10), 999-1012. doi:

10.1038/ncb2562

Li, J., Tang, Y., Purkayastha, S., Yan, J., & Cai, D. (2014). Control of obesity and glucose

intolerance via building neural stem cells in the hypothalamus. Mol Metab, 3(3), 313-

324. doi: 10.1016/j.molmet.2014.01.012

Lincoln, G. A., & Fraser, H. M. (1979). Blockade of episodic secretion of luteinizing hormone

in the ram by the administration of antibodies to luteinizing hormone releasing hormone.

Biol Reprod, 21(5), 1239-1245. doi: 10.1095/biolreprod21.5.1239

Marshall, G. P., 2nd, Reynolds, B. A., & Laywell, E. D. (2007). Using the neurosphere assay

to quantify neural stem cells in vivo. [Review]. Curr Pharm Biotechnol, 8(3), 141-145.

doi: 10.2174/138920107780906559

Meirsman, A. C., Le Merrer, J., Pellissier, L. P., Diaz, J., Clesse, D., Kieffer, B. L., & Becker,

J. A. (2016). Mice Lacking GPR88 Show Motor Deficit, Improved Spatial Learning,

and Low Anxiety Reversed by Delta Opioid Antagonist. Biol Psychiatry, 79(11), 917-

927. doi: 10.1016/j.biopsych.2015.05.020

Messager, S., Chatzidaki, E. E., Ma, D., Hendrick, A. G., Zahn, D., Dixon, J., . . . Aparicio, S.

A. (2005). Kisspeptin directly stimulates gonadotropin-releasing hormone release via G

protein-coupled receptor 54. Proc Natl Acad Sci U S A, 102(5), 1761-1766. doi:

10.1073/pnas.0409330102

Messina, A., Langlet, F., Chachlaki, K., Roa, J., Rasika, S., Jouy, N., . . . Prevot, V. (2016). A

microRNA switch regulates the rise in hypothalamic GnRH production before puberty.

Nat Neurosci, 19(6), 835-844. doi: 10.1038/nn.4298

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

Migaud, M., Batailler, M., Pillon, D., Franceschini, I., & Malpaux, B. (2011). Seasonal changes

in cell proliferation in the adult sheep brain and pars tuberalis. Journal of biological

rhythms, 26(6), 486-496. doi: 10.1177/0748730411420062

Migaud, M., Batailler, M., Segura, S., Duittoz, A., Franceschini, I., & Pillon, D. (2010).

Emerging new sites for adult neurogenesis in the mammalian brain: a comparative study

between the hypothalamus and the classical neurogenic zones. The European journal of

neuroscience, 32(12), 2042-2052. doi: 10.1111/j.1460-9568.2010.07521.x

Mohr, M. A., DonCarlos, L. L., & Sisk, C. L. (2017). Inhibiting Production of New Brain Cells

during Puberty or Adulthood Blunts the Hormonally Induced Surge of Luteinizing

Hormone in Female Rats. eNeuro, 4(5). doi: 10.1523/ENEURO.0133-17.2017

Morshead, C. M., Garcia, A. D., Sofroniew, M. V., & van Der Kooy, D. (2003). The ablation

of glial fibrillary acidic protein-positive cells from the adult central nervous system

results in the loss of forebrain neural stem cells but not retinal stem cells. Eur J Neurosci,

18(1), 76-84. doi: 10.1046/j.1460-9568.2003.02727.x

Mullier A, Bouret SG, Prevot V, & Dehouck B. (2010). Differential distribution of tight

junction proteins suggests a role for tanycytes in blood-hypothalamus barrier regulation

in the adult mouse brain. J Comp Neurol, 518(7), 943-962.

Orgeur, P., Bernard, S., Naciri, M., Nowak, R., Schaal, B., & Levy, F. (1999). Psychobiological

consequences of two different weaning methods in sheep. Reprod Nutr Dev, 39(2), 231-

244. doi: 10.1051/rnd:19990208

Osterstock, G., El Yandouzi, T., Romano, N., Carmignac, D., Langlet, F., Coutry, N., . . . Mery,

P. F. (2014). Sustained alterations of hypothalamic tanycytes during posttraumatic

hypopituitarism in male mice. Endocrinology, 155(5), 1887-1898. doi:

10.1210/en.2013-1336

Parkash, J., Messina, A., Langlet, F., Cimino, I., Loyens, A., Mazur, D., . . . Giacobini, P.

(2015). Semaphorin7A regulates neuroglial plasticity in the adult hypothalamic median

eminence. Nat Commun, 6, 6385. doi: 10.1038/ncomms7385

Pavlou, S. N., Debold, C. R., Island, D. P., Wakefield, G., Rivier, J., Vale, W., & Rabin, D.

(1986). Single subcutaneous doses of a luteinizing hormone-releasing hormone

antagonist suppress serum gonadotropin and testosterone levels in normal men. J Clin

Endocrinol Metab, 63(2), 303-308. doi: 10.1210/jcem-63-2-303

Pellegrino, G., Trubert, C., Terrien, J., Pifferi, F., Leroy, D., Loyens, A., . . . Sharif, A. (2018).

A comparative study of the neural stem cell niche in the adult hypothalamus of human,

mouse, rat and gray mouse lemur (Microcebus murinus). J Comp Neurol, 526(9), 1419-

1443. doi: 10.1002/cne.24376

Pencea V, Bingaman KD, Wiegand SJ, & Luskin MB. (2001). Infusion of brain-derived

neurotrophic factor into the lateral ventricle of the adult rat leads to new neurons in the

parenchyma of the striatum, septum, thalamus, and hypothalamus. J Neurosci, 21(17),

6706-6717.

Pierce, A. A., & Xu, A. W. (2010). De novo neurogenesis in adult hypothalamus as a

compensatory mechanism to regulate energy balance. The Journal of neuroscience : the

official journal of the Society for Neuroscience, 30(2), 723-730. doi:

10.1523/JNEUROSCI.2479-09.2010

Pineda, J. L., Lee, B. C., Spiliotis, B. E., Vale, W., Rivier, J., Brown, T. J., & Bercu, B. B.

(1983). Effect of GnRH antagonist, [Ac-delta 3Pro1, pFDPhe2, DTrp3,6] GnRH, on

pulsatile gonadotrop in secretion in the castrate male primate. J Clin Endocrinol Metab,

56(2), 420-422. doi: 10.1210/jcem-56-2-420

Platel, J. C., Gordon, V., Heintz, T., & Bordey, A. (2009). GFAP-GFP neural progenitors are

antigenically homogeneous and anchored in their enclosed mosaic niche. Glia, 57(1),

66-78. doi: 10.1002/glia.20735

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

Prevot V, Croix D, Bouret S, Dutoit S, Tramu G, Stefano GB, & Beauvillain JC. (1999).

Definitive evidence for the existence of morphological plasticity in the external zone of

the median eminence during the rat estrous cycle: implication of neuro-glio-endothelial

interactions in gonadotropin-releasing hormone release. Neuroscience, 94(3), 809-819.

Prevot, V., Dehouck, B., Sharif, A., Ciofi, P., Giacobini, P., & Clasadonte, J. (2018). The

Versatile Tanycyte: A Hypothalamic Integrator of Reproduction and Energy

Metabolism. Endocr Rev, 39(3), 333-368. doi: 10.1210/er.2017-00235

Prieto, M., Chauvet, N., & Alonso, G. (2000). Tanycytes transplanted into the adult rat spinal

cord support the regeneration of lesioned axons. Exp Neurol, 161(1), 27-37. doi:

10.1006/exnr.1999.7223

Robins, S.C., Stewart, I., McNay, D.E., Taylor, V., Giachino, C., Goetz, M., . . . Placzek, M.

(2013). α-Tanycytes of the adult hypothalamic third ventricle include distinct

populations of FGF-responsive neural progenitors. Nat Commun, 4(2049).

Rodriguez, E. M., Blazquez, J. L., Pastor, F. E., Pelaez, B., Pena, P., Peruzzo, B., & Amat, P.

(2005). Hypothalamic tanycytes: a key component of brain-endocrine interaction. Int

Rev Cytol, 247, 89-164. doi: 10.1016/S0074-7696(05)47003-5

Seri, B., Garcia-Verdugo, J. M., McEwen, B. S., & Alvarez-Buylla, A. (2001). Astrocytes give

rise to new neurons in the adult mammalian hippocampus. J Neurosci, 21(18), 7153-

7160.

Sharif A, Fitzsimons C.P., & Lucassen P. (2021). Neurogenesis in the adult hypothalamus: A

distinct form of structural plasticity involved in metabolic and circadian regulation,

with potential relevance for human pathophysiology (Vol. 179): Elsevier B.V.

Sousa-Ferreira L, de Almeida LP, & Cavadas C. (2014). Role of hypothalamic neurogenesis in

feeding regulation. Trends Endocrinol Metab, 25(2), 80-88.

Steyn, F. J., Wan, Y., Clarkson, J., Veldhuis, J. D., Herbison, A. E., & Chen, C. (2013).

Development of a methodology for and assessment of pulsatile luteinizing hormone

secretion in juvenile and adult male mice. Endocrinology, 154(12), 4939-4945. doi:

10.1210/en.2013-1502

Thompson, E. L., Murphy, K. G., Patterson, M., Bewick, G. A., Stamp, G. W., Curtis, A. E., .

. . Bloom, S. R. (2006). Chronic subcutaneous administration of kisspeptin-54 causes

testicular degeneration in adult male rats. Am J Physiol Endocrinol Metab, 291(5),

E1074-1082. doi: 10.1152/ajpendo.00040.2006

Wei. LC, Shi. M, Chen. LW, Cao. R, Zhang. P, & Chan. YS. (2002). Nestin-containing cells

express glial fibrillary acidic protein in the proliferative regions of central nervous

system of postnatal developing and adult mice. Brain Res Dev Brain Res, 139(1), 9-17.

Xu, Y., Tamamaki, N., Noda, T., Kimura, K., Itokazu, Y., Matsumoto, N., . . . Ide, C. (2005).

Neurogenesis in the ependymal layer of the adult rat 3rd ventricle. Experimental

neurology, 192(2), 251-264. doi: 10.1016/j.expneurol.2004.12.021

Yoo, S., & Blackshaw, S. (2018). Regulation and function of neurogenesis in the adult

mammalian hypothalamus. Prog Neurobiol, 170, 53-66. doi:

10.1016/j.pneurobio.2018.04.001

Yoo, S., Cha, D., Kim, S., Jiang, L., Cooke, P., Adebesin, M., . . . Blackshaw, S. (2020).

Tanycyte ablation in the arcuate nucleus and median eminence increases obesity

susceptibility by increasing body fat content in male mice. Glia, 68(10), 1987-2000. doi:

10.1002/glia.23817

Zhang, G., Li, J., Purkayastha, S., Tang, Y., Zhang, H., Yin, Y., . . . Cai, D. (2013).

Hypothalamic programming of systemic ageing involving IKK-beta, NF-kappaB and

GnRH. Nature, 497(7448), 211-216. doi: 10.1038/nature12143

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

Zhang, Y., Kim, M. S., Jia, B., Yan, J., Zuniga-Hertz, J. P., Han, C., & Cai, D. (2017).

Hypothalamic stem cells control ageing speed partly through exosomal miRNAs.

Nature, 548(7665), 52-57. doi: 10.1038/nature23282

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

Table 1, Primary and secondary antibodies used for immunohistochemistry

Primary

antibody

Manufacturer,

species type, cat. no.

Unmasking

step Dilution Secondary

antibody

Manufacturer,

cat. no. Dilution

GFAP Dako, rabbit

polyclonal, #Z0334

1,1000 Donkey anti-rabbit

IgG, Alexa 488

Molecular Probes,

#A21206

1,600

Sox2 R&D systems, goat

polyclonal, #

abAF2018

Sodium

borohydrure

0.1%

1,300 Donkey anti-goat

IgG, Alexa 555

Molecular Probes,

#A21432

1,600

Vimentin Millipore, chicken

polyclonal, #AB5733

1,2000 Donkey anti-

chicken IgY,

Fluorescein

isothiocyanate

Jackson

ImmunoResearch

#703095155

1,600

ERα Santa Cruz-MC20,

rabbit polyclonal,

#sc542

1,200 Donkey anti-rabbit

IgG, Alexa 488

Molecular Probes,

#A21206

1,600

GnRH Polyclonal rabbit (no.

19900)

1,10000 Donkey anti-rabbit

IgG, Alexa 488

Molecular Probes,

#A21206

1,600

Kisspeptin Polyclonal rabbit (no.

564)

Citric acid

(pH 6)

1,5000 Donkey anti-rabbit

IgG, Alexa 555

Molecular Probes,

#A31572

1,600

NPY Sigma, rabbit

polyclonal, #N9528

Citric acid

(pH 6)

1,10000 Donkey anti-rabbit

IgG, Alexa 647

Molecular Probes,

#A31573

1,600

POMC Phoenix, rabbit

polyclonal, #H02930

Sodium

borohydrure

0.1%

1,400 Donkey anti-rabbit

IgG, Alexa 488

Molecular Probes,

#A21206

1,600

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

.CC-BY-ND 4.0 International licensemade available under a

(which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is

The copyright holder for this preprintthis version posted August 1, 2021. ; https://doi.org/10.1101/2021.07.31.454492doi: bioRxiv preprint

The polygamous GnRH neuron: Astrocytic and tanycytic communication with a neuroendocrine neuronal population

Article

Feb 2022

To ensure the survival of the species, hypothalamic neuroendocrine circuits controlling fertility, which converge onto neurons producing gonadotropin‐releasing hormone (GnRH), must respond to fluctuating physiological conditions by undergoing rapid and reversible structural and functional changes. However, GnRH neurons do not act alone, but through reciprocal interactions with multiple hypothalamic cell populations, including several glial and endothelial cell types. For instance, it has long been known that in the hypothalamic median eminence, where GnRH axons terminate and release their neurohormone into the pituitary portal blood circulation, morphological plasticity displayed by distal processes of tanycytes modifies their relationship with adjacent neurons as well as the spatial properties of the neurohemal junction. These alterations not only regulate the capacity of GnRH neurons to release their neurohormone, but also the activation of discrete non‐neuronal pathways that mediate feedback by peripheral hormones onto the hypothalamus. Additionally, a recent breakthrough has demonstrated that GnRH neurons themselves orchestrate the establishment of their neuroendocrine circuitry during postnatal development by recruiting an entourage of newborn astrocytes that escort them into adulthood and, via signaling through gliotransmitters such as prostaglandin E2, modulate their activity and GnRH release. Intriguingly, several environmental and behavioral toxins perturb these neuron‐glia interactions and consequently, reproductive maturation and fertility. Deciphering the communication between GnRH neurons and other neural cell types constituting hypothalamic neuroendocrine circuits is thus critical both to understanding physiological processes such as puberty, estrous cyclicity and aging, and to developing novel therapeutic strategies for dysfunctions of these processes, including the effects of endocrine disruptors.

Fibroblast growth factor 10 is a negative regulator of postnatal neurogenesis in the mouse hypothalamus

Article

Full-text available

Jul 2020

New neurons are generated in the postnatal rodent hypothalamus, with a subset of tanycytes in the third ventricular (3V) wall serving as neural stem/progenitor cells. However, the precise stem cell niche organization, the intermediate steps and the endogenous regulators of postnatal hypothalamic neurogenesis remain elusive. Quantitative lineage-tracing in vivo revealed that conditional deletion of fibroblast growth factor 10 (Fgf10) from Fgf10-expressing β-tanycytes at postnatal days (P)4-5 results in the generation of significantly more parenchymal cells by P28, composed mostly of ventromedial and dorsomedial neurons and some glial cells, which persist into adulthood. A closer scrutiny in vivo and ex vivo revealed that the 3V wall is not static and is amenable to cell movements. Furthermore, normally β-tanycytes give rise to parenchymal cells via an intermediate population of α-tanycytes with transient amplifying cell characteristics. Loss of Fgf10 temporarily attenuates the amplification of β-tanycytes but also appears to delay the exit of their α-tanycyte descendants from the germinal 3V wall. Our findings suggest that transience of cells through the α-tanycyte domain is a key feature, and Fgf10 is a negative regulator of postnatal hypothalamic neurogenesis.

Hypothalamic tanycytes generate acute hyperphagia through activation of the arcuate neuronal network

Article

Full-text available

Jun 2020

Significance Tanycytes are nutrient-sensing cells that line the third ventricle within the hypothalamus. The role of tanycytes in the regulation of food intake has not been documented. Indeed, the mechanistic link between nutrient concentrations in the CSF and activation of neurons responsible for the regulation of food intake, such as orexigenic (NPY/AgRP) or anorexigenic (POMC) cells, is not yet clear. Here, we demonstrate that tanycytes, engineered to express channelrhodopsin, can activate arcuate neurons to induce acute hyperphagia when activated by light. These data provide further evidence that tanycytes are an integral link between CSF nutrients and the hypothalamic neuronal networks that regulate appetite and energy balance.

NF-κB signaling in tanycytes mediates inflammation-induced anorexia

Article

Full-text available

May 2020

Objectives Infections, cancer and systemic inflammation elicit anorexia. Despite the medical significance of this phenomenon, the question of how peripheral inflammatory mediators affect the central regulation of food intake is incompletely understood. Therefore, we have investigated the sickness behavior induced by the prototypical inflammatory mediator IL-1β. Methods IL-1β was injected intravenously. To interfere with IL-1β signaling we deleted the essential modulator of NF-κB signaling (Nemo) in astrocytes and tanycytes. Results Systemic IL-1β increased the activity of the transcription factor NF-κB in tanycytes of the mediobasal hypothalamus (MBH). By activating NF-κB signaling, IL-1β induced the expression of cyclooxygenase-2 (Cox-2) and stimulated the release of the anorexigenic prostaglandin E2 (PGE2) from tanycytes. When we deleted Nemo in astrocytes and tanycytes, the IL-1β-induced anorexia was alleviated whereas the fever and lethargy response were unchanged. Similar results were obtained after selective deletion of Nemo exclusively in tanycytes. Conclusions Tanycytes form the brain barrier that mediates the anorexic effect of systemic inflammation in the hypothalamus.

Tanycyte ablation in the arcuate nucleus and median eminence increases obesity susceptibility by increasing body fat content in male mice

Article

Full-text available

Mar 2020

Tanycytes are radial glial cells located in the mediobasal hypothalamus. Recent studies have proposed that tanycytes play an important role in hypothalamic control of energy homeostasis, although this has not been directly tested. Here, we report the phenotype of mice in which tanycytes of the arcuate nucleus and median eminence were conditionally ablated in adult mice. Although the cerebrospinal fluid‐hypothalamic barrier was rendered more permeable following tanycyte ablation, neither the blood‐hypothalamic barrier nor leptin‐induced pSTAT3 activation in hypothalamic parenchyma were affected. We observed a significant increase in visceral fat distribution accompanying insulin insensitivity in male mice, without significant effect on either body weight or food intake. A high‐fat diet tended to accelerate overall body weight gain in tanycyte‐ablated mice, but the development of visceral adiposity and insulin insensitivity was comparable to wildtype. Thermoneutral housing exacerbated fat accumulation and produced a shift away from fat oxidation in tanycyte‐ablated mice. These results clarify the extent to which tanycytes regulate energy balance, and demonstrate a role for tanycytes in regulating fat metabolism. • Tanycyte ablation resulted in a modest increase of fat mass independent of weight gain and induced insulin resistance.• Tanycyte ablation did not significantly affect the blood‐hypothalamus barrier, leptin response in brain, or pituitary hormone levels.

Challenges in quantifying food intake in rodents

Article

Full-text available

Aug 2018
BRAIN RES

Feeding is a critical behavior that animals depend on for survival, and pathological alterations in food intake underlie disorders such as obesity and anorexia nervosa. To understand these disorders and their development in animal models, researchers must quantify food intake. Although conceptually straightforward, it remains a challenge to obtain accurate records of food intake in rodents. Several approaches have been used to accomplish this, each with benefits and drawbacks. In this article, we survey the four most common methods for measuring food intake in rodents: manual weighing of food, automated weighing scales, pellet dispensers, and video-based analyses. We highlight each method's benefits and drawbacks for use in feeding research, focusing on accuracy, potential sources of errors, affordability, and practical concerns relating to their use. Finally, we discuss the outlook for feeding devices and unmet challenges for measuring food intake in laboratory rodents.

Pineal-dependent increase of hypothalamic neurogenesis contributes to the timing of seasonal reproduction in sheep

Article

Full-text available

Apr 2018

To survive in temperate latitudes, species rely on the photoperiod to synchronize their physiological functions, including reproduction, with the predictable changes in the environment. In sheep, exposure to decreasing day length reactivates the hypothalamo-pituitary-gonadal axis, while during increasing day length, animals enter a period of sexual rest. Neural stem cells have been detected in the sheep hypothalamus and hypothalamic neurogenesis was found to respond to the photoperiod. However, the physiological relevance of this seasonal adult neurogenesis is still unexplored. This longitudinal study, therefore aimed to thoroughly characterize photoperiod-stimulated neurogenesis and to investigate whether the hypothalamic adult born-cells were involved in the seasonal timing of reproduction. Results showed that time course of cell proliferation reached a peak in the middle of the period of sexual activity, corresponding to decreasing day length period. This enhancement was suppressed when animals were deprived of seasonal time cues by pinealectomy, suggesting a role of melatonin in the seasonal regulation of cell proliferation. Furthermore, when the mitotic blocker cytosine-b-D-arabinofuranoside was administered centrally, the timing of seasonal reproduction was affected. Overall, our findings link the cyclic increase in hypothalamic neurogenesis to seasonal reproduction and suggest that photoperiod-regulated hypothalamic neurogenesis plays a substantial role in seasonal reproductive physiology.

The Versatile Tanycyte: A Hypothalamic Integrator of Reproduction and Energy Metabolism

Article

Full-text available

Jan 2018

The fertility and survival of an individual rely on the ability of the periphery to promptly, effectively and reproducibly communicate with brain neural networks that control reproduction, food intake and energy homeostasis. Tanycytes, a specialized glial cell type lining the wall of the third ventricle in the median eminence of the hypothalamus, appear to act as the linchpin of these processes by dynamically controlling the secretion of neuropeptides into the portal vasculature by hypothalamic neurons and regulating blood-brain and blood-cerebrospinal fluid exchanges, both processes that depend on the ability of these cells to adapt their morphology to the physiological state of the individual. In addition to their barrier properties, they possess the ability to sense blood glucose levels, and play a fundamental and active role in shuttling circulating metabolic signals to hypothalamic neurons that control food intake. Moreover, accumulating data suggest that, in keeping with their putative descent from radial glial cells, tanycytes are endowed with neural stem cell properties and may respond to dietary or reproductive cues by modulating hypothalamic neurogenesis. Tanycytes could thus constitute the missing link in the loop connecting behavior, hormonal changes, signal transduction, central neuronal activation and, finally, behavior again. In this paper, we will examine these recent advances in the understanding of tanycytic plasticity and function in the hypothalamus, and the underlying molecular mechanisms. We will also discuss the putative involvement and therapeutic potential of hypothalamic tanycytes in metabolic and fertility disorders.

Stimulation of Leydig and Sertoli Cellular Secretory Function by Anti-Oestrogens: Tamoxifen

Article

Feb 2020

Tamoxifen is a selective oestrogen receptor modulator (SERM). SERMs act on oestrogen receptors to inhibit oestradiol mediated negative feedback on the hypothalamic-pituitary-gonadal (HPG) axis, thereby upregulating gonadotrophin secretion and release from the pituitary. Hence, Tamoxifen is used to upregulate activation of the HPG axis in the treatment of male-factor infertility. However, due to a lack of robust evidence, Tamoxifen has not been FDA approved for use in male-factor infertility and so its use is currently off-label. In this study, we performed a literature search of the OVID medline database and identified 37 studies describing the effects of tamoxifen which we then reviewed. Evidence suggests Tamoxifen effectively increases androgen levels and sperm concentrations in males with idiopathic oligozoospermia. Evidence for increased motility and pregnancy rates in these patients is less conclusive. Further randomised control trials are needed to elucidate the safety of Tamoxifen combination therapies and their efficacy in improving pregnancy rates.

Regulation and function of neurogenesis in the adult mammalian hypothalamus

Article

Apr 2018

Over the past two decades, evidence has accumulated that neurogenesis can occur in both the juvenile and adult mammalian hypothalamus. Levels of hypothalamic neurogenesis can be regulated by dietary, environmental and hormonal signals. Since the hypothalamus has a central role in controlling a broad range of homeostatic physiological processes, these findings may have far ranging behavioral and medical implications. However, many questions in the field remain unresolved, including the cells of origin of newborn hypothalamic neurons and the extent to which these cells actually regulate hypothalamic-controlled behaviors. In this manuscript, we conduct a critical review of the literature on postnatal hypothalamic neurogenesis in mammals, lay out the main outstanding controversies in the field, and discuss how best to advance our knowledge of this fascinating but still poorly understood process.

A comparative study of the neural stem cell niche in the adult hypothalamus of human, mouse, rat and grey mouse lemur ( Microcebus murinus )

Article

Dec 2017
J COMP NEUROL

The adult brain contains niches of neural stem cells that continuously add new neurons to selected circuits throughout life. Two niches have been extensively studied in various mammalian species including humans, the subventricular zone of the lateral ventricles and the subgranular zone of the hippocampal dentate gyrus. Recently, studies conducted mainly in rodents have identified a third neurogenic niche in the adult hypothalamus. In order to evaluate whether a neural stem cell niche also exists in the adult hypothalamus in humans, we performed multiple immunofluorescence labeling to assess the expression of a panel of neural stem/progenitor cell (NPC) markers (Sox2, nestin, vimentin, GLAST, GFAP) in the human hypothalamus and compared them with the mouse, rat and a non-human primate species, the grey mouse lemur (Microcebus murinus). Our results show that the adult human hypothalamus contains four distinct populations of cells that express the five NPC markers: i) a ribbon of small stellate cells that lines the third ventricular wall behind a hypocellular gap, similar to that found along the lateral ventricles, ii) ependymal cells, iii) tanycytes, which line the floor of the third ventricle in the tuberal region, and iv) a population of small stellate cells in the suprachiasmatic nucleus. In the mouse, rat and mouse lemur hypothalamus, co-expression of NPC markers is primarily restricted to tanycytes, and these species lack a ventricular ribbon. Our work thus identifies four cell populations with the antigenic profile of NPCs in the adult human hypothalamus, of which three appear specific to humans. This article is protected by copyright. All rights reserved.

Selective ablation of adult GFAP-expressing tanycytes leads to hypogonadotropic hypogonadism in males

Abstract

Recommended publications

INRAE (France) is recruiting 55 research scientists

INRAE is hiring 10 research scientists - Call for research projects (CRCN)

INRAE is hiring 45 Scientists through open competitions and offering permanent positions.

Selective Depletion of Adult GFAP-Expressing Tanycytes Leads to Hypogonadotropic Hypogonadism in Mal...

Selective depletion of adult GFAP-expressing tanycytes leads to hypogonadotropic hypogonadism in mal...

GFAP-expressing cells in the adult hypothalamus can generate multiple neural cell lineages in vitro

Adult Neurogenesis and Reproductive Functions in Mammals

Cell proliferation and glial cell marker expression in the wall of the third ventricle in the tubera...