Available via license: CC BY 4.0
Content may be subject to copyright.
A new species of Micryletta Dubois, 1987
(Anura,Microhylidae) from Yunnan Province, China
Shuo Liu1, Mian Hou2, Mingzhong Mo3, Dingqi Rao4
1 Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences, 32 Jiaochang Donglu, Kunming,
Yunnan 650223, China
2 College of Continuing (Online) Education, Sichuan Normal University, No. 5, Jing’an Road, Jinjiang District, Chengdu, Sichuan 610066, China
3 Honghe Prefecture Forestry and Grassland Bureau of Yunnan Province, Honghe Avenue and Tianzhu Road’s intersection, Mengzi, Yunnan
661199, China
4 Kunming Institute of Zoology, Chinese Academy of Sciences, No. 17 Longxin Road, Kunming, Yunnan 650201, China
http://zoobank.org/0B4CC0BB-19C0-4E1E-8542-E2CD5A9D6B60
Corresponding authors: Shuo Liu (liushuo@mail.kiz.ac.cn); Dingqi Rao (raodq@mail.kiz.ac.cn)
Academic editor: Günter Gollmann ♦
Received
5 June 2021 ♦
Accepted
8 July 2021 ♦
Published
23 July 2021
Abstract
A new species of the genus Micryletta Dubois, 1987 is described from Yunnan Province, China, based on morphological and mo-
lecular analyses. The most obvious dierences between the new species and other species of this genus are small body size, unique
coloration, and relatively longer hind limbs. In 16S rRNA gene sequences, the new species is diverged from all other congeners by
3.1%–8.0%.
Key Words
16S rRNA, Hekou County, Honghe Prefecture, Paddy Frog, taxonomy
Introduction
The genus Micryletta was originally described by Dubois
(1987). Initially, Micryletta was considered to be synon-
ymous with Microhyla (Zhao and Adler 1993; Fei 1999),
and eventually, it was shown to be phylogenetically dis-
tinct in the subfamily Microhylinae (Frost et al. 2006;
Van der Meijden et al. 2007; Kurabayashi et al. 2011; Py-
ron and Wiens 2011; De Sá et al. 2012; Blackburn et al.
2013; Peloso et al. 2016; Tu et al. 2018; Poyarkov et al.
2018; Garg and Biju 2019).
To date, the genus Micryletta comprises nine recog-
nized species: M. aishani Das, Garg, Hamidy, Smith &
Biju, 2019; M. dissimulans Suwannapoom, Nguyen,
Pawangkhanant, Gorin, Chomdej, Che & Poyarkov,
2020; M. erythropoda (Tarkhnishvili, 1994); M. immac-
ulata Yang & Poyarkov, 2021; M. inornata (Bouleng-
er, 1890); M. lineata (Taylor, 1962); M. nigromaculata
Poyarkov, Nguyen, Duong, Gorin & Yang, 2018; M.
steinegeri (Boulenger, 1909); and M. sumatrana Munir,
Hamidy, Matsui, Kusrini & Nishikawa, 2020. Among
them, M. lineata had been regarded as a subspecies of
M. inornata until it was recently elevated to full species
(Zug and Mulcahy 2020; Miller et al. 2021).
During our eldwork in Honghe Prefecture, Yunnan
Province, China, in May 2021, two specimens of the genus
Micryletta were collected from Hekou County. Phylogenet-
ic analysis based on the 16S rRNA mtDNA gene showed the
two specimens distinct from all other species of the genus.
Thus, we describe these two specimens as a new species.
Herpetozoa 34: 131–140 (2021)
DOI 10.3897/herpetozoa.34.e69755
Copyright Shuo Liu et al. This is an open access article distributed under the terms of the Creative Commons Attribution License
(CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source
are credited.
herpetozoa.pensoft.net
Shuo Liu et al.: A new Paddy Frog species from China
132
Materials and methods
Field survey in Hekou County, Honghe Prefecture, Yun-
nan Province, China (Figure 1), was carried out under the
permission of Daweishan National Natural Reserve Man-
agement and Protection Bureau. Specimens were xed
and preserved in 75% ethanol and deposited at Kunming
Natural History Museum of Zoology, Kunming Institute
of Zoology, Chinese Academy of Sciences (KIZ). Mea-
surements were taken to the nearest 0.1 mm with digi-
tal calipers. Paired measurements were made on the left
side. The descriptions of morphological characteristics
followed Poyarkov et al. (2018) with minor modica-
tions. SVL: snout–vent length, measured from the tip of
the snout to cloaca; HL: head length, measured from the
tip of snout to hind border of jaw angle; SL: snout length,
measured from the anterior corner of eye to the tip of
snout; EL: eye length, measured as the distance between
anterior and posterior corners of the eye; NEL: nostril–
eye length, measured as the distance between the anterior
corner of the eye and the nostril center; HW: head width,
measured as the maximum width of head on the level of
mouth angles in ventral view; IND: internarial distance,
measured as the distance between the central points of
nostrils; IOD: interorbital distance, measured as the
shortest distance between the medial edges of eyeballs in
dorsal view; UEW: upper eyelid width, measured as the
maximum distance between the medial edge of eyeball
and the lateral edge of upper eyelid; TMP: Tympanum
length, measured as the horizontal tympanum diameter;
FLL: forelimb length, measured as the length of straight-
ened forelimb to the tip of third nger; LAL: lower arm
and hand length, measured as the distance between el-
bow and the tip of third nger; HAL: hand length, mea-
sured as the distance between the proximal end of outer
palmar (metacarpal) tubercle and the tip of third nger;
1FL: rst nger length, measured as the distance between
the tip and the distal end of inner palmar tubercle; IPTL:
inner palmar tubercle length, measured as the maximum
distance between proximal and distal ends of inner pal-
mar tubercle; OPTL: outer palmar tubercle length, mea-
sured as the maximum diameter of outer palmar tubercle;
3FDD: third nger disk diameter; HLL: hindlimb length,
measured as the length of straightened hindlimb from
groin to the tip of fourth toe; TL: tibia length, measured
as the distance between the knee and tibiotarsal articula-
tion; FL: foot length, measured as the distance between
the base of the inner metatarsal tubercle to the tip of the
fourth toe; IMTL: inner metatarsal tubercle length, mea-
sured as the maximum length of inner metatarsal tuber-
cle; 1TOEL: rst toe length, measured as the distance
between the distal end of inner metatarsal tubercle and
the tip of rst toe; 4TDD: fourth toe disk diameter. We
compared morphological characters of the new species
with other members of the genus relying on original spe-
cies descriptions (Boulenger 1890, 1909; Taylor 1962;
Tarkhnishvili 1994; Poyarkov et al. 2018; Das et al. 2019;
Munir et al. 2020; Suwannapoom et al. 2020; Yang and
Poyarkov 2021) and the additional data from Yang and
Poyarkov (2021).
Total genomic DNA was extracted from liver tissues
using the standard phenol-chloroform method (Hillis et
al. 1996; Sambrook and Russell 2001). A fragment en-
coding mitochondrial 16S rRNA gene was amplied
and sequenced. The primers L2188 (Matsui et al. 2006):
5’–AAAGTGGGCCTAAAAGCAGCCA–3’ and 16H1
(Hedges 1994): 5’–CTCCGGTCTGAACTCAGATCAC-
GTAGG–3’ were used in amplication and cycle sequenc-
ing. Amplied DNA was produced in 20 μl reactions after
an initial denaturation step of 5 min at 94 °C and 43 cy-
cles of denaturation for 1 min at 94 °C, annealing for 1
min with the TouchDown program from 65 °C to 55 °C
reducing 1 °C every cycle, extension for 1 min at 72 °C,
and nal extension for 5 min at 72 °C. PCR products were
isolated through electrophoresis using 1.5% agarose gel,
and further puried using Millipore Microcon Kits. Puri-
ed PCR products were sequenced by Davis Sequencing
using BigDye terminator 3.1 and sequences were edited
and manually managed using SeqMan in Lasergene 7.1
(DNASTAR Inc., Madison, WI, USA) and MEGA X
(Kumar et al. 2018).
All new sequences have been deposited in GenBank,
sequences of all eight nominal Micryletta taxa, includ-
ing type specimens of M. aishani (India), M. dissimulans
(Songkhla, Thailand), M. immaculata (Hainan, China),
M. nigromaculata (Vietnam), and M. sumatrana (Suma-
tra, Indonesia), topotype specimens of M. inornata (Su-
matra, Indonesia), M. erythropoda (Ma Da, Dong Nai,
Vietnam), and M. steinegeri (Taiwan, China), as well as
M. inornata sensu stricto from Tanintharyi, Myanmar,
and M. lineata from southern Thailand and Myanmar
(Poyarkov et al. 2018; Alhadi et al. 2019; Das et al. 2019;
Munir et al. 2020; Suwannapoom et al. 2020; Miller et
al. 2021; Yang and Poyarkov 2021) were downloaded
from Genbank (Table 1). Sequences of Mysticellus fran-
Figure 1. Map showing the type locality (red dot) of Micryletta
hekouensis sp. nov.
Herpetozoa 34: 131–140 (2021)
herpetozoa.pensoft.net
133
Table 1. Localities, voucher information, and GenBank accession numbers for all specimens used in molecular analyses in this study.
Species Voucher Locality Accession No.
Micryletta aishani SDBDU 3920 India: Assam, Cachar district, Subhong MK889218
Micryletta dissimulans AUP01690 Thailand: Songkla Prov., Saba Yoi district MT573414
Micryletta dissimulans AUP01691 Thailand: Songkla Prov., Saba Yoi district MT573415
Micryletta dissimulans AUP01696 Thailand: Songkla Prov., Saba Yoi district MT573416
Micryletta dissimulans AUP01698 Thailand: Songkla Prov., Saba Yoi district MT573413
Micryletta erythropoda ZMMU A4721-1533 Vietnam: Dong Nai, Ma Da (Vinh Cuu) N.R. MH756146
Micryletta erythropoda ZMMU A4721-1542 Vietnam: Dong Nai, Ma Da (Vinh Cuu) N.R. MH756147
Micryletta immaculata KFBG 14270 China: Hainan, Exian MW376736
Micryletta immaculata KFBG 14271 China: Hainan, Exian MW376737
Micryletta inornata MZB Amph 23949 Indonesia: Sumatra, Deli Serdang LC208135
Micryletta inornata MZB Amph 23947 Indonesia: Sumatra, Deli Serdang LC208136
Micryletta inornata MZB Amph 23948 Indonesia: Sumatra, Deli Serdang LC208137
Micryletta inornata MZB Amph 27242 Indonesia: Sumatra, Aceh LC208138
Micryletta inornata USNM 587625 Myanmar: Tanintharyi MT609033
Micryletta inornata USNM 587901 Myanmar: Tanintharyi MT609034
Micryletta lineata KUHE 23858 Thailand: Ranong AB634695
Micryletta lineata CAS 247206 Myanmar: Tanintharyi Div., Kawthaung dist. KM509167
Micryletta nigromaculata ZMMU A5947 Vietnam: Hai Phong, Cat Ba N.P. MH756148
Micryletta nigromaculata ZMMU A5937 Vietnam: Hai Phong, Cat Ba N.P. MH756149
Micryletta nigromaculata ZMMU A5946 Vietnam: Hai Phong, Cat Ba N.P. MH756151
Micryletta nigromaculata DTU 301 Vietnam: Ninh Binh, Cuc Phuong N.P. MH756154
Micryletta steinegeri KUHE 35937 China: Taiwan, Yunlin AB634696
Micryletta steinegeri ZMMU A5336-1 China: Taiwan, Kaohsiung MW376732
Micryletta steinegeri ZMMU A5336-2 China: Taiwan, Kaohsiung MW376733
Micryletta steinegeri ZMMU A5336-3 China: Taiwan, Kaohsiung MW376734
Micryletta sumatrana / Indonesia: Sumatra Selatan MN727065
Micryletta hekouensis sp. nov. KIZ20210510 China: Honghe, Hekou MZ536627
Micryletta hekouensis sp. nov. KIZ20210511 China: Honghe, Hekou MZ536628
Mysticellus franki ZSI/WGRC/V/A/967 India: Kerala, Wayand MK285340
Kaloula pulchra NMNS 3208 China KC822614
Uperodon systoma SDBDU 2005.4723 India: Tamil Nadu: Kunnapattu MG557949
ki, Kaloula pulchra and Uperodon systoma were used as
outgroups according to Suwannapoom et al. (2020) and
Yang and Poyarkov (2021).
Sequences were aligned using ClustalW (Thompson
et al. 1994) integrated in MEGA X (Kumar et al. 2018)
with default parameters. Genetic divergences (uncorrect-
ed p-distance) were calculated in MEGA X with the pa-
rameters Transitions + Transversions, Uniform rates, and
Pairwise deletion (Kumar et al. 2018). The best substi-
tution model GTR+F+G4 was selected using the Akaike
Information Criterion (AIC) in ModelFinder (Kalyaana-
moorthy et al. 2017). Maximum likelihood phylogenet-
ic analysis was performed in IQ-TREE 1.6.12 (Nguyen
et al. 2015), and nodal support was estimated by 1,000
ultrafast bootstrap (UFB) replicates. Nodes with UFB
values of 95 and above were considered signicantly
supported (Minh et al. 2013). Bayesian Inference was
performed in MrBayes 3.2.7 (Ronquist et al. 2012) based
on the selected substitution model. Two runs were per-
formed simultaneously with four Markov chains starting
from a random tree. The chains were run for 1,000,000
generations and sampled every 100 generations. The
rst 25% of the sampled trees were discarded as burn-in
after the standard deviation of split frequencies of the
two runs was less than a value of 0.01, and then the re-
maining trees were used to create a 50% majority-rule
consensus tree and to estimate Bayesian posterior proba-
bilities (BPP). Nodes were considered well-supported if
they had BPP of 0.95 or higher (Huelsenbeck et al. 2001;
Wilcox et al. 2002).
Results
Bayesian inference and Maximum likelihood analyses re-
covered consistent topology (Figure 2) and agreed essen-
tially with earlier phylogenies of Micryletta (Poyarkov et
al. 2018; Das et al. 2019; Suwannapoom et al. 2020; Yang
and Poyarkov 2021). The two specimens from Hekou
County were nested in the genus Micryletta and formed a
distinct clade sister to a clade consisting of M. immacula-
ta and M. steinegeri with strong support.
The genetic divergences between the two specimens
from Hekou County and all other congeners ranged from
3.1% (with M. steinegeri) to 8.0% (with M. nigromacu-
lata) (Table 2).
Micryletta hekouensis sp. nov.
http://zoobank.org/1CEEDB31-AFF2-427B-A219-860D0C0C991E
Figures 3–5
Type material. Holotype. KIZ20210510, adult male
from Nanxi village, Nanxi Town, Hekou County, Hong-
he Prefecture, Yunnan Province, China (22°38'17"N,
103°59'8"E, elevation 350 m a.s.l.), collected by Shuo
Liu at 23:50 on 15 May 2021.
Paratype. KIZ20210511, adult female from the same
locality as for the holotype, collected by Shuo Liu at
21:15 on 17 May 2021.
Diagnosis. Micryletta hekouensis sp. nov. can be dis-
tinguished from its congeners by a combination of the
herpetozoa.pensoft.net
Shuo Liu et al.: A new Paddy Frog species from China
134
Figure 2. Bayesian Inference tree of Micryletta reconstructed on the base of 16S rRNA gene sequences. Values before slashes
correspond to Bayesian posterior probabilities (>0.9 remain), and values after slashes correspond to Maximum Likelihood bootstrap
replicates (>90 remain).
Table 2. Uncorrected p-distances (%) of 16S rRNA sequences among Micryletta species and outgroups.
1234567891011 12
1 Micryletta aishani
2 Micryletta dissimulans 4.4
3 Micryletta erythropoda 4.7 7.4
4 Micryletta immaculata 4.5 6.4 7.2
5 Micryletta inornata 5.1 6.1 7.7 7.2
6 Micryletta lineata 3.2 6.0 2.9 9.5 6.5
7 Micryletta nigromaculata 4.7 5.2 8.2 8.0 6.7 7.0
8 Micryletta steinegeri 3.5 4.8 6.6 4.2 5.6 5.1 7.1
9 Micryletta sumatrana 5.9 5.1 9.1 8.3 8.2 7.4 5.5 6.0
10 Micryletta hekouensis sp. nov. 3.5 5.0 6.4 4.6 5.7 4.6 8.0 3.1 6.7
11 Mysticellus franki 8.6 9.3 10.2 9.4 9.8 8.8 10.0 9.0 10.7 9.2
12 Kaloula pulchra 10.4 9.2 14.1 16.7 9.9 17.3 12.8 14.3 12.1 14.7 11.4
13 Uperodon systoma 10.1 11.1 12.5 10.3 12.7 10.3 10.2 9.9 11.3 10.1 9.7 8.3
following characters: small-sized within genus (SVL
20.5–20.8 mm); areas above canthus rostralis, upper
eyelids, areas posterior to eyelids, and dorsum of upper
arms golden, other parts of dorsum almost solid black
or yellowish grey with brownish black stripes; lateral
sides of head and body black or yellowish grey, a white
stripe from lower front of eye along upper lip back to
anterior forelimb insertion; ventral side of body and
limbs pink brown, chin region in adult males brownish
black, small and irregular white marbling patterns on
chest and lateral belly; supratympanic fold indistinct;
outer metatarsal tubercle absent; webbing between toes
absent; tibiotarsal articulation adpressed limb reaching
level of front of eye.
Description of holotype. Adult male. SVL 20.5 mm;
habitus relatively slender; head small and triangular,
slightly wider (HW 6.9 mm) than long (HL 6.5 mm);
snout (SL 2.9 mm) abruptly rounded in dorsal view and
slightly acuminate in prole, projecting beyond margin
of lower jaw; eyes relatively small, slightly protuberant,
pupil oval, transverse, eye diameter (EL 2.5 mm) ap-
proximately equal to interorbital distance (IOD 2.4 mm).
Top of head at, canthus rostralis rounded and distinct;
loreal region weakly concave; nostril round, closer to tip
Herpetozoa 34: 131–140 (2021)
herpetozoa.pensoft.net
135
Figure 3. Type series of Micryletta hekouensis sp. nov. in preservative. A. dorsal view; B. ventral view.
herpetozoa.pensoft.net
Shuo Liu et al.: A new Paddy Frog species from China
136
of snout than to eye; interorbital distance (IOD 2.4 mm)
greater than internarial distance (IND 2.0 mm) and upper
eyelid width (UEW 1.7 mm). Tympanum rounded, small
(TMP 0.6 mm) and distinct; supratympanic fold very in-
distinct. Choanae rounded; vomerine teeth absent; open-
ing of vocal sac long cleft; tongue slender, with no notch
at posterior tip.
Forelimbs slender (FLL 14.9 mm), lower arm and
hand length (LAL 10.9 mm) more than a half of snout-
vent length (LAL/SVL 0.53). Fingers slender with no
webbing, rounded in cross-section, no lateral fringes; rst
nger well-developed, second nger slightly shorter than
fourth, relative nger lengths: I<II<IV<III; tips of ngers
round and not dilated; subarticular tubercles on ngers
distinct, rounded and prominent, formula 1, 1, 2, 2; super-
numerary tubercles on palm present and developed; three
metacarpal tubercles, inner one rounded and smallest
(IPTL 0.4 mm), median one (MPTL 0.7 mm) rounded and
almost directly in front of elongated outer one (OPTL 0.8
mm); two rounded and one elongated prominent supernu-
merary palmar tubercles on the base of ngers II–IV, re-
spectively, slightly larger than inner metacarpal tubercle;
nuptial pad absent.
Hindlimbs slender and long (HLL 33.3 mm), more
than two times longer than forelimbs (HLL/FLL 2.23);
tibia (TL 10.9 mm) slightly shorter than one-third of
hindlimb length; tibiotarsal articulation of adpressed limb
reaching level of front of eye; foot (FL 11.4 mm) slight-
ly longer than tibia. Relative toe lengths: I<II<V<III<IV;
tarsus smooth, tarsal fold absent; tips of toes round and
not dilated, slightly wider than those of ngers; webbing
between toes absent; subarticular tubercles on toes oval
and prominent, formula: 1, 1, 2, 3, 2; dermal ridges pres-
ent under 2nd to 4th toes but indistinct; inner metatarsal tu-
bercle oval, prominent, and small (IMTL 0.7 mm); outer
metatarsal tubercle absent.
Dorsal skin smooth above, scattered with tiny and at
tubercles on dorsum of body, anks, and hindlimbs; sub-
tle longitudinal median ridge present on dorsum; dorso-
lateral fold absent; lateral sides of head smooth; ventral
skin of body and limbs smooth.
Coloration of holotype in life. Areas above canthus
rostralis, upper eyelids, areas just posterior to eyelids,
dorsum of upper arms, and areas above tibiotarsal ar-
ticulation golden; other parts of dorsum of body black
with two indistinct parallel longitudinal grey stripes on
back; other parts of dorsum of limbs black mottled with
gray and yellow. Lateral sides of head and body black,
from lower front of eye along upper lip back to anterior
forelimb insertion white; one indistinct longitudinal grey
stripe on each side of body. Ventral side of body and limbs
pinkish brown, chin region brownish black; small and ir-
regular white marbling patterns on chest and lateral belly;
some small white spots on lower lip. Iris bicolored, with
upper third bronze and lower two-thirds brownish black.
Coloration of holotype in preservative. Colors fad-
ed; areas above canthus rostralis, upper eyelids, and areas
just posterior to eyelids turned to dark grey; dorsum of
upper arms turned to pink; ventral side turned to yellow-
ish white with light gray marbling on chest and lateral
sides of belly; colors of other parts of body almost the
same as in life.
Variation. The female paratype is quite similar in ap-
pearance to the holotype (Table 3), but show some vari-
ations in coloration. The female paratype has a relatively
lighter body color, areas above canthus rostralis, upper
eyelids, areas posterior to eyelids, and dorsum of upper
arms are golden, the same as holotype; however, midline
of the back is brownish black, one discontinuous black
Table 3. Measurements (in mm) of the type specimens of Mic-
ryletta hekouensis sp. nov.
KIZ20210510 KIZ20210511 Mean±SD (n=2)
SVL 20.5 20.8 20.65±0.21
HL 6.5 7.3 6.90±0.57
SL 2.9 2.8 2.85±0.07
EL 2.5 2.4 2.45±0.07
NEL 1.7 1.8 1.75±0.07
HW 6.9 7.1 7.00±0.14
IND 2.0 2.1 2.05±0.07
IOD 2.4 2.2 2.30±0.14
UEW 1.7 1.6 1.65±0.07
TMP 0.6 0.7 0.65±0.07
FLL 14.9 16.2 15.55±0.92
LAL 10.9 11.6 11.25±0.49
HAL 5.3 6.0 5.65±0.49
1FL 3.1 3.1 3.10±0.00
IPTL 0.4 0.4 0.40±0.00
MPTL 0.7 0.7 0.70±0.00
OPTL 0.8 0.8 0.80±0.00
3FDD 0.5 0.4 0.45±0.07
HLL 33.3 34.0 33.65±0.49
TL 10.9 10.8 10.85±0.07
FL 11.4 11.9 11.65±0.35
IMTL 0.7 0.8 0.75±0.07
1TOEL 2.6 3.1 2.85±0.35
4TDD 0.6 0.5 0.55±0.07
Figure 4. Close-up views of the hand and foot of the holotype
(KIZ20210510) of Micryletta hekouensis sp. nov. A. volar view
of left hand; B. plantar view of left foot.
Herpetozoa 34: 131–140 (2021)
herpetozoa.pensoft.net
137
stripe dorsolateral on each side, lower parts of anks
greyish brown; other parts of dorsal and lateral body
are yellowish grey; dorsa of lower arms and hindlimbs
brownish grey with larger and more obvious irregular
yellow spots. The color of the ventral side is similar to
that of the holotype, except that the chin region is not
brownish black but light yellow.
Sexual dimorphism. Male has opening of vocal sac
and single hypopharyngeal vocal sac, female has no vo-
cal sac and opening of vocal sac. Besides this, there is no
signicant morphological character dierence between
males and females.
Etymology. The specic epithet hekouensis refers to
Hekou County, the type locality of the new species. We
propose “Hekou Paddy Frog” for the common English
name and “河口小姬蛙” (Hé Kǒu Xiǎo Jī Wā) for the
common Chinese name of the new species.
Natural history. Specimens of the new species were
found in the grass on the ground at night. Once startled,
they jumped away quickly. The collection site is sur-
rounded by primary broad-leaved forest and bamboo.
There are karst rocks nearby, no water body within a few
hundred meters, and no courtship calls were heard. The
collection site is in the nature reserve and the environ-
ment is not destroyed; this species is not threatened at
present (Figure 6).
Distribution. This species is currently known only
from the type locality, Nanxi Town, Hekou County,
Figure 5. The holotype (KIZ20210510) and the paratype (KIZ20210511) of Micryletta hekouensis sp. nov. in life. A. dorsal view
of the holotype; B. lateral view of the holotype; C. ventral view of the holotype; D. dorsal view of the paratype; E. lateral view of
the paratype; F. ventral view of the paratype.
herpetozoa.pensoft.net
Shuo Liu et al.: A new Paddy Frog species from China
138
Honghe Prefecture, Yunnan Province, China. It is expect-
ed to be found in neighboring Northern Vietnam.
Comparisons. Micryletta hekouensis sp. nov. diers
from M. aishani by relatively smaller body size (SVL
20.5–20.8 mm vs. 22.1–27.3); snout abruptly rounded in
dorsal view and slightly acuminate in lateral view (vs.
snout shape nearly truncate in dorsal view and acute in
lateral view); dorsum almost solid black or yellowish
grey with brownish black stripes (vs. dorsum brown to
reddish brown with several blackish brown spots present
on posterior parts of back and near groin); tibiotarsal ar-
ticulation adpressed limb reaching level of front of eye
(vs. reaching to armpit).
Micryletta hekouensis sp. nov. diers from M. dissim-
ulans by dorsum almost solid black or yellowish grey
with brownish black stripes (vs. dorsum reddish brown
with merging irregular shaped brown blotches edged in
beige); anks black or greyish brown (vs. large black
spots on anks and axillary and inguinal areas present);
white stripes on upper lips present (vs. absent); tibiotarsal
articulation adpressed limb reaching level of front of eye
(vs. reaching to tympanum).
Micryletta hekouensis sp. nov. diers from M. eryth-
ropoda by relatively smaller body (SVL 20.5–20.8 mm
vs. up to 30 mm); dorsum almost solid black or yellow-
ish grey with brownish black stripes (vs. dorsum gray
or beige to saturated ochre or brick red, dark contrast-
ing round or irregular shape spots irregularly scattered
throughout the dorsum); venter without dark patterns (vs.
with relatively distinct dark and light marbled speckling);
outer metatarsal tubercle absent (vs. present); tibiotarsal
articulation adpressed limb reaching level of front of eye
(vs. reaching to posterior edge of tympanum).
Micryletta hekouensis sp. nov. can be distinguished
from M. immaculata by relatively smaller body (SVL
20.5–20.8 mm vs. up to 23.3–30.1 mm); dorsum almost
solid black or yellowish grey with brownish black stripes
(vs. dorsum bronze brown to reddish brown without dark
patterns); supratympanic fold indistinct (vs. distinct);
supratympanic fold indistinct (vs. distinct); webbing be-
tween toes absent (vs. basal and poorly developed); tibi-
otarsal articulation adpressed limb reaching level of front
of eye (vs. reaching to tympanum).
Micryletta hekouensis sp. nov. can be distinguished
from M. inornata sensu stricto from Sumatra, Indonesia,
and from Tanintharyi, Myanmar, by dorsum almost sol-
id black or yellowish grey with brownish black stripes
(vs. dorsum brownish grey with irregular blackish brown
blotches and blackish brown streak); ventral side of body
and limbs pinkish brown or pinkish grey with small and
irregular white marbling patterns on chest and lateral bel-
ly (vs. ventral side of body and limbs light reddish grey
without mottling, nearly immaculate, or chin, chest, and
lateral belly with a few dark marbling patterns); tibiotar-
sal articulation adpressed limb reaching level of front of
eye (vs. reaching to eye).
Micryletta hekouensis sp. nov. can be diagnosed from
M. lineata by supratympanic fold indistinct (vs. distinct);
venter pink brown with small and irregular white mar-
bling patterns on chest and lateral belly (vs. venter beige
with light brown mottling along throat); tibiotarsal artic-
ulation adpressed limb reaching level of front of eye (vs.
reaching to eye).
Micryletta hekouensis sp. nov. diers from M. nigro-
maculata by supratympanic fold indistinct (vs. distinct);
dorsum almost solid black or yellowish grey with brown-
ish black stripes (vs. dorsum brown to reddish brown with
dark brown irregular hourglass shaped pattern and two
large dark inguinal spots); anks black or greyish brown
(vs. anks greyish white with dark patches or spots);
white stripes on upper lips present (vs. absent); chin re-
gion in males brownish black (vs. whitish with light-gray
marbling); tibiotarsal articulation adpressed limb reach-
ing level of front of eye (vs. reaching to eye).
Micryletta hekouensis sp. nov. diers from M. suma-
trana by supratympanic fold indistinct (vs. distinct); dor-
sum almost solid black or yellowish grey with brownish
black stripes (vs. dorsum golden brown scattered with
black spots); dark cross bands on tibia and tarsus absent
(vs. present); venter without dark patterns (vs. with dark
brown and cream mottling).
Micryletta hekouensis sp. nov. diers from M. steine-
geri by relatively smaller body (SVL 20.5–20.8 mm vs.
up to 30 mm); dorsum almost solid black or yellowish
grey with brownish black stripes (vs. dorsum dark gray
Figure 6. Habitat of Micryletta hekouensis sp. nov. at the type
locality in Nanxi Town, Hekou County, Yunnan Province, China.
A. The collection site; B. The surroundings of the collection site.
Herpetozoa 34: 131–140 (2021)
herpetozoa.pensoft.net
139
to violet with irregular dark blotches or speckles); venter
without dark patterns (vs. with grayish white and brown
spots); webbing between toes absent (vs. rudimentary
webbing); tibiotarsal articulation adpressed limb reach-
ing level of front of eye (vs. reaching to tympanum).
Discussion
Yang and Rao (2008), Fei et al. (2009), Fei et al. (2012),
and AmphibiaChina (2021) all recorded Micryletta in-
ornata distributed in Menglun Town, Mengla County,
Xishuangbanna Prefecture, Yunnan Province, China.
Micryletta inornata sensu lato was widely reported from
mainland Southeast Asia; however, recent phylogenetic
studies have indicated that M. inornata sensu stricto is
restricted to Indonesia and southern Myanmar, and the
populations of M. inornata sensu lato contain several
undescribed paraphyletic lineages with respect to other
named taxa (Das et al. 2019; Munir et al. 2020; Miller et
al. 2021). Therefore, the population distribution in Xish-
uangbanna remains to be studied.
Acknowledgements
We would like to thank Decai Ouyang for assistance in
the eld. Thanks to our colleagues for their help and ad-
vice. We also thank the editors and reviewers for their
work on the manuscript. This work was supported by
Science-Technology Basic Condition Platform from the
Ministry of Science and Technology of the People’s Re-
public of China (Grant No. 2005DKA21402), and the
project of Ministry of Ecology and Environment of Chi-
na: Investigation and assessment of amphibians and rep-
tiles in southern Yunnan.
References
Alhadi F, Hamidy A, Farajallah A, Munir M, Atmaja VY, Garg S, Biju
SD, Smith EN (2019) Rediscovery of Micryletta inornata (Bou-
lenger, 1890) from Sumatra: redescription, molecular identity and
taxonomic implications. Zootaxa 4613(1): 111–126. https://doi.
org/10.11646/zootaxa.4613.1.5
AmphibiaChina (2021) The database of Chinese amphibians. Electronic
Database. http://www.amphibiachina.org [Accessed on 1 June 2021]
Blackburn DC, Siler CD, Diesmos AC, McGuire JA, Cannatella DC,
Brown RM (2013) An adaptive radiation of frogs in a Southeast
Asian island archipelago. Evolution 67(9): 2631–2646. https://doi.
org/10.1111/evo.12145
Boulenger GA (1890) List of the reptiles, batrachians, and freshwater
shes collected by Professor Moesch and Mr. Iversen in the district
of Deli, Sumatra. Proceedings of the Zoological Society of London
1890: 30–39.
Boulenger GA (1909) Descriptions of four new frogs and a new
snake discovered by Mr. H. Sauter in Formosa. Annals and Mag-
azine of Natural History Series 4(24): 492–495. https://doi.
org/10.1080/00222930908692704
Das A, Garg S, Hamidy A, Smith EN, Biju SD (2019) A new species
of Micryletta frog (Microhylidae) from Northeast India. PeerJ 7:
e7012. https://doi.org/10.7717/peerj.7012
De Sá RO, Streicher JW, Sekonyela R, Forlani MC, Loader SP, Green-
baum E, Richards S, Haddad CFB (2012) Molecular phylogeny of
microhylid frogs (Anura: Microhylidae) with emphasis on relation-
ships among New World genera. BMC Evolutionary Biology 12:
е241. https://doi.org/10.1186/1471-2148-12-241
Dubois A (1987) Miscellanea taxinomica batrachologica, II. Alytes 6:
1–9.
Fei L (1999) Atlas of Amphibians of China. Henan Press of Science and
Technology, Zhengzhou, 432 pp.
Fei L, Hu SQ, Ye CY, Huang YZ (2009) Fauna Sinica (Vol. 2). Amphib-
ia Anura. Science Press, Beijing, 957 pp.
Fei L, Ye CY, Jiang JP (2012) Colored Atlas of Chinese Amphibians
and Their Distributions. Sichuan Publishing House of Science and
Technology, Chengdu, 620 pp.
Frost DR, Grant T, Faivovich J, Bain RH, Haas A, Haddad CFB, De Sá
RO, Channing A, Wilkinson M, Donnellan SC, Raxworthy CJ, Camp-
bell JA, Blotto BL, Moler P, Drewes RC, Nussbaum RA, Lynch JD,
Green DM, Wheeler WC (2006) The amphibian tree of life. Bulletin
of the American Museum of Natural History 297: 1–291. https://doi.
org/10.1206/0003-0090(2006)297[0001:TATOL]2.0.CO;2
Garg S, Biju SD (2019) New microhylid frog genus from Peninsular
India with Southeast Asian anity suggests multiple Cenozoic bi-
otic exchanges between India and Eurasia. Scientic Reports 9(1):
е1906. https://doi.org/10.1038/s41598-018-38133-x
Hedges SB (1994) Molecular evidence for the origin of birds. Proceed-
ings of the National Academy of Sciences of the United States of
America 91(7): 2621–2624. https://doi.org/10.1073/pnas.91.7.2621
Hillis DM, Moritz C, Mable BK (1996) Molecular Systematics
(2nd Edn.). Sinauer Associates, Sunderland, 655 pp. https://doi.
org/10.2307/1447682
Huelsenbeck JP, Ronquist F, Nielsen R, Bollback JP (2001) Bayesian in-
ference of phylogeny and its impact on evolutionary biology. Science
294(5550): 2310–2314. https://doi.org/10.1126/science.1065889
Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS
(2017) ModelFinder: fast model selection for accurate phylogenet-
ic estimates. Nature Methods 14: 587–589. https://doi.org/10.1038/
nmeth.4285
Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X:
Molecular Evolutionary Genetics Analysis across computing plat-
forms. Molecular Biology and Evolution 35: 1547–1549. https://doi.
org/10.1093/molbev/msy096
Kurabayashi A, Matsui M, Belabut DM, Yong H, Ahmad N, Sudin A,
Kuramoto M, Hamidy H, Sumida M (2011) From Antarctica or
Asia? New colonization scenario for Australian-New Guinean nar-
row mouth toads suggested from the ndings on a mysterious genus
Gastrophrynoides. BMC Evolutionary Biology 11(1): е175. https://
doi.org/10.1186/1471-2148-11-175
Matsui M, Shimada T, Liu W-Z, Maryati M, Khonsue W, Orlov N
(2006) Phylogenetic relationships of Oriental torrent frogs in the
genus Amolops and its allies (Amphibia, Anura, Ranidae). Mo-
lecular Phylogenetics and Evolution 38(3): 659–666. https://doi.
org/10.1016/j.ympev.2005.11.019
herpetozoa.pensoft.net
Shuo Liu et al.: A new Paddy Frog species from China
140
Miller AH, Zug GR, Wogan GOU, Lee JL, Mulcahy DG (2021) Phylog-
eny, diversity, and distribution of Micryletta (Anura: Microhylidae)
in Myanmar. Ichthyology & Herpetology 109(1): 245–257. https://
doi.org/10.1643/h2020100
Minh Q, Nguyen MAT, von Haeseler A (2013) Ultrafast approximation
for phylogenetic bootstrap. Molecular Biology and Evolution 30(5):
1188–1195. https://doi.org/10.1093/molbev/mst024
Munir M, Hamidy A, Matsui M, Kusrini MD, Nishikawa K (2020) A
new species of Micryletta (Amphibia: Anura) from Sumatra, Indo-
nesia. Zoological Science 37(3): 295–301. https://doi.org/10.2108/
zs200006
Nguyen LT, Schmidt HA, von Haeseler A, Minh BQ (2015) IQ-TREE: a
fast and eective stochastic algorithm for estimating maximum-like-
lihood phylogenies. Molecular Biology and Evolution 32: 268–274.
https://doi.org/10.1093/molbev/msu300
Peloso PLV, Frost DR, Richards SJ, Rodrigues MT, Donnellan S, Matsui
M, Raxworthy CJ, Biju SD, Lemmon EM, Lemmon AR, Wheeler
WC (2016) The impact of anchored phylogenomics and taxon sam-
pling on phylogenetic inference in narrow-mouthed frogs (Anura,
Microhylidae). Cladistics 32(2): 113–140. https://doi.org/10.1111/
cla.12118
Poyarkov NA, Nguyen TV, Duong TV, Gorin VA, Yang JH (2018) A
new limestone-dwelling species of Micryletta (Amphibia: Anura:
Microhylidae) from northern Vietnam. PeerJ 6: e5771. https://doi.
org/10.7717/peerj.5771
Pyron RA, Wiens JJ (2011) A large-scale phylogeny of Amphib-
ia including over 2800 species, and a revised classication of
extant frogs, salamanders, and caecilians. Molecular Phyloge-
netics and Evolution 61(2): 543–583. https://doi.org/10.1016/j.
ympev.2011.06.012
Ronquist F, Teslenko M, Van Der Mark P, Ayres DL, Darling A, Höh-
na S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) Mr-
Bayes 3.2: ecient Bayesian phylogenetic inference and model
choice across a large model space. Systematic Biology 61: 539–542.
https://doi.org/10.1093/sysbio/sys029
Sambrook JF, Russell RW (2001) Molecular Cloning: A Laboratory
Manual. Third Edition. Cold Spring Harbor Laboratory Press, New
York, 2345 pp.
Suwannapoom C, Nguyen TV, Pawangkhanant P, Gorin VA, Chomdej S,
Che J, Poyarkov NA (2020) A new species of Micryletta (Amphibia:
Microhylidae) from southern Thailand. Zoological Research 41(5):
581–588. https://doi.org/10.24272/j.issn.2095-8137.2020.139
Tarkhnishvili DN (1994) Amphibian communities of the southern Viet
Nam: preliminary data. Journal of the Bengal Natural History Soci-
ety 13(1): 3–62.
Taylor EH (1962) The amphibian fauna of Thailand. University of Kan-
sas Science Bulletin 43: 265–599. https://www.biodiversitylibrary.
org/page/4379553
Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving
the sensitivity of progressive multiple sequence alignment through
sequence weighting, position-specic gap penalties and weight
matrix choice. Nucleic Acids Research 22: 4673–4680. https://doi.
org/10.1093/nar/22.22.4673
Tu N, Yang MH, Liang D, Zhang P (2018) A large-scale phylogeny of
Microhylidae inferred from a combined dataset of 121 genes and
427 taxa. Molecular Phylogenetics and Evolution 126: 85–91.
https://doi.org/10.1016/j.ympev.2018.03.036
Van der Meijden A, Vences M, Hoegg S, Boistel R, Channin GA,
Meyer A (2007) Nuclear gene phylogeny of narrow-mouthed toads
(Family: Microhylidae) and a discussion of competing hypotheses
concerning their biogeographical origins. Molecular Phylogenet-
ics and Evolution 44(3): 1017–1030. https://doi.org/10.1016/j.
ympev.2007.02.008
Wilcox TP, Zwickl DJ, Heath TA, Hillis DM (2002) Phylogenetic re-
lationships of the Dwarf Boas and a comparison of Bayesian and
bootstrap measures of phylogenetic support. Molecular Phyloge-
netics and Evolution 25: 361–371. https://doi.org/10.1016/S1055-
7903(02)00244-0
Yang DT, Rao DQ (2008) Amphibia and Reptilia of Yunnan. Yunnan
Publishing Group Corporation, Yunnan Science and Technology
Press, Kunming, 411 pp.
Yang JH, Poyarkov NA (2021) A new species of the genus Micrylet-
ta (Anura, Microhylidae) from Hainan Island, China. Zoological
Research 42(2): 234–240. https://doi.org/10.24272/j.issn.2095-
8137.2020.333
Zhao EM, Adler K. 1993. Herpetology of China. Society for the Study
of Amphibians and Reptiles, Oxford, 552 pp.
Zug GR, Mulcahy DG (2020) Identication Guide – Amphibians &
Reptiles of South Tanintharyi. Fauna & Flora International, Cam-
bridge, 203 pp.
