ArticlePDF Available

Therapeutic Potential of Novel Mastoparan-Chitosan Nanoconstructs Against Clinical MDR Acinetobacter baumannii: In silico, in vitro and in vivo Studies

Authors:

Abstract and Figures

Purpose: Acinetobacter baumannii antibiotic resistant infections in high-risk patients are a great challenge for researchers and clinicians worldwide. In an effort to achieve potent bactericidal outcomes, a novel chitosan-mastoparan nanoconstruct (Mast-Cs NC) was designed and assessed for its therapeutic potential through in silico, in vitro and in vivo experimentation against clinical multidrug-resistant (MDR) A. baumannii. Methods: Optimized 3D structures of mastoparan and chitosan were coupled computationally through an ionic cross-linker to generate a circular ring of chitosan encasing mastoparan. The complex was assessed for interactions and stability through molecular dynamic simulation (MDS). Binding pocket analysis was used to assess the protease-peptide interface. Mast-Cs NC were prepared by the ionic gelation method. Mast-Cs NC were evaluated in vitro and in vivo for their therapeutic efficacy against drug-resistant clinical A. baumannii. Results: MDS for 100 ns showed stable bonds between chitosan and mastoparan; the first at chitosan oxygen atom-46 and mastoparan isoleucine carbon atom with a distance of 2.77 Å, and the second between oxygen atom-23 and mastoparan lysine nitrogen atom with a distance of 2.80 Å, and binding energies of -3.6 and -7.4 kcal/mol, respectively. Mast-Cs complexes approximately 156 nm in size, with +54.9 mV zeta potential and 22.63% loading capacity, offered >90% encapsulation efficiency and were found to be geometrically incompatible with binding pockets of various proteases. The MIC90 of Mast-Cs NC was significantly lower than that of chitosan (4 vs 512 μg/mL, respectively, p<0.05), with noticeable bacterial damage upon morphological analysis. In a BALB/c mouse sepsis model, a significant reduction in bacterial colony count in the Mast-Cs treated group was observed compared with chitosan and mastoparan alone (p<0.005). Mast-Cs maintained good biocompatibility and cytocompatibility. Conclusion: Novel mastoparan-loaded chitosan nanoconstructs signify a successful strategy for achieving a synergistic bactericidal effect and higher therapeutic efficacy against MDR clinical A. baumannii isolates. The Mast-Cs nano-drug delivery system could work as an alternative promising treatment option against MDR A. baumannii.
n silico analysis of chitosan and mastoparan. (A) RMSD plot for Mast-Cs complex during 100 ns of molecular dynamic simulation. Mastoparan is shown in blue and chitosan in red. The RMSD values of mastoparan (left y-axis) and chitosan (right y-axis), calculated in angstroms (Å), were plotted against simulation time (x-axis 0-100 ns). (B) RMSF of mastoparan (Å) illustrated no/less fluctuation in the structure, and more rigidity in α-helices of mastoparan. (C) Mastoparan-chitosan interactions. Mastoparan-chitosan/ligand interactions are presented with interaction fractions on the y-axis and amino acids on the x-axis (green represents hydrogen bonding, pink represents ionic interactions, blue represents water bridges, purple representes hydrophobic interactions). (D) Timeline illustration of the Mast-Cs interactions presented with amino acids on the y-axis and time from 0 to 100 ns on the x-axis. The orange band on the right-hand side of the graph represents the number of contacts, ranging from zero (white) to more than four (dark orange). The graph shows alanine 7, alanine 10, isoleucine 13 and lysine 4 contributing to stable backbone hydrogen bonding throughout the 100 ns simulation. (E) Ligand torsion analysis over the course of the trajectory (0-100 ns). Each rotatable bond in the chitosan (ligand) is color coded. The dial plot (0-180°) represents the conformational changes in the bond over time. (F) Chitosan (ligand) properties over 100 ns simulation. Ligand RMSD (cÅ), radius of gyration (Å), intramolecular hydrogen bond, MolSA (Å), SASA (cÅ) and PSA Å) values during the simulation (y-axis) are presented with reference to time (100 ns on the x-axis). (G and H) Graphical illustrations of SSE analysis, with SSE (α-helix) represented in orange. SSE vs residue index (amino acids) shows an α-helix distribution by residue index; time (100 ns) vs residue index shows the SSE composition for each frame over the 100 ns simulation, and the plot shows the contribution of each residue over time. The structure of Mast-Cs remained globally conserved throughout the 100 ns simulation. Abbreviations: RMSD, root mean square deviation; RMSF, root mean square fluctuation; MolSa, molecular surface area; SASA, solvent-accessible surface area; PSA, polar surface area; SSE, secondary structure element.
… 
Content may be subject to copyright.
ORIGINAL RESEARCH
Therapeutic Potential of Novel Mastoparan-Chitosan
Nanoconstructs Against Clinical MDR Acinetobacter
baumannii: In silico, in vitro and in vivo Studies
Afreenish Hassan
1
Aamer Ikram
1
Abida Raza
2
Sidra Saeed
2
Rehan Zafar Paracha
3
Zumara Younas
1
Muhammad Tahir Khadim
1
1
Department of Microbiology, Armed
Forces Institute of Pathology, National
University of Medical Sciences,
Rawalpindi, Pakistan;
2
NILOP
Nanomedicine Research Laboratories,
National Institute of Lasers and
Optronics College, Pakistan Institute of
Engineering and Applied Sciences,
Islamabad, Pakistan;
3
National University
of Sciences and Technology, Islamabad,
Pakistan
Purpose: Acinetobacter baumannii antibiotic resistant infections in high-risk patients are
a great challenge for researchers and clinicians worldwide. In an effort to achieve potent
bactericidal outcomes, a novel chitosan–mastoparan nanoconstruct (Mast-Cs NC) was
designed and assessed for its therapeutic potential through in silico, in vitro and in vivo
experimentation against clinical multidrug-resistant (MDR) A. baumannii.
Methods: Optimized 3D structures of mastoparan and chitosan were coupled computation-
ally through an ionic cross-linker to generate a circular ring of chitosan encasing mastoparan.
The complex was assessed for interactions and stability through molecular dynamic simula-
tion (MDS). Binding pocket analysis was used to assess the protease–peptide interface. Mast-
Cs NC were prepared by the ionic gelation method. Mast-Cs NC were evaluated in vitro and
in vivo for their therapeutic efcacy against drug-resistant clinical A. baumannii.
Results: MDS for 100 ns showed stable bonds between chitosan and mastoparan; the rst at
chitosan oxygen atom-46 and mastoparan isoleucine carbon atom with a distance of 2.77 Å,
and the second between oxygen atom-23 and mastoparan lysine nitrogen atom with
a distance of 2.80 Å, and binding energies of −3.6 and −7.4 kcal/mol, respectively. Mast-
Cs complexes approximately 156 nm in size, with +54.9 mV zeta potential and 22.63%
loading capacity, offered >90% encapsulation efciency and were found to be geometrically
incompatible with binding pockets of various proteases. The MIC
90
of Mast-Cs NC was
signicantly lower than that of chitosan (4 vs 512 μg/mL, respectively, p<0.05), with
noticeable bacterial damage upon morphological analysis. In a BALB/c mouse sepsis
model, a signicant reduction in bacterial colony count in the Mast-Cs treated group was
observed compared with chitosan and mastoparan alone (p<0.005). Mast-Cs maintained good
biocompatibility and cytocompatibility.
Conclusion: Novel mastoparan-loaded chitosan nanoconstructs signify a successful strategy
for achieving a synergistic bactericidal effect and higher therapeutic efcacy against MDR
clinical A. baumannii isolates. The Mast-Cs nano-drug delivery system could work as an
alternative promising treatment option against MDR A. baumannii.
Keywords: Acinetobacter baumannii, mastoparan, antimicrobial resistance, simulation,
chitosan, antimicrobial peptides, therapeutic efcacy, interactions
Introduction
Antibiotic-resistant bacterial infections are a critical healthcare challenge which is
being faced globally.
1
Acinetobacter baumannii has rapidly gained signicant attention
over the time, from being an innocuous organism to a superbug. It is one of the leading
pathogens in nosocomial infections, responsible for ventilator-associated pneumonia,
Correspondence: Abida Raza
NILOP Nanomedicine Research
Laboratories, National Institute of Lasers
and Optronics College, Pakistan Institute
of Engineering and Applied Sciences,
Lehtrar Road, Nilore, Islamabad, Pakistan
Tel +92519248671-6 ext. 3103, 3177
Fax +92 51 2208051
Email abida_rao@yahoo.com
Afreenish Hassan
Department of Microbiology, Armed
Forces Institute of Pathology, National
University of Medical Sciences,
Rawalpindi, Pakistan
Tel +92515176406 ext. 345
Email afreenish.hassan@yahoo.com
International Journal of Nanomedicine 2021:16 3755–3773 3755
© 2021 Hassan et al. This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms.
php and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By accessing the
work you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed. For
permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms (https://www.dovepress.com/terms.php).
International Journal of Nanomedicine Dovepress
open access to scientific and medical research
Open Access Full Text Article
Received: 13 December 2020
Accepted: 27 March 2021
Published: 1 June 2021
International Journal of Nanomedicine downloaded from https://www.dovepress.com/ by 185.234.144.17 on 02-Jun-2021
For personal use only.
Powered by TCPDF (www.tcpdf.org)
wound infections, septicemia and urinary tract infections,
especially in the immunocompromised patients.
2,3
Its gen-
ome has the ability to acquire resistance and to adapt its
virulence mechanisms with the passage of time.
4,5
Some
A. baumannii strains even show resistance to the last-line
available drugs, such as carbapenems and colistin.
6
The
Infectious Diseases Society of America has included
A. baumannii in the hit list of the top six priority pathogens
(ESKAPE) against which either no or very limited treatment
options are available.
7
In a nationwide surveillance program
in China, conducted during 2005–2014, high resistance
against imipenem (57%) and meropenem (61%) was
reported in Acinetobacter spp.
8
Drug-resistant
A. baumannii can contribute as much as 63% to nosocomial
infections.
9
The mortality rate in ventilator-associated pneu-
monia caused by extensively drug-resistant A. baumannii
strains can be as high as 84.3%.
10
The alarmingly high
disease burden of resistant A. baumannii has led to the
exploration of alternative approaches. A phototheranostic
nanoparticle-based antibiotic,
11
photothermal eradication of
bacterial biolms,
12
physical cavitation through laser
irradiation,
13
photodynamic therapy
14
and polylactic co–gly-
colic acid nanocapsules
15
have been applied to address the
bacterial resistance phenomenon.
The therapeutic potential of antimicrobial peptides
(AMPs) has been highlighted over the years. The unique
electrostatic interactions between AMPs and bacterial cells
have shown promising therapeutic results. Furthermore,
AMPs, being small in nature, have the ability to penetrate
cells and tissues and can show effective antimicrobial
activity against both Gram-positive and Gram-negative
bacteria without any specic binding to receptors.
16–19
LL-37, melittin, indolicidin, Cec4, Agelaia-MP1, poly-
bia–MPII, PolydimI and Con10 have shown high bacter-
icidal activity against A. baumannii.
20–24
LysAB2 P0–P3
has also demonstrated reasonably good in vitro and in vivo
antibacterial activity (minimal inhibitory concentration
[MIC] 4–64 μM) against multidrug-resistant (MDR)
A. baumannii.
25
Mastoparan is a 1479-Da positively charged peptide,
extracted from wasp venom, which contains 14 amino acid
residues (Ile–Asn–Leu–Lys–Ala–Leu–Ala–Ala–Leu–Ala–
Lys–Lys–Ile–Leu–NH
2
).
26
It is rich in hydrophobic residues
(71%) and forms amphipathic helical structures. The pro-
posed mechanism of action of mastoparan
includes disruption of the cell membrane, through the barrel
stave, toroidal pore, carpet or interfacial model,
27
causing
increased membrane permeability, cell lysis and ultimately
death.
The in vitro and in vivo behavior of AMPs against
bacteria can be predicted using in silico methodologies.
Majumder et al applied a quantitative structure–activity
relationship model based on an articial neural network,
and rationally predicted the MIC for mastoparan to be 14
μg/mL.
28
Similarly, Ramachandran et al conducted mole-
cular docking and free energy calculations to understand
the drug interactions with oxacillinases produced by
A. baumannii.
29–31
The presence of proteases (serine
protease, lysosomal acid alpha-glucosidase, cysteine pro-
tease, human calpain-1, prolylcarboxypeptidase, thimet
oligopeptidase, dipeptidyl peptidase) lowers the stability
of AMPs in biological uids. This impedes the therapeu-
tic application of AMPs in clinical practice.
19,32,33
Several researchers have suggested encapsulating AMPs
in smart and efcient drug delivery nanosystems, which
not only provide protection from proteolytic degradation
but also have the ability to generate synergistic
effects.
34–38
Fu et al reported a synergistic effect of
chitosan and polymyxin B-loaded liposomes against bio-
lm producing A. baumannii.
39
Similarly, Tamara et al
used chitosan nanovehicles for protamine to enhance the
antimicrobial activity toward Escherichia coli.
40
In
a study by Pourhajibagher et al, chitosan nanoparticles
were used as an efcient vehicle for indocyanine green
against A. baumannii.
41
The aim of the present work is to develop a novel
smart chitosan-encapsulated mastoparan drug delivery sys-
tem and to assess its therapeutic efcacy against MDR
A. baumannii clinical isolates both in vivo and in vitro.
We have adopted innovative approaches to study the sta-
bility parameters of Mast-Cs NC using in silico molecular
dynamic simulation (MDS). The suggested nanocomplex
has been shown to be bactericidal against these bacteria,
and may be a promising treatment solution against rapidly
emerging drug resistance in A. baumannii organisms.
Materials and Methods
Ethical Approval
The Institutional Review Board at the Armed Forces
Institute of Pathology, National University of Medical
Sciences, Rawalpindi, approved the whole study, including
the cell-line work (PhD-PATH-17-01/READ–IRB/19/202
NUMS, dated 4th March 2019), and the National Institute
of Health, Islamabad, approved the use of animals (F.1-5/
https://doi.org/10.2147/IJN.S296717
DovePress
International Journal of Nanomedicine 2021:16
3756
Hassan et al Dovepress
Powered by TCPDF (www.tcpdf.org)
International Journal of Nanomedicine downloaded from https://www.dovepress.com/ by 185.234.144.17 on 02-Jun-2021
For personal use only.
Powered by TCPDF (www.tcpdf.org)
ERC/2019, dated 29th July 2019). The handling and use of
animals followed International Council for Harmonisation
guidelines.
42
Human rhabdomyosarcoma (RD) cells ATCC
CCL 136 were received as a gift from the National
Institute of Health, Islamabad, Pakistan, for the cytocom-
patibility study only.
Materials
The mastoparan sequence (INLKALAALAKKIL-NH2),
retrieved from antimicrobial peptide database AP00201,
was synthesized with a purity of 97.48% and molecular
weight of 1478.94 Da (Bio Basic, Canada). Chitosan (mole-
cular weight 210 kDa, titration 77%, degree of deacetylation
92%). Other materials were acquired as follows: sodium
tripolyphosphate (TPP, Na
5
P
3
O
10
; Daejung, Korea); acetic
acid (Merck, Germany); MicroBCA assay kit (Bio Basic,
Canada); DMEM, bovine calf serum, L-glutamine,
Dulbecco’s phosphate-buffered saline (PBS), penicillin/
streptomycin and MTT 3-(4,5-dimethylthiazol-2-yl)-
2,5-diphenyltetrazolium bromide (Sigma Aldrich, USA).
Immunocompetent BALB/c male mice weighing 16–20
g and aged 4–6 weeks were obtained from the National
Institute of Health, Islamabad, Pakistan.
Conrmation of Multidrug-Resistant
A. baumannii from Clinical Specimens
Acinetobacter baumannii was isolated from clinical speci-
mens (including blood, pus, intravenous catheter tip and
bronchoalveolar lavage) at the Armed Forces Institute of
Rawalpindi, Pakistan, and conrmed biochemically.
Antimicrobial susceptibility was checked using the Kirby–
Bauer disk diffusion method/broth microdilution for cefotax-
ime (30 μg), ceftriaxone (30 μg), ceftazidime (30 μg), mer-
openem (10 μg), imipenem (10 μg), amikacin (30 μg),
gentamicin (10 μg), tobramycin (10 μg), ciprooxacin (5
μg), doxycycline (30 μg), minocycline (30 μg), tetracycline
(30 μg), trimethoprim–sulphamethoxazole (1.25/23.75 μg)
and polymyxin B (MIC ≤2 μg/mL sensitive; ≥4 μg/mL
resistant). Results were interpreted as “sensitive” or “resis-
tant” according to Clinical and Laboratory Standard Institute
(M100) guidelines.
43
The isolates that were concurrently
resistant to more than one antimicrobial agent were further
conrmed by PCR for aminoglycosides, quinolones and
tetracyclines.
44
The PCR mix was prepared as a volume of
25 μL comprising 200 µM dNTPs, 1.5 mM MgCl
2
, 1.25
U Taq DNA polymerase, 0.5 µM of each primer (forward
and reverse of each gene), 5 µL PCR buffer (10×) and 2.5 µL
DNA template. The PCR conditions were 95°C for 4 min, 30
cycles of 95°C for 50 s, 58°C for 60 s, 72°C for 45 s and nal
extension at 72°C for 5 min. Gel electrophoresis of the PCR
amplied product was carried out in 1.5% agarose gel in 1×
TBE buffer for 30 min at 80 V, stained with ethidium bro-
mide. The gel was examined under ultraviolet illumination
(Fisher Scientic, USA). A 100-bp ladder was used as the
standard for determining the molecular mass of PCR pro-
ducts (Table 1).
In Silico Positioning and MDS of Mast-Cs
Complex
The structure of mastoparan with PDB ID 1D7N
(INLKALAALAKKIL) was retrieved from the RCSB data-
base. The three-dimensional (3D) structure of mastoparan
was prepared by correcting the bond orders, addition of
hydrogens and lling in missing side chains in Maestro soft-
ware, using the default parameters.
45
Mastoparan was energy
minimized to 0.3 Å RMSD. The two-dimensional (2D) struc-
ture of chitosan was sketched in MarvinSketch (https://che
maxon.com/) and converted to the 3D structure in Maestro
visualizer.
46
Ten monomers of chitosan were connected with
TPP, as an ionic cross-linker, to create a circular ring. The
structure was minimized using Macromodel with the Merck
Molecular Force Field (MMFF).
46
UCSF Chimera (1.13.1)
was used to align the chitosan ring with mastoparan.
47
MDS of the Mast-Cs complex was carried out for 100 ns
using the Desmond module in Schrodinger.
48
The complex
was solvated using water model TIP3P in a cubic box.
Counter ions were added to neutralize system charge.
Desmond’s default minimization protocol was used to mini-
mize the system. A temperature of 300K and 1 bar pressure
were selected for equilibration. Finally, the system was simu-
lated for 100 ns. A total of 1000 frames were collected.
Trajectories were further investigated using the Simulation
Quality Analysis tool available with Desmond.
48
Root mean
square deviation (RMSD), ligand torsion, hydrogen bonding
and radius of gyrations were calculated to predict the complex
structural changes and conformations in Mast-Cs. The com-
plex was analyzed for interactions using Molecular Operating
Environment (MOE) software.
49
Electrostatic interactions of
Mast-Cs were assessed using Pymol version 2.2.0.
50
Computational Analysis of Enzyme–
Peptide Behavior
Peptides are sensitive to degradation by proteases in serum.
Vlieghe et al listed human proteolytic enzymes that are
International Journal of Nanomedicine 2021:16 https://doi.org/10.2147/IJN.S296717
DovePress
3757
Dovepress Hassan et al
Powered by TCPDF (www.tcpdf.org)
International Journal of Nanomedicine downloaded from https://www.dovepress.com/ by 185.234.144.17 on 02-Jun-2021
For personal use only.
Powered by TCPDF (www.tcpdf.org)
frequently involved in peptide degradation.
19,51
The role of
protein binding pockets is crucial for interaction specicity.
To understand the interaction of Mast-Cs NC with human
proteases, surface area, volume and binding pocket analysis
was conducted.
52
The surface binding analysis tool in UCSF
Chimera (1.13.1) was used to analyze the total surface area,
depth and enclosed volume of Mast-Cs nanoconstruct. The
DoGsiteScorer (https://proteins.plus/) binding pocket analy-
sis tool was used for the proteases, including serine protease,
prolyl oligopeptidase, human neutrophil elastase, human
chymotrypsin C, lysosomal acid alpha glucosidase, cysteine
protease, human calpain-1, prolylcarboxypeptidase, thimet
oligopeptidase and dipeptidyl peptidase.
53
The algorithm
behind the tool is a grid-based method which uses the dif-
ference of Gaussian lter to detect binding pockets, and
calculates the size, shape and chemical features of pockets.
Based on volume, hydrophobicity and enclosure, it gener-
ates a druggability score. Various binding pockets were
detected for the analyzed proteins, centered on 3D heavy
atom coordinates of the enzyme/protein (Table 2).
Synthesis of Mast-Cs Nanoconstructs
Mast-Cs NC were prepared by an ionic gelation method.
54
In
brief, a stock solution of TPP was prepared in double-distilled
water (5 mg/mL). Mastoparan (400 μg) was added to chitosan
(1 mg/mL) in mild acetic acid (1% v/v, pH 5) under continuous
stirring (600 rpm) at room temperature (22–25°C).
Nanoformulations were sonicated with a probe sonicator of
6 mm diameter for 10 min, with sonication amplitude 60%,
and pulse rate set at 40 s on, 20 s off (Vibra-Cell; Sonics,
USA). They were then centrifuged for 10 min at 14,000 g and
4°C. The supernatant was assessed for the unconjugated
mastoparan.
Characterization of Mast-Cs NC
The hydrodynamic size and zeta potential of Mast-Cs NC
were measured by dynamic light scattering (DLS)
(Nanotrac Wave II; Microtrac, USA). The formulation
was diluted (1:1000) for testing. The dielectric constant
of acetic acid as the solvent and the refractive index of
chitosan at 25°C were adjusted. The morphology of Mast-
Cs NC was studied by scanning electron microscopy
(TESCAN Mira3; Alpha Contec, Germany).
Encapsulation Efciency and Loading
Capacity of Mast-Cs NC
The encapsulation efciency (EE) and loading capacity
(LC) were calculated using the bicinchoninic method
https://doi.org/10.2147/IJN.S296717
DovePress
International Journal of Nanomedicine 2021:16
3758
Hassan et al Dovepress
Table 1 Susceptibility and Genotypic Characterization of Acinetobacter baumannii Clinical Isolates Used in the Current Study
Isolate
ID
Patient’s
Age
(Years)
Gender Specimen
Type
Antibiotic Susceptibility Pattern (Kirby–Bauer Disk Diffusion Test; for Polymyxin B, MIC Breakpoints (<2=S, >4=R) PCR for Antibiotic Resistance Genes
Ceftazidime
30 µg
Cefotaxime
30 µg
Ceftriaxone
30 µg
Meropenem
10 µg
Imipenem
10 µg
Amikacin
30 µg
Gentamicin
10 µg
Tobramycin
10 µg
Doxycycline
30 µg
Minocycline
30 µg
Tetracycline
30 µg
Ciprooxacin
5 µg
Trimethoprim/
Sulphamethoxazole
1.25/23.75 µg
Polymyxin
B
Ciprooxacin
(gyrA)
Aminoglycosides
(STrB)
Tetracycline
(TetB)
B1 53 M Pus 13 11 10 11 15 12 18 9 6 19 17 10 7 S + + +
B2 51 M Blood 12 9 11 9 12 10 17 9 16 18 16 11 7 S + + +
B3 25 M NBL 10 9 10 8 12 9 17 11 7 10 17 10 8 S + + +
B4 2 F Blood 11 10 9 9 11 11 9 7 8 19 18 9 5 S + + +
B5 14 M Pus 12 10 9 20 23 10 8 8 8 19 19 12 6 S + + +
B6 16 M Sputum 11 10 8 11 13 11 9 10 17 20 18 11 6 S + + +
B7 7 M Blood 11 8 11 10 15 21 19 10 6 7 17 10 7 S + + +
B8 23 M CVP tip 12 10 10 21 22 9 10 11 4 6 18 9 4 S + + +
B9 50 M Sputum 12 11 9 9 13 11 9 7 5 17 18 11 5 S + + +
B10 16 M Pus 10 10 8 9 10 8 10 8 6 6 16 4 7 S + + +
B11 58 M Sputum 11 11 9 20 22 11 11 8 6 18 17 12 8 S + + +
B12 55 F NBL 12 10 9 21 23 20 9 9 5 6 16 13 9 S + + +
B13 26 M Pus 10 11 10 9 10 10 8 9 6 7 19 12 5 S + + +
B14 45 M NBL 9 11 9 8 11 7 8 10 4 5 18 12 6 S + + +
B15 35 M NBL 10 9 10 9 10 21 19 11 4 7 17 11 6 S + +
Notes: Acinetobacter baumannii was isolated from clinical samples (blood, pus, intravenous catheter tip and bronchoalveolar lavage specimens). Antibiotic susceptibility
testing was performed by the standard Kirby–Bauer disk diffusion and Etest method (for polymyxin B only). Polymerase chain reaction was conducted to conrm the
presence of antibiotic resistance genes (gyrA, STrB, Tetb) in the isolates using primers: gyrA-F, ACAAGAAATCTGCTCGT, gyrA-R, CGAAGTTACCCTGACCATC;
strB-F, ATGGGGTTGATGTTCATGCCGC, strB-R, CTAGTATGACGTCTGTCGCAC; tetB F, CAGTGCTGTTGTTGTCATTAA, tetB R, GCTTGGAATACTGAGTGTAA.
Zone sizes as per CLSI 2019 guidelines: ceftazidime ≤14=R, ≥18=S, cefotaxime ≤14=R, ≥23=S, ceftriaxone ≤13=R, ≥21=S, meropenem ≤14=R, ≥18=S, imipenem
≤18=R, ≥22=S, amikacin ≤14=R, ≥17=S, gentamicin ≤12=R, ≥15=S, tobramycin ≤12=R, ≥15=S, doxycycline ≤9=R, ≥13=S, minocycline≤12=R, ≥16=S, tetracycline ≤11=R,
≥15=S, ciprooxacin ≤15=R, ≥21=S, trimethoprim sulphamethoxazole ≤10=R, ≥16=S. Zone of inhibition is measured in mm.
Powered by TCPDF (www.tcpdf.org)
International Journal of Nanomedicine downloaded from https://www.dovepress.com/ by 185.234.144.17 on 02-Jun-2021
For personal use only.
Powered by TCPDF (www.tcpdf.org)
Table 1 Susceptibility and Genotypic Characterization of Acinetobacter baumannii Clinical Isolates Used in the Current Study
Isolate
ID
Patient’s
Age
(Years)
Gender Specimen
Type
Antibiotic Susceptibility Pattern (Kirby–Bauer Disk Diffusion Test; for Polymyxin B, MIC Breakpoints (<2=S, >4=R) PCR for Antibiotic Resistance Genes
Ceftazidime
30 µg
Cefotaxime
30 µg
Ceftriaxone
30 µg
Meropenem
10 µg
Imipenem
10 µg
Amikacin
30 µg
Gentamicin
10 µg
Tobramycin
10 µg
Doxycycline
30 µg
Minocycline
30 µg
Tetracycline
30 µg
Ciprooxacin
5 µg
Trimethoprim/
Sulphamethoxazole
1.25/23.75 µg
Polymyxin
B
Ciprooxacin
(gyrA)
Aminoglycosides
(STrB)
Tetracycline
(TetB)
B1 53 M Pus 13 11 10 11 15 12 18 9 6 19 17 10 7 S + + +
B2 51 M Blood 12 9 11 9 12 10 17 9 16 18 16 11 7 S + + +
B3 25 M NBL 10 9 10 8 12 9 17 11 7 10 17 10 8 S + + +
B4 2 F Blood 11 10 9 9 11 11 9 7 8 19 18 9 5 S + + +
B5 14 M Pus 12 10 9 20 23 10 8 8 8 19 19 12 6 S + + +
B6 16 M Sputum 11 10 8 11 13 11 9 10 17 20 18 11 6 S + + +
B7 7 M Blood 11 8 11 10 15 21 19 10 6 7 17 10 7 S + + +
B8 23 M CVP tip 12 10 10 21 22 9 10 11 4 6 18 9 4 S + + +
B9 50 M Sputum 12 11 9 9 13 11 9 7 5 17 18 11 5 S + + +
B10 16 M Pus 10 10 8 9 10 8 10 8 6 6 16 4 7 S + + +
B11 58 M Sputum 11 11 9 20 22 11 11 8 6 18 17 12 8 S + + +
B12 55 F NBL 12 10 9 21 23 20 9 9 5 6 16 13 9 S + + +
B13 26 M Pus 10 11 10 9 10 10 8 9 6 7 19 12 5 S + + +
B14 45 M NBL 9 11 9 8 11 7 8 10 4 5 18 12 6 S + + +
B15 35 M NBL 10 9 10 9 10 21 19 11 4 7 17 11 6 S + +
Notes: Acinetobacter baumannii was isolated from clinical samples (blood, pus, intravenous catheter tip and bronchoalveolar lavage specimens). Antibiotic susceptibility
testing was performed by the standard Kirby–Bauer disk diffusion and Etest method (for polymyxin B only). Polymerase chain reaction was conducted to conrm the
presence of antibiotic resistance genes (gyrA, STrB, Tetb) in the isolates using primers: gyrA-F, ACAAGAAATCTGCTCGT, gyrA-R, CGAAGTTACCCTGACCATC;
strB-F, ATGGGGTTGATGTTCATGCCGC, strB-R, CTAGTATGACGTCTGTCGCAC; tetB F, CAGTGCTGTTGTTGTCATTAA, tetB R, GCTTGGAATACTGAGTGTAA.
Zone sizes as per CLSI 2019 guidelines: ceftazidime ≤14=R, ≥18=S, cefotaxime ≤14=R, ≥23=S, ceftriaxone ≤13=R, ≥21=S, meropenem ≤14=R, ≥18=S, imipenem
≤18=R, ≥22=S, amikacin ≤14=R, ≥17=S, gentamicin ≤12=R, ≥15=S, tobramycin ≤12=R, ≥15=S, doxycycline ≤9=R, ≥13=S, minocycline≤12=R, ≥16=S, tetracycline ≤11=R,
≥15=S, ciprooxacin ≤15=R, ≥21=S, trimethoprim sulphamethoxazole ≤10=R, ≥16=S. Zone of inhibition is measured in mm.
Table 2 Estimation of Mast-Cs–Proteases Interface
Name PDB ID Volume (Å
3
) Surface (Å
2
) Depth (Å) Simple Score
Mast-Cs 3262 1890 4.58 0
Endopeptidases
Serine protease
Serine protease 1HXE 928.77 1293.6 27.9 0.59
Lysosomal acid alpha glucosidase 5NN3 707.09 834.7 23.56 0.43
Human chymotrypsin C 4H4F 849.54 1130.66 16.59 0.49
Prolyl oligopeptidase 3DDU 800.83 940.88 17.92 0.51
Human neutrophil elastase 3Q76 565.12 777.97 20.54` 0.33
Cysteine protease
Human calpain-1 2ARY 1029.94 1460.61 23.21 0.61
Cysteine protease 1CJL 524.54 714.97 17.9 0.29
Aspartic acid protease
Pepsin 1PSO 539.71 493.18 21.26 0.28
Metalloproteases
Thimet oligopeptidase 1S4B 1030.86 1245.94 24.73 0.61
Exopeptidase
Human prolylcarboxypeptidase 3N2Z 512.5 649.07 18.66 0.35
Human dipeptidyl peptidase 1R9M 1330.9 1273.2 29.86 0.59
Notes: Binding pockets and their characteristic descriptors of human proteases and Mast-Cs were calculated using DoGSiteScorer and UCSF Chimera, respectively; the
table shows the volume (Å
3
, cubic angstrom), surface area (Å
2
, square angstrom), depth (Å, angstrom) and score of the largest binding pocket of each of analyzed protease;
the greater the score and depth cavity, the greater the chance of potential binding of the protease with the substrate (Mast-Cs).
International Journal of Nanomedicine 2021:16 https://doi.org/10.2147/IJN.S296717
DovePress
3759
Dovepress Hassan et al
Powered by TCPDF (www.tcpdf.org)
International Journal of Nanomedicine downloaded from https://www.dovepress.com/ by 185.234.144.17 on 02-Jun-2021
For personal use only.
Powered by TCPDF (www.tcpdf.org)
(MicroBCA protein assay kit; Bio Basic, Canada)
with standard controls. Optical density was measured
at 562 nm (UV-1900, UV-visible spectrophotometer;
Shimadzu, Japan). EE and LC were calculated using
the formula:
Encapsulation
efficiency ð%Þ¼
Total peptide added Free non
entrapped petide=Total peptide
added 100
Loading
capacity ð%Þ¼
Amount of total entrapped
petide=Total nanoparticle
weight 100
Fourier Transform Infrared Spectroscopy
(FTIR) of Mast-Cs NC
Functional groups involved in Mast-Cs interactions were
assessed by FTIR spectroscopy. The results were recorded
in the mid-IR range 4000−400 cm
−1
using an FTIR spec-
trophotometer, with OMNIC™ version 6.0a software
(Thermo Fisher Scientic, USA). FTIR spectra of opti-
mized Mast-Cs NC, mastoparan alone and chitosan alone
were compared to analyze interactions.
In Vitro A. baumannii Bactericidal Assay of
Mast-Cs NC
Mast-Cs NC, mastoparan alone and chitosan (control)
were tested against MDR A. baumannii using the broth
microdilution method described by Weigand et al.
55
Chitosan was used as the control for the test. For chitosan,
concentrations ranging from 512 to 2 μg/mL were used.
One row was used for each isolate, with up to 10 different
dilutions of mastoparan and Mast-Cs solution (32, 16, 8, 4,
2, 1, 0.5, 0.25, 0.125 and 0.0625 μg/mL). Thus, 50 μL of
each of the tested solutions (Mast-Cs, chitosan and mas-
toparan solution) was added to each well. Bacterial dilu-
tions were prepared to obtain nal concentrations of 5×10
5
CFU/mL. For the purity plate, 10 μL from the growth
control well was taken and added to 990 μL of sterile
saline. It was further diluted (1:10) in sterile saline and
100 μL of the dilution was plated in nutrient agar plates.
Microtiter plates were read after incubation at 37°C for
16–20 h using an ELISA plate reader (EZ Read 400
Microplate Reader; Biochrom, UK).
Data analysis was carried out using GraphPad Prism
version 8.4.2. The t-test with 95% condence
intervals was used for statistical analysis of MIC values
obtained for Mast-Cs NC, chitosan and mastoparan.
A p-value <0.05 was taken as statistically signicant.
Morphological Analysis of A. baumannii
Treated with Mast-Cs NC
The copper grid was sputtered with gold using a Smart
Coater (JEOL, USA) containing 0.1 mm gold target. Gold-
coated grids were xed with bacterial suspension (control,
Mast-Cs NC treated and chitosan treated) for 30 s. The
cells were stained with a drop of 1% phosphotungstic acid,
pH 7.2, for 30 s. The excess stain was removed with lter
paper. The grid was air dried before viewing. Images were
recorded at magnications ranging from 3000 to 18,000×
under a scanning electron microscope (JSM IT200; JEOL,
USA). An A. baumannii suspension without any treatment
was taken as the control group.
Biocompatibility Assay of Mast-Cs NC
For this assay, 500 μL of washed red blood cells (RBCs)
was suspended in PBS (10% in volume), mixed with Mast-
Cs and mastoparan solution in varying concentrations
(0.0625, 0.125, 0.25, 0.5, 1, 2, 4, 8 and 16 μg/mL), and
incubated for 1 h at 37°C. The supernatant was measured
for hemoglobin content along with the negative control
(RBCs in PBS) and positive control (RBCs exposed to 1%
Triton X-100). Percent hemolysis was calculated as
follows:
Hemolysis ð%Þ ¼
OD of Mast Cs NC OD of negative
control=OD of positive control
OD of negative control
Results were expressed as the mean ± SD of triplicate
experiments. The t-test (GraphPad Prism version 8.02)
was used to compare the groups; a p-value <0.05 was
taken as signicant.
Cytocompatibility Assay of Mast-Cs NC
For the in vitro cytocompatibility assay, 3×10
3
RD
cells were seeded in 96-well plates. After 24 h at 37°C
in 5% CO
2
and 85% humidity, the culture medium was
removed and wells were exposed with Mast-Cs NC and
mastoparan (concentrations ranging from 0.28 to 36 μg/
mL) for a further 24, 48 and 72 h at 37°C in 5% CO
2
.
Cells in DMEM alone were used as the blank. At the
prescribed times, the formulations were removed and
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide (MTT) (diluted 1:10) was added and incubated
for 4 h at 37°C. The salt was reduced to formazan only
by metabolically active cells. The solution was removed,
and the formazan crystals were dissolved in DMSO.
Measurement of formazan dye absorbance was carried
https://doi.org/10.2147/IJN.S296717
DovePress
International Journal of Nanomedicine 2021:16
3760
Hassan et al Dovepress
Powered by TCPDF (www.tcpdf.org)
International Journal of Nanomedicine downloaded from https://www.dovepress.com/ by 185.234.144.17 on 02-Jun-2021
For personal use only.
Powered by TCPDF (www.tcpdf.org)
out and cytocompatibility was expressed in terms
of percent viability, Mast-Cs and mastoparan-treated
cells were observed under a cell imager (EVOS FL;
Life Technologies, UK) establish their morphology.
Statistical analysis was performed using GraphPad
Prism version 8.02. The t-test was used to compare the
groups; a p-value <0.05 was taken as signicant.
Bactericidal Activity of Mast-Cs NC in
A. baumannii Sepsis Mouse Model
The sepsis model was optimized in BALB/c immunocom-
petent mice using MDR A. baumannii strain B10 (Table
1). Four groups (n=5 per group) of mice were categorized
according to time of exposure of bacteria (a: 30 min; b:
1 h; c: 2 h; d: 4 h). The groups were challenged with
a bacterial concentration of 1×10
7
CFU/mL. At specied
time intervals, mice were anesthetized for exsanguination
and cardiac blood was collected. Then, 100 μL of collected
blood thoroughly mixed in normal saline was used to
make 10-fold serial dilutions. Each dilution (500 μL) was
streaked on MacConkey’s agar plates, than incubated for
24–48 h at 37°C, followed by colony counts and culturing.
The group that was exposed for 1 h showed the highest
bacterial count in blood. Therefore, the time interval of 1
h was selected for subsequent experiments. The Mast-Cs
NC, chitosan (control) and mastoparan (control) were
injected into mice in groups A, B and C, respectively,
with ve mice per group, at 1 h postinfection; group
D was kept as a control without any treatment. At 30
min postinjection, mice were anesthetized for exsanguina-
tion and blood was drawn by cardiac puncture. The same
procedure was followed for serial dilutions, culturing and
colony counts as mentioned in the previous paragraph.
Statistical Analysis
Statistical analysis was carried out using GraphPad
Prism version 8.02. Data are presented as mean with
standard deviation where applicable. Student t-test was
applied to assess statistical differences between the
groups.
Results
In Silico Analysis of Mast-Cs Complex
We adapted innovative in silico approaches to under-
stand the molecular interactions between mastoparan
and chitosan before performing wet laboratory experi-
ments. 3D structures of mastoparan and chitosan were
positioned and Mast-Cs interactions were analyzed using
MOE software.
49
Interactions were observed between
chitosan oxygen atom-46 and mastoparan isoleucine
carbon atom with a distance of 2.77 Å, and between
oxygen atom-23 and mastoparan lysine nitrogen atom
with a distance of 2.80 Å. The binding energies of the
two hydrogen bonds were found to be −3.6 and −7.4
kcal/mol, respectively. These factors resulted in the sta-
bility of the complex. Figure 1B shows the basic amino
acids as pink circles with a blue outline, greasy as green
circles with a gray outline, receptor exposure as clear
white circles with a light blue glow and ligand exposure
as dark blue circles with a dark blue glow. Electrostatic
interactions were assessed on the Mast-Cs complex by
Pymol version 2.2.0. Mastoparan is an amphiphilic pep-
tide with both hydrophilic and hydrophobic ends, and
the chitosan ring with anionic TPP encloses the peptide
in its center. During in vitro experiments, the pH was
kept at 5 (after repetitive optimizations), which enabled
the repulsion of the two structures to be overcome. This
led to the enhancement of the loading content of mas-
toparan in the nanoconstruct (Figure 1AC).
Mastoparan’s interactions with chitosan were evalu-
ated during 100 ns molecular dynamics simulations in
Desmond. RMSD values of the mastoparan and chitosan
(ligand) were calculated relative to the structure present
in the minimized equilibrated system. The ligand RMSD
indicated the stability of chitosan with respect to mas-
toparan, while mastoparan RMSD demonstrated the sta-
bility of mastoparan throughout the simulation. The
maximum RMSD found to be 2.5 Å at 5 ns, and the
plot reached a plateau at 5 ns which remained nearly
constant until 100 ns. This showed the stability of the
complex during the simulations. The initial change in
the RMSD that was observed between 1 and 4 ns may
be due to adjustments of steric hindrances and atomic
interactions. After 5 ns, the complex remained stable
without any major conformational changes. The root
mean square uctuation (RMSF) showed the average
mobility of mastoparan residues in the complex from
its mean position. The interacting residues of masto-
paran showed minor uctuations. This caused adjust-
ments of the molecules with each other and and an
increase in stability (Figure 2A and B).
The mastoparan–chitosan (ligand) contact was
assessed and plotted against time. This demonstrated the
contribution of each amino acid to the interactions with
chitosan. Lysine and isoleucine showed stable hydrogen
International Journal of Nanomedicine 2021:16 https://doi.org/10.2147/IJN.S296717
DovePress
3761
Dovepress Hassan et al
Powered by TCPDF (www.tcpdf.org)
International Journal of Nanomedicine downloaded from https://www.dovepress.com/ by 185.234.144.17 on 02-Jun-2021
For personal use only.
Powered by TCPDF (www.tcpdf.org)
bonding throughout the 100 ns simulation. The chitosan/
ligand torsion plot demonstrated the conformational evo-
lution of the ligand over the course of the trajectory.
Mastoparan’s secondary structure (alpha helix) was mon-
itored during the entire simulation. The secondary struc-
ture element (SSE) distribution was observed as the
residue index. The secondary structure remained globally
conserved during the entire simulation. The chitosan/
ligand RMSD, intramolecular hydrogen bond within the
ligand molecule, molecular surface area, solvent-
accessible surface area and polar surface area were calcu-
lated during the 100 ns simulation study. The radius of
gyration maintained a relatively steady value, which con-
rmed that the chitosan/ligand remained compact during
the simulation (Figure 2CH).
Computational Analysis of Enzyme–
Peptide Behavior
Binding pocket analysis is an advanced and innovative
approach which was used in this work to explore the
effect of proteases on Mast-Cs nanocomplexes. The
overall volume of the Mast-Cs structure was estimated
as 3262 Å
3
and the surface area as 1890 Å
2
. The
volume of Mast-Cs NC was much greater than the
volume of the largest binding pocket size of each of
the analyzed proteases/peptidases. The interaction of
the enzyme with the substrate depends on binding
pocket conformation.
56
The ligand binds with pockets
when they are geometrically compatible with
binding site assembly.
57
A binding site score of zero
for the Mast-Cs complex indicated that mastoparan
binding sites were well encapsulated in the chitosan
ring and there was no opportunity to interact with
proteases and peptidases. This made the Mast-Cs nano-
complex suitable for in vivo therapeutic evaluation
(Table 2).
Characterization of Mast-Cs NC
The prepared suspension of nanoparticles appeared
homogeneous and opalescent. The hydrodynamic size
of Mast-Cs NC was measured as approximately 156
nm and the zeta potential as +54.9 mV by DLS.
Scanning electron microscopy estimated the size of
particles as 93±8 nm (Figure 3). The formulation was
kept at 2–8°C and continuously monitored for 4 days.
The size remained constant at approximately 150 nm,
with a zeta potential of about 54 mV. The FTIR spec-
trum of raw chitosan indicated a characteristic broad
absorption peak at 3448 cm
−1
, which corresponded to
the amino and hydroxyl group stretching vibrations
Figure 1 Computational analysis of the Mast-Cs complex. (A) Side view of the complex showing mastoparan surface (cyan) encapsulated by 10 chitosan monomers
(attached by TPP) (green). Oxygen atoms are highlighted in red, nitrogen in blue and hydrogen in white. (B) Mastoparan–chitosan interactions obtained by Molecular
Operating Environment software. Interactions were observed between chitosan oxygen atom-46 and mastoparan LEU9 carbon atom with a distance of 2.77 Å (blue dotted
line) and between oxygen atom-23 and mastoparan LYS11 nitrogen atom with a distance of 2.80 Å (green dotted line). The binding energies of the two hydrogen bonds were
3.6 and 7.4 kcal/mol, respectively. Basic amino acids are presented as pink circles with a blue outline, greasy as green circles with a gray outline, receptor exposure as clear
white circles with a light blue glow, and ligand exposure as dark blue circles with a dark blue glow. (C) Electrostatic interactions between mastoparan and chitosan were
calculated by Pymol 2.2.0, demonstrated by positive (blue) and negative (red) charges on mastoparan, and chitosan, being positively charged, tends to attach to the negative
end of mastoparan.
Abbreviations: TPP, sodium tripolyphosphate; LEU, isoleucine; LYS, lysine.
https://doi.org/10.2147/IJN.S296717
DovePress
International Journal of Nanomedicine 2021:16
3762
Hassan et al Dovepress
Powered by TCPDF (www.tcpdf.org)
International Journal of Nanomedicine downloaded from https://www.dovepress.com/ by 185.234.144.17 on 02-Jun-2021
For personal use only.
Powered by TCPDF (www.tcpdf.org)
(N–H and O–H bonds, stretch). The peak at 2870 cm
−1
was responsible for –CH
2
stretching (C–H bond,
stretch). The characteristic bend at 1388 cm
−1
repre-
sented the C–H bend. Mastoparan alone showed angu-
lar deformations at N–H bonds of the amino groups at
1540 cm
−1
. The spectrum of the conjugated formula-
tion of mastoparan and chitosan indicated conforma-
tional change in peaks and bands: the N–H and O–
H peak had broadened at 3200 cm
−1
, the N–H bands/
peaks had widened at 1540–1590 cm
−1
, and the
1130 cm
−1
peak had disappeared, owing to the interac-
tion between mastoparan and the polymeric structure of
chitosan (Figure 4). The EE was found to be 90.54%,
indicating the high percentage of mastoparan enclosed
in the nanoconstruct, while the LC was estimated as
22.63%.
Figure 2 In silico analysis of chitosan and mastoparan. (A) RMSD plot for Mast-Cs complex during 100 ns of molecular dynamic simulation. Mastoparan is shown in blue and
chitosan in red. The RMSD values of mastoparan (left y-axis) and chitosan (right y-axis), calculated in angstroms (Å), were plotted against simulation time (x-axis 0–100 ns). (B) RMSF
of mastoparan (Å) illustrated no/less uctuation in the structure, and more rigidity in α-helices of mastoparan. (C) Mastoparan–chitosan interactions. Mastoparan–chitosan/ligand
interactions are presented with interaction fractions on the y-axis and amino acids on the x-axis (green represents hydrogen bonding, pink represents ionic interactions, blue
represents water bridges, purple representes hydrophobic interactions). (D) Timeline illustration of the Mast-Cs interactions presented with amino acids on the y-axis and time
from 0 to 100 ns on the x–axis. The orange band on the right-hand side of the graph represents the number of contacts, ranging from zero (white) to more than four (dark orange).
The graph shows alanine 7, alanine 10, isoleucine 13 and lysine 4 contributing to stable backbone hydrogen bonding throughout the 100 ns simulation. (E) Ligand torsion analysis
over the course of the trajectory (0–100 ns). Each rotatable bond in the chitosan (ligand) is color coded. The dial plot (0–180°) represents the conformational changes in the bond
over time. (F) Chitosan (ligand) properties over 100 ns simulation. Ligand RMSD (cÅ), radius of gyration (Å), intramolecular hydrogen bond, MolSA (Å), SASA (cÅ) and PSA Å)
values during the simulation (y-axis) are presented with reference to time (100 ns on the x-axis). (G and H) Graphical illustrations of SSE analysis, with SSE (α-helix) represented in
orange. SSE vs residue index (amino acids) shows an α-helix distribution by residue index; time (100 ns) vs residue index shows the SSE composition for each frame over the 100 ns
simulation, and the plot shows the contribution of each residue over time. The structure of Mast-Cs remained globally conserved throughout the 100 ns simulation.
Abbreviations: RMSD, root mean square deviation; RMSF, root mean square uctuation; MolSa, molecular surface area; SASA, solvent-accessible surface area; PSA, polar
surface area; SSE, secondary structure element.
International Journal of Nanomedicine 2021:16 https://doi.org/10.2147/IJN.S296717
DovePress
3763
Dovepress Hassan et al
Powered by TCPDF (www.tcpdf.org)
International Journal of Nanomedicine downloaded from https://www.dovepress.com/ by 185.234.144.17 on 02-Jun-2021
For personal use only.
Powered by TCPDF (www.tcpdf.org)
Susceptibility and Molecular
Characterization of A. baumannii Clinical
Isolates
Fifteen different clinical isolates of A. baumannii were
tested in the present work. According to the age-wise
distribution, three were isolated from patients in the age
group 0–15 years, ve in the age group 16–30 years, two
in the age group 31–45 years and ve in the age group
46–60 years. The male to female ratio was 13:2. Four
isolates were from nasobronchial lavage, three from
sputum, three from blood and two from pus, and one
came from an intravenous catheter specimen. Fourteen
different antibiotics were tested against these clinical iso-
lates. All 15 A. baumannii strains were MDR and simulta-
neously resistant to more than one antimicrobial agent, ie,
ceftazidime, ceftriaxone, cefotaxime, ciprooxacin, tobra-
mycin, tetracycline and trimethoprim–sulphamethoxazole.
With regard to other antibiotics, A. baumannii was resis-
tant to meropenem (73%), imipenem (73%), amikacin
(80%), gentamicin (67%), doxycycline (87%) and
Figure 3 (AC) Scanning electron microscopy (SEM) micrographs and dynamic light scattering analysis (DLS) of Mast-Cs NC. (A) SEM micrograph at magnication 70.0 k×,
voltage 10.0 kV, working distance 11.91 mm, with 500 nm scale bar. (B) SEM micrograph at magnication 70.0 k×, voltage 10.0 kV, working distance 12.65 mm, with 500 nm
scale bar. The size of synthesized nanoparticles on micrographs ranged from approximately 85 to 101 nm. (C) DLS particle size distribution graph represented with percent
passing on the y-axis and size (nm) on the x-axis. The hydrodynamic size of Mast-Cs NC was measured as approximately 156 nm.
Abbreviations: kV, kilovolts; Mast, mastoparan; Cs, chitosan; NC, nanoconstruct; A baumannii, Acinetobacter baumannii.
Figure 4 Fourier transform infrared spectra of Mast-CS NC, chitosan and mastoparan. The y-axis shows the percent transmittance and the x-axis the wave number (cm
1
).
The spectrum of raw chitosan (black line) indicates the characteristic broad absorption peak at 3448 cm
1
, which corresponds to the amino and hydroxyl group stretching
vibrations (N–H and O–H bonds, stretch). The peak at 2870 cm
1
is responsible for –CH
2
stretching (C–H bond, stretch). The characteristic bend at 1388 cm
1
shows the
C–H bend. Mastoparan (red line) shows angular deformations at the N–H bonds of the amino groups at 1540 cm
1
. The spectrum of Mast-Cs NC (blue line)
indicates conformational change in peaks/bands; the N–H and O–H peak has broadened at 3200 cm
1
, and N–H bands/peaks have widened at 1540–1590 cm
1
; the
1130 cm
1
peaks have disappeared, owing to the interaction between mastoparan and the polymeric structure of chitosan.
Abbreviations: N–H, nitrogen–hydrogen; O–H, oxygen–hydrogen; C–H, carbon–hydrogen; Mast, mastoparan; Cs, chitosan; NC, nanoconstruct; A. baumannii, Acinetobacter
baumannii.
https://doi.org/10.2147/IJN.S296717
DovePress
International Journal of Nanomedicine 2021:16
3764
Hassan et al Dovepress
Powered by TCPDF (www.tcpdf.org)
International Journal of Nanomedicine downloaded from https://www.dovepress.com/ by 185.234.144.17 on 02-Jun-2021
For personal use only.
Powered by TCPDF (www.tcpdf.org)
minocycline (54%). All isolates were sensitive to poly-
myxin B. Antibiotic resistance genes for aminoglycosides
(94%), quinolones (100%) and tetracyclines (100%) were
observed in the strains. B10 isolate, which was used in the
in vivo A. baumannii studies, was resistant to all 13 anti-
biotics, with the exception of polymyxin B (Table 1).
Mast-Cs NC Inhibits Bacterial Growth (In
Vitro)
The antibacterial activities of Mast-Cs NC, chitosan
(control) and mastoparan alone were tested against all
clinical MDR A. baumannii isolates by both the spec-
trophotometric method and visual inspection.
58
The
MIC was taken as the lowest concentration that inhibits
the growth of bacteria. Using the spectrophotometric
method, the MIC was taken as the concentration of
formulation where there is an abrupt decline in the
absorbance value compared to drug-free growth con-
trol. The MIC
50
and MIC
90
were calculated using the
formula (n + 1) × 0.5 and n × 0.9 (as n is an odd number
of tested organisms in this study), respectively.
Chitosan was used as the control and concentrations
from 512 to 2 μg/mL were tested. The MIC
50
for
chitosan was calculated as 256 μg/mL and the MIC
90
as 512 μg/mL; the MIC
50
and MIC
90
for Mast-Cs NC
were calculated as 2 and 4 μg/mL, respectively; while
for mastoparan alone, the MIC
50
and MIC
90
were cal-
culated as 8 and 16 μg/mL, respectively (Figure 5A
C). The chitosan inhibited bacterial growth at high
concentrations. It was observed that the addition of
mastoparan with chitosan increased the antibacterial
activity at low concentrations. A statistically signicant
difference (p<0.05) was found between the MIC values
for Mast-Cs NC: chitosan alone and Mast-Cs NC:
mastoparan alone.
The effect of Mast-Cs NC against bacteria was ana-
lyzed by uorescence microscopy (Evos FL, Cell Imaging
System; Thermo Fisher Scientic). The bacterial cells
were treated with Nile red stain and imaged with
a uorescent microscope under a GFP cube. The untreated
live bacteria appeared as uorescent and maintained clear
round structures, while the bacteria after treatment with
Mast-Cs NC ceased to uoresce and appeared deformed
(Figure 6).
Morphology of A. baumannii Cells Treated
with Mast-Cs NC Under SEM
In SEM micrographs, bacterial cells appeared dark when
imaged on gold-coated grids with negative staining. The
Figure 5 In vitro bactericidal assays of Mast-Cs NC against MDR A. baumannii. The MIC was measured for Mast-Cs NC, mastoparan and chitosan using a broth
microdilution assay against 15 different MDR A. baumannii strains. (A) Graph showing absorbance (OD) on the y-axis and Mast-Cs NC concentration (μg/mL) on the x-axis.
The MIC
90
for Mast-Cs NC was calculated as 4 μg/mL. The patterns in MIC by visual turbidity in 96-well microtiter plates after treatment with Mast-Cs NC are presented
below the graph. (B) Graph showing absorbance (OD) on the y-axis and chitosan concentration (μg/mL) on the x-axis. The MIC
90
for chitosan alone (used as control) was
calculated as 512 μg/mL. Patterns in MIC by visual turbidity in 96-well microtiter plates after treatment of A. baumannii with chitosan alone are presented below the graph.
(C) Graph showing absorbance (OD) on the y-axis and mastoparan concentration (μg/mL) on the x-axis. The MIC
90
for mastoparan was calculated as 16 μg/mL. The
patterns in MIC by visual turbidity in 96-well microtiter plates after treatment with mastoparan alone are presented below the graph.
Abbreviations: MIC, minimum inhibitory concentration; Mast, mastoparan; Cs, chitosan; NC, nanoconstruct; A. baumannii, Acinetobacter baumannii; MDR, multidrug-
resistant; OD, optical density.
International Journal of Nanomedicine 2021:16 https://doi.org/10.2147/IJN.S296717
DovePress
3765
Dovepress Hassan et al
Powered by TCPDF (www.tcpdf.org)
International Journal of Nanomedicine downloaded from https://www.dovepress.com/ by 185.234.144.17 on 02-Jun-2021
For personal use only.
Powered by TCPDF (www.tcpdf.org)
untreated A. baumannii (control) cells had a smooth sur-
face with an intact membrane. After treatment with Mast-
Cs NC, the A. baumannii cells lost their integrity and
extracellular thread-like structures appeared around the
cells. Chitosan-treated cells had intact surface integrity,
with relatively round cells (Figure 7AC). The synergistic
action of nano-based formulations is supported by other
studies. Mei et al reported increased membrane damage
due to the activity of multicomponent nanostructures
against Gram-positive and Gram-negative bacteria.
59,60
Biocompatibility of Mast-Cs NC
Evaluation of the biocompatibility of synthesized Mast-Cs NC
is essential for biomedical applications. The effect of different
concentrations of Mast-Cs NC on total blood hemoglobin
demonstrated that it remained biocompatible. No hemolysis
was observed, even at higher concentrations, compared to the
positive control. The intrinsic biocompatible nature of the
polymer helped to maintain the integrity of RBC membranes.
Mastoparan when tested alone showed dose-dependent hemo-
lytic activity. There was increasing hemolysis as the concen-
tration of mastoparan increased. The amino acid residues in
mastoparan interacted with the zwitterionic membrane of the
RBCs, leading to cytolysis. With a 95% condence interval,
16 degrees of freedom and t
crit
at 2.649, a two-tailed p-value of
<0.0001 was obtained between the Mast-Cs and chitosan
groups, which showed a statistically signicant reduction in
the two groups (Figure 8A and B).
Cytocompatibility of Mast-Cs NC
Human RD cells were exposed to different concentrations
of Mast-Cs NC and mastoparan. At 24, 48 and 72 h of
Figure 6 Antibacterial effect of Mast-Cs NC against A. baumannii by uorescence microscopy (Evos FL, Cell Imaging System; Thermo Fisher Scientic). (A and B) The A. baumannii
cells were stained with Nile red and imaged with a uorescent microscope under a GFP lter. Untreated live bacterial cells (10×X) (A) appeared as uorescent and maintained clear
round structures, while bacteria after treatment with Mast-Cs NC (6b) ceased to uoresce and appeared deformed. (C and D) Unstained bacterial cells imaged with a uorescent
microscope. Untreated live bacterial cells (100×) (C) appeared as uniform round structures while bacteria after treatment with Mast-Cs NC (D) appeared distorted.
Abbreviations: Mast, mastoparan; Cs, chitosan; NC, nanoconstruct; A. baumannii, Acinetobacter baumannii; GFP, green uorescence protein.
https://doi.org/10.2147/IJN.S296717
DovePress
International Journal of Nanomedicine 2021:16
3766
Hassan et al Dovepress
Powered by TCPDF (www.tcpdf.org)
International Journal of Nanomedicine downloaded from https://www.dovepress.com/ by 185.234.144.17 on 02-Jun-2021
For personal use only.
Powered by TCPDF (www.tcpdf.org)
incubation, approximately 98% viability was observed
with Mast-Cs NC compared to mastoparan, which pre-
sented 42–56% viability. Statistically signicant differ-
ences (p<0.05) were observed for the two formulations
tested at 24 and 48 h. RD cells maintained their regular
morphology when treated with Mast-Cs NC, whereas mas-
toparan-treated cells lost their regular morphology after
24, 48 and 72 h of exposure (Figure 9AD).
Bactericidal Activity of Mast-Cs NC in
A. baumannii Sepsis Mouse Model
The mice in the control group, 1 h postinoculation, were
lethargic and showed decreased physical activity. The
mice showed normal physical activity in the group that
was treated with Mast-Cs NC. At 30 min, blood was
withdrawn from each group, serially diluted and cultured.
After 18–24 h of incubation at 37°C, the bacterial load in
the control group was 4.47 log
10
±29,000 CFU/mL, com-
pared to 3.53 log
10
±3400 CFU/mL in Mast-Cs NC, 4.33
log
10
±22,000 CFU/mL in the mastoparan test group and
4.2 log
10
±12,500 CFU/mL in the chitosan test group.
Statistically signicant differences were observed between
the groups. With a 95% condence interval, 4 degrees of
freedom and t
crit
at 14.48, a two-tailed p-value of <0.0001
was obtained between the Mast-Cs and chitosan groups,
which indicated a statistically signicant reduction in the
study groups. Similarly, with a 95% condence interval, 4
degrees of freedom and t
crit
at 17.93, the student t-test was
applied between mastoparan alone and Mast-Cs NC,
which revealed a two-tailed p-value of <0.0001.
A signicant reduction in colony count (p<0.05) was
seen in the in Mast-Cs NC-treated group compared to the
control chitosan and mastoparan-treated groups. Thus,
Mast-Cs NC led to signicant bactericidal activity in the
MDR A. baumannii septicemic mouse model (Figure 10).
Discussion
Treatment of drug-resistant A. baumannii infections is
a challenge for clinicians all over the world. Bacteria
acquire resistance against conventional antibiotics through
various mechanisms including decreased uptake of anti-
biotics, plasmid-mediated antibiotic resistance genes,
enzymic inactivation of antibiotics and activation of efux
pumps.
61
These rapidly emerging drug-resistant pathogens
impede the development process of novel antibiotics, as
these evolve rapidly to resist the effects of antibiotics.
Alternate approaches such as antimicrobial peptides and
chitosan-based nano-drug delivery systems offer promis-
ing directions.
62
These can be deployed in nanotherapeu-
tics to treat microbial infections. Nanotechnology has
undoubtedly opened new avenues, particularly with regard
to their function as vehicles for drug delivery. In the
Figure 7 Scanning electron microscopy of A. baumannii treated with Mast-Cs NC and chitosan (control). (A) Image taken in high vacuum mode, magnication 14,000×, at
a working distance of 12.3 mm, landing voltage 5.0 kV, FOV 9.143×6.857 µm, probe current 35.0, scan rotation 21.1°, with scale bar 1 µm. A. baumannii cells appeared as
coccobacilli with an average diameter of 1.301 µm. The untreated bacterial cells were taken as a control group. (B) Image taken in high vacuum mode, magnication 18,000×,
working distance 12.8 mm, landing voltage 5.0 kV, FOV 7.111×5.333 µm, probe current 35.0 A, scan rotation 21.1°, with scale bar 1 µm, showing A. baumannii cells after
treatment with Mast-Cs NC. The damage to the cells’ integrity and extracellular projections can be observed. (C) Image taken in high vacuum mode, magnication 13,000×,
working distance 12.7 mm, landing voltage 5.0 kV, FOV 9.846×7.385 µm, probe current 35.0 A, scan rotation 21.1°, with scale bar 1 µm, showing that bacterial cell surface
integrity was maintained after exposure to chitosan.
Abbreviations: FOV, eld of view; kV, kilovolts; Mast, mastoparan; Cs, chitosan; NC, nanoconstruct; A. baumannii, Acinetobacter baumannii.
International Journal of Nanomedicine 2021:16 https://doi.org/10.2147/IJN.S296717
DovePress
3767
Dovepress Hassan et al
Powered by TCPDF (www.tcpdf.org)
International Journal of Nanomedicine downloaded from https://www.dovepress.com/ by 185.234.144.17 on 02-Jun-2021
For personal use only.
Powered by TCPDF (www.tcpdf.org)
present work, mastoparan-loaded chitosan nanoconstructs
were developed which effectively targeted MDR
A. baumannii clinical isolates, both in vitro and in vivo.
Moreover, computational studies on Mast-Cs complex
helped us to understand their behavior at the molecular
level (Figure 11).
Mastoparan, an amphiphilic antimicrobial peptide, is
derived from wasp (Vespula lewissi) venom. Upon inter-
action with bacterial cell membrane, it binds along its long
axis to the phospholipid bilayer, thus interfering with
expansion of the outer structure of the bilayer. AMPs
confer a distinctive mode of interaction with the bacterial
cell wall, which evades specic protein binding sites or
receptor-mediated uptake mechanisms.
63
Vila-Farres et al
reported that mastoparan inhibits bacterial growth with an
MIC
90
of 8 μg/mL.
34
The MIC
50
of mastoparan against
A. baumannii isolates was observed to be 8–16 μg/mL.
64
In our study, Mast-Cs NC showed a lower MIC
90
value (2
μg/mL) compared to mastoparan alone (16 μg/mL). It is
worth mentioning that in our study a statistically signi-
cantly reduction (p<0.05) in MIC values was observed
with Mast-Cs NC compared to those of chitosan and
mastoparan alone. Entrapment of mastoparan in chitosan
nanovehicles enhanced its therapeutic efcacy. This con-
rms the success of this nanoformulation and its potential
application against rapidly prevailing antibiotic-resistant
strains.
Computational approaches were found to be helpful in
understanding the dynamics of the interaction between chit-
osan and mastoparan. Chitosan is computationally aligned
with mastoparan to achieve a spherical shape/structure. It is
assumed that mastoparan becomes encased in the polymer
matrix. Initially, during positioning, chitosan and TPP
demonstrated structural steric clashes between amine groups
and sodium groups, respectively. The repulsive forces due to
overlapping electronic clouds may result in steric effects.
Energy minimization was performed to overcome this hin-
drance and obtain a stable conformation. The resulting
Figure 8 Biocompatibility assay of Mast-Cs NC and mastoparan. (A) Percent hemolysis is presented on the y-axis and concentration (μg/mL) on the x-axis. Mast-Cs
NC percent hemolysis is shown in purple and mastoparan percent hemolysis is shown in blue. Mast-Cs NC at different concentrations (0.0625, 0.125, 0.25, 0.5,1, 2, 4, 8, 16,
32 μg/mL) showed 0% hemolysis. In contrast, mastoparan showed dose-dependent increasing hemolytic activity (0.0625, 0.125, 0.25, 0.5,1, 2, 4, 8, 16, 32 μg/mL). (B)
Microtiter plate wells with mastoparan-treated RBC, Mast-Cs NC-treated RBC and Triton X-100-treated RBC (as positive control). No visible hemolytic phenomenon was
observed with Mast-Cs NCs compared to the positive control of Triton X-100, which showed 100% hemolysis.
Abbreviations: Mast, mastoparan; Cs, chitosan; NC, nanoconstruct; A. baumannii, Acinetobacter baumannii; RBC, red blood cells.
https://doi.org/10.2147/IJN.S296717
DovePress
International Journal of Nanomedicine 2021:16
3768
Hassan et al Dovepress
Powered by TCPDF (www.tcpdf.org)
International Journal of Nanomedicine downloaded from https://www.dovepress.com/ by 185.234.144.17 on 02-Jun-2021
For personal use only.
Powered by TCPDF (www.tcpdf.org)
structure had reduced imprecision and formed a stable shape.
MD simulations predicted the stable behavior of two struc-
tures as early as 5 ns, and supported in vitro and in vivo
experimentation. Hydrophobic interactions were observed
between mastoparan (amino acids) and chitosan, which
were responsible for increases in EE and LC for mastoparan.
Protease stability plays a pivotal role in the success of
peptides.
63,65
Zha et al used nanobers to stabilize an antic-
ancer peptide, which otherwise could be degraded by hyalur-
onidase enzyme.
66
The lock-and-key interaction of enzymes
with substrates is crucial for their substantial activity.
52
In our
study, computational examination showed that the total
volume and surface area of the nanocomplex were geome-
trically incompatible with the protease binding pockets. This
led to the good clinical outcome of the nanocomplex in the
in vivo study.
During in vitro preparation, the size of the nanoconstruct
was optimized by chitosan, with optimal TPP, temperature,
pH of the solution and stirring rate. The polyphosphoric
groups of TPP interacted with the ammonium groups of
chitosan.
67
The nanosize (85−101 nm) provided a larger
Figure 10 Bactericidal activity of Mast-Cs NC in an A. baumannii sepsis mouse
model. The mean log
(10)
CFU/mL (blood) is presented on the y-axis, and control
(black), chitosan (blue), Mast-Cs NC (yellow) and mastoparan (light blue) groups
are presented on the x-axis. Bacterial load in the control group at 1 h 30 min after
inoculation was 4.47 log
10
CFU/mL. Bacterial load in the test group (Mast-Cs NC)
at 30 min postinfection was 3.53 log
10
CFU/mL, in the mastoparan test group at 30
min postinfection was 4.33 log
10
CFU/mL and in the chitosan test group at 30 min
postinfection was 4.2 log
10
CFU/mL. Signicant bactericidal activity was seen after
treatment with Mast-Cs NC in multidrug-resistant septicemia. A statistically sig-
nicant reduction in colony count (p<0.005) in the Mast-Cs NC-treated group was
observed compared to the control and mastoparan-treated groups.
Abbreviations: Mast, mastoparan; Cs, chitosan; NC, nanoconstruct; A. baumannii,
Acinetobacter baumannii; CFU, colony-forming units; p value, level of signicance/
probability value.
Figure 9 Cytocompatibility assay of Mast-Cs NC against human RD cell lines. (A) Percent viability is presented on the y-axis and concentration (μg/mL) on the x-axis.
Mastoparan results at 24, 48 and 72 h exposure are presented in light blue, purple and pink, respectively. Mast-CS NC results at 24, 48 and 72 h exposure are presented in
green, dark blue and dark purple. The graph shows the rhabdomyosarcoma cell lines exposed to Mast-Cs and mastoparan concentrations (ranging from 0.28 to 36 μg/mL)
for different durations (24, 48 and 72 h). At 24, 48 and 72 h of incubation with cell lines at ambient temperature, approximately 98% viability was observed with Mast-Cs NC,
compared to mastoparan, which showed 42–56% viability. (B) Real-time microscopy of untreated RD cell lines, which are used as control (untreated cells). (C) Real-time
microscopy of RD cells after treatment with Mast-Cs NC; the cells maintained their regular morphology, which is indicative of the viability of cells. (D) Real-time microscopy
of mastoparan-treated cells, which have lost their regular morphology, indicating the cytotoxic effect of mastoparan.
Abbreviations: Mast, mastoparan; Cs, chitosan; NC, nanoconstruct; A. baumannii, Acinetobacter baumannii; RD, rhabdomyosarcoma.
International Journal of Nanomedicine 2021:16 https://doi.org/10.2147/IJN.S296717
DovePress
3769
Dovepress Hassan et al
Powered by TCPDF (www.tcpdf.org)
International Journal of Nanomedicine downloaded from https://www.dovepress.com/ by 185.234.144.17 on 02-Jun-2021
For personal use only.
Powered by TCPDF (www.tcpdf.org)
surface area to volume ratio and increased the concentration
gradient for mastoparan. The high encapsulation efciency
(90.54%) achieved in the present work undoubtedly
demonstrates the success of the method. The appropriate
size of the nanoparticles (~93 nm) attained in our work is
a notable feature. It has been reported previously that a size
of 200 nm or more can lead to the immediate activation of the
lymphatic system and clearance from the body.
68
Charge
repulsion between chitosan and mastoparan is reduced by
keeping the pH of solution acidic during preparation. The
average particle size (93±8 nm) observed by SEM was less
than that seen by DLS, which is attributed to the hydrody-
namic diameter of nanoparticles compared to the microsco-
pically observed particle size. A positive zeta potential (54.9
mV) of the nanoformulation was observed, which resulted in
increased stability owing to the large electrostatic repulsion
between particles.
69
Chitosan has been reported to have bactericidal potential
as a result of electrostatic interactions.
70
Liu et al reported
that chitosan-treated E. coli showed altered outer membranes
in electron micrographs.
64
Costa et al reported MIC values of
0.5–1 mg/mL against A. baumannii, while another study
reported chitosan MIC ranging from 160 to 310 μg/mL.
71,72
In the present in vitro experiments, chitosan alone showed an
MIC
50
of 256 μg/mL, whereas the Mast-Cs complex showed
bacterial inhibition at concentrations as low as 2 μg/mL. The
synergistic effect of chitosan with mastoparan led to a greater
bactericidal effect, ie, an MIC
90
of 512 μg/mL, and scanning
electron micrographs conrmed the damage. Tamara et al
also proved the synergistic effect of a combination of prota-
mine (an AMP) and chitosan against pathogenic E. coli.
40
A sepsis model was created by intraperitoneal inocula-
tion of an extensively drug-resistant clinical strain of
A. baumannii in BALB/c mice. In previous work, low-
virulence A. baumannii strains were used to create sepsis
models, and in order to achieve sustained infection, immu-
nosuppressive agents were used.
73
In our study, we used
a highly virulent clinical MDR strain and studied the effect
of a novel nanoconstruct in immunocompetent mice. This
approach is also supported in other studies in which
researchers have developed successful models using clin-
ical isolates.
74,75
Considering the bacterial inocula, freshly
grown culture during the exponential phase were used.
This helped to avoid the presence of dead bacterial cells
Figure 11 Illustrative diagram depicting the workow of the present work: synthesis of Mast-Cs NC followed by in vitro characterization (DLS, SEM and FTIR), in silico
analysis (MDS and peptide–enzyme behavior), in vitro studies (biocompatibility and cytocompatibility, broth microdilution MIC) and in vivo therapeutic efcacy studies.
Abbreviations: Mast, mastoparan; Cs, chitosan; NC, nanoconstruct; A. baumannii, Acinetobacter baumannii; DLS, dynamic light scattering; SEM, scanning electron
microscopy; FTIR, Fourier transform infrared spectroscopy; MDS, molecular dynamic simulation; MIC, minimum inhibitory concentration.
https://doi.org/10.2147/IJN.S296717
DovePress
International Journal of Nanomedicine 2021:16
3770
Hassan et al Dovepress
Powered by TCPDF (www.tcpdf.org)
International Journal of Nanomedicine downloaded from https://www.dovepress.com/ by 185.234.144.17 on 02-Jun-2021
For personal use only.
Powered by TCPDF (www.tcpdf.org)
in the inoculation dose. A signicant reduction (p<0.05) in
bacterial count was seen with Mast-Cs NC compared with
mastoparan and chitosan alone. This indicated that once
mastoparan had been encapsulated in the chitosan nano-
carrier, it remained effective in the in vivo environment.
However, results obtained in mouse sepsis models may not
manifest all of the pathological mechanisms occurring in
the human body. Despite the intrinsic limitations of the
models, the present work provides fundamental under-
standing of antimicrobial-based nanosystems in an
in vivo environment. Further work is warranted to evaluate
the pharmacokinetic behavior of the suggested
nanosystems.
Conclusion
The clinical utility of antimicrobial peptides can be
enhanced with the use of nano-drug delivery systems.
The present study has proposed a therapeutic solution for
resistant microbial infections. Multiple in silico
approaches have been used in an innovative way to under-
stand and conrm the molecular interactions between mas-
toparan and chitosan prior to wet laboratory synthesis of
Mast-Cs NC. We have successfully evaluated our hypoth-
esis on the conjugation behavior of mastoparan with chit-
osan. In addition, the binding pocket score of “zero” of the
Mast-Cs nanocomplex reveals that this nano-drug delivery
system can evade the effects of proteases and peptidases.
Mast-Cs NC causes a synergistic bactericidal effect, dama-
ging the integrity of the bacterial cell surface more than
mastoparan and chitosan alone. The lower MIC against
A. baumannii signies the potential worth of this system as
an effective therapeutic tool. In an in vivo A. baumannii
sepsis model created against extensively drug -resistant
indigenous clinical isolates, this novel mastoparan chito-
san drug delivery system led to good clinical outcomes. In
this post-antibiotic era, when clinicians face challenges in
treating drug-resistant infections, such innovative antimi-
crobial peptide-based nanosystems will be a valuable addi-
tion to the elds of clinical microbiology and
nanomedicine.
Disclosure
All authors declare no conicts of interest.
References
1. Andersson DI, Hughes D. Antibiotic resistance and its cost: is it
possible to reverse resistance? Nat Rev Microbiol. 2010;8(4):260.
doi:10.1038/nrmicro2319
2. Dexter C, Murray GL, Paulsen IT, Peleg AY. Community-acquired
Acinetobacter baumannii: clinical characteristics, epidemiology and
pathogenesis. Expert Rev Anti Infect Ther. 2015;13(5):567–573.
doi:10.1586/14787210.2015.1025055
3. Wong D, Nielsen TB, Bonomo RA, Pantapalangkoor P, Luna B,
Spellberg B. Clinical and pathophysiological overview of
Acinetobacter infections: a century of challenges. Clin Microbiol
Rev. 2017;30(1):409–447.
4. Nowak J, Zander E, Stefanik D, et al. High incidence of
pandrug-resistant Acinetobacter baumannii isolates collected from
patients with ventilator-associated pneumonia in Greece, Italy and
Spain as part of the MagicBullet clinical trial. J Antimicrob
Chemother. 2017;72(12):3277–3282. doi:10.1093/jac/dkx322
5. Harding CM, Hennon SW, Feldman MF. Uncovering the mechanisms
of Acinetobacter baumannii virulence. Nat Rev Microbiol. 2018;16
(2):91. doi:10.1038/nrmicro.2017.148
6. Ahmed SS, Alp E, Hopman J, Voss A. Global epidemiology on
colistin resistant Acinetobacter baumannii. J Infect Dis Ther. 2016.
7. Cho YL, Yun JY, Chae SE, et al. Cephalosporin Derivatives and
Pharmaceutical Compositions Thereof. Google Patents; 2017.
8. Hu F-P, Guo Y, Zhu D-M, et al. Resistance trends among clinical
isolates in China reported from CHINET surveillance of bacterial
resistance, 2005–2014. Clin Microbiol Infect. 2016;22:S9–S14.
doi:10.1016/j.cmi.2016.01.001
9. Ventola CL. The antibiotic resistance crisis: part 1: causes and
threats. Pharm Ther. 2015;40(4):277.
10. Inchai J, Pothirat C, Bumroongkit C, Limsukon A,
Khositsakulchai W, Liwsrisakun C. Prognostic factors associated
with mortality of drug-resistant Acinetobacter baumannii
ventilator-associated pneumonia. J Intensive Care. 2015;3(1):9.
doi:10.1186/s40560-015-0077-4
11. Guo X, Cao B, Wang C, Lu S, Hu XJN. In vivo photothermal inhibition
of methicillin-resistant Staphylococcus aureus infection by in situ tem-
plated formulation of pathogen-targeting phototheranostics. Nanoscale.
2020;12(14):7651–7659. doi:10.1039/d0nr00181c
12. Wang C, Zhao W, Cao B, et al. Biolm-responsive polymeric nanoparti-
cles with self-adaptive deep penetration for in vivo photothermal treat-
ment of implant infection. Chem Mater. 2020;32(18):7725–7738.
13. Cao B, Lyu X, Wang C, Lu S, Xing D, Hu XJB. Rational collabora-
tive ablation of bacterial biolms ignited by physical cavitation and
concurrent deep antibiotic release. Biomaterials. 2020;262:120341.
doi:10.1016/j.biomaterials.2020.120341
14. Xiao F, Cao B, Wen L, et al. Photosensitizer conjugate-functionalized
poly (hexamethylene guanidine) for potentiated broad-spectrum bac-
terial inhibition and enhanced biocompatibility. Chin Chem Lett.
2020;31(9):2516–2519. doi:10.1111/jce.14669
15. Gao M, Long X, Du J, et al. Enhanced curcumin solubility and anti-
bacterial activity by encapsulation in PLGA oily core nanocapsules.
Food & Function. 2020;11(1):448–455. doi:10.1039/c9fo00901a
16. Mahlapuu M, Håkansson J, Ringstad L, Björn C. Antimicrobial
peptides: an emerging category of therapeutic agents. Front Cell
Infect Microbiol. 2016;6:194. doi:10.3389/fcimb.2016.00194
17. Sun E, Belanger CR, Haney EF, Hancock RE. Host defense (anti-
microbial) peptides. In: Peptide Applications in Biomedicine,
Biotechnology and Bioengineering. Elsevier; 2018:253–285.
18. Rossi LM, Rangasamy P, Zhang J, Qiu XQ, Wu GY. Research
advances in the development of peptide antibiotics. J Pharm Sci.
2008;97(3):1060–1070. doi:10.1002/jps.21053
19. Vlieghe P, Lisowski V, Martinez J, Khrestchatisky M. Synthetic
therapeutic peptides: science and market. Drug Discov Today.
2010;15(1–2):40–56. doi:10.1016/j.drudis.2009.10.009
20. Vila-Farres X, De La Maria CG, López-Rojas R, Pachón J, Giralt E,
Vila J. In vitro activity of several antimicrobial peptides against
colistin-susceptible and colistin-resistant Acinetobacter baumannii.
Clin Microbiol Infect. 2012;18(4):383–387. doi:10.1111/j.1469-
0691.2011.03581.x
International Journal of Nanomedicine 2021:16 https://doi.org/10.2147/IJN.S296717
DovePress
3771
Dovepress Hassan et al
Powered by TCPDF (www.tcpdf.org)
International Journal of Nanomedicine downloaded from https://www.dovepress.com/ by 185.234.144.17 on 02-Jun-2021
For personal use only.
Powered by TCPDF (www.tcpdf.org)
21. Spencer JJ, Pitts RE, Pearson RA, King LB. The effects of antimi-
crobial peptides WAM-1 and LL-37 on multidrug-resistant
Acinetobacter baumannii. Pathog Dis. 2018;76(2):fty007.
doi:10.1093/femspd/fty007
22. Das Neves RC, Mortari MR, Schwartz EF, Kipnis A, Junqueira-
Kipnis AP. Antimicrobial and antibiolm effects of peptides from
venom of social Wasp and scorpion on multidrug-resistant
Acinetobacter baumannii. Toxins. 2019;11(4):216. doi:10.3390/
toxins11040216
23. Peng J, Long H, Liu W, et al. Antibacterial mechanism of peptide
Cec4 against Acinetobacter baumannii. Infect Drug Resist.
2019;12:2417. doi:10.2147/IDR.S214057
24. Neshani A, Sedighian H, Mirhosseini SA, Ghazvini K, Zare H,
Jahangiri A. Antimicrobial peptides as a promising treatment option
against Acinetobacter baumannii infections. Microb Pathog.
2020;146:104238.
25. Peng SY, You RI, Lai MJ, Lin NT, Chen LK, Chang KC. Highly
potent antimicrobial modied peptides derived from the
Acinetobacter baumannii phage endolysin LysAB2. Sci Rep. 2017;7
(1):1–12. doi:10.1038/s41598-017-11832-7
26. Howl J, Howl L, Jones S. The cationic tetradecapeptide mastoparan
as a privileged structure for drug discovery: enhanced antimicrobial
properties of mitoparan analogues modied at position-14. Peptides.
2018;101:95–105. doi:10.1016/j.peptides.2018.01.007
27. Brogden KA. Antimicrobial peptides: pore formers or metabolic
inhibitors in bacteria? Nat Rev Microbiol. 2005;3(3):238–250.
doi:10.1038/nrmicro1098
28. Majumder A, Biswal MR, Prakash MK. Computational screening of
antimicrobial peptides for Acinetobacter baumannii. PLoS One.
2019;14(10):e0219693. doi:10.1371/journal.pone.0219693
29. Skariyachan S, Muddebihalkar AG, Badrinath V, et al. Natural
epiestriol-16 act as potential lead molecule against prospective mole-
cular targets of multidrug resistant Acinetobacter baumannii-Insight
from in silico modelling and in vitro investigations. Infect Genet
Evol. 2020;82:104314.
30. Ramachandran B, Jeyakanthan J, Lopes BS. Molecular docking,
dynamics and free energy analyses of Acinetobacter baumannii
OXA class enzymes with carbapenems investigating their hydrolytic
mechanisms. J Med Microbiol. 2020;69(8):1062–1078. doi:10.1099/
jmm.0.001233
31. Amera GM, Khan RJ, Pathak A, Jha RK, Muthukumaran J,
Singh AK. Computer aided ligand based screening for identication
of promising molecules against enzymes involved in peptidoglycan
biosynthetic pathway from Acinetobacter baumannii. Microb Pathog.
2020;147:104205.
32. Saito H, Sakakibara Y, Sakata A, et al. Antibacterial activity of
lysozyme-chitosan oligosaccharide conjugates (LYZOX) against
Pseudomonas aeruginosa, Acinetobacter baumannii and
Methicillin-resistant Staphylococcus aureus. PLoS One. 2019;14(5):
e0217504.
33. Meng H, Kumar KJ. Antimicrobial activity and protease stability of
peptides containing uorinated amino acids. J Am Chem Soc.
2007;129(50):15615–15622. doi:10.1021/ja075373f
34. Vila-Farrés X, López-Rojas R, Pachón-Ibánez ME, et al.
Sequence-activity relationship, and mechanism of action of masto-
paran analogues against extended-drug resistant Acinetobacter
baumannii. Eur J Med Chem. 2015;101:34–40. doi:10.1016/j.
ejmech.2015.06.016
35. Kobsa S, Saltzman WM. Bioengineering approaches to controlled
protein delivery. Pediatr Res. 2008;63(5):513. doi:10.1203/PDR.0b
013e318165f14d
36. Eslam ED, Astaneh SDA, Rasooli I, Nazarian S, Jahangiri A. Passive
immunization with chitosan-loaded biolm-associated protein against
Acinetobacter baumannii murine infection model. Gene Rep.
2020;20:100708.
37. Fan T, Yu X, Shen B, Sun LJ. Peptide self-assembled nanostructures
for drug delivery applications. J Nanomater. 2017;2017. doi:10.1155/
2017/1806461
38. Brandelli A. Nanostructures as promising tools for delivery of anti-
microbial peptides. Mini Rev Med Chem. 2012;12(8):731–741.
doi:10.2174/138955712801264774
39. Fu YY, Zhang L, Yang Y, et al. Synergistic antibacterial effect of
ultrasound microbubbles combined with chitosan-modied poly-
myxin B-loaded liposomes on biolm-producing Acinetobacter
baumannii. Int J Nanomed. 2019;14:1805. doi:10.2147/IJN.
S186571
40. Tamara F, Lin C, Mi FL, Ho YC. Antibacterial effects of chitosan/
cationic peptide nanoparticles. Nanomaterials. 2018;8(2):88.
doi:10.3390/nano8020088
41. Pourhajibagher M, Hosseini N, Boluki E, Chiniforush N,
Bahador AJ. Photoelimination potential of chitosan
nanoparticles-indocyanine green complex against the biological
activities of Acinetobacter baumannii strains: a preliminary in vitro
study in burn wound infections. J Lasers Med Sci. 2020;11(2):187.
42. International Council for Harmonisation. ICH guidelines. home-
page on internet; 2019. Available from: http://www.ich.org/pro
ducts/guidelines/safety/article/safety-guidelines.html. Accessed
April 2, 2021.
43. Clinical and Laboratory Standards Institute. Performance standards
for antimicrobial susceptibility testing; Twenty-second Informational
supplement. CLSI document M100-S22. Wayne, PA: Clinical and
Laboratory Standards Institute; 2015.
44. Magiorakos AP, Srinivasan A, Carey R, et al. Multidrug-resistant,
extensively drug-resistant and pandrug-resistant bacteria: an interna-
tional expert proposal for interim standard denitions for acquired
resistance. Clin Microbiol Infect. 2012;18(3):268–281. doi:10.1111/
j.1469-0691.2011.03570.x
45. Schrödinger Release 2016–2: Maestro. New York, NY: Schrödinger,
LLC; 2017.
46. Schrödinger Release 2016–3: MacroModel. New York, NY:
Schrödinger, LLC; 2016.
47. Pettersen EF, Goddard TD, Huang CC, et al. UCSF Chimera—a visua-
lization system for exploratory research and analysis. J Computat Chem.
2004;25(13):1605–1612. doi:10.1002/jcc.20084
48. Schrödinger Release 2017–3: Desmond molecular dynamics system.
New York, NY: DE Shaw Research; 2017.
49. Chemical Computing Group. Molecular operating environment
(MOE). Montreal: Chemical Computing Group Inc; 2016.
50. DeLano WL. The PyMOL Molecular Graphics System. San Carlos,
CA: Delano Scientic; 2002.
51. Razzaq A, Shamsi S, Ali A, et al. Microbial proteases applications.
Front Bioeng Biotechnol. 2019;7:110. doi:10.3389/fbioe.2019.00110
52. Stank A, Kokh DB, Fuller JC, Wade RC. Protein binding pocket
dynamics. Acc Chem Res. 2016;49(5):809–815. doi:10.1021/acs.
accounts.5b00516
53. Volkamer A, Kuhn D, Rippmann F, Rarey M. DoGSiteScorer: a web
server for automatic binding site prediction, analysis and druggability
assessment. Bioinformatics. 2012;28(15):2074–2075. doi:10.1093/
bioinformatics/bts310
54. Piras AM, Maisetta G, Sandreschi S, et al. Chitosan nanoparticles
loaded with the antimicrobial peptide temporin B exert a long-term
antibacterial activity in vitro against clinical isolates of
Staphylococcus epidermidis. Front Microbiol. 2015;6:372.
doi:10.3389/fmicb.2015.00372
55. Wiegand I, Hilpert K, Hancock RE. Agar and broth dilution methods
to determine the minimal inhibitory concentration (MIC) of antimi-
crobial substances. Nature Protocols. 2008;3(2):163. doi:10.1038/
nprot.2007.521
56. Coleman RG, Sharp KA. Protein pockets: inventory, shape, and
comparison. J Chem Informat Model. 2010;50(4):589–603.
doi:10.1021/ci900397t
https://doi.org/10.2147/IJN.S296717
DovePress
International Journal of Nanomedicine 2021:16
3772
Hassan et al Dovepress
Powered by TCPDF (www.tcpdf.org)
International Journal of Nanomedicine downloaded from https://www.dovepress.com/ by 185.234.144.17 on 02-Jun-2021
For personal use only.
Powered by TCPDF (www.tcpdf.org)
57. Uddin R, Ra S. Structural and functional characterization of
a unique hypothetical protein (WP_003901628. 1) of
Mycobacterium tuberculosis: a computational approach. Med Chem
Res. 2017;26(5):1029–1041.
58. Balouiri M, Sadiki M, Ibnsouda SK. Methods for in vitro evaluating
antimicrobial activity: a review. J Pharm Anal. 2016;6(2):71–79.
doi:10.1016/j.jpha.2015.11.005
59. Mei L, Xu Z, Shi Y, et al. Multivalent and synergistic chitosan
oligosaccharide-Ag nanocomposites for therapy of bacterial
infection. Sci Rep. 2020;10(1):1–9.
60. Mei L, Zhang X, Wang Y, et al. Multivalent polymer–Au nanocom-
posites with cationic surfaces displaying enhanced antimicrobial
activity. Polym Chem. 2014;5(8):3038–3044. doi:10.1038/
ncomms4038
61. Sultan I, Rahman S, Jan AT, Siddiqui MT, Mondal AH, Haq QMR.
Antibiotics, resistome and resistance mechanisms: a bacterial
perspective. Front Microbiol. 2018;9:2066. doi:10.3389/fmicb.20
18.02066
62. Cruz J, Ortiz C, Guzman F, Fernandez-Lafuente R, Torres R.
Antimicrobial peptides: promising compounds against pathogenic
microorganisms. Curr Med Chem. 2014;21(20):2299–2321.
doi:10.2174/0929867321666140217110155
63. Bechinger B, Gorr S-U. Antimicrobial peptides: mechanisms of
action and resistance. J Dent Res. 2017;96(3):254–260. doi:10.1177/
0022034516679973
64. Liu H, Du Y, Wang X, Sun L. Chitosan kills bacteria through cell
membrane damage. Int J Food Microbiol. 2004;95(2):147–155.
doi:10.1016/j.ijfoodmicro.2004.01.022
65. Biswaro LS, da Costa Sousa MG, Rezende T, Dias SC, Franco OL.
Antimicrobial peptides and nanotechnology, recent advances and
challenges. Front Microbiol. 2018;9:855. doi:10.3389/fmicb.20
18.00855
66. Zha RH, Sur S, Stupp SI. Self-assembly of cytotoxic peptide amphi-
philes into supramolecular membranes for cancer therapy. Adv
Healthcare Mater. 2013;2(1):126–133. doi:10.1002/adhm.201200118
67. Qi L, Xu Z, Jiang X, Hu C, Zou X. Preparation and antibacterial
activity of chitosan nanoparticles. Carbohydr Res. 2004;339
(16):2693–2700. doi:10.1016/j.carres.2004.09.007
68. Bachmann MF, Jennings GT. Vaccine delivery: a matter of size,
geometry, kinetics and molecular patterns. Nat Rev Immunol.
2010;10(11):787. doi:10.1038/nri2868
69. Honary S, Zahir F. Effect of zeta potential on the properties of
nano-drug delivery systems-a review (Part 2). Trop J Pharm Res.
2013;12(2):265–273.
70. Landriscina A, Rosen J, Friedman AJ. Biodegradable chitosan nano-
particles in drug delivery for infectious disease. Nanomedicine.
2015;10(10):1609–1619. doi:10.2217/nnm.15.7
71. Costa E, Silva S, Vicente S, Veiga M, Tavaria F, Pintado M. Chitosan
as an effective inhibitor of multidrug resistant Acinetobacter
baumannii. Carbohydr Polym. 2017;178:347–351. doi:10.1016/j.
carbpol.2017.09.055
72. Cobrado L, Azevedo M, Silva-Dias A, Ramos JP, Pina–Vaz C,
Rodrigues AJ. Cerium, chitosan and hamamelitannin as novel biolm
inhibitors? J Antimicrob Chemother. 2012;67(5):1159–1162.
doi:10.1093/jac/dks007
73. Harris G, KuoLee R, Xu HH, Chen W. Mouse models of
Acinetobacter baumannii infection. Curr Protoc Microbiol. 2017;46
(1):6G. 3.1–6G. 3.23. doi:10.1002/cpmc.36
74. Valentine SC, Contreras D, Tan S, Real LJ, Chu S, Xu HH.
Phenotypic and molecular characterization of Acinetobacter bauman-
nii clinical isolates from nosocomial outbreaks in Los Angeles
County, California. J Clin Microbiol. 2008;46(8):2499–2507.
doi:10.1128/JCM.00367-08
75. Jacobs AC, Thompson MG, Black CC, et al. AB5075, a highly
virulent isolate of Acinetobacter baumannii, as a model strain for
the evaluation of pathogenesis and antimicrobial treatments. MBio.
2014;5(3). doi:10.1128/mBio.01076-14
International Journal of Nanomedicine Dovepress
Publish your work in this journal
The International Journal of Nanomedicine is an international, peer-
reviewed journal focusing on the application of nanotechnology in
diagnostics, therapeutics, and drug delivery systems throughout the
biomedical eld. This journal is indexed on PubMed Central,
MedLine, CAS, SciSearch
®
, Current Contents
®
/Clinical Medicine,
Journal Citation Reports/Science Edition, EMBase, Scopus and the
Elsevier Bibliographic databases. The manuscript management system
is completely online and includes a very quick and fair peer-review
system, which is all easy to use. Visit http://www.dovepress.com/
testimonials.php to read real quotes from published authors.
Submit your manuscript here: https://www.dovepress.com/international-journal-of-nanomedicine-journal
International Journal of Nanomedicine 2021:16 DovePress
3773
Dovepress Hassan et al
Powered by TCPDF (www.tcpdf.org)
International Journal of Nanomedicine downloaded from https://www.dovepress.com/ by 185.234.144.17 on 02-Jun-2021
For personal use only.
Powered by TCPDF (www.tcpdf.org)
... Mast-Cs NC displayed a synergistic bactericidal effect through damaging the bacterial cell membrane. Mast-Cs NC also induced a significant reduction in the bacterial count in a mouse sepsis model compared with chitosan and mastoparan alone (Hassan et al., 2021). ...
... Nanotechnology-based systems also represent a promising alternative to prevent the proteolytic degradation of drugs, as well as to potentiate the desired effects. The nanoformulation containing mastoparan and chitosan is effective in killing clinical isolates of multidrug-resistant Acinetobacter baumannii and has no hemolytic activity (Hassan et al., 2021). ...
Article
Full-text available
Biologically active peptides have been attracting increasing attention, whether to improve the understanding of their mechanisms of action or in the search for new therapeutic drugs. Wasp venoms have been explored as a remarkable source for these molecules. In this review, the main findings on the group of wasp linear cationic α-helical peptides called mastoparans were discussed. These compounds have a wide variety of biological effects, including mast cell degranulation, activation of protein G, phospholipase A2, C, and D activation, serotonin and insulin release, and antimicrobial, hemolytic, and anticancer activities, which could lead to the development of new therapeutic agents.
... MAS is a peptide found in wasp venom and has potent bioactivity [7]. As a peptide, MAS is composed of 14 amino acids ( Figure 1) such as Ile-Asn-Leu-Lys-Ala-Leu-Ala-Ala-Leu-Ala-Lys-Lys-Ile-Leu-NH2 [8]. Thus, MAS is basically amphipathic in nature, but it contains 71% of hydrophobic residues. ...
Article
Full-text available
Lung cancer has a very low survival rate, and non-small cell lung cancer comprises around 85% of all types of lung cancers. Fluvastatin (FLV) has demonstrated the apoptosis and suppression of tumor-cell proliferation against lung cancer cells in vitro. Drug–peptide nanoconjugates were found to enhance the cytotoxicity of anti-cancer drugs. Thus, the present study aimed to develop a nanocomplex of FLV with mastoparan (MAS), which is a peptide that has membranolytic anti-tumor activity. The nanocomplex of FLV and MAS (MAS-FLV-NC) was prepared and optimized for particle size using Box–Behnken design. The amount of FLV had the highest influence on particle size. While higher levels of FLV and incubation time favored higher particle size, a higher level of sonication time reduced the particle size of MAS-FLV-NC. The optimum formula of MAS-FLV-NC used 1.00 mg of FLV and was prepared with an incubation time of 12.1339 min and a sonication time of 6 min. The resultant particle size was 77.648 nm. The in vitro cell line studies of MAS-FLV-NC, FLV, and MAS were carried out in A549 cells. The IC50 values of MAS-FLV-NC, FLV, and MAS were 18.6 ± 0.9, 58.4 ± 2.8, and 34.3 ± 1.6 µg/mL respectively, showing the enhanced cytotoxicity of MAS-FLV-NC. The apoptotic activity showed that MAS-FLV-NC produced a higher percentage of cells in the late phase, showing a higher apoptotic activity than FLV and MAS. Furthermore, cell cycle arrest in S and Pre G1 phases by MAS-FLV-NC was observed in the cell cycle analysis by flow cytometry. The loss of mitochondrial membrane potential after MAS-FLV-NC treatment was significantly higher than those observed for FLV and MAS. The IL-1β, IL-6, and NF-kB expressions were inhibited, whereas TNF-α, caspase-3, and ROS expressions were enhanced by MAS-FLV-NC treatment. Furthermore, the expression levels of Bax, Bcl-2, and p53 strongly established the enhanced cytotoxic effect of MAS-FLV-NC. The results indicated that MAS-FLV-NC has better cytotoxicity than individual effects of MAS and FLV in A549 cells. Further pre-clinical and clinical studies are needed for developing MAS-FLV-NC to a clinically successful therapeutic approach against lung cancer.
Article
Full-text available
Sepsis is a major immune response disorder caused by infection, with very high incidence and mortality rates. In the clinic, sepsis and its complications are mainly controlled and treated with antibiotics, anti-inflammatory, and antioxidant drugs. However, these treatments have some shortcomings, such as rapid metabolism and severe side effects. The emergence of drug delivery nanosystems can significantly improve tissue permeability, prolong drugs' circulation time, and reduce side effects. In this paper, we reviewed recent drug delivery nanosystems designed for sepsis treatment based on their mechanisms (anti-bacterial, anti-inflammatory, and antioxidant). Although great progress has been made recently, clinical practice transformation is still very difficult. Therefore, we also discussed key obstacles, including tissue distribution, overcoming bacterial resistance, and single treatment modes. Finally, a rigorous optimization of drug delivery nanosystems is expected to present great potential for sepsis therapy.
Article
Full-text available
Acinetobacter baumannii is an opportunistic pathogen which is undoubtedly known for a high rate of morbidity and mortality in hospital-acquired infections. A. baumannii causes life-threatening infections, including; ventilator-associated pneumonia (VAP), meningitis, bacteremia, and wound and urinary tract infections (UTI). In 2017, the World Health Organization listed A. baumannii as a priority-1 pathogen. The prevalence of A. baumannii infections and outbreaks emphasizes the direct need for the use of effective therapeutic agents for treating such infections. Available antimicrobials, such as; carbapenems, tigecycline, and colistins have insufficient effectiveness due to the appearance of multidrug-resistant strains, accentuating the need for alternative and novel therapeutic remedies. To understand and overcome this menace, the knowledge of recent discoveries on the virulence factors of A. baumannii is needed. Herein, we summarized the role of various virulence factors, including; outer membrane proteins, efflux pumps, biofilm, penicillin-binding proteins, and siderophores/iron acquisition systems. We reviewed the recent scientific literature on different A. baumannii virulence factors and the effective antimicrobial agents for the treatment and management of bacterial infections.
Article
Full-text available
A 45‐year old female presented with recurrent symptomatic palpitations responsive to adenosine. An electrophysiology study was performed with decapolar catheter in the coronary sinus (CS) and quadripolar catheters in the His and right ventricular (RV) apex. This article is protected by copyright. All rights reserved.
Article
Full-text available
Chitosan oligosaccharide functionalized silver nanoparticles with synergistic bacterial activity were constructed as a multivalent inhibitor of bacteria. Placing the chitosan oligosaccharide on silver nanoparticles can dramatically enhance the adsorption to the bacterial membrane via multivalent binding. The multicomponent nanostructures can cooperate synergistically against gram-positive and gram-negative bacteria. The antibacterial activity was increased via orthogonal array design to optimize the synthesis condition. The synergistic bacterial activity was confirmed by fractional inhibitory concentration and zone of inhibition test. Through studies of antimicrobial action mechanism, it was found that the nanocomposites interacted with the bacteria by binding to Mg²⁺ ions of the bacterial surface. Then, the nanocomposites disrupted bacterial membrane by increasing the permeability of the outer membrane, resulting in leakage of cytoplasm. This strategy of chitosan oligosaccharide modification can increase the antibacterial activity of silver nanoparticles and accelerate wound healing at the same time. The nanomaterial without cytotoxicity has promising applications in bacteria-infected wound healing therapy.
Article
Full-text available
Introduction : Acinetobacter baumannii strains are important agents causing serious nosocomial infections including soft-tissue and skin infections in patients with burn wounds which have become resistant to several classes of antibiotics. Antimicrobial photodynamic therapy (aPDT) as an alternative antimicrobial procedure is suggested for the treatment of these kinds of infections. The aim of the current study is to evaluate the antibacterial and anti-biofilm efficiency of aPDT by the utilization of an improved form of indocyanine green (ICG) which is encapsulated in chitosan nanoparticles (NCs@ICG). Methods : NCs@ICG were synthesized and confirmed by the scanning electron microscope (SEM). aPDT was performed using NCs@ICG with an 810 nm wavelength of the diode laser at the fluency of 31.2 J/cm ² on 50 A. baumannii strains isolated from burn wounds. The antibacterial and antibiofilm potential of NCs@ICG-aPDT was determined via the colony forming unit (CFU)/mL and crystal violet assays, respectively. In addition, microbial biofilm degradation was evaluated by the SEM. Results : According to the results, NCs@ICG-aPDT showed a significant reduction of 93.2% on the CFU/ mL of planktonic A. baumannii strains compared to the control group (untreated group; P < 0.05). In addition, the biofilm formation of A. baumannii strains was significantly reduced by 55.3% when the bacteria were exposed to NCs@ICG-aPDT (P < 0.05). In contrast, NCs@ICG, ICG, and the diode laser alone were not able to inhibit the CFU/mL and biofilm of A. baumannii strains ( P > 0.05). Based on the results of SEM images, NCs@ICG-aPDT disrupted the biofilm structure of A. baumannii strains more than other groups. Conclusion : NCs@ICG-aPDT demonstrates a promising treatment candidate for exploitation in wound infections against both planktonic and biofilm forms of A. baumannii strains
Article
Bacteria biofilm has extracellular polymeric substances to protect bacteria from external threats, which is a stubborn problem for human health. Herein, a kind of gasifiable nanodroplet is fabricated to ablate Staphylococcus aureus (S. aureus) biofilm. Upon NIR pulsed laser irradiation, the nanodroplets can gasify to generate destructive gas shockwave, which further potentiates initial acoustic cavitation effect, thus synergistically disrupting the protective biofilm and killing resident bacteria. More importantly, the gasification can further promote antibiotic release in deep biofilm for residual bacteria eradication. The nanodroplets not only exhibit deep biofilm penetration capacity and high potency to ablate biofilms, but also good biocompatibility without detectable side effects. In vivo mouse implant model indicates that the nanodroplets can accumulate at the S. aureus infected implant sites. Upon pulsed laser treatment, the nanodroplets efficiently eradicate bacteria biofilm in implanted catheter by synergistic contribution of gas shockwave-enhanced cavitation and deep antibiotic release. Current phase changeable nanodroplets with synergistic physical and chemical therapeutic modalities are promising to combat complex bacterial biofilms with drug resistance, which provides an alternative visual angle for biofilm inhibition in biomedicine.
Article
Biofilm can protect bacteria from immune attacks and antibiotic inhibition, and bacterial biofilm hosted in implanted materials and medical devices is a serious threat for modern medical system. Herein, we report biofilm-responsive caged guanidine nanoparticles (CGNs) to deeply penetrate and accumulate in bacterial biofilm, then efficient photothermal eradication of bacterial biofilm is achieved upon NIR laser irradiation via the proof-of-concept formulation of photothermal agents in CGNs. In physiological condition and blood circulation, CGNs are negatively charged by masking the positive charge of guanidine via covalent modification with acid-cleavable moities, exhibiting high biocompatibility and minimal hemolysis. Whereas upon blood circulation and passive accumulation at infected implant sites, CGNs are self-adaptive in acidic biofilm to release the protective caging group and expose native guanidine moieties, which can promote nanoparticles deep biofilm penetration and bacteria adhesion as well as membrane fusion. After that, remarkable photothermal effect with a high photothermal conversion efficiency of ∼40.9% can eradicate implant biofilm upon NIR laser irradiation. It can efficiently treat S. aureus biofilm infected implant catheters in vivo via only one single treatment in mouse model, exhibiting ~99.6% bacteria inhibition ratio. Apart from this proof-of-concept work, current guanidine-caged biofilm responsive polymeric nanoparticles are promising general vectors to treat biofilm and resistant pathogens in medicine and daily healthcare.
Article
Introduction. Acinetobacter baumannii is a critical priority pathogen listed by the World Health Organization due to increasing levels of resistance to carbapenem classes of antibiotics. It causes wound and other nosocomial infections, which can be life-threatening. Hence, there is an urgent need for the development of new classes of antibiotics. Aim. To study the interaction of carabapenems with class D beta-lactamases (oxacillinases) and analyse drug resistance by studying enzyme–substrate complexes using modelling approaches as a means of establishing correlations with the phenotypic data. Methodology. The three-dimensional structures of carbapenems (doripenem, ertapenem, imipenem and meropenem) were obtained from DrugBank and screened against class D beta-lactamases. Further, the study was extended with their variants. The variants’ structure was homology-modelled using the Schrödinger Prime module (Schrödinger LLC, NY, USA). Results. The first discovered intrinsic beta-lactamase of Acinetobacter baumannii , OXA-51, had a binding energy value of −40.984 kcal mol ⁻¹ , whereas other OXA-51 variants, such as OXA-64, OXA-110 and OXA-111, have values of −60.638, –66.756 and −67.751 kcal mol ⁻¹ , respectively. The free energy values of OXA-51 variants produced better results than those of other groups. Conclusions. Imipenem and meropenem showed MIC values of 2 and 8 µg ml ⁻¹ , respectively against OXA-51 in earlier studies, indicating that these are the most effective drugs for treatment of A. baumannii infection. According to our results, OXA-51 is an active enzyme that shows better interactions and is capable of hydrolyzing carbapenems. When correlating the hydrogen-bonding interaction with MIC values, the predicted results are in good agreement and might provide initial insights into performing similar studies related to OXA variants or other antibiotic–enzyme-based studies.
Article
Background With the increasing rate of antibiotic resistance in Acinetobacter, the World Health Organization introduced the carbapenem-resistant isolates in the priority pathogens list for which innovative new treatments are urgently needed. Antimicrobial peptides (AMPs) are one of the antimicrobial agents with high potential to produce new anti-Acinetobacter drugs. This review aims to summarize recent advances and compare AMPs with anti-Acinetobacter baumannii activity. Methods Active AMPs against Acinetobacter were considered, and essential features, including structure, mechanism of action, anti-A. baumannii potent, and other prominent characteristics, were investigated and compared to each other. In this regard, the Google Scholar search engine and databases of PubMed, Scopus, and Web of Science were used. Results Forty-six anti-Acinetobacter peptides were identified and classified into ten groups: Cathelicidins, Defensins, Frog AMPs, Melittin, Cecropins, Mastoparan, Histatins, Dermcidins, Tachyplesins, and computationally designed AMPs. According to the Minimum Inhibitory Concentration (MIC) reports, six peptides of Melittin, Histatin-8, Omega76, AM-CATH36, Hymenochirin, and Mastoparan have the highest anti-A. baumannii power against sensitive and antibiotic-resistant isolates. All anti-Acinetobacter peptides except Dermcidin have a net positive charge. Most of these peptides have alpha-helical structure; however, β-sheet and other structures have been observed among them. The mechanism of action of these antimicrobial agents is divided into two categories of membrane-based and intracellular target-based attack. Conclusion Evidence from this review indicates that AMPs would be likely among the main anti-A. baumannii drugs in the post-antibiotic era. Also, the application of computer science to increase anti-A. baumannii activity and reduce toxicity could be helpful.
Article
A. baumannii has been considered as Priority-I as suggested by the World Health Organization (WHO) and the most critical pathogenic microorganism for causing nosocomial infection in imunno-compromised hospital-acquired patients due to multi-drug resistance (MDR). In the current study, we utilized “Computer-aided ligand-based virtual screening approach” for identification of promising molecules against Mur family proteins based on the known inhibitor (Naphthyl Tetronic Acids ((5Z)-3-(4-chlorophenyl)-4-hydroxy-5-(1-naphthylmethylene) furan-2(5H)-one)) of MurB from E. coli. The in-house library was prepared using a similarity search of a known inhibitor (Drug Bank ID: DB07296) against several relevant chemical databases. The molecules obtained from virtual screening of Naphthyl Tetronic Acids in-house library were successively subjected to physicochemical and ADMET screening. After this, the molecules which passed all the filters, subsequently subjected into interaction analysis with the drug target proteins (MurB, MurD, MurE and MurG) of A. baumanni and the results explained that four molecules were promising (CHEMBL468144, DB07296, Enamine_T5956969 and 54723243) for further molecular dynamics simulations. The free and ligand bounded proteins that undergone MD simulation are listed as follows: MurB, MurB-CHEMBL468144, MurB-DB07296, MurE, MurE-54723243, MurE-DB07296, MurD, MurD-Enamine_T5956969, MurD-DB07296, MurG, MurG-CHEMBL468144, and MurG-DB07296. Based on global and essential dynamics analysis, the stability order of molecules towards MurB (CHEMBL468144 > DB07296); MurD (Enamine_T5956969 > DB07296); MurE (54723243 > DB07296) and MurG (CHEMBL468144 > DB07296) indicates that the newly identified molecules are more promising one in comparison with the existing inhibitor. Based on all the docking and MD simulation results, the stability order of the free and ligand bounded protein are as follows; MurB and MurB-ligand complexes > MurD and MurD-ligand complexes > MurG and MurG-ligand complexes > MurE and MurE-ligand complexes. Finally, the selected compounds would be recommended for further experimental investigations and used as promising inhibitors of the infection caused by A. baumannii.
Article
The current study aimed to identify putative drug targets of multidrug resistant Acinetobacter baumannii (MDRAb) and study the therapeutic potential of natural epiestriol-16 by computer aided virtual screening and in vitro studies. The clinical isolates (n = 5) showed extreme dug resistance to carbapenems and colistins (p ≤ .05). Computational screening suggested that out of 236 natural molecules selected, 06 leads were qualified for drug likeliness, pharmacokinetic features and one potential molecule namely natural epiestriol-16 (16b-Hydroxy-17a-estradiol) exhibited significant binding potential towards four prioritised drug targets in comparison with the binding of faropenem to their usual target. Natural epiestriol demonstrated profound binding to the outer membrane protein (Omp38), protein RecA (RecA), orotate phosphoribosyltransferase (PyrE) and orotidine 5′-phosphate decarboxylase (PyrF) with binding energy of −6.0, −7.3, −7.3 and −8.0 kcal/mol respectively. MD simulations suggested that 16-epiestriol-receptor complexes demonstrated stability throughout the simulation. The growth curve and time kill assays revealed that MDRAb showed resistance to faropenem and polymyxin-B and the pure epiestriol-16 showed significant inhibitory properties at a concentration of 200 μg/mL (p ≤ .5). Thus, natural epiestriol-16 can be used as potential inhibitor against the prioritised targets of MDRAb and this study provide insight for drug development against carbapenem and colistin resistant A. baumannii.