Content uploaded by Pierre-Yves Lozach
Author content
All content in this area was uploaded by Pierre-Yves Lozach on Aug 10, 2021
Content may be subject to copyright.
Article
TMPRSS2expression dictates the entry route used
by SARS-CoV-2to infect host cells
Jana Koch
1,2,3,†
, Zina M Uckeley
1,2,3,†
, Patricio Doldan
1,3
, Megan Stanifer
1,4,*
,
Steeve Boulant
1,3,5,**
& Pierre-Yves Lozach
1,2,3,6,***
Abstract
SARS-CoV-2is a newly emerged coronavirus that caused the global
COVID-19 outbreak in early 2020. COVID-19 is primarily associated
with lung injury, but many other clinical symptoms such as loss of
smell and taste demonstrated broad tissue tropism of the virus.
Early SARS-CoV-2–host cell interactions and entry mechanisms
remain poorly understood. Investigating SARS-CoV-2infection in
tissue culture, we found that the protease TMPRSS2determines
the entry pathway used by the virus. In the presence of TMPRSS2,
the proteolytic process of SARS-CoV-2was completed at the
plasma membrane, and the virus rapidly entered the cells within
10 min in a pH-independent manner. When target cells lacked
TMPRSS2expression, the virus was endocytosed and sorted into
endolysosomes, from which SARS-CoV-2entered the cytosol via
acid-activated cathepsin L protease 40–60 min post-infection.
Overexpression of TMPRSS2in non-TMPRSS2expressing cells abol-
ished the dependence of infection on the cathepsin L pathway and
restored sensitivity to the TMPRSS2inhibitors. Together, our
results indicate that SARS-CoV-2infects cells through distinct,
mutually exclusive entry routes and highlight the importance of
TMPRSS2for SARS-CoV-2sorting into either pathway.
Keywords Coronavirus; COVID-19; protease; SARS-CoV-2; virus entry
Subject Categories Membranes & Trafficking; Microbiology, Virology & Host
Pathogen Interaction
DOI 10.15252/embj.2021107821 | Received 25 January 2021 | Revised 14 June
2021 | Accepted 18 June 2021
The EMBO Journal (2021)e107821
Introduction
The Coronaviridae is a large viral family, consisting of several
hundred members, that constitutes the order Nidovirales along with
Arteriviridae and Roniviridae (Modrow et al, 2013). To date, four
coronaviruses (CoVs) have been identified as leading causes of the
common cold in humans (Paules et al, 2020). Three other CoVs that
cause severe respiratory disease have emerged in the human popu-
lation as a result of spillover events from wildlife during the last two
decades (Hartenian et al, 2020). Severe acute respiratory syndrome
(SARS)-CoV and Middle East respiratory syndrome (MERS)-CoV
were first isolated in China in 2002 and Saudi Arabia in 2011,
respectively (Hartenian et al, 2020). The most recent CoV, SARS-
CoV-2, is responsible for CoV-induced disease 2019 (COVID-19),
which became a pandemic in early 2020. As of May 24, 2021, more
than 167 million human cases of COVID-19 have been reported with
at least 3.4 million deaths.
Similar to other CoVs, SARS-CoV-2 has enveloped, roughly
spherical particles, with a diameter between 90 and 110 nm (Caly
et al, 2020; Ke et al, 2020; Matsuyama et al, 2020). The viral
genome consists of one single-stranded positive-sense RNA segment
that replicates in the cytosol and encodes four structural proteins.
Three transmembrane proteins are embedded in the viral envelope
and are exposed at the virion surface, namely the large glycoprotein
S, the membrane protein M, and the envelope protein E (Hartenian
et al, 2020). The nucleoprotein NP binds to the genomic RNA to
form nucleocapsid structures inside viral particles. In the viral
envelope, glycoprotein S forms spike-like projections up to 35 nm in
length that are responsible for virus attachment to host cells and
penetration by membrane fusion (Turonova et al, 2020).
Although SARS-CoV-2 has been the subject of intense research
since the beginning of 2020, our current understanding of cell entry
remains essentially derived from studies on SARS-CoV-1 and other
CoVs (Hartenian et al, 2020). SARS-CoV-2 has been shown to rely
on ACE2 (Hoffmann et al, 2020b), heparan sulfates (Clausen et al,
2020), and neuropilin-1 (Daly et al, 2020) at the cell surface for
infection. Inhibitor studies support the possibility that the virus
enters endosomal vesicles and relies on vacuolar acidification for
the infectious entry process (Hoffmann et al, 2020b; Ou et al, 2020;
1Center for Integrative Infectious Diseases Research (CIID), University Hospital Heidelberg, Heidelberg, Germany
2CellNetworks –Cluster of Excellence, Heidelberg, Germany
3Department of Infectious Diseases, Virology, University Hospital Heidelberg, Heidelberg, Germany
4Department of Infectious Diseases, Molecular Virology, University Hospital Heidelberg, Heidelberg, Germany
5German Cancer Center (DKFZ), Heidelberg, Germany
6INRAE, EPHE, IVPC, University of Lyon, Lyon, France
*Corresponding author. Tel: +49 0 6221 56 7858; E-mail: m.stanifer@dkfz-heidelberg.de
**Corresponding author. Tel: +49 0 6221 56 7865; E-mail: s.boulant@dkfz-heidelberg.de
***Corresponding author. Tel: +49 0 6221 56 1328; E-mail: pierre-yves.lozach@med.uni-heidelberg.de
†
These authors contributed equally to this work
ª2021 The Authors. Published under the terms of the CC BY NC ND 4.0license The EMBO Journal e107821 |2021 1of 20
Wang et al, 2020). As with many other CoVs, there is intense debate
as to whether SARS-CoV-2 enters host cells from the plasma
membrane directly or through intracellular compartments.
To gain access to the cytosol, enveloped viruses must fuse their
envelope with the cell membrane. Several classes of viral fusion
proteins are known to mediate this process, each with their own
molecular specificities [reviewed in (Harrison, 2015)]. Structural
studies categorized the SARS-CoV-2 S protein as a class-I viral
fusion protein, within the same group as those from other CoVs,
human immunodeficiency virus, and influenza A virus (IAV) (Lai
et al, 2017; Walls et al, 2020; Wrapp et al, 2020). Cryo-electron
microscopy showed that the S protein forms homotrimers on the
surface of the SARS-CoV-2 particle, in which the viral fusion subu-
nits are buried (Ke et al, 2020; Walls et al, 2020; Wrapp et al,
2020). The activation of class-I viral fusion proteins usually
involves proteolytic processing, and membrane fusion is triggered
by interactions with cell receptors and sometimes endosomal acidi-
fication. Activation and priming are irreversible steps, and class-I
viral fusion proteins act only once (Harrison, 2015). In the case of
SARS-CoV-2, endosomal acidification appears to be nonessential
for spike-mediated fusion of the host membrane with the viral
envelope (Buchrieser et al, 2020). However, why SARS-CoV-2
infection is sensitive to the perturbation of endosomal acidification
remains unclear.
Several proteases have been proposed to prime and activate the
S protein (Bestle et al, 2020; Tang et al, 2021), a step prior to virus
fusion and infection. Furin is a calcium-dependent serine endopro-
tease that is widely expressed in diverse tissues. It has been
proposed to cleave the S protein at site S1/S2 (Bestle et al, 2020;
Coutard et al, 2020; Hoffmann et al, 2020a), most likely when viral
progeny exit infected cells. The cleavage produces two subunits, S1
and S2. S1 contains a receptor-binding domain, and S2 is the
membrane fusion effector. Additional proteolytic cleavage in the S2
subunit at the site S20occurs during virus entry to trigger fusion of
the viral envelope with the host cell membrane. Transmembrane
serine protease 2 (TMPRSS2), a cell surface trypsin-like protease
(Choi et al, 2009), and cathepsin L, an endolysosomal cysteine
protease (Mohamed & Sloane, 2006), have both been proposed to be
involved in cleavage at the S20site (Bestle et al, 2020; Hoffmann
et al, 2020b; Liu et al, 2020; Matsuyama et al, 2020; Shang et al,
2020). Nevertheless, the timing and dynamics of these proteolytic
cleavages and their potential roles in SARS-CoV-2 activation, fusion,
and entry remain poorly characterized.
SARS-CoV-2 primarily targets cells of the lung epithelium but is
also found in many other epithelial tissues as it spreads throughout
the host. Epithelia cells express ACE2, TMPRSS2, and cathepsin L,
and these different cellular factors are likely to differentially influ-
ence the cell entry mechanisms of SARS-CoV-2 in a specific manner.
To determine whether SARS-CoV-2 enters epithelial cells from intra-
cellular compartments and whether endosomal acidification is
involved, we analyzed the proteolytic processing, dependence on
low pH for infection, intracellular trafficking, and membrane fusion
of the virus in various epithelial cell types. The results showed that
SARS-CoV-2 shares with other CoVs the ability to use different host
cell proteases and distinct entry pathways to infect target cells.
Unlike SARS- and MERS-CoV, SARS-CoV-2 uses mutually exclusive
routes to enter cells, and TMPRSS2 is critical for the sorting of the
virus into either pathway.
Results
Characterization of the SARS-CoV-2life cycle in Caco-2and
Vero cells
Many epithelial cell types have been reported to support productive
SARS-CoV-2 infection (Hoffmann et al, 2020b), and both TMPRSS2
and cathepsin L in target cells have been implicated in the prote-
olytic processing of the viral S protein (Bestle et al, 2020; Hoffmann
et al, 2020b; Liu et al, 2020; Matsuyama et al, 2020; Shang et al,
2020). We selected four epithelial cell lines that are known to
support SARS-CoV-2 infection, i.e., Calu-3, Caco-2, A549, and Vero
cells (Hoffmann et al, 2020b). A549 cells are intrinsically poorly
infectable by SARS-CoV-2 due to the absence of the SARS-CoV-2
receptor ACE2 (Hoffmann et al, 2020b). As such, we used A549 cells
stably overexpressing ACE2 (A549*) (Steuten et al, 2021). When cell
lysates were subjected to SDS–PAGE and Western blotting, we
found that TMPRSS2 was effectively expressed in Calu-3 cells and to
a lesser extent in Caco-2 cells (Fig 1A), corroborating results from
other groups (Zecha et al, 2020; Steuten et al, 2021). TMPRSS2 was
seen as a band of approximately 50 kDa in both Calu-3 and Caco-2
cells. A second band of approximately 42 kDa was observed in
Caco-2 cells, which represents a cleaved form of TMPRSS2 (Chen
et al, 2010). Regardless of the presence of TMPRSS2, cathepsin L
(from 25 to 31 kDa) and its inactive form, i.e., procathepsin L (35 to
41 kDa), were present in all the cell lines (Fig 1B). However, the
conversion of procathepsin L to cathepsin L appeared to be signifi-
cantly higher in Vero cells than in the three other cell lines.
To address how the presence or absence of TMPRSS2 influences
SARS-CoV-2 infectious penetration and how endosomal acidification
contributes to the process, we aimed to compare cell lines express-
ing or not expressing this protease. To this end, we first defined the
timing for a single round of infection in the selected cell lines. Calu-
3 and Caco-2 served as TMPRSS2-positive (TMPRSS2+) cells, and
A549*and Vero cells served as TMPRSS2-nonexpressing
(TMPRSS2) cells. The susceptibility of Caco-2 and Vero cells to
SARS-CoV-2 at a multiplicity of infection (MOI) of 0.2 was assessed
8 h post-infection (hpi) by fluorescence microscopy after immunos-
taining with a mouse monoclonal antibody (mAb) against the intra-
cellular viral nucleoprotein NP (Fig 1C). The results showed that
10% of Caco-2 cells were positive for NP while 35% of Vero cells
were infected (Fig 1C).
To quantify infection more accurately, we then performed
flow cytometry analysis of Caco-2 and Vero cells infected with
SARS-CoV-2 at different MOIs (Fig 1D and E). The fluorescence
increased over time and reached a plateau within 16 hpi in
Caco-2 cells (Fig 1E and Appendix Fig S1), showing that the
signal detected in the flow cytometry-based assays corresponded
to viral replication and not to the input particles. These kinetics
were in agreement with real-time quantitative reverse transcrip-
tion PCR (qRT–PCR) monitoring over time of the SARS-CoV-2
genome (Fig 1F).
To evaluate the production and release of de novo infectious viral
particles, we infected Caco-2 and Vero cells and quantified virus
production up to 24 hpi by a 50% tissue culture infective dose assay
(TCID50). Infectious progeny viruses were found to be released
from infected cells as early as 8–12 hpi (Fig 1G). Virus replication
kinetics and de novo virus release were found to be similar in Calu-3
2of 20 The EMBO Journal e107821 |2021 ª2021 The Authors
The EMBO Journal Jana Koch et al
and A549*cells. Altogether, our analysis revealed that SARS-CoV-2
completes one round of infection, from virus binding and entry to
replication and release of de novo infectious particles, within 8 h in
Caco-2 cells and in a somewhat longer window in Vero cells,
between 8 and 12 h. In all further experiments, as we aimed to char-
acterize SARS-CoV-2 entry mechanisms, we limited our assays to 8
hpi. In addition, as our cell lines differed in their sensitivity to
SARS-CoV-2 infection, we used different MOIs for each cell line
allowing the infection of approximately 20% of the cells. This range
of infection generally avoids saturation of cells and thus allows
detection of potential inhibitory or enhancing effects of a pertur-
bant.
AD
E
F
G
B
C
Figure 1.
ª2021 The Authors The EMBO Journal e107821 |2021 3of 20
Jana Koch et al The EMBO Journal
SARS-CoV-2makes a differential use of host cell proteases for
infectious penetration
To evaluate the role of the cell surface TMPRSS2 and endolysoso-
mal cathepsin L proteases in the entry mechanisms of SARS-CoV-
2, we used aprotinin and SB412515, respectively, to selectively
inhibit the two proteases. As expected, no noticeable effect was
observed when aprotinin was added to TMPRSS2cells (A549*
and Vero cells) prior to infection (Fig 2A and Appendix Fig S2).
In agreement with previous work (Bojkova et al, 2020), we
observed that aprotinin reduced SARS-CoV-2 infection in a dose-
dependent manner in cells that expressed TMPRSS2 (Calu-3 and
Caco-2 cells) (Fig 2A). Similar results were obtained with camostat
mesylate (Fig EV1A–D), a more specific and potent inhibitor of
TMPRSS2 than aprotinin, also known to block SARS-CoV-2 infec-
tion (Hoffmann et al, 2020b). Conversely, SB412515 effectively
prevented the infection of cells lacking TMPRSS2 (Vero and A549*
cells) in a dose-dependent manner but had no effect on SARS-
CoV-2 infection of Calu-3 and Caco-2 cells (Fig 2B and
Appendix Fig S3). The observation that aprotinin interfered with
SARS-CoV-2 infection in Calu-3 and Caco-2 cells indicated that, in
the event that TMPRSS2 was blocked, cathepsin L would not take
over and subsequently process SARS-CoV-2. Of note, the protease
inhibitors, and all other drugs used in this work, were evaluated
in a range of concentrations for which no cytotoxicity was
detected, as shown by a quantitative assay measuring the release
of lactate dehydrogenase into the extracellular medium upon cell
death and lysis (Appendix Fig S4A–D).
We next determined the kinetics of the cathepsin L- and
TMPRSS2-dependent SARS-CoV-2 entry process. Cells were incu-
bated with viruses at a low MOI (0.6<) on ice and rapidly shifted to
37°C to allow virus entry and protease activity. Cathepsin L and
TMPRSS2 inhibitors were added at different times after warming to
prevent further activation and penetration of the virus. In other
words, we determined the time at which inhibition of SARS-CoV-2
activation was no longer possible, which resulted in an increase in
infection. In both TMPRSS2cell lines (A549*and Vero cells), the
SB412515 add-in time course revealed that activation by cathepsin L
and the subsequent infectious penetration of SARS-CoV-2 started
after a 15-min lag and reached a half-maximal level (t
1/2
) within 40–
60 min (Fig 2C). Evidently, exposure of individual viruses to
cathepsin L occurred nonsynchronously during a time span of 15–
90 min after warming. The aprotinin add-in time course showed
that productive penetration was much faster in TMPRSS2+cells
(Calu-3 and Caco-2 cells) (Fig 2D). The t
1/2
of activation by
TMPRSS2 was reached within 5–10 min in both cell lines. Taken
together, our observations demonstrated more rapid activation and
penetration of SARS-CoV-2 in cells expressing TMPRSS2 compared
with those in which infection depends on cathepsin L.
TMPRSS2governs SARS-CoV-2dependence on low pH for
infectious entry
Recent reports have indicated that SARS-CoV-2 infection is sensitive
to weak lysosomotropic bases that neutralize vacuolar pH such as
ammonium chloride (NH
4
Cl) and chloroquine (Hoffmann et al,
2020b; Ou et al, 2020; Wang et al, 2020). However, TMPRSS2 is
active at the cell surface under neutral pH conditions (Choi et al,
2009), unlike cathepsin L, which requires the low-pH environment
typical of endolysosomes (Mohamed & Sloane, 2006). To assess the
importance of endosomal acidification for infectious entry in cells
expressing (Caco-2 and Calu-3) and lacking (A549*and Vero)
TMPRSS2, cells were exposed to SARS-CoV-2 in the presence of
increasing amounts of NH
4
Cl or chloroquine. Our results showed
that both weak bases induced a dose-dependent inhibition of infec-
tion regardless of cell type and of TMPRSS2 expression (Fig 3A and
B). However, the dose required to inhibit 50% of SARS-CoV-2 infec-
tion (IC
50
) was found to be significantly lower in cells lacking
TMPRSS2 than in cells that expressed the protease; this difference
reached 200-fold for chloroquine (Table 1).
To validate the observation that TMPRSS2+cells were less
dependent on endosomal acidification for SARS-CoV-2 infection, we
used bafilomycin A1 and concanamycin B, which are inhibitors of
vacuolar-type proton-ATPases (vATPases). Incubation of cells with
increasing amounts of the two drugs resulted in a dose-dependent
inhibition of SARS-CoV-2 infection (Fig 3C and D). Importantly, the
inhibition produced by 10 nM bafilomycin A1 or concanamycin B in
TMPRSS2+cells (Caco-2 and Calu-3) was marginal, and the
decrease in infection did not surpass 50–80% at 50 nM concana-
mycin B. For comparison, infection with Uukuniemi virus (UUKV),
a late-penetrating virus that relies on low pH in late endosomes
(LEs) for penetration (Lozach et al, 2010), is strongly inhibited in
▸
Figure 1. Quantification of SARS-CoV-2infection.
A, B Cells were lysed and analyzed by SDS–PAGE and Western blotting under nonreducing conditions (A) or reducing conditions (B). TMPRSS2levels are expressed as
percentages of TMPRSS2levels in Calu-3cells normalized to levels of EF2.*1indicates TMPRSS2(A) and procathepsin L (B), and *2shows cleaved TMPRSS2(A) and
cathepsin L (B). A549*, ACE2-expressing A549 cells; EF2, elongation factor 2.
C Vero and Caco-2cells were infected with SARS-CoV-2at MOIs of 0.2for 8h. Infected cells were then permeabilized and immunostained for the intracellular SARS-
CoV-2nucleoprotein (NP, red). Nuclei were stained with Hoechst (blue) before imaging by fluorescence confocal microscopy. Scale bars: 100 µm.
D Vero and Caco-2cells were exposed to SARS-CoV-2at MOIs of 0.3and 0.2, respectively, and harvested 16 h later. After fixation and permeabilization, infected cells
were stained with the primary mAb against NP. Infection was analyzed by flow cytometry. SSC-A =side scatter-area.
E Infection of Vero and Caco-2cells was monitored over 24 h using the same flow cytometry-based assay used for the experiment shown in panel D. Infection is
given as the total fluorescence associated with the NP protein-positive cells. MFI, mean fluorescence intensity. n=3.
F SARS-CoV-2mRNA levels were quantified by qRT–PCR in both Vero and Caco-2cells infected at MOIs of 0.3and 0.4, respectively, for up to 24 h. n=3.
G Supernatants from infected cells were collected during the time course in F and assessed for the production of new infectious viral particles using a TCID50 assay
on na
€
ıve Vero cells. n=3–6.
Data information: Images are representative of at least three independent experiments. (E, F) Results are representative of three independent experiments and expressed
as mean standard error of mean (SEM) of three biological replicates.
Source data are available online for this figure.
◀
4of 20 The EMBO Journal e107821 |2021 ª2021 The Authors
The EMBO Journal Jana Koch et al
the presence of 2–10 nM concanamycin B or bafilomycin A1
(Lozach et al, 2010). From these results, it was evident that, similar
to the case for weak lysosomotropic bases, SARS-CoV-2 infection
was significantly less sensitive to vATPase inhibitors in TMPRSS2+
cells (Caco-2 and Calu-3) than in cells lacking the protease (Vero
and A549*cells) (Table 1).
AB
CD
Figure 2. SARS-CoV-2makes differential use of host cell proteases for infectious penetration.
A, B Cells were pretreated with the indicated concentrations of aprotinin (A) and SB412515 (B), which are inhibitors of TMPRSS2and cathepsin L, respectively. Infection
of Calu-3, Caco-2,A549*, and Vero cells with SARS-CoV-2at MOIs of 0.3,0.4,0.2, and 0.3, respectively, was achieved in the continuous presence of the drug. Infected
cells were quantified by flow cytometry as described in Fig 1D, and data were normalized to samples where inhibitors had been omitted. n=2–4biological
replicates.
C, D SARS-CoV-2particles were bound to A549* and Vero cells (MOIs 0.2and 0.3, respectively) (C) or Calu-3and Caco-2cells (0.6and 0.5, respectively) (D) on ice for
90 min and subsequently warmed rapidly to 37°C to allow infectious penetration. SB412515 (10 µM, C) or aprotinin (30 µM, D) was added at different times
postwarming to block further proteolytic activation. Infection was analyzed by flow cytometry, and data were normalized to samples where protease inhibitors
had been omitted. n=2.
Data information: (A, B) Data are expressed as mean SEM from two independent experiments. (C, D) Results are representative of 2–3independent experiments and
expressed as mean SEM of two biological replicates.
Source data are available online for this figure.
▸
Figure 3. SARS-CoV-2infection depends on endosomal acidification.
A–D Cells were pretreated with endosomal pH-interfering drugs at the indicated concentrations and subsequently infected with SARS-CoV-2as described in Fig 2A and
B in the continuous presence of NH
4
Cl (A), chloroquine (B), bafilomycin A1(C), or concanamycin B (D). The proportion of infected cells was quantified by flow
cytometry as described in Fig 1D, and data were normalized to control samples that were not treated with inhibitors. n=2–6biological replicates.
E Binding of SARS-CoV-2to Calu-3, Caco-2,A549*, and Vero cells (MOIs of 0.5,0.6,0.2, and 0.3, respectively) was synchronized on ice for 90 min. Subsequently, cells
were rapidly shifted to 37°C to allow penetration. NH
4
Cl (50 mM for A549* and Vero cells, and 75 mM for Calu-3and Caco-2cells) was added at the indicated
times to neutralize endosomal pH and block the acid-dependent step of SARS-CoV-2infectious penetration. The proportion of infected cells was analyzed by flow
cytometry, and data were normalized to that from control samples that had not been treated with NH
4
Cl. n=2.
F, G Same as in (E) but using concanamycin B (50 nM) instead of NH
4
Cl. Uukuniemi virus (UUKV) was used at a MOI of 150 to control the efficiency of concanamycin B
to neutralize endosomal pH in Caco-2cells. n=2.
H Same as in (E) but using chloroquine instead of NH
4
Cl. n=2.
Data information: (A-D) Data are expressed as mean SEM from at least two independent experiments. (E-H) Results are representative of three independent
experiments and expressed as mean SEM of two biological replicates.
Source data are available online for this figure.
ª2021 The Authors The EMBO Journal e107821 |2021 5of 20
Jana Koch et al The EMBO Journal
SARS-CoV-2can use two distinct routes to enter and infect
target cells
Our results suggested that SARS-CoV-2 infection relied more on
endosomal acidification in cells devoid of TMPRSS2 than cells
expressing the protease. To further investigate this phenomenon,
we first determined the kinetics of the acidification step required for
the infectious penetration of SARS-CoV-2 into TMPRSS2cells. We
took advantage of the fact that the neutralization of endosomal pH
is nearly instantaneous upon the addition of NH
4
Cl to the extracellu-
lar medium (Ohkuma & Poole, 1978). For these assays, virus parti-
cles were first allowed to attach to A549*and Vero cells on ice.
AB
CD
EF
GH
Figure 3.
6of 20 The EMBO Journal e107821 |2021 ª2021 The Authors
The EMBO Journal Jana Koch et al
Virus entry was then synchronized by switching the cells rapidly to
37°C, and NH
4
Cl was added at different times after the temperature
switch. To ensure that viral penetration is completely abolished
after adding NH
4
Cl, a concentration of up to 75 mM was used
(Fig EV2A). In A549*and Vero cells, viruses had completed the
NH
4
Cl-sensitive step 15 min after cell warming, and t
1/2
was
reached within 50 min (Fig 3E). Overall, the kinetics of SARS-CoV-2
acid-activated penetration closely resembled the time course of
cathepsin L-dependent activation in the absence of TMPRSS2
(Fig 2C).
To examine how long SARS-CoV-2 remains acid-activable in
TMPRSS2cells, we followed the reverse approach of adding
NH
4
Cl. This assay relies on the fact that the neutralization of endo-
somal pH by NH
4
Cl is reversible after washing. Virus binding to
Vero cells was synchronized at low MOI (~0.3) on ice, and cells
were rapidly shifted to 37°C in the presence of NH
4
Cl before the
weak base was washed out at varying times. In other words, we
determined the time at which SARS-CoV-2 acid activation was no
longer possible. In Vero cells, infection decreased by 70% during
the first 30 min and then more slowly until it reached a 90%
decrease after 2 h (Fig EV2B), which was the exact opposite of the
NH
4
Cl addition approach (Fig 3E). Together, the NH
4
Cl add-in and
wash-out kinetics indicated that SARS-CoV-2 infectivity decreases
sharply in TMPRSS2cells if the virus is not allowed to enter the
cytosol rapidly by acid-activated penetration, most likely, from
endosomal vesicles.
In Calu-3 and Caco-2 cells, both of which express TMPRSS2, it
was not possible to determine the timing of the acid-requiring step.
We failed to detect SARS-CoV-2-infected cells when NH
4
Cl was
added, even if the addition occurred several hours after transferring
the cells from 4 to 37°C (Fig 3E). In samples where NH
4
Cl was omit-
ted, however, infection was readily detectable with 17% of Calu-3
and Caco-2 cells infected (Fig EV2A), suggesting that the weak base
interferes with SARS-CoV-2 replication in these two cell lines. To
clarify whether NH
4
Cl blocks virus entry or replication in these
cells, we next assessed SARS-CoV-2 infection in our wash-out assay.
Neutralization of endosomal pH with NH
4
Cl in Caco-2 cells had no
noticeable effect on SARS-CoV-2 infection for the first hour after
warming (Fig EV2B), when the virus had normally already pene-
trated TMPRSS2+cells (Fig 2D). In this assay, viral replication was
not affected, most likely because the weak base was washed out
early enough to avoid side effects. Altogether, these results suggest
that SARS-CoV-2 does not depend on endosomal acidification for
infectious entry into TMPRSS2+cells, but rather that NH
4
Cl disrupts
Calu-3 and Caco-2 cell-specific functions that are important for
SARS-CoV-2 replication. NH
4
Cl not only neutralizes the intracellular
pH but also alters all endosomal, lysosomal, and trans-Golgi
network functions that are acid dependent (Helenius, 2013).
As an alternative method to alter endosomal pH, we added the
vATPase inhibitor concanamycin B to cell-bound virus, instead of
NH
4
Cl, at different times after warming. The time course showed
that infectious entry of UUKV began later than 15 min and had not
reached a maximum 2 h after cell warming (Fig 3F). In marked
contrast, SARS-CoV-2 infection was virtually insensitive to the
concanamycin B addition as early as a few seconds after shifting
TMPRSS2+cells to 37°C (Fig 3F). As expected, SARS-CoV-2 passed
the concanamycin B-sensitive step in TMPRSS2cells within less
than 15 min, and infectious entry reached a plateau value after
45 min, somewhat faster than in cells treated with NH
4
Cl (Fig 3G).
This difference in sensitivity to endosomal pH may be because
concanamycin B interferes not only with endosomal functions that
are acid dependent but also, indirectly, with the maturation of endo-
somes. However, unlike NH
4
Cl, it was apparent that concanamycin
B had no adverse effect on SARS-CoV-2 replication in any of these
experiments. Neutralization of endosomal pH by chloroquine leads
to similar kinetics of SARS-CoV-2 infection as concanamycin B
(Fig 3H).
Taken together, these results strongly suggest that SARS-CoV-2
can use two different routes to enter and infect target cells, i.e., a
fast pH-independent route in TMPRSS2+cells (Figs 2D and 3F and
H, and EV2B) and a slow acid-activated route in cells lacking
TMPRSS2 (Figs 2C and 3E, G and H).
TMPRSS2drives the pH-independent entry of SARS-CoV-2
To correlate the presence of TMPRSS2 with the viral entry pathway,
we examined SARS-CoV-2 infection in the same cell line expressing
or lacking the protease. To this end, we stably expressed TMPRSS2
in the TMPRSS2A549*cells and confirmed the overexpression by
SDS–PAGE and Western blotting (Fig 4A) (Steuten et al, 2021). As
expected, the TMPRSS2 inhibitor, camostat mesylate, did not inhibit
SARS-CoV-2 infection when it was added to the parental A549*cells
prior to infection (Fig 4B). However, we found that camostat mesy-
late reduced SARS-CoV-2 infection in a dose-dependent manner in
Table 1. Half-maximal inhibitory concentration (IC
50
) of inhibitors against SARS-CoV-2.
IC
50
SEM
TMPRSS2+TMPRSS2
Calu-3Caco-2A549*Vero
Aprotinin (µM) 0.40.10.60.0xx
Bafilomycin A1(nM) 16.36.610.42.32.00.618.65.5
Camostat mesylate (nM) 72.925.8 806 481 xx
Chloroquine (µM) 50.124.427.42.80.30.00.20.1
Concanamycin B (nM) 12.25.850.330.46.01.28.62.2
MG-132 (nM) 670 205 5,249 2,129 4.41.416.45.6
NH
4
Cl (mM) 4.40.97.92.42.20.12.50.6
SB412515 (nM) x x 125.729.936.910.9
ª2021 The Authors The EMBO Journal e107821 |2021 7of 20
Jana Koch et al The EMBO Journal
TMPRSS2-overexpressing A549*cells (Fig 4B). Conversely, the
cathepsin L inhibitor (SB412515) efficiently prevented infection of
regular A549*cells but had no effect on infection of A549*cells that
expressed TMPRSS2 (Fig 4C).
Our results indicated that endosomal acidification is required for
SARS-CoV-2 infection of TMPRSS2cells but not for infection of
cells expressing TMPRSS2 (Fig 3E–H). To evaluate the role of
TMPRSS2 in the dependence of SARS-CoV-2 on low pH for entry,
A549*cells expressing or lacking TMPRSS2 were infected in the
presence of bafilomycin A1 to neutralize endosomal pH. As antici-
pated, infection of TMPRSS2- A549*cells with SARS-CoV-2
decreased dramatically with increasing concentrations of bafilo-
mycin A1 (Fig 4D). In contrast, there was no noticeable effect of
bafilomycin A1 on infection of TMPRSS2+A549*cells. This con-
firmed that SARS-CoV-2 infection does not rely on endosomal acidi-
fication when TMPRSS2 is expressed. Overall, TMPRSS2 appears as
the major determinant of the fast pH-independent route taken by
SARS-CoV-2 to enter and infect TMPRSS2+cells.
SARS-CoV-2relies on endolysosomal maturation for infection of
TMPRSS2cells
The timing of acid-dependent and protease-activated steps suggested
that SARS-CoV-2 penetration might occur through endolysosomes in
cells devoid of TMPRSS2 and from the plasma membrane or early
endosomes (EEs) in TMPRSS2+cells. To determine whether SARS-
CoV-2 requires the endolysosomal compartments for the productive
infection of TMPRSS2cells, we exploited the small GTPase Rab7a,
which is a key player in LE maturation and function. TMPRSS2
Vero cells were transfected with DNA plasmids encoding the wild-
type (wt), dominant-negative (Rab7a T22N), and constitutively
active (Rab7a Q67L) forms of Rab7a tagged with enhanced green
fluorescent protein (EGFP) prior to infection with SARS-CoV-2.
Transfected cells exhibiting different levels of EGFP expression
(low, medium, and high) were selected and then analyzed for infec-
tion. Increasing expression of wt Rab7a facilitated SARS-CoV-2
infection. In contrast, increasing the expression of either Rab7a
mutant, which perturbates the maturation of newly formed LEs
(Lozach et al, 2010; Lozach et al, 2011a), resulted in an about 20–
30% decrease in infection at the highest expression (Fig 5A).
The analysis relies on the assumption that the different Rab7a
forms exhibit similar levels of expression; however, we found a 1.4-
fold higher and a 0.7-fold lower infection in cells with a similar and
high expression of wt Rab7a and either mutant of the small GTPase,
respectively (Fig 5A). This comparison revealed a 50% inhibitory
effect of the two Rab7a mutants on SARS-CoV-2 infection, indicating
that virus fusion is hampered in cells with late endosomal vesicles
expressing Rab7a T22N or Q67L. This inhibitory effect was very
A
B
C
D
Figure 4. TMPRSS2drives pH- and cathepsin L-independent
SARS-CoV-2entry.
A TMPRSS2-overexpressing and parental A549* cells were lysed and
subjected to SDS–PAGE and Western blot analysis under reducing
conditions. *1and *2indicate the full-length and cleaved forms of
TMPRSS2, respectively.
B–DA549* cells expressing or lacking TMPRSS2were pretreated with the
indicated concentrations of camostat mesylate (B), SB412515 (C), and
bafilomycin A1(D). Infection with SARS-CoV-2(MOI ~0.2) was achieved
in the continuous presence of the drug. Infected cells were quantified by
flow cytometry as described in Fig 1D, and data were normalized to
samples where inhibitors had been omitted. n=5–6biological
replicates.
Data information: Images are representative of at least three independent
experiments. Data are all expressed as mean SEM from 3independent
experiments.
Source data are available online for this figure.
8of 20 The EMBO Journal e107821 |2021 ª2021 The Authors
The EMBO Journal Jana Koch et al
significant as late endosomal maturation is hard to completely abol-
ish by only targeting Rab7a (Huotari & Helenius, 2011). In general,
disruption of LE functions rarely leads to a complete block in
infection by viruses relying on LEs for penetration (Khor et al, 2003;
Quirin et al, 2008; Lozach et al, 2010). Taken together, the combina-
tion of increased and decreased infection with increasing levels of
ABC
D
GH
EF
Figure 5. SARS-CoV-2relies on late endosomal maturation for infection.
A EGFP-Rab7a wild-type (wt), Q79L (constitutively active mutant), and T22N (dominant-negative mutant) were transiently expressed in Vero cells. The cells were then
infected with SARS-CoV-2at an MOI of ~0.3. Using flow cytometry, cell populations with levels of EGFP-Rab7a expression varying by roughly one-log increments
were selected, and the proportion of infected cells within each population was quantified at 8hpi. Data were normalized to that of the cell population with the
lowest EGFP-Rab7a intensity. Unpaired t-test with Welch’s correction was applied. *P<0.05;**P<0.01.n=5–6biological replicates.
B, C Vero and A549* cells were pretreated with colcemid (B) or MG-132 (C) at the indicated concentrations and subsequently infected with SARS-CoV- 2(MOIs ~0.3and
0.2, respectively) in the continuous presence of inhibitors. Infection was analyzed by flow cytometry, and data were normalized to samples where inhibitors had
been omitted. n=3–4biological replicates. Unpaired t-test with Welch’s correction was applied. *P<0.05;**P<0.01; ****P<0.0001.
D SARS-CoV-2particles were bound to A549* and Vero cells (MOIs of 0.2and 0.3, respectively) on ice for 90 min and then switched rapidly to 37°C to allow infectious
penetration. MG-132 (3.7µM) was added to cells at the indicated times to block further late endosomal maturation. Infection was analyzed by flow cytometry, and
data were normalized to that of control samples that had not been treated with MG-132.n=2.
E As in panel B but using a MOI of 0.4and Caco-2cells instead of Vero cells. n=6biological replicates.
F As in panel C but using a MOI of 0.3and 0.4and Calu-3and Caco-2cells. n=2–8biological replicates.
G The timing of the MG-132-sensitive step during SARS-CoV-2infectious entry into Calu-3and Caco-2cells was assayed as detailed in D but using 60 µM MG-132 for
Caco-2cells and MOIs of 0.5and 0.6, respectively. n=2.
HA549* cells expressing or lacking TMPRSS2were pretreated with MG-132 at the indicated concentrations and subsequently infected with SARS-CoV-2(MOI ~0.2)in
the continuous presence of the drug. The proportion of infected cells was quantified by flow cytometry as described in Fig 1D, and data were normalized to that
from control samples for which MG-132 had been omitted. n=6biological replicates.
Data information: (A to C, E, F, and H) data are expressed as mean SEM from 2-4independent experiments. (D and G) Results are representative of at least two
independent experiments and expressed as mean SEM of two biological replicates.
Source data are available online for this figure.
ª2021 The Authors The EMBO Journal e107821 |2021 9of 20
Jana Koch et al The EMBO Journal
Rab7a wt and mutants, respectively, suggested that proper matura-
tion of LEs is mandatory for cathepsin L-dependent infectious entry
of SARS-CoV-2.
LE maturation relies on microtubule-mediated transport to the
nuclear periphery and proteasome activity (Lozach et al, 2010;
Lozach et al, 2011a). Treatment of Vero cells with colcemid, a drug
that interferes with microtubule polymerization, resulted in a 30–
45% decrease in infection (Fig 5B). Additionally, late endosomal
penetration of IAV and UUKV has been shown to be sensitive to free
ubiquitin depletion produced by the proteasome inhibitor MG-132
(Khor et al, 2003; Lozach et al, 2010). Therefore, to determine
whether free ubiquitin was required for SARS-CoV-2 infection,
A549*and Vero cells were treated with MG-132. The results showed
that SARS-CoV-2 infection was strongly inhibited in the presence of
MG-132 in both cell lines (Fig 5C). The calculated IC
50
(4–17 nM)
confirmed that MG-132 interfered with the cathepsin L-mediated
SARS-CoV-2 entry route with high efficiency (Table 1).
To determine the kinetics of the MG-132-sensitive step in the
entry process, we followed the same experimental procedure used
to determine the kinetics of endosomal acidification-dependent and
cathepsin L-mediated activation of SARS-CoV-2 (Figs 2C and 3E)
but with MG-132 instead of protease inhibitor and NH
4
Cl. Briefly,
viruses were bound to A549*and Vero cells at a low MOI on ice,
rapidly switched to 37°C, and then treated with MG-132 at different
timepoints. After a 15-min lag, infectious penetration occurred asyn-
chronously between 30 and 60 min, reaching t
1/2
within 40–50 min
(Fig 5D). This time course was consistent with endolysosomal
maturation, which usually lasts 30–60 min (Huotari & Helenius,
A
D
EF
BC
Figure 6.
10 of 20 The EMBO Journal e107821 |2021 ª2021 The Authors
The EMBO Journal Jana Koch et al
2011). Altogether, these results show that cathepsin L-dependent
SARS-CoV-2 infection depends on endolysosome maturation in
TMPRSS2A549*and Vero cells.
Inhibitors of LE maturation, i.e., colcemid and MG-132, also
reduced SARS-CoV-2 infection in a dose-dependent manner in
TMPRSS2+cells (Calu-3 and Caco-2 cells) (Fig 5E and F). Although
the inhibition was significant, the decrease in infection caused by
colcemid was barely 25–30% (Fig 5E). The IC
50
values of MG-132
were one to three logs higher in TMPRSS2+cells than in TMPRSS2
cells (Fig 5F and Table 1). As shown in Fig 5G, infection was not
readily detectable in Calu-3 and Caco-2 cells when MG-132 was
added at 2 hpi. Additionally, MG-132 had no effect on SARS-CoV-2
infection of TMPRSS2-overexpressing A549*cells (Fig 5H). This
result contrasted with the infection of parental A549*cells, which
decreased with increasing amounts of drug (Fig 5H). Taken
together, these data suggested that the TMPRSS2-dependent SARS-
CoV-2 entry pathway does not rely on LE maturation.
Activation of SARS-CoV-2is incomplete after its release from
producer cells
Furin expression in the producer cells and TMPRSS2 expression at
the surface of target cells are believed to mediate SARS-CoV-2 acti-
vation through proteolytic processing of the S protein. Hence, we
first evaluated the cleaved spike content in viral particles after
biosynthesis. Authentic infectious viruses were analyzed by SDS–
PAGE and Western blot using a primary antibody recognizing the S2
segment (S
2
) of the SARS-CoV-2 spike. A strong band corresponding
to the full-length SARS-CoV-2 spike, which includes S1 and S2
segments (S
0
), was detected at 160 kDa (Fig 6A). A second band,
although of lower intensity, was clearly visible at 75 kDa, which
corresponds to S
2
. With a lower extent, additional bands were
discernible above 160 kDa, which likely correspond to dimeric and
trimeric forms of the SARS-CoV-2 spike. Upon semi-quantifying the
intensities of the S
0
and S
2
bands, the ratio of cleaved spike (S
2
)to
the total of spike, i.e., uncleaved plus cleaved (S
0
+S
2
), was found
to be one third [(q)=S
2
/S
0
+S
2
] (Fig 6B). These results were
consistent with prediction models based on the SARS-CoV-2 spike
structure (Wrobel et al, 2020).
Next, we assessed the efficiency of exogenous furin and trypsin
in processing S
0
into S
2
on viral particles. In this assay, trypsin was
used to mimic TMPRSS2 at the cell surface as the two enzymes are
closely related and both belong to the group of trypsin-like
proteases. The use of exogenous cathepsin L was excluded because
the enzyme is active only at pH ~5, which would have made it
impossible to distinguish the effects of low pH from those of prote-
olytic cleavage. After treatments with the exogenous proteases,
samples were analyzed by Western blot using the primary antibody
against S
2
. Although the presence of serum in our virus prepara-
tions, both trypsin and furin proteolytically processed the full-length
form of spike S
0
into S
2
, but with a striking difference in efficiency
(Fig 6A). Trypsin treatment greatly reduced the relative intensity of
S
0
, which resulted in an increase in the intensity of S
2
, with a (q)
value reaching almost 1.0, while furin treatment had a more modest
impact as the (q) value increased from 0.3 to 0.5 (Fig 6B). To con-
firm that the presence of serum had no impact on protease cleavage
of spike, A549*cells expressing or lacking TMPRSS2 were infected
with SARS-CoV-2 produced in the presence or absence of serum.
Results showed that the presence of serum did not impact SARS-
CoV-2 infection and cleavage (Fig EV3A and B).
To determine whether increased proteolytic processing of the S
protein results in enhanced SARS-CoV-2 activation and infection,
viral particles were subjected to exogenous furin and trypsin and
then added to Caco-2 and Vero cells. Using our flow cytometry-
based assay, we found that infection increased as much as 2- to 3-
fold following SARS-CoV-2 proteolytic preprocessing by trypsin
whereas the pre-exposure of particles to furin had no apparent effect
(Fig 6C). Overall, the gain in infection appeared to correlate with
greater conversion of S
0
into S
2
in SARS-CoV-2 particles. Taken
together, these data indicated that proteolytic processing of spike
proteins and activation of SARS-CoV-2 were largely incomplete after
release of the virus from producer cells.
Proteolytic processing is both sufficient and necessary for
SARS-CoV-2fusion
To relate the proteolytic processing of the SARS-CoV-2 spike with
the viral fusion mechanisms, we then evaluated the capacity of the
◀Figure 6. Proteolytic processing triggers SARS-CoV-2membrane fusion.
A SDS–PAGE and Western blot analysis of SARS-CoV-2particles treated with trypsin or furin under reducing conditions. S was detected using a rabbit antibody against
the SARS-CoV-2S2region.
B SARS-CoV-2regions S
0
(uncleaved) and S
2
(cleaved) were semiquantified from (A), and the proportion of S
2
on viral particles is shown as (q)=S
2
/S
0
+S
2
.n=3.
C SARS-CoV-2was subjected to pretreatment with trypsin and furin for 15 min at 37°C prior to infection of Caco-2and Vero cells (MOIs of 0.4and 0.3, respectively).
Infected cells were quantified by flow cytometry as described in Fig 1D. Data were normalized to samples not pretreated with trypsin. n=4–6biological replicates.
D Depicts the cell–cell fusion model employed in this study. (1)or(2) indicates treatment with either exogenous proteases or low-pH buffers; CMFDA, cytosolic green
dye; IF anti-NP, immunofluorescence staining against the SARS-CoV-2nucleoprotein.
EA549* expressing or lacking TMPRSS2cells and Vero cells were first infected with SARS-CoV-2at MOIs of 0.1and 0.2, respectively, for 24 h and then cocultured for 5h
along with target cells, not infected but prestained with CMFDA, a cytosolic green dye. Cells were subsequently treated with trypsin or furin for 5min at 37°C and left
to coculture for an additional hour at 37°C. After fixation, nuclei were stained with Hoechst (blue), and infected cells were subjected to immunofluorescence staining
against SARS-CoV-2nucleoprotein (magenta). Samples were ultimately imaged by confocal fluorescence microscopy. White stars indicate syncytia with at least four
nuclei. Scale bars: 100 µm.
F Images of microscope fields obtained in (E) were quantified [A549*: n(no virus) =30,n(no protease) =80,n(trypsin) =80, and n(furin) =60;A
549* TMPRSS2:n(no
virus) =30,n(no protease) =80 ,n(trypsin) =79, and n(furin) =60; Vero: n(no virus) =40 ,n(no protease) =112,n(trypsin) =114 , and n(furin) =60]. The fusion
index is given as f=1–[(number of cells in a field after fusion)/(number of nuclei)].
Data information: Images are representative of three independent experiments. (B) Data are expressed as mean SEM from three independent experiments. (C) Data
are expressed as mean SEM from 2to 3independent experiments. (F) Results are expressed as mean SEM of three independent experiments.
Source data are available online for this figure.
ª2021 The Authors The EMBO Journal e107821 |2021 11 of 20
Jana Koch et al The EMBO Journal
virus to mediate cell–cell fusion, i.e., the formation of syncytia
(‘‘fusion-from-within’’) (Fig 6D). Similar systems have recently
been described for SARS-CoV-2, and previously, for unrelated
viruses (Bratt & Gallaher, 1969; Buchrieser et al, 2020; Papa et al,
2021). Briefly, cells were first infected with SARS-CoV-2 and then
cocultured along with fresh cells, not infected and prestained with
the cytosolic green dye CMFDA. CMFDA has the advantage of freely
passing through membranes, but once inside the cells, the dye is no
longer able to cross the plasma membrane, thus preventing leakage
to neighboring cells. Immunofluorescence staining against the viral
nucleoprotein allowed for the distinction between infected and
target cells. Confocal images clearly showed infected cells in
magenta, target cells in green, and the syncytia that result from the
fusion of the two in white, i.e., magenta plus green (Figs 6E and
EV4, Appendix Figs S5 and S6).
The infection of parental A549*and Vero cells led to the forma-
tion of a marginal number of syncytia, and all were small, with only
two-three nuclei (Fig 6E, Appendix Figs S5 and S6). In contrast,
large syncytia with six or more nuclei were observed upon infection
of TMPRSS2+A549*cells (Figs 6E and EV4). The extent of cell–cell
fusion was confirmed with a fusion (f) index that expresses the
average number of fusion events per original mononucleated cell
(White et al, 1981). The (f) index reaches 1 when all the nuclei in
the microscope field are present in a single cell, and the value is 0
when all cells have one nucleus each. The (f) index ranged from
0.04 to 0.24 in Vero and A549*cells and reached 0.5 in TMPRSS2+
A549*cells, i.e., a 2- to 13-fold higher compared to that obtained
with TMPRSS2target cells (Fig 6F). Combined, our results con-
firmed that the presence of TMPRSS2 on target cells promotes
SARS-CoV-2-mediated syncytia formation (Buchrieser et al, 2020),
most likely by achieving the proteolysis of the S protein on the
surface of infected cells.
Using our cell–cell fusion model, we then wanted to determine
whether furin and trypsin can also complete the proteolytic process-
ing of the SARS-CoV-2 spike for fusion. A549*and Vero cells are
both negative for TMPRSS2 and thus represent a convenient model
for monitoring proteolytic activation of cell surface spike proteins
by exogenous proteases. Trypsin treatment of infected A549*and
Vero cells cocultured with CMFDA+target cells resulted in the
formation of large syncytia with multiple nuclei (Appendix Figs S5
and S6), similar to those observed after infection of TMPRSS2+
A549*cells (Figs 6E and EV4). In contrast, no difference was
observed between furin- and mock-treated-infected A549*and Vero
cells, among which the only cells with more than one nucleus were
actively dividing cells (Appendix Figs S5 and S6). Additionally, the
fusion index in A549*and Vero cells was significantly increased
under trypsin treatment compared with mock- and furin-treated
cells (Fig 6F). Of note, neither furin nor trypsin treatment enhanced
syncytia formation upon infection of TMPRSS2+A549*cells
(Figs 6F and EV4). Our data collectively indicated that furin is inef-
fective in completing spike activation and that proteolytic cleavage
is both sufficient and necessary for SARS-CoV-2 membrane fusion.
Endosomal acidification is required for endolysosomal proteases
priming viral fusion
SARS-CoV-2 does not rely on endosomal acidification to enter
TMPRSS2+cells, which suggests that the virus does not rely on low
pH for membrane fusion but solely for the activation of cathepsin L
in cells lacking TMPRSS2. To pursue this possibility, we first
assessed whether it was possible to inactivate the virus by applying
acidic buffers prior to infection. In such an assay, the virus under-
goes a transition toward the postfusion state at the optimal pH. If
the transition is irreversible, the spike protein is no longer able to
fuse with target-cell membranes, and thus, the viral particles are
rendered noninfectious. With this approach, we found that more
than 80% of viruses remained infectious in Caco-2 and Vero cells
after exposure to buffers at pH ~6 for 10 min (Fig 7A). Semliki forest
virus (SFV) is an early-penetrating virus that has a class II viral
fusion glycoprotein with an irreversible priming step that is triggered
at a pH-activation threshold of 6.2 (Lozach et al, 2010). In contrast
to SARS-CoV-2, the infectiousness of low pH-pretreated SFV was
reduced by 60–70% after exposure to pH ~6.0 (Fig 7B). We next
investigated the influence of low pH on SARS-CoV-2 fusion in our
cell–cell fusion assay. The formation of syncytia and the (f) index
did not differ significantly when cells were treated with low-pH or
neutral buffers regardless of the presence of TMPRSS2 (Fig 7C).
Our results support a model in which endosomal acidification is
not essential for SARS-CoV-2 membrane fusion, but SARS-CoV-2
infection relies on low pH for cathepsin L-dependent infection in
cells lacking TMPRSS2. Therefore, we tested the possibility that
acidic pH is required for the activation of the endolysosomal
proteases that trigger SARS-CoV-2 fusion. In such a scenario, the S
proteins that are already primed by proteases should no longer
require low pH for fusion. Indeed, we found that the fusion index
was not increased when trypsin treatment was followed by exposure
to a decrease in pH of 7.4 to 5 (Fig 7C and D), the latter value being
typical of the luminal pH of endolysosomes (Lozach et al, 2011a).
To confirm that SARS-CoV-2 membrane fusion is independent of
low pH, viral particles were then exposed to buffers with pH ~5 and
subsequently subjected to proteolytic cleavage by trypsin. Our
results revealed that SARS-CoV-2 infectivity was preserved when
viral particles were exposed to the low-pH buffer prior to trypsin
treatment, whereas those of virus particles that were solely exposed
to acidic pH were not infective (Fig 7E). The infectivity also
remained preserved when the virus was first subjected to trypsin
and then acidified. Taken together, the results showed that endoso-
mal acidification does not play a role in SARS-CoV-2 membrane
fusion, whether it occurs before or after the proteolytic processing
of viral particles. In addition, our results strongly suggested that the
potential pH-induced conformational changes in the SARS-CoV-2
spikes were neither irreversible nor detrimental for viral fusion.
To directly test whether endosomal acidification is needed for
the host cell proteases that prime SARS-CoV-2 fusion, and not for
the fusion mechanisms themselves, we assessed whether preacti-
vated viral particles remain dependent on endosomal acidification
for infectious entry. For this purpose, the proteolytic processing of
the virus particles was achieved with trypsin and thermolysin prior
to the infection of A549*and Vero cells. Thermolysin is known to
prime the surface glycoprotein of Ebola virus in the same way as
cathepsin L (Schornberg et al, 2006) and therefore was used here to
mimic cathepsin L. Thermolysin was chosen as it has the advantage
to function at neutral pH. To disrupt the acid-dependent endolysoso-
mal proteases, the infection was carried out in the continuous pres-
ence of 50 nM bafilomycin A1. As A549*and Vero cells do not
express TMPRSS2, this assay allowed us to directly test the impact
12 of 20 The EMBO Journal e107821 |2021 ª2021 The Authors
The EMBO Journal Jana Koch et al
of extracellular protease-activated viral particles. As reported above
(Fig 3C), infection with untreated viral particles was severely
impeded when proton pumps were blocked in the absence of
TMPRSS2 (Fig 8A). In stark contrast, the protease-preactivated viral
particles remained infectious in the presence of bafilomycin A1
(Fig 8A).
A
C
DE
B
Figure 7. Low pH does not inactivate SARS-CoV-2.
A, B (A) SARS-CoV-2and (B) Semliki forest virus (SFV) particles were pretreated at the indicated pH for 10 min at 37°C. Viruses were subsequently neutralized with
buffer at pH ~7.4and allowed to infect Caco-2(MOI ~0.4) and Vero cells (MOI of 0.3and 0.8, respectively). Infected cells were then immunostained against the NP
protein and SFV E2protein, respectively, and analyzed by flow cytometry. Data are normalized to that of samples pretreated with buffers at pH ~7.4.n=2.
C Samples were prepared as described in Fig 6E but, after trypsin treatment, infected cells were subjected to buffers at the indicated pH for 5min at 37°C and left to
recover for an additional hour at 37°C. Images of microscope fields (50 <n<120) were quantified, and fusion index was calculated as in Fig 6F. n>50 microscope
fields were analyzed.
D Cell–cell fusion after trypsin treatment according to pH. The fusion is given as the ratio of the values obtained for trypsin-treated samples to those obtained for
untreated samples. n=3–4.
E SARS-CoV-2particles (MOI of 0.3) were first subjected to trypsin treatment for 15 min at 37°C and then exposed to buffers at the indicated pH for 10 min at 37°C,
and vice versa. Calu-3and Vero cells were then infected at a MOI of 0.3and analyzed by flow cytometry as described in Fig 1D. n=4–8biological replicates.
Data information: (A, B) Results are representative of at least two independent experiments and expressed as mean SEM of two biological replicates. (C and D) Results
are expressed as mean SEM of three independent experiments. (E) Data are expressed as mean SEM from 2independent experiments.
Source data are available online for this figure.
ª2021 The Authors The EMBO Journal e107821 |2021 13 of 20
Jana Koch et al The EMBO Journal
The capacity of SARS-CoV-2 to infect A549*and Vero cells upon
proteolytic activation, despite the absence of functional endolysoso-
mal proteases, was confirmed using NH
4
Cl. As expected, in our
synchronized infection assay, untreated particles became NH
4
Cl
insensitive at 50 min postentry (Figs 8B and 3E). However, when
the viral particles were pretreated with trypsin, no sensitivity to
NH
4
Cl was observed (Fig 8B). These results strongly supported the
model that the virus is no longer dependent on endosomal acidifi-
cation for infection once activated by proteolytic cleavage.
Finally, we wanted to see whether SARS-CoV-2 requires the
activity of endolysosomal proteases for infectious entry after its acti-
vation. To this end, trypsin and thermolysin were used to preacti-
vate viral particles, and infection of A549*and Vero cells was
performed in the presence of the cathepsin L inhibitor SB412515. As
expected, the cathepsin L inhibitor completely abolished infection
when viruses were not preactivated with proteases (Figs 2B and
8C). Conversely, preactivation of SARS-CoV-2 with thermolysin
fully restored infection of A549*and Vero cells in the presence of
A
B
C
Figure 8. SARS-CoV-2no longer requires endosomal acidification after proteolytic processing.
A Trypsin- or thermolysin-activated SARS-CoV-2was allowed to infect A549* and Vero cells at MOIs of 0.2and 0.3, respectively, in the continuous presence of
bafilomycin A1. Infection was quantified by flow cytometry, and data were normalized to that from control samples not exposed to the inhibitor. n=2–4biological
replicates.
B Binding of trypsin-activated SARS-CoV-2to A549* and Vero cells (MOI ~0.2and 0.3, respectively) was synchronized on ice for 90 min. Subsequently, the cells were
rapidly shifted to 37°C to allow penetration. NH
4
Cl (50 mM) was added at the indicated time to neutralize endosomal pH and block the acid-dependent step of SARS-
CoV-2infectious penetration. Infected cells were analyzed by flow cytometry, and data were normalized to samples where NH
4
Cl had been omitted. n=2.
C SARS-CoV-2was first treated with trypsin or thermolysin and then allowed to infect A549* and Vero cells (MOIs ~0.2and 0.3) in the continuous presence of SB412515
(cathepsin L inhibitor). Infected cells were quantified by flow cytometry as described in Fig 1D, and data were normalized to samples where SB412515 had been
omitted. n=4biological replicates.
Data information: (A and C) data are expressed as mean SEM from two independent experiments. (B) Results are representative of two independent experiments and
expressed as mean SEM of two biological replicates.
Source data are available online for this figure.
14 of 20 The EMBO Journal e107821 |2021 ª2021 The Authors
The EMBO Journal Jana Koch et al
SB412515 (Fig 8C). Trypsin treatment was also found to rescue
infection, however with a lower extent (i.e., 50–70%) (Fig 8C).
Taken together, these results suggest that TMPRSS2and cathepsin
L-dependent penetration pathways require differential proteolytic
processing of the SARS-CoV-2 protein S.
Altogether, our data show that SARS-CoV-2 resembles other
CoVs in that its entry depends on diverse host cell proteases. It
can use two distinct routes; either TMPRSS2 mediates the pH-
independent penetration of the virus from on or near the cell surface
or, alternatively, the virus is transported to endolysosomes, where
low pH activates cathepsin L, which in turn primes viral fusion and
penetration.
Discussion
The infectious entry process of CoVs is complex (Hartenian et al,
2020). Several host cell proteases can prime the CoV spike (S)
protein for viral membrane fusion, but it is not yet known whether
these mechanisms require specific proteases or a coordinated,
spatiotemporal combination of multiple proteases. The importance
of endosomal acidification in the productive penetration of all CoVs
is also a matter of debate. Furin, TMPRSS2, and cathepsin L have all
been implicated in CoV activation for entry (Bestle et al, 2020; Hoff-
mann et al, 2020b; Liu et al, 2020; Matsuyama et al, 2020; Shang
et al, 2020), and agents elevating endosomal pH, such as chloro-
quine, have been reported to interfere with infection (Hoffmann
et al, 2020b; Ou et al, 2020; Wang et al, 2020). SARS-CoV-2 and
other CoVs have apparently found a way to use diverse entry mech-
anisms to infect target cells and spread throughout the host.
In this study, we developed reliable and accurate assays for the
investigation of SARS-CoV-2 infection of lung, intestine, and kidney
epithelial cells, from proteolytic activation to membrane fusion. In
agreement with other reports (Bojkova et al, 2020; Hoffmann et al,
2020b), our results showed that SARS-CoV-2 infection was sensitive
to inhibitors of TMPRSS2 and cathepsin L. We further found that
blocking TMPRSS2 abrogated infection even when the cells were
expressing cathepsin L, indicating that the virus does not reach
endolysosomal cathepsins when TMPRSS2 is present. Others have
shown that infection by MERS pseudoviruses was suppressed by
trypsin-like protease inhibitors in the presence of tetraspanin CD9,
while entry was unaffected, but further infection progression was
blocked by cathepsin inhibitors in the absence of CD9 (Earnest et al,
2017). These authors proposed that tetraspanins concentrate CoV
entry factors into localized positions on or near the cell surface,
allowing rapid and efficient activation of viral fusion (Hantak et al,
2019).
We observed that SARS-CoV-2 used two distinct routes to enter
cells, one fast (~10 min), corresponding to the timing of TMPRSS2
activation, and one slower (40–50 min), corresponding to cathepsin
L priming. Although other cellular factors are likely necessary, our
results support the view that TMPRSS2 is a major determinant of
the SARS-CoV-2 fast entry mechanism. Similar observations have
been made for human CoV 229E (hCoV-229E), which prefers cell
surface TMPRSS2 to endosomal cathepsins for cell entry (Bertram
et al, 2013; Shirato et al, 2017; Shirato et al, 2018).
It is clear from our data that, in the presence of TMPRSS2, SARS-
CoV-2 did not rely on endosomal acidification and late endosomal
maturation for infectious penetration. Concanamycin B, which
specifically inhibits vATPases and elevates endosomal pH, affected
UUKV, an enveloped virus that penetrates host cells by acid-
activated membrane fusion (Lozach et al, 2010), but did not affect
SARS-CoV-2 infection. MG-132, known to divert IAV and UUKV
away from LEs (Khor et al, 2003; Lozach et al, 2010), was no longer
able to impede SARS-CoV-2 infection when TMPRSS2 was overex-
pressed. This was consistent with reports that TMPRSS2 processes
CoV S and other substrates at or near the plasma membrane
(Kleine-Weber et al, 2018; Wang & Xiang, 2020), i.e., at neutral pH.
Using aprotinin, we found that half of the bound viral particles had
completed the TMPRSS2-dependent step within 5–10 min. We
cannot completely exclude the possibility that aprotinin was not
instantaneously effective when it was added to the infected cells. In
this case, the timing of the TMPRSS2-requiring step was therefore
faster. SARS-CoV-2 activation and penetration would then likely
take place at the plasma membrane following proteolytic activation,
as proposed for hCoV-229E and MERS-CoV (Qian et al, 2013;
Shirato et al, 2017).
An alternative scenario is that SARS-CoV-2 is sorted into the
endocytic machinery regardless of TMPRSS2 expression. The time
course of the TMPRSS2-requiring step resembled that of cargo sort-
ing into EEs, approximately 5–10 min (Huotari & Helenius, 2011).
Another observation supporting this hypothesis was that colcemid
partially hampered infection. This drug perturbs LE maturation by
disrupting the microtubule network and in turn causes EE accumu-
lation and dysfunction (Lozach et al, 2010). Such a strategy has
been proposed for reoviruses, which use a similar uptake pathway
but different trafficking pathways depending on whether viral parti-
cles are activated or not (Boulant et al, 2013). As is the case for
other CoVs (Wang & Xiang, 2020), additional functional investiga-
tions are required to determine exactly where, whether from the
plasma membrane or from EEs, SARS-CoV-2 enters the cytosol of
TMRPSS2+cells, as well as whether the processing of the S protein
is followed by transport of the virus to downstream organelles for
penetration.
In the absence of TMPRSS2, it was evident that SARS-CoV-2
depended on endocytosis and transport through the late endosomal
system for infectious penetration. Infectious entry was inhibited by
endosomal pH neutralizing drugs. Impairing LE maturation, either
by colcemid treatment or by the expression of Rab7a T22N or Q67L,
affected SARS-CoV-2 infection. The sensitivity to MG-132 mirrored
those observed for UUKV, IAV, and murine CoVs, which accumu-
lated in cytosolic vesicles and failed to infect the cells (Khor et al,
2003; Yu & Lai, 2005; Lozach et al, 2010). Other researchers have
reported that SARS-CoV-2 depends on PIKfyve for the infection of
293T cells, a line devoid of TMPRSS2 (Ou et al, 2020). PIKfyve is a
phosphoinositide kinase involved in the first stages of LE matura-
tion. Collectively, our results indicate that SARS-CoV-2, like other
CoVs (Simmons et al, 2005; Kawase et al, 2009; Qian et al, 2013), is
dependent on functional endolysosomes and cathepsins for infec-
tious penetration when the viral particles are not activated at or near
the cell surface.
Our results suggested that the proteolytic activation of the spike
S protein was sufficient and necessary for SARS-CoV-2 fusion. The
Vero cells used in our virus-mediated cell–cell fusion assay did not
express TMPRSS2 on the cell surface, or at least at a detectable
level. In this assay, exogenous furin failed to promote syncytia
ª2021 The Authors The EMBO Journal e107821 |2021 15 of 20
Jana Koch et al The EMBO Journal
formation, indicating that furin cleavage was either inefficient or not
sufficient to achieve the full activation of the S protein at the plasma
membrane. The S1/S2 site of SARS-CoV-2 S protein exhibits an
RRAR motif instead of the typical RX(R/K)R furin motif, and a
recent structural study indicates that cleavage by furin at this site in
S trimers is rather low, approximately 30% (Bestle et al, 2020; Cai
et al, 2020; Wrobel et al, 2020). However, we found that, unlike
furin, trypsin prompted the formation of syncytia, which supports
the proposed involvement of the proteases within target cells, such
as TMPRSS2 and cathepsin L, in completing the proteolytic process-
ing of the S protein. Others have shown that SARS-CoV-2 and
MERS-CoV mediate cell–cell fusion at neutral pH without any
further proteolytic treatment when target cells express TMPRSS2
(Shirato et al, 2013; Buchrieser et al, 2020). It is tempting to postu-
late that the more protease is expressed in the target cells, the more
molecules of spike are cleaved and activated, and the more fuso-
genic the virus is. Additionally, work evaluating SARS-CoV-2 infec-
tion of primary human intestinal epithelial cells showed that
TMPRSS2 expression was the best indicator of cell tropism (Triana
et al, 2021).
It is also apparent from our results that the SARS-CoV-2 progeny
were not fully processed and activated. Trypsin pretreatment
increased virus infectivity. More work is required to decipher the
SARS-CoV-2 fusion mechanism. The list of the involved host cell
proteases is most likely not restricted to furin, TMPRSS2, and
cathepsin L, as suggested by recent biochemical studies (Jaimes
et al, 2020; Tang et al, 2021). S proteolytic activation might involve
the cleavage of sites other than S1/S2 and S20, as was found for the
MERS-CoV S protein (Kleine-Weber et al, 2018). Consistent with the
results from others, our own data indicated that the cleavage to S1
and S2 is incomplete on SARS-CoV-2 particles, most likely with only
one of the three S1/S2 sites within S trimers cut by furin in producer
cells. As recently proposed, cutting at all the S1/S2 sites would be
achieved in this model with the aid of proteases within target cells,
such as TMPRSS2 and cathepsin L (Ou et al, 2021; Tang et al,
2021). The fusogenic conformational change would then occur and
be completed by the cleavage of the S20sites to unmask the fuso-
genic units. The amino acid sequence of the S1/S2 site differs signif-
icantly among CoVs (Bestle et al, 2020), and it is highly likely that
the sequence influences the overall viral fusion process.
We found that the level of viral mRNA and amount of infectious
viral progeny released in the outer media were lower in the absence
of TMPRSS2. The TMPRSS2-dependent entry mechanisms occurred
more rapidly than the cathepsin L-activated mechanisms, and it
might be that the early route results in a more productive infection
than the late-penetrating process. Separate studies support the view
that early entry results in productive infection, while late penetra-
tion would be an alternative backup route, at least for some CoV
strains including HCoV-229E (Shirato et al, 2017; Shirato et al, 2018;
Hantak et al, 2019). Other works on candidate therapeutics have
linked host cell proteases to CoV spread. Inhibitors of TMPRSS2, but
not of cathepsins, effectively prevent the pathogenesis of SARS-CoV
in mice, suggesting that SARS-CoV mainly uses cell surface
proteases rather than endosomal cathepsins in vivo (Zhou et al,
2015). The identification of all host cell proteases involved in SARS-
CoV-2 and other CoV infections, as well as the tissues and organs
that express them, remains an important objective for better under-
standing viral propagation and virus-induced diseases.
Intriguingly, SARS-CoV-2 showed a strong resistance to acidic
buffers. Exposure to pH ~5.0 only marginally inactivated the virus,
and infectivity was rescued or even enhanced by proteolytic treat-
ment. In addition, trypsin activation appeared to protect the virus
from acid inactivation, which could explain how it infects the
gastrointestinal tract in vivo. SARS-CoV-2 has evidently developed a
remarkable ability to adapt to an acidic environment. Interestingly,
low pH has been shown to alter the positioning of the receptor-
binding domain in the SARS-CoV-2 S trimers, which could help the
virus escape the immune system (Zhou et al, 2020). Overall, this
property certainly endows the virus with the ability to sustain high
infectivity by entering host cells not only from endosomes but also
from the extracellular space, especially during the spread of the
virus throughout the host.
Reports on the cell entry mechanisms of SARS-CoV-2 and other
CoVs often describe only one cell model system, and the literature
in this field remains unclear in general. Our study recapitulates the
SARS-CoV-2 entry process within a single investigation and provides
an overview of the cellular mechanisms used by SARS-CoV-2 to
penetrate and infect target cells. Although it remains to be con-
firmed under physiological conditions, we propose that SARS-CoV-2
can enter cells through two distinct and mutually exclusive path-
ways. When target cells express TMPRSS2, the virus is activated at
or close to the cell surface and penetrates early in a pH-independent
manner. When target cells lack TMPRSS2, SARS-CoV-2 is endocy-
tosed and sorted into endolysosomes, from which the virus is acti-
vated in a pH-dependent manner and penetrates the cytosol at a late
timepoint. With the ability to utilize diverse cell entry routes, SARS-
CoV-2 has likely found a way to expand its number of target tissues
and organs, which certainly contributes to the broad tropism of the
virus in vivo.
Materials and Methods
Cells
African green monkey Vero kidney epithelial cells (ATCC CRL
1586), human Caco-2 colorectal adenocarcinoma (ATCC HTB-37),
human Calu-3 lung adenocarcinoma (ATCC HTB-55), and A549
human epithelial lung cells stably expressing ACE2 or ACE2 and
TMPRSS2 (A549*and TMPRSS2+A549*, respectively) were all
maintained in Dulbecco’s modified Eagle’s medium (DMEM) supple-
mented with 10% fetal bovine serum (FBS), 100 units/ml penicillin,
and 100 µg/ml streptomycin. A549 cell lines were a kind gift from
Prof. Ralf Bartenschlager (Steuten et al, 2021). Baby hamster kidney
cells (BHK-21) were grown in Glasgow’s minimal essential medium
containing 10% tryptose phosphate broth, 5% FBS, 100 units/ml
penicillin, and 100 µg/ml streptomycin. All cell lines were grown in
an atmosphere of 5% CO
2
in air at 37°C. All products used for cell
culture were obtained from Thermo Fisher Scientific and Sigma-
Aldrich.
Viruses
SARS-CoV-2 (strain BavPat1) was obtained from Prof. Christian
Drosten at the Charit
e in Berlin, Germany, and provided via the
European Virology Archive. The virus was amplified in Vero
16 of 20 The EMBO Journal e107821 |2021 ª2021 The Authors
The EMBO Journal Jana Koch et al
cells in the presence of 2% serum, and working stocks were
used after three passages. Uukuniemi (UUKV) and Semliki forest
(SFV) viruses were previously described and amplified in BHK-21
cells (Helenius et al, 1980; Mazelier et al, 2016). For titration of
SARS-CoV-2, confluent monolayers of Vero cells were infected
with 10-fold dilutions of virus in serum-free medium and then
grown in the presence of complete medium containing 2%
serum and 0.05% agarose to prevent virus spread. Plaques were
stained by crystal violet 3 days post-infection. The MOI was
assigned for SARS-CoV-2 according to the titer determined on
Vero cells. The MOI for SFV and UUKV was given based on the
titers determined on BHK-21 cells as previously described
(Lozach et al, 2010).
Antibodies
The mouse mAb against SARS-CoV-2 nucleoprotein NP (40143-
MM05) was purchased from Sino Biologicals and used at dilutions
of 1:500 for flow cytometry analysis and 1:1,000 for titration in
TCID50 assays. The rabbit polyclonal antibody against SARS-CoV-
2 spike protein was obtained from Thermo Fisher Scientific (PA1-
41165). The rabbit polyclonal antibody U2 targets all the UUKV
structural proteins and was used at a dilution of 1:4,000 for
immunohistochemistry in foci-forming unit assays (Lozach et al,
2011b). The mouse mAb 8B11A3 against the UUKV nucleoprotein
N was a kind gift from Ludwig Institute for Cancer Research
(Stockholm, Sweden) (Persson & Pettersson, 1991). The mouse
mAb against SFV glycoprotein E2 was kindly provided by Prof.
Margaret Kielian (Albert Einstein College of Medicine, USA). mAb
8B11A3 and mAb against SFV E2 were used at a dilution of 1:400
for flow cytometry analysis. Rabbit antibodies against TMPRSS2
(ab92323) and actin (A2066) were obtained from Abcam and
Sigma, respectively. Mouse mAb against cathepsin L (BMS1032)
and a-tubulin (T5158) were purchased from Thermo Fisher Scien-
tific and Sigma, respectively. The goat polyclonal antibody against
the elongation factor 2 (EF2, SC-13004) was obtained from Santa
Cruz. Anti-mouse secondary antibodies were conjugated to Alexa
Fluor (AF) 405 (Molecular Probes), AF488 (Molecular Probes),
IRDye 700 (LI-COR), IRDye 800CW (LI-COR), and horseradish
peroxidase (HRP; Vector Laboratories). Anti-rabbit and anti-goat
secondary antibodies conjugated to IRDye 800CW were purchased
from LI-COR.
Reagents and plasmids
Aprotinin (Cayman Chemical), camostat mesylate (Sigma), chloro-
quine diphosphate (Sigma), and NH
4
Cl (Sigma) stocks were
dissolved in water. Bafilomycin A1 (BioViotica), colcemid (Cayman
Chemical), concanamycin B (BioViotica), MG-132 (Selleck
Chemicals), SB412515 (Cayman Chemical), and DL-threo-1-phenyl-
2-palmitoylamino-3-morpholino-1-propanol (PPMP, Cayman
Chemical) were all dissolved in DMSO. All drugs were assessed for
cytotoxicity at the indicated concentrations using the CytoTox96
Non-Radioactive Cytotoxicity colorimetric assay (Promega) accord-
ing to the provider’s recommendations. Furin was purchased from
R&D, and thermolysin and trypsin were purchased from Sigma.
Plasmids encoding EGFP-tagged Rab7a, Rab7a T22N, and Rab7a
Q67L have been described elsewhere (Lozach et al, 2010).
Protein analysis
Cells were lysed with phosphate-buffered saline (PBS) containing
0.1% Triton X-100 (Merck Millipore) according to a standard proce-
dure (Lozach et al, 2011b). Cell lysates were then diluted in LDS
sample buffer (Thermo Fisher Scientific) and analyzed by SDS–
PAGE (Nu-PAGE Novex 10% Bis-Tris gels; Thermo Fisher Scien-
tific). Proteins were subsequently transferred to polyvinylidene
difluoride membranes (iBlot transfer stacks; Thermo Fisher Scien-
tific). The membranes were first blocked with intercept blocking
buffer (LI-COR) and then incubated with primary antibodies against
the SARS-CoV-2 spike, TMPRSS2, cathepsin L, EF2, actin, and a-
tubulin, all diluted in Tris-buffered saline containing 0.1% Tween
and intercept blocking buffer (1:1,000, 1:1,000, 1:400, 1:1,000,
1:5,000, and 1:2,000, respectively). After extensive washing, the
membranes were incubated with the corresponding secondary anti-
bodies conjugated to IRDye 700 or 800CW (both at 1:10,000) or
HRP (1:1,000). Proteins were analyzed with a LI-COR Odyssey CLx
scanner, or alternatively, detected with SuperSignal West Pico PLUS
chemiluminescent substrate (Thermo Fisher Scientific) and an Intas
ChemoStar ECL analyzer.
Virus infection
Cells were exposed to viruses at the indicated MOIs in the presence
of 2% FBS for 1 h at 37°C. Viral input was then replaced with
complete culture medium, and the infected cells were incubated for
8 h before fixation. For virus-mediated cell–cell fusion, cells were
infected for 24 h. Cells that transiently expressed EGFP-Rab7a and
related mutants were infected 18 h post-transfection. For pH inacti-
vation, citric acid, 2-(N-morpholino)-ethanesulfonic acid (MES), and
4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) were
used at 100 mM as buffers with pH values of pH <5.5, 5.5 <pH
<6.5, and 6.5 <pH, respectively. Viral inputs were exposed to
buffers at the indicated pH for 10 min at 37°C and then to buffers at
neutral pH prior to infection. For furin, trypsin, or thermolysin acti-
vation, SARS-CoV-2 was pretreated with furin (1 µg/ml), trypsin
(100 µg/ml), or thermolysin (1 mg/ml), respectively, for 15 min at
37°C and then allowed to infect cells. For inhibition assays, cells
were pretreated with drugs for 30 min at 37°C or 3 h on ice for
colcemid pretreatment and then exposed to viruses in the continu-
ous presence of the inhibitors. For inhibitor add-in time courses,
virus binding to cells was synchronized on ice for 90 min. Cells
were then rapidly warmed to 37°C, and SB412515 (10 µM), apro-
tinin (30 µM), NH
4
Cl (at indicated concentrations), concanamycin B
(50 nM), and MG-132 (at indicated concentrations) were added at
the indicated times. Cells were subsequently incubated at 37°C and
harvested 8 h after the initial warm shift. Infection was monitored
by flow cytometry, fluorescence microscopy, or qRT–PCR. For anal-
ysis of infection by microscopy, cells were seeded on Lab-Tek glass-
bottom 8-well chamber slides.
DNA transfection
As previously described (Meier et al, 2014), Vero cells in 24-well
plates were transfected with 750 ng of plasmids using Lipofectamine
2000 (Invitrogen) according to the manufacturer’s recommendations
and washed 5 h later.
ª2021 The Authors The EMBO Journal e107821 |2021 17 of 20
Jana Koch et al The EMBO Journal
Immunofluorescence microscopy
Fluorescence microscopy was performed as extensively described in
Ref. Leger et al (2020). Briefly, infected cells were rinsed with PBS,
permeabilized with 0.5% Triton X-100 (Sigma) for 15 min at room
temperature (RT), and stained with primary antibodies diluted in
PBS for 1 h at RT. Subsequently, the cells were extensively washed
and incubated with secondary antibodies for 1 h at RT. Samples
were then stained with Hoechst 33258 (0.5 µg/ml, Thermo Fisher
Scientific) and imaged with a Leica TCS SP8 confocal microscope.
Flow cytometry
The flow cytometry-based infection assay has been described previ-
ously (Mazelier et al, 2016). Briefly, infected cells were fixed with
4% formaldehyde for 30 min at RT and then permeabilized with
0.1% saponin (SERVA). Cells were then exposed to primary anti-
body at RT for 1 h, washed, and subsequently incubated with
secondary anti-mouse antibodies at RT for another 1 h. Infected
cells were quantified with a FACSCelesta cytometer (Becton Dickin-
son) and FlowJo software (TreeStar).
Viral RNA quantification
As previously reported (Woelfl et al, 2020), RNA was harvested
from cells using the NucleoSpin RNA extraction kit (Macherey-
Nagel) according to the manufacturer’s instructions. cDNA was
synthesized using iSCRIPT reverse transcriptase (Bio-Rad) from
250 ng of total RNA as per supplier recommendations. qPCR was
performed using iTaq SYBR green (Bio-Rad) following the manufac-
turer’s instructions for the SARS-CoV-2 genome using the forward
primer, GCCTCTTCTCGTTCC, and the reverse primer, AGCAGCAT-
CACCGCC. HPRT1 was used as a housekeeping gene and amplified
using the forward primer CCTGGCGTCGTGATTAGTGAT and
reverse primer AGACGTTCAGTCCTGTCCATAA.
TCID50 assay
Confluent monolayers of Vero and Caco-2 cells in 96-well plates
were infected with 10-fold serial dilutions of SARS-CoV-2. Infected
cells were fixed at 24 hpi and subjected to immunostaining using
mouse mAb anti-SARS-CoV-2 NP as the primary antibody and then
anti-mouse antibody 800CW (1:10,000) as the secondary antibody.
Samples were finally scanned on LI-COR.
Cell–cell fusion
Infected cells and fresh cells, not infected but prestained with
2.5 µM of CellTracker Green CMFDA dye (Thermo Fisher Scientific)
in serum-free medium for 30 min at 37°C, were detached with
0.5 mM ethylenediaminetetraacetic acid (EDTA, Thermo Fisher
Scientific) and cocultured at a 3:1 ratio in complete medium for 5 h
at 37°C. Cells were then washed in PBS, exposed to furin (1 µg/ml)
and trypsin (100 µg/ml) for 5 min at 37°C, and left to incubate for
an additional hour at 37°C prior fixation. Alternatively, cells were
not fixed but treated with DMEM containing 0.2% bovine serum
albumin (Gibco) buffered at pH 7.4, 6.0, or 5.0 with 30 mM HEPES,
MES, or citric acid, respectively, for 5 min at 37°C. Subsequently,
the cells were washed and incubated in complete medium for an
additional hour at 37°C prior fixation. After fixation, cells were
subjected to immunofluorescence staining against SARS-CoV-2 NP,
and nuclei stained with Hoechst 33258 (0.5 µg/ml). The formation
of syncytia was evaluated by fluorescence microscopy by counting
the number of nuclei and cells positive for CMFDA present in a
microscope field. A fusion index (f) was calculated according to the
equation f=(1 –[c/n]), where cis the number of cells in a field
after fusion and nis the number of nuclei. An average field
contained 30–60 nuclei.
Statistical analysis
Graph plotting of numerical values, as well as the statistics, was
achieved with Prism v9.1.1 (GraphPad Software). The sample sizes
(n), reproducibility information, and statistical methods, including
parameters and Pvalues, are indicated in the figure legends when
appropriate.
Data availability
This study includes no data deposited in external repositories.
Expanded View for this article is available online.
Acknowledgements
This work was supported by grants from CellNetworks Research Group funds,
Heidelberg, and from the Deutsche Forschungsgemeinschaft (DFG) project
numbers LO-2338/1-1and LO-2338/3-1to PYL. This work was also supported
by INRAE starter funds, IDEX-Impulsion 2020 (University of Lyon), and FINOVI
(Fondation pour l’Universit
e de Lyon), all to PYL. SB received support from DFG
project numbers 415089553 (Heisenberg program), 240245660 (SFB1129),
278001972 (TRR186), and 272983813 (TRR179) as well as the state Baden
Wuerttemberg (AZ: 33.7533.-6-21/5/1) and the Bundesministerium Bildung und
Forschung (BMBF) (01KI20198A). MS was supported by DFG project
416072091. We acknowledge funding from the German Academic Exchange
Service (DAAD, Research Grant 57440921) to PD. We also acknowledge Vibor
Laketa and the Imaging Platform at the Center for Integrative Infectious
Disease Research, Heidelberg. We thank Felix Rey and Ari Helenius for fruitful
discussions. Open Access funding enabled and organized by Projekt DEAL.
Author contributions
JK, ZMU, and P-YL designed research; JK, ZMU, PD, and MS performed research;
JK, ZMU, MS, SB, and P-YL analyzed data; P-YL wrote the original draft; and JK,
ZMU, MS, SB, and P-YL reviewed and edited the paper.
Conflict of interest
The authors declare that they have no conflict of interest.
References
Bertram S, Dijkman R, Habjan M, Heurich A, Gierer S, Glowacka I, Welsch K,
Winkler M, Schneider H, Hofmann-Winkler H et al (2013) TMPRSS2
activates the human coronavirus 229E for cathepsin-independent host cell
entry and is expressed in viral target cells in the respiratory epithelium. J
Virol 87:6150 –6160
18 of 20 The EMBO Journal e107821 |2021 ª2021 The Authors
The EMBO Journal Jana Koch et al
Bestle D, Heindl MR, Limburg H, van Lam Van T, Pilgram O, Moulton H, Stein
DA, Hardes K, Eickmann M, Dolnik O et al (2020) TMPRSS2and furin are
both essential for proteolytic activation of SARS-CoV-2in human airway
cells. Life Sci Alliance 3:e202000786
Bojkova D, Bechtel M, McLaughlin K-M, McGreig JE, Klann K, Bellinghausen C,
Rohde G, Jonigk D, Braubach P, Ciesek S et al (2020) Aprotinin inhibits
SARS-CoV-2replication. Cells 9:2377
Boulant S, Stanifer M, Kural C, Cureton DK, Massol R, Nibert ML, Kirchhausen
T(2013) Similar uptake but different trafficking and escape routes of
reovirus virions and infectious subvirion particles imaged in polarized
Madin-Darby canine kidney cells. Mol Biol Cell 24:1196 –1207
Bratt MA, Gallaher WR (1969) Preliminary analysis of the requirements for
fusion from within and fusion from without by Newcastle disease virus.
Proc Natl Acad Sci USA 64:536 –543
Buchrieser J, Dufloo J, Hubert M, Monel B, Planas D, Rajah MM, Planchais C,
Porrot F, Guivel-Benhassine F, Van der Werf S et al (2020) Syncytia
formation by SARS-CoV-2-infected cells. EMBO J 39:e106267
Cai Y, Zhang J, Xiao T, Peng H, Sterling SM, Walsh Jr RM, Rawson S, Rits-
Volloch S, Chen B (2020) Distinct conformational states of SARS-CoV-2
spike protein. Science 369:1586 –1592
Caly L, Druce J, Roberts J, Bond K, Tran T, Kostecki R, Yoga Y, Naughton W,
Taiaroa G, Seemann T et al (2020) Isolation and rapid sharing of the 2019
novel coronavirus (SARS-CoV-2) from the first patient diagnosed with
COVID-19 in Australia. Med J Aust 212:459 –462
Chen Y-W, Lee M-S, Lucht A, Chou F-P, Huang W, Havighurst TC, Kim KM,
Wang J-K, Antalis TM, Johnson MD et al (2010) TMPRSS2, a serine
protease expressed in the prostate on the apical surface of luminal
epithelial cells and released into semen in prostasomes, is misregulated in
prostate cancer cells. Am J Pathol 176:2986 –2996
Choi SY, Bertram S, Glowacka I, Park YW, Pohlmann S (2009) Type II
transmembrane serine proteases in cancer and viral infections. Trends Mol
Med 15:303 –312
Clausen TM, Sandoval DR, Spliid CB, Pihl J, Painter CD, Thacker BE, Glass CA,
Narayanan A, Majowicz SA, Zhang Y et al (2020) SARS-CoV-2infection
depends on cellular heparan sulfate and ACE2.Cell 183:1043 –1057.e15
Coutard B, Valle C, de Lamballerie X, Canard B, Seidah NG, Decroly E (2020)
The spike glycoprotein of the new coronavirus 2019-nCoV contains a
furin-like cleavage site absent in CoV of the same clade. Antiviral Res 176:
104742
Daly JL, Simonetti B, Klein K, Chen KE, Williamson MK, Anton-Plagaro C,
Shoemark DK, Simon-Gracia L, Bauer M, Hollandi R et al (2020)
Neuropilin-1is a host factor for SARS-CoV-2infection. Science 370:
861 –865
Earnest JT, Hantak MP, Li K, McCray Jr PB, Perlman S, Gallagher T (2017) The
tetraspanin CD9facilitates MERS-coronavirus entry by scaffolding host
cell receptors and proteases. PLoS Pathog 13:e1006546
Hantak MP, Qing E, Earnest JT, Gallagher T (2019) Tetraspanins: architects of
viral entry and exit platforms. J Virol 93:e01429-17
Harrison SC (2015) Viral membrane fusion. Virology 479–480:498 –507
Hartenian E, Nandakumar D, Lari A, Ly M, Tucker JM, Glaunsinger BA (2020)
The molecular virology of coronaviruses. J Biol Chem 295:12910 –12934
Helenius A (2013) Virus entry: what has pH got to do with it? Nat Cell Biol
15:125
Helenius A, Kartenbeck J, Simons K, Fries E (1980) On the entry of Semliki
forest virus into BHK-21 cells. J Cell Biol 84:404 –420
Hoffmann M, Kleine-Weber H, Pohlmann S (2020a) A multibasic cleavage site
in the spike protein of sars-cov-2is essential for infection of human lung
cells. Mol Cell 78:779 –784.e5
Hoffmann M, Kleine-Weber H, Schroeder S, Kr€
uger N, Herrler T, Erichsen S,
Schiergens TS, Herrler G, Wu N-H, Nitsche A et al (2020b) SARS-CoV-2Cell
entry depends on ACE2and TMPRSS2and is blocked by a clinically proven
protease inhibitor. Cell 181:271 –280.e8
Huotari J, Helenius A (2011) Endosome maturation. EMBO J 30:3481 –3500
Jaimes JA, Andr
e NM, Millet JK, Whittaker GR (2020) Phylogenetic analysis
and structural modeling of SARS-CoV-2spike protein reveals an
evolutionary distinct and proteolytically sensitive activation loop. J Mol
Biol 432:3309 –3325
Kawase M, Shirato K, Matsuyama S, Taguchi F (2009) Protease-mediated
entry via the endosome of human coronavirus 229E. J Virol 83:712 –721
Ke Z, Oton J, Qu K, Cortese M, Zila V, McKeane L, Nakane T, Zivanov J,
Neufeldt CJ, Cerikan B et al (2020) Structures and distributions of SARS-
CoV-2spike proteins on intact virions. Nature 588:498 –502
Khor R, McElroy LJ, Whittaker GR (2003) The ubiquitin-vacuolar protein
sorting system is selectively required during entry of influenza virus into
host cells. Traffic 4:857 –868
Kleine-Weber H, Elzayat MT, Hoffmann M, Pohlmann S (2018) Functional
analysis of potential cleavage sites in the MERS-coronavirus spike protein.
Sci Rep 8:16597
Lai AL, Millet JK, Daniel S, Freed JH, Whittaker GR (2017) The SARS-CoV fusion
peptide forms an extended bipartite fusion platform that perturbs
membrane order in a calcium-dependent manner. J Mol Biol 429:
3875 –3892
L
eger P, Nachman E, Richter K, Tamietti C, Koch J, Burk R, Kummer S, Xin Q,
Stanifer M, Bouloy M et al (2020) NSs amyloid formation is associated
with the virulence of Rift Valley fever virus in mice. Nat Commun 11:3281
Liu T, Luo S, Libby P, Shi GP (2020) Cathepsin L-selective inhibitors: a
potentially promising treatment for COVID-19 patients. Pharmacol Ther
213:107587
Lozach PY, Huotari J, Helenius A (2011a) Late-penetrating viruses. Curr Opin
Virol 1:35 –43
Lozach PY, Kuhbacher A, Meier R, Mancini R, Bitto D, Bouloy M, Helenius A
(2011b) DC-SIGN as a receptor for phleboviruses. Cell Host Microbe 10:
75 –88
Lozach PY, Mancini R, Bitto D, Meier R, Oestereich L, Overby AK, Pettersson
RF, Helenius A (2010) Entry of bunyaviruses into mammalian cells. Cell
Host Microbe 7:488 –499
Matsuyama S, Nao N, Shirato K, Kawase M, Saito S, Takayama I, Nagata N,
Sekizuka T, Katoh H, Kato F et al (2020) Enhanced isolation of SARS-CoV-2
by TMPRSS2-expressing cells. Proc Natl Acad Sci USA 117:7001 –7003
Mazelier M, Rouxel RN, Zumstein M, Mancini R, Bell-Sakyi L, Lozach PY
(2016) Uukuniemi virus as a tick-borne virus model. J Virol 90:6784 –6798
Meier R, Franceschini A, Horvath P, Tetard M, Mancini R, von Mering C,
Helenius A, Lozach PY (2014) Genome-wide small interfering RNA screens
reveal VAMP3as a novel host factor required for Uukuniemi virus late
penetration. J Virol 88:8565 –8578
Modrow S, Falke D, Truyen U, Sch€
atzl H (2013) Viruses with single-stranded,
positive-sense RNA genomes. In Molecular virology, Modrow S, Falke D,
Truyen U, Sch€
atzl H (eds.), pp 185 –349. Berlin, Heidelberg: Springer
Mohamed MM, Sloane BF (2006) Cysteine cathepsins: multifunctional
enzymes in cancer. Nat Rev Cancer 6:764 –775
Ohkuma S, Poole B (1978) Fluorescence probe measurement of the
intralysosomal pH in living cells and the perturbation of pH by various
agents. Proc Natl Acad Sci USA 75:3327 –3331
Ou T, Mou H, Zhang L, Ojha A, Choe H, Farzan M (2021) Hydroxychloroquine-
mediated inhibition of SARS-CoV-2entry is attenuated by TMPRSS2.PLoS
Pathog 17:e1009212
ª2021 The Authors The EMBO Journal e107821 |2021 19 of 20
Jana Koch et al The EMBO Journal
Ou X, Liu Y, Lei X, Li P, Mi D, Ren L, Guo Li, Guo R, Chen T, Hu J et al (2020)
Characterization of spike glycoprotein of SARS-CoV-2on virus entry and
its immune cross-reactivity with SARS-CoV. Nat Commun 11:1620
Papa G, Mallery DL, Albecka A, Welch LG, Cattin-Ortola J, Luptak J, Paul D,
McMahon HT, Goodfellow IG, Carter A et al (2021) Furin cleavage of SARS-
CoV-2Spike promotes but is not essential for infection and cell-cell fusion.
PLoS Pathog 17:e1009246
Paules CI, Marston HD, Fauci AS (2020) Coronavirus infections-more than just
the common cold. JAMA 323:707 –708
Persson R, Pettersson RF (1991) Formation and intracellular transport of a
heterodimeric viral spike protein complex. J Cell Biol 112:257 –266
Qian Z, Dominguez SR, Holmes KV (2013) Role of the spike glycoprotein of
human Middle East respiratory syndrome coronavirus (MERS-CoV) in virus
entry and syncytia formation. PLoS One 8:e76469
Quirin K, Eschli B, Scheu I, Poort L, Kartenbeck J, Helenius A (2008)
Lymphocytic choriomeningitis virus uses a novel endocytic pathway for
infectious entry via late endosomes. Virology 378:21 –33
Schornberg K, Matsuyama S, Kabsch K, Delos S, Bouton A, White J (2006) Role
of endosomal cathepsins in entry mediated by the Ebola virus
glycoprotein. J Virol 80:4174 –4178
Shang J, Wan Y, Luo C, Ye G, Geng Q, Auerbach A, Li F (2020) Cell entry
mechanisms of SARS-CoV-2.Proc Natl Acad Sci USA 117:11727 –11734
Shirato K, Kanou K, Kawase M, Matsuyama S (2017) Clinical isolates of human
coronavirus 229E bypass the endosome for cell entry. J Virol 91:e01387-16
Shirato K, Kawase M, Matsuyama S (2013) Middle East respiratory syndrome
coronavirus infection mediated by the transmembrane serine protease
TMPRSS2.J Virol 87:12552 –12561
Shirato K, Kawase M, Matsuyama S (2018) Wild-type human coronaviruses
prefer cell-surface TMPRSS2to endosomal cathepsins for cell entry.
Virology 517:9–15
Simmons G, Gosalia DN, Rennekamp AJ, Reeves JD, Diamond SL, Bates P
(2005) Inhibitors of cathepsin L prevent severe acute respiratory syndrome
coronavirus entry. Proc Natl Acad Sci USA 102:11876 –11881
Steuten K, Kim H, Widen JC, Babin BM, Onguka O, Lovell S, Bolgi O, Cerikan B,
Neufeldt CJ, Cortese M et al (2021) Challenges for targeting SARS-CoV-2
proteases as a therapeutic strategy for COVID-19.ACS Infect Dis 7:
1457 –1468
Tang T, Jaimes JA, Bidon MK, Straus MR, Daniel S, Whittaker GR (2021)
Proteolytic activation of SARS-CoV-2spike at the S1/S2boundary:
potential role of proteases beyond Furin. ACS Infect Dis 7:264 –272
Triana S, Metz-Zumaran C, Ramirez C, Kee C, Doldan P, Shahraz M,
Schraivogel D, Gschwind AR, Sharma AK, Steinmetz LM et al (2021) Single-
cell analyses reveal SARS-CoV-2interference with intrinsic immune
response in the human gut. Mol Syst Biol 17:e10232
Turo
nov
a B, Sikora M, Sch€
urmann C, Hagen WJH, Welsch S, Blanc FEC, von
B€
ulow S, Gecht M, Bagola K, Hörner C et al (2020) In situ structural
analysis of SARS-CoV-2spike reveals flexibility mediated by three hinges.
Science 370:203 –208
Walls AC, Park YJ, Tortorici MA, Wall A, McGuire AT, Veesler D (2020)
Structure, function, and antigenicity of the sars-cov-2spike glycoprotein.
Cell 181:281 –292.e6
Wang L, Xiang Y (2020) Spike glycoprotein-mediated entry of SARS
coronaviruses. Viruses 12:1289
Wang M, Cao R, Zhang L, Yang X, Liu J, Xu M, Shi Z, Hu Z, Zhong W, Xiao G
(2020) Remdesivir and chloroquine effectively inhibit the recently emerged
novel coronavirus (2019-nCoV) in vitro. Cell Res 30:269 –271
White J, Matlin K, Helenius A (1981) Cell fusion by Semliki forest, influenza,
and vesicular stomatitis viruses. J Cell Biol 89:674 –679
Woelfl F, Leger P, Oreshkova N, Pahmeier F, Windhaber S, Koch J, Stanifer M,
Roman Sosa G, Uckeley ZM, Rey FA et al (2020) Novel toscana virus
reverse genetics system establishes nss as an antagonist of type I
interferon responses. Viruses 12:400
Wrapp D, Wang N, Corbett KS, Goldsmith JA, Hsieh CL, Abiona O, Graham BS,
McLellan JS (2020) Cryo-EM structure of the 2019-nCoV spike in the
prefusion conformation. Science 367:1260 –1263
Wrobel AG, Benton DJ, Xu P, Roustan C, Martin SR, Rosenthal PB, Skehel JJ,
Gamblin SJ (2020) SARS-CoV-2and bat RaTG13 spike glycoprotein
structures inform on virus evolution and furin-cleavage effects. Nat Struct
Mol Biol 27:763 –767
Yu GY, Lai MM (2005) The ubiquitin-proteasome system facilitates the
transfer of murine coronavirus from endosome to cytoplasm during virus
entry. J Virol 79:644 –648
Zecha J, Lee C-Y, Bayer FP, Meng C, Grass V, Zerweck J, Schnatbaum K,
Michler T, Pichlmair A, Ludwig C et al (2020) Data, reagents, assays and
merits of proteomics for SARS-CoV-2research and testing. Mol Cell
Proteomics 19:1503 –1522
Zhou T, Tsybovsky Y, Gorman J, Rapp M, Cerutti G, Chuang G-Y, Katsamba PS,
Sampson JM, Schön A, Bimela J et al (2020) Cryo-EM structures of SARS-
CoV-2spike without and with ACE2reveal a pH-dependent switch to
mediate endosomal positioning of receptor-binding domains. Cell Host
Microbe 28:867 –879.e5
Zhou Y, Vedantham P, Lu K, Agudelo J, Carrion R, Nunneley JW, Barnard
D, Pöhlmann S, McKerrow JH, Renslo AR et al (2015) Protease
inhibitors targeting coronavirus and filovirus entry. Antiviral Res 116:
76 –84
License: This is an open access article under the
terms of the Creative Commons Attribution-NonCom
mercial-NoDerivs License, which permits use and
distribution in any medium, provided the original
work is properly cited, the use is non-commercial and
no modifications or adaptations are made.
20 of 20 The EMBO Journal e107821 |2021 ª2021 The Authors
The EMBO Journal Jana Koch et al
